Mice Expressing a Mutant Krt75 (K6hf) Allele Develop Hair and Nail

Total Page:16

File Type:pdf, Size:1020Kb

Load more

ORIGINAL ARTICLE Mice Expressing a Mutant Krt75 (K6hf ) Allele Develop Hair and Nail Defects Resembling Pachyonychia Congenita Jiang Chen1, Karin Jaeger2,3, Zhining Den4, Peter J. Koch1,4,5, John P. Sundberg2 and Dennis R. Roop1,4,5 KRT75 (formerly known as K6hf) is one of the isoforms of the keratin 6 (KRT6) family located within the type II cytokeratin gene cluster on chromosome 12 of humans and chromosome 15 of mice. KRT75 is expressed in the companion layer and upper germinative matrix region of the hair follicle, the medulla of the hair shaft, and in epithelia of the nail bed. Dominant mutations in members of the KRT6 family, such as in KRT6A and KRT6B cause pachyonychia congenita (PC) -1 and -2, respectively. To determine the function of KRT75 in skin appendages, we introduced a dominant mutation into a highly conserved residue in the helix initiation peptide of Krt75. Mice expressing this mutant form of Krt75 developed hair and nail defects resembling PC. This mouse model provides in vivo evidence for the critical roles played by Krt75 in maintaining hair shaft and nail integrity. Furthermore, the phenotypes observed in our mutant Krt75 mice suggest that KRT75 may be a candidate gene for screening PC patients who do not exhibit obvious mutations in KRT6A, KRT6B, KRT16,orKRT17, especially those with extensive hair involvement. Journal of Investigative Dermatology (2008) 128, 270–279; doi:10.1038/sj.jid.5701038; published online 13 September 2007 INTRODUCTION the skin, hair follicles, and nails. However, each member of The keratin 6 (KRT6) cluster consists of several genes that the KRT6 gene family shows a cell- and tissue-type-specific encode intermediate filament (IF) proteins belonging to the expression pattern. KRT6A and KRT6B are constitutively type II keratin family. In humans, functional KRT6 genes expressed in the outer root sheath of anagen-stage hair include KRT6A, KRT6B, KRT6C (formerly known as KRT6E/ follicles, epithelia of the nail bed, and stratified epithelia H), KRT75 (formerly known as K6hf) and KRT71-KRT74 lining the oral cavity and the esophagus (Moll et al., 1982; (formerly known as K6irs1-K6irs4), whereas in the mouse Ouhayoun et al., 1985; Stark et al., 1987; O’Guin et al., Krt6a, Krt6b, and Krt71-Krt75 make up this family of 1990; Langbein and Schweizer, 2005). KRT75 is expressed genes (These designations are used according to the in the companion layer, upper germinative matrix region of new nomenclature for mammalian keratins (Schweizer the hair follicle, and medulla of the hair shaft (Winter et al., et al., 2006).). These genes share striking sequence simi- 1998; Wojcik et al., 2001; Wang et al., 2003). In addition, larities and are widely expressed in epithelial tissues, especially the mouse keratin 75 protein (K75) is also synthesized in the nail bed epithelia of mice (Wojcik et al., 2001). 1Department of Molecular and Cellular Biology, Baylor College of Medicine, In addition to constitutive expression, several KRT6 Houston, Texas, USA; 2The Jackson Laboratory, Bar Harbor, Maine, USA; isoforms are specifically induced in response to hyperproli- 3Department of Dermatology, Medical University of Vienna, Vienna, Austria ferative stimuli, such as wounding. For example, KRT6A is 4 and Department of Dermatology, Baylor College of Medicine, Houston, induced in all layers of the epidermis under hyperprolifera- Texas, USA tive conditions, whereas the induction of KRT6B is restricted 5Current address: Department of Dermatology and Regenerative Medicine and Stem Cell Biology Program, University of Colorado at Denver and Health to the more differentiated layers of the epidermis (Wojcik Sciences Center, Aurora, Coloardo 80045, USA et al., 2000). The in vivo functions of Krt6 genes have been Correspondence: Dr Dennis R. Roop, Department of Dermatology and evaluated in genetically engineered mouse models for Krt6a Regenerative Medicine and Stem Cell Biology Program, University of (Krt6atm1Der) and Krt6a/Krt6b (Krt6a/Krt6btm1Cou, Krt6a/ Colorado at Denver Health Sciences Center, PO Box 6511, Mail Stop 8320, Krt6btm1Der) (Wojcik et al., 2000, 2001; Wong et al., 2000). Aurora, Colorado 80045, USA. E-mail: [email protected] Interestingly, the absence of Krt6a or Krt6a/K6b did not Abbreviations: BAC, bacterial artificial chromosome; ES, embryonic stem IF, intermediate filament; K75, human and mouse keratin 75 (formerly known prevent normal development and function of epithelial as K6hf) protein; KRT6, keratin 6; KRT75, human keratin 75 (formerly known tissues and ectodermal appendages. However, loss of these as human K6hf) gene; Krt75, mouse keratin 75 (formerly known as mouse tm1Der proteins altered the response of these tissues to injury and K6hf) gene; Krt75 , mouse keratin 75-targeted mutation; PC, mechanical stress. For instance, delayed re-epithelialization pachyonychia congenita; PC-1, Type I PC; SEM, scanning electron tm1Der microscopy; SM-CSM, selection counter selection marker of the skin was observed in Krt6a mice following Received 7 May 2007; accepted 24 June 2007; published online wounding (Wojcik et al., 2000), and hyperplastic changes 13 September 2007 secondary to mechanical stress associated with food intake 270 Journal of Investigative Dermatology (2008), Volume 128 & 2007 The Society for Investigative Dermatology J Chen et al. Mouse Model for a Dominant Krt75 Mutation were reported in the oral cavities of Krt6a/Krt6btm1Cou and To explore the role of mouse Krt75 in hair and nail Krt6a/Krt6btm1Der mice (Wong et al., 2000; Wojcik et al., formation and generate a mouse model that more closely 2001). In contrast to Krt6a and Krt6b, Krt75 expression is not mimicked human PC, we genetically engineered a dominant induced in the epidermis in response to mechanical stress or mutation into the mouse Krt75 locus. We present, the first wounding (Wojcik et al., 2001). reported ‘‘knock-in’’ model for a dominant type II keratin Mutations in KRT6A and KRT6B result in pachyonychia mutation. We report that deletion of the highly conserved congenita (PC) (OMIM #167200 and #167210). PC is a rare, asparagine residue (N159) in the initiation motif of the helical autosomal dominant form of ectodermal dysplasia, charac- rod domain of Krt75 caused collapse of the keratin IFs terized by distally progressive hypertrophic onychodystrophy in vitro, and produced hair and nail abnormalities in vivo. and focal hyperkeratosis of palms and soles (Leachman et al., 2005). Germline mutations in KRT6A and KRT16 are RESULTS associated with Type I PC (PC-1), whereas mutations in Generation of a Krt75 dominant mutation that interferes with KRT6B and KRT17 are associated with Type II PC (PC-2) normal IF assembly in cultured cells (Smith et al., 2005). KRT16 and KRT17 encode type I keratins Dominant-negative mutations have been identified in the (K16 and K17) that form keratin IF together with K6A and KRT6A gene of PC-1 patients. The most frequent mutation is a K6B, respectively. Codon 171 (AAC) and 172 (AAC) of deletion of codon 172, encoding asparagine (N). It is thought KRT6A both encode asparagines (N). Previous reports that this mutation leads to the synthesis of a defective K6a referred to deletion of one of these codons as either protein that interferes with the assembly of a functional N171del or N172del. The Human Genome Variation Society keratin IF cytoskeleton. A comparison of the NH2-terminal (www.hgvs.org) has recently recommended that when a rod domains of human K6A and mouse K75 reveals a high codon is deleted from a series of identical codons, the degree of amino-acid sequence homology (Figure 1a). N172 deletion should be designated as the last codon in the series. of human K6A corresponds to N159 of mouse K75. There- Therefore, in accordance with this recommendation, we have fore, we hypothesized that a deletion of N159 (N159del) now designated N171del as N172del. We previously suggested that N172del was a mutational ‘‘hotspot’’ KRT6A GAGCGTGAACAGATCAAGACCCTCAACAACAAGTTTGCCTCCTTCATC (Lin et al., 1999) and a recent review as confirmed that K6A -E--R--E--Q--I--K--T--L--N--N--K--F--A--S--F--I-- N172del is the most common mutation in PC-1 (Lane and (172) McLean, 2004). This residue is located at the beginning of the KRT75 GAACGGGAGCAGATCAAGACTCTGAACAACAAGTTCGCCTCCTTCATT K75 -E--R--E--Q--I--K--T--L--N--N–--K--F--A--S--F--I-- initiation motif of the highly conserved helical rod domain (159) (also called the helix initiation peptide) of keratins. The short initiation motif is believed to be critical in mediating keratin assembly and maintaining IF stability. Analogous mutations in this evolutionarily conserved amino-acid residue have been reported in white sponge nevus (OMIM #193900), caused by deletion of the corresponding asparagine in KRT4 (Rugg et al., 1995), ichthyosis bullosa of Siemens caused by mutations in KRT2 (Whittock et al., 2001), and epidermolytic palmoplantar keratoderma caused by mutations in KRT9 (Reis et al., 1994). Many studies have noted that there is considerable variation in clinical severity of diseases caused by these mutations. Consequently, other genetic and/or environmental modifiers have been suggested to contribute significantly to disease severity. Mouse models with targeted deletions of Krt6a, Krt6b, and Krt17 have been developed (Wojcik et al., 2000, 2001; Wong et al., 2000; McGowan et al., 2002). However, these models did not fully recapitulate the clinical features of PC as seen in Figure 1. Alignment of nucleotide and peptide sequences of human KRT6A humans, in particular the nail changes, which occur in almost and mouse Krt75, and immunofluorescence labeling of PtK2 cells transfected with wild-type and mutant Krt75 expression vectors. (a) The 16 amino acids all PC patients (Leachman et al., 2005). One explanation for at the beginning of the initiation motif of the human K6A (NM005554) and this discrepancy is that PC cases are caused by dominant mouse K75 (XM128143) are identical. The amino acid corresponding to N172 mutations, which result in the accumulation of mutated of human KRT6A is underlined for mouse Krt75.
Recommended publications
  • And Β-Keratins on Developing Chicken Skin Integuments: Functional Interaction and Evolutionary Perspectives

    And Β-Keratins on Developing Chicken Skin Integuments: Functional Interaction and Evolutionary Perspectives

    Topographical mapping of α- and β-keratins on developing chicken skin integuments: Functional interaction and evolutionary perspectives Ping Wua,1, Chen Siang Ngb,1, Jie Yana,c, Yung-Chih Laia,d,e, Chih-Kuan Chenb,f, Yu-Ting Laib, Siao-Man Wub, Jiun-Jie Chenb, Weiqi Luoa, Randall B. Widelitza, Wen-Hsiung Lib,g,2, and Cheng-Ming Chuonga,d,e,h,2 aDepartment of Pathology, Keck School of Medicine, University of Southern California, Los Angeles, CA 90033; bBiodiversity Research Center, Academia Sinica, Taipei 11529, Taiwan; cJiangsu Key Laboratory for Biodiversity and Biotechnology, College of Life Sciences, Nanjing Normal University, Nanjing 210023, China; dResearch Center for Developmental Biology and Regenerative Medicine, National Taiwan University, Taipei 10041, Taiwan; eIntegrative Stem Cell Center, China Medical University, Taichung 40447, Taiwan; fInstitute of Ecology and Evolutionary Biology, National Taiwan University, Taipei 10617, Taiwan; gDepartment of Ecology and Evolution, University of Chicago, Chicago, IL 60637; and hCenter for the Integrative and Evolutionary Galliform Genomics, National Chung Hsing University, Taichung 40227, Taiwan Contributed by Wen-Hsiung Li, October 19, 2015 (sent for review July 19, 2015; reviewed by Scott V. Edwards and Roger H. Sawyer) Avian integumentary organs include feathers, scales, claws, and innovations of feather development genes predate the origin of beaks. They cover the body surface and play various functions to feathers, suggesting that the avian dinosaur ancestor already had help adapt birds to diverse environments. These keratinized struc- the nonkeratin protein-coding toolkit for making feathers (12). α tures are mainly composed of corneous materials made of -keratins, While fewer new genes have been found in bird genomes (13) β which exist in all vertebrates, and -keratins, which only exist in birds and the α-keratin gene family has shrunk in birds relative to and reptiles.
  • Universidade Estadual De Campinas Instituto De Biologia

    Universidade Estadual De Campinas Instituto De Biologia

    UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA VERÔNICA APARECIDA MONTEIRO SAIA CEREDA O PROTEOMA DO CORPO CALOSO DA ESQUIZOFRENIA THE PROTEOME OF THE CORPUS CALLOSUM IN SCHIZOPHRENIA CAMPINAS 2016 1 VERÔNICA APARECIDA MONTEIRO SAIA CEREDA O PROTEOMA DO CORPO CALOSO DA ESQUIZOFRENIA THE PROTEOME OF THE CORPUS CALLOSUM IN SCHIZOPHRENIA Dissertação apresentada ao Instituto de Biologia da Universidade Estadual de Campinas como parte dos requisitos exigidos para a obtenção do Título de Mestra em Biologia Funcional e Molecular na área de concentração de Bioquímica. Dissertation presented to the Institute of Biology of the University of Campinas in partial fulfillment of the requirements for the degree of Master in Functional and Molecular Biology, in the area of Biochemistry. ESTE ARQUIVO DIGITAL CORRESPONDE À VERSÃO FINAL DA DISSERTAÇÃO DEFENDIDA PELA ALUNA VERÔNICA APARECIDA MONTEIRO SAIA CEREDA E ORIENTADA PELO DANIEL MARTINS-DE-SOUZA. Orientador: Daniel Martins-de-Souza CAMPINAS 2016 2 Agência(s) de fomento e nº(s) de processo(s): CNPq, 151787/2F2014-0 Ficha catalográfica Universidade Estadual de Campinas Biblioteca do Instituto de Biologia Mara Janaina de Oliveira - CRB 8/6972 Saia-Cereda, Verônica Aparecida Monteiro, 1988- Sa21p O proteoma do corpo caloso da esquizofrenia / Verônica Aparecida Monteiro Saia Cereda. – Campinas, SP : [s.n.], 2016. Orientador: Daniel Martins de Souza. Dissertação (mestrado) – Universidade Estadual de Campinas, Instituto de Biologia. 1. Esquizofrenia. 2. Espectrometria de massas. 3. Corpo caloso.
  • Downregulation of Salivary Proteins, Protective Against Dental Caries, in Type 1 Diabetes

    Downregulation of Salivary Proteins, Protective Against Dental Caries, in Type 1 Diabetes

    proteomes Article Downregulation of Salivary Proteins, Protective against Dental Caries, in Type 1 Diabetes Eftychia Pappa 1,* , Konstantinos Vougas 2, Jerome Zoidakis 2 , William Papaioannou 3, Christos Rahiotis 1 and Heleni Vastardis 4 1 Department of Operative Dentistry, School of Dentistry, National and Kapodistrian University of Athens, 11527 Athens, Greece; [email protected] 2 Proteomics Laboratory, Biomedical Research Foundation Academy of Athens, 11527 Athens, Greece; [email protected] (K.V.); [email protected] (J.Z.) 3 Department of Preventive and Community Dentistry, School of Dentistry, National and Kapodistrian University of Athens, 11527 Athens, Greece; [email protected] 4 Department of Orthodontics, School of Dentistry, National and Kapodistrian University of Athens, 11527 Athens, Greece; [email protected] * Correspondence: effi[email protected] Abstract: Saliva, an essential oral secretion involved in protecting the oral cavity’s hard and soft tissues, is readily available and straightforward to collect. Recent studies have analyzed the sali- vary proteome in children and adolescents with extensive carious lesions to identify diagnostic and prognostic biomarkers. The current study aimed to investigate saliva’s diagnostic ability through proteomics to detect the potential differential expression of proteins specific for the occurrence of carious lesions. For this study, we performed bioinformatics and functional analysis of proteomic datasets, previously examined by our group, from samples of adolescents with regulated and unreg- ulated type 1 diabetes, as they compare with healthy controls. Among the differentially expressed Citation: Pappa, E.; Vougas, K.; proteins relevant to caries pathology, alpha-amylase 2B, beta-defensin 4A, BPI fold containing family Zoidakis, J.; Papaioannou, W.; Rahiotis, C.; Vastardis, H.
  • Associated Palmoplantar Keratoderma

    Associated Palmoplantar Keratoderma

    DR ABIGAIL ZIEMAN (Orcid ID : 0000-0001-8236-207X) Article type : Review Article Pathophysiology of pachyonychia congenita-associated palmoplantar keratoderma: New insight into skin epithelial homeostasis and avenues for treatment Authors: A. G. Zieman1 and P. A. Coulombe1,2 # Affiliations: 1Department of Cell and Developmental Biology, University of Michigan Medical School, Ann Arbor, MI 48109, USA; 2Department of Dermatology, University of Michigan Medical School, Ann Arbor, MI 48109, USA #Corresponding author: Pierre A. Coulombe, PhD, 3071 Biomedical Sciences Research Building, 109 Zina Pitcher Place, Ann Arbor, MI 48109, USA. Tel: 734-615-7509. Email: [email protected]. Funding Sources: These studies were supported by grant AR044232 issued to P.A.C. from the National Institute of Arthritis, Musculoskeletal and Skin Disease (NIAMS). A.G.Z. received support from grant T32 CA009110 from the National Cancer Institute. Author Manuscript This is the author manuscript accepted for publication and has undergone full peer review but has not been through the copyediting, typesetting, pagination and proofreading process, which may lead to differences between this version and the Version of Record. Please cite this article as doi: 10.1111/BJD.18033 This article is protected by copyright. All rights reserved Conflict of interest disclosures: None declared. Bulleted statements: What’s already known about this topic? Pachyonychia congenita is a rare genodermatosis caused by mutations in KRT6A, KRT6B, KRT6C, KRT16, KRT17, which are normally expressed in skin appendages and induced following injury. Individuals with PC present with multiple clinical symptoms that usually include thickened and dystrophic nails, palmoplantar keratoderma (PPK), glandular cysts, and oral leukokeratosis.
  • Keratin 9 Point Mutation in the Pedigree of Epidermolytic Hereditary Palmoplantar Keratoderma Perturbs Keratin Intermediate Filament Network Formation

    Keratin 9 Point Mutation in the Pedigree of Epidermolytic Hereditary Palmoplantar Keratoderma Perturbs Keratin Intermediate Filament Network Formation

    FEBS 17004 FEBS Letters 386 (1996) 149-155 Keratin 9 point mutation in the pedigree of epidermolytic hereditary palmoplantar keratoderma perturbs keratin intermediate filament network formation Setsu Kobayashi, Toshihiro Tanaka*, Norihisa Matsuyoshi, Sadao Imamura Department of Dermatology, Graduate School of Medicine, Kyoto University, Kyoto, 606 Japan Received 12 January 1996; revised version received 4 April 1996 Abstract Keratins form an intracellular keratin filament net- point mutations in the K9 gene in EHPPK [4-8] but none work in keratinocytes. Point mutations in the epidermal keratins showed a function assay with these mutations. Here, we pro- could lead to the disruption of keratin filament formation, vide the first demonstration that the point mutation found in developing skin diseases such as epidermolytic hereditary a pedigree of EHPPK has a dominant-negative effect on the palmoplantar keratoderma (EHPPK). We found a G to A assembly of keratin intermediate filaments in the cells. transition in keratin 9 (K9) cDNA, resulting in the substitution of glutamine for arginine at 162, in all patients of a pedigree of 2. Materials and methods EHPPK. Transfection into MDCK cells and DJM-1 cells revealed that the plasmid CMX vector containing normal keratin 2.1. PCR and DNA sequence 9 cDNA showed normal keratin network formation, whereas the Genomic DNA was extracted and purified from blood or biopsy vector with a G to A point mutated keratin 9 cDNA showed specimens from the patients. The primers were designed at nucleotide disrupted keratin filaments with droplet formation in the cells. 263 282 and 664-683 based on the K9 cDNA sequence [9].
  • Cellular and Molecular Signatures in the Disease Tissue of Early

    Cellular and Molecular Signatures in the Disease Tissue of Early

    Cellular and Molecular Signatures in the Disease Tissue of Early Rheumatoid Arthritis Stratify Clinical Response to csDMARD-Therapy and Predict Radiographic Progression Frances Humby1,* Myles Lewis1,* Nandhini Ramamoorthi2, Jason Hackney3, Michael Barnes1, Michele Bombardieri1, Francesca Setiadi2, Stephen Kelly1, Fabiola Bene1, Maria di Cicco1, Sudeh Riahi1, Vidalba Rocher-Ros1, Nora Ng1, Ilias Lazorou1, Rebecca E. Hands1, Desiree van der Heijde4, Robert Landewé5, Annette van der Helm-van Mil4, Alberto Cauli6, Iain B. McInnes7, Christopher D. Buckley8, Ernest Choy9, Peter Taylor10, Michael J. Townsend2 & Costantino Pitzalis1 1Centre for Experimental Medicine and Rheumatology, William Harvey Research Institute, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, Charterhouse Square, London EC1M 6BQ, UK. Departments of 2Biomarker Discovery OMNI, 3Bioinformatics and Computational Biology, Genentech Research and Early Development, South San Francisco, California 94080 USA 4Department of Rheumatology, Leiden University Medical Center, The Netherlands 5Department of Clinical Immunology & Rheumatology, Amsterdam Rheumatology & Immunology Center, Amsterdam, The Netherlands 6Rheumatology Unit, Department of Medical Sciences, Policlinico of the University of Cagliari, Cagliari, Italy 7Institute of Infection, Immunity and Inflammation, University of Glasgow, Glasgow G12 8TA, UK 8Rheumatology Research Group, Institute of Inflammation and Ageing (IIA), University of Birmingham, Birmingham B15 2WB, UK 9Institute of
  • Diabetes Induced Alterations in Murine Vitreous Proteome Are Mitigated by IL-6 Trans-Signaling Inhibition

    Diabetes Induced Alterations in Murine Vitreous Proteome Are Mitigated by IL-6 Trans-Signaling Inhibition

    Retina Diabetes Induced Alterations in Murine Vitreous Proteome Are Mitigated by IL-6 Trans-Signaling Inhibition Rebekah Robinson,1 Hannah Youngblood,2 Hersha Iyer,1 Justin Bloom,1 Tae Jin Lee,1 Luke Chang,3 Zachary Lukowski,3 Wenbo Zhi,1 Ashok Sharma,1,3–5 and Shruti Sharma1,3,5 1Center for Biotechnology and Genomic Medicine, Augusta University, Augusta, Georgia, United States 2Department of Cellular Biology and Anatomy, Augusta University, Augusta, Georgia, United States 3Department of Ophthalmology, Augusta University, Augusta, Georgia, United States 4Department of Population Health Sciences, Augusta University, Augusta, Georgia, United States 5Culver Vision Discovery Institute, Augusta University, Augusta, Georgia, United States Correspondence: Shruti Sharma, PURPOSE. Diabetic retinopathy (DR) is a microvascular complication caused by prolonged Center for Biotechnology and hyperglycemia and characterized by leaky retinal vasculature and ischemia-induced Genomic Medicine, Medical College angiogenesis. Vitreous humor is a gel-like biofluid in the posterior segment of the eye of Georgia, Augusta University, 1460 between the lens and the retina. Disease-related changes are observed in the biochem- Laney Walker Blvd, CAII 4139, ical constituents of the vitreous, including proteins and macromolecules. Recently, we Augusta, GA 30912, USA; [email protected]. found that IL-6 trans-signaling plays a significant role in the vascular leakage and retinal pathology associated with DR. Therefore, in this study, comprehensive proteomic profil- Received: May 18, 2020 ing of the murine vitreous was performed to identify diabetes-induced alterations and to Accepted: August 5, 2020 determine effects of IL-6 trans-signaling inhibition on these changes. Published: September 1, 2020 METHODS. Vitreous samples from mice were collected by evisceration, and proteomic Citation: Robinson R, Youngblood H, Iyer H, et al.
  • Comparative Genomics Analyses of Alpha-Keratins Reveal Insights Into

    Comparative Genomics Analyses of Alpha-Keratins Reveal Insights Into

    Sun et al. Frontiers in Zoology (2017) 14:41 DOI 10.1186/s12983-017-0225-x RESEARCH Open Access Comparative genomics analyses of alpha- keratins reveal insights into evolutionary adaptation of marine mammals Xiaohui Sun, Zepeng Zhang, Yingying Sun, Jing Li, Shixia Xu* and Guang Yang* Abstract Background: Diversity of hair in marine mammals was suggested as an evolutionary innovation to adapt aquatic environment, yet its genetic basis remained poorly explored. We scanned α-keratin genes, one major structural components of hair, in 16 genomes of mammalian species, including seven cetaceans, two pinnipeds, polar bear, manatee and five terrestrial species. Results: Extensive gene loss and high pseudogenization rate of α-keratin genes were identified in cetaceans when compared to terrestrial artiodactylans (average number of α-keratins 37.29 vs. 58.33; pseudogenization rate 29.89% vs. 8.00%), especially of hair follicle-specific keratin genes (average pseudogenization rate in cetaceans of 43.88% relative to 3.80% artiodactylian average). Compared to toothed whale, the much more number of intact functional α-keratin genes was examined in the baleen whale that had specific keratinized baleen. In contrast, the number of keratin genes in pinnipeds, polar bear and manatee were comparable to those of their respective terrestrial relatives. Additionally, four keratin genes (K39, K9, K42, and K74) were found to be pseudogenes or lost uniquely in cetaceans and manatees. Conclusions: Species-specific evolution of α-keratin gene family identified in the marine mammals might be responsible for their different hair characteristics. Increased gene loss and pseudogenization rate identified in cetacean lineages was likely to contribute to hair-less phenotype to adaptation for complete aquatic environment.
  • Proteomic Approaches Identify Members of Cofilin Pathway Involved in Oral Tumorigenesis

    Proteomic Approaches Identify Members of Cofilin Pathway Involved in Oral Tumorigenesis

    Proteomic Approaches Identify Members of Cofilin Pathway Involved in Oral Tumorigenesis Giovana M. Polachini1, Lays M. Sobral2, Ana M. C. Mercante3, Adriana F. Paes-Leme4, Fla´via C. A. Xavier5, Tiago Henrique1, Douglas M. Guimara˜es6, Alessandra Vidotto1, Erica E. Fukuyama7, Jose´ F. Go´ is-Filho7, Patricia M. Cury8, Ota´vio A. Curioni9, Pedro Michaluart Jr10, Adriana M. A. Silva11, Victor Wu¨ nsch-Filho12, Fabio D. Nunes6, Andre´ia M. Leopoldino2, Eloiza H. Tajara1,13* 1 Departamento de Biologia Molecular; Faculdade de Medicina (FAMERP), Sa˜oJose´ do Rio Preto, SP, Brazil, 2 Departamento de Ana´lises Clı´nicas, Toxicolo´gicas e Bromatolo´gicas, Faculdade de Cieˆncias Farmaceˆuticas da Universidade de Sa˜o Paulo, Ribeira˜o Preto, SP, Brazil, 3 Laborato´rio de Patologia, Hospital Helio´polis, Sa˜o Paulo, SP, Brazil, 4 Laborato´rio Nacional de Biocieˆncias (LNBio), Centro Nacional de Pesquisa em Energia e Materiais, Campinas, SP, Brazil, 5 Departamento de Propedeˆutica e Clı´nica Integrada, Faculdade de Odontologia da Universidade Federal da Bahia, Salvador,BA, Brazil, 6 Departamento de Estomatologia, Faculdade de Odontologia da Universidade de Sa˜o Paulo, Sa˜o Paulo, SP, Brazil, 7 Servic¸o de Cirurgia de Cabec¸a e Pescoc¸o, Instituto do Caˆncer Arnaldo Vieira de Carvalho, Sa˜o Paulo, SP, Brazil, 8 Departamento de Patologia e Medicina Legal, Faculdade de Medicina (FAMERP), Sa˜oJose´ do Rio Preto, SP, Brazil, 9 Departamento de Cirurgia de Cabec¸a e Pescoc¸o e Otorrinolaringologia, Hospital Helio´polis, Sa˜o Paulo, SP, Brazil, 10 Divisa˜o
  • The Correlation of Keratin Expression with In-Vitro Epithelial Cell Line Differentiation

    The Correlation of Keratin Expression with In-Vitro Epithelial Cell Line Differentiation

    The correlation of keratin expression with in-vitro epithelial cell line differentiation Deeqo Aden Thesis submitted to the University of London for Degree of Master of Philosophy (MPhil) Supervisors: Professor Ian. C. Mackenzie Professor Farida Fortune Centre for Clinical and Diagnostic Oral Science Barts and The London School of Medicine and Dentistry Queen Mary, University of London 2009 Contents Content pages ……………………………………………………………………......2 Abstract………………………………………………………………………….........6 Acknowledgements and Declaration……………………………………………...…7 List of Figures…………………………………………………………………………8 List of Tables………………………………………………………………………...12 Abbreviations….………………………………………………………………..…...14 Chapter 1: Literature review 16 1.1 Structure and function of the Oral Mucosa……………..…………….…..............17 1.2 Maintenance of the oral cavity...……………………………………….................20 1.2.1 Environmental Factors which damage the Oral Mucosa………. ….…………..21 1.3 Structure and function of the Oral Mucosa ………………...….……….………...21 1.3.1 Skin Barrier Formation………………………………………………….……...22 1.4 Comparison of Oral Mucosa and Skin…………………………………….……...24 1.5 Developmental and Experimental Models used in Oral mucosa and Skin...……..28 1.6 Keratinocytes…………………………………………………….….....................29 1.6.1 Desmosomes…………………………………………….…...............................29 1.6.2 Hemidesmosomes……………………………………….…...............................30 1.6.3 Tight Junctions………………………….……………….…...............................32 1.6.4 Gap Junctions………………………….……………….….................................32
  • Proteome Profiling of Exosomes Purified from a Small Amount Of

    Proteome Profiling of Exosomes Purified from a Small Amount Of

    proteomes Article Proteome Profiling of Exosomes Purified from a Small Amount of Human Serum: The Problem of Co-Purified Serum Components Mateusz Smolarz 1, Monika Pietrowska 1, Natalia Matysiak 2, Łukasz Miela ´nczyk 2 and Piotr Widłak 1,* 1 Maria Skłodowska-Curie Institute—Oncology Center, Gliwice Branch, 44-101 Gliwice, Poland; [email protected] (M.S.); [email protected] (M.P.) 2 Department of Histology and Cell Pathology, School of Medicine with Division of Dentistry in Zabrze, Medical University of Silesia, 41-800 Zabrze, Poland; [email protected] (N.M.); [email protected] (Ł.M.) * Correspondence: [email protected]; Tel.: +48-32-2789672 Received: 26 March 2019; Accepted: 26 April 2019; Published: 28 April 2019 Abstract: Untargeted proteomics analysis of extracellular vesicles (EVs) isolated from human serum or plasma remains a technical challenge due to the contamination of these vesicles with lipoproteins and other abundant serum components. Here we aimed to test a simple method of EV isolation from a small amount of human serum (<1 mL) using the size-exclusion chromatography (SEC) standalone for the discovery of vesicle-specific proteins by the untargeted LC–MS/MS shotgun approach. We selected the SEC fraction containing vesicles with the size of about 100 nm and enriched with exosome markers CD63 and CD81 (but not CD9 and TSG101) and analyzed it in a parallel to the subsequent SEC fraction enriched in the lipoprotein vesicles. In general, there were 267 proteins identified by LC–MS/MS in exosome-containing fraction (after exclusion of immunoglobulins), yet 94 of them might be considered as serum proteins.
  • Keratin-Pan Polyclonal Antibody Catalog # AP73512

    Keratin-Pan Polyclonal Antibody Catalog # AP73512

    苏州工业园区双圩路9号1幢 邮 编 : 215000 电 话 : 0512-88856768 Keratin-pan Polyclonal Antibody Catalog # AP73512 Specification Keratin-pan Polyclonal Antibody - Product info Application WB, IHC-P Primary Accession P35908 Reactivity Human, Mouse, Rat Host Rabbit Clonality Polyclonal Keratin-pan Polyclonal Antibody - Additional info Gene ID 3849 Other Names KRT2; KRT76; KRT3; KRT5; KRT6A; KRT6B; KRT6C; KRT71; KRT72; KRT73; KRT74; KRT75; KRT79; KRT8; KRT84; Keratin, type II cytoskeletal 2 epidermal; Keratin, type II cytoskeletal 2 oral; Keratin, type II cytoskeletal 3; Keratin, type II cytoskeletal 5;Keratin, type II cytoskeletal 6A; Keratin, type II cytoskeletal 6B; Keratin, type II cytoskeletal 6C; Keratin, type II cytoskeletal 71; Keratin, type II cytoskeletal 72; Keratin, type II cytoskeletal Western Blot analysis of Jurkat cells 73; Keratin, type II cytoskeletal 74; using Keratin-pan Polyclonal Antibody.. Secondary antibody was diluted at Dilution 1:20000 WB~~Western Blot: 1/500 - 1/2000. IHC-p: 1/100-1/300. ELISA: 1/20000. Not yet tested in other applications. Format Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. Storage Conditions -20℃ Keratin-pan Polyclonal Antibody - Protein Information Immunohistochemical analysis of Name KRT2 paraffin-embedded human-mammary-cancer, antibody was Synonyms KRT2A, KRT2E diluted at 1:100 Function Probably contributes to terminal cornification (PubMed:<a href="http://www.uniprot.org/citations/1380918" target="_blank">1380918</a>). Associated with keratinocyte activation, proliferation and keratinization (PubMed:<a href="http://www.uniprot.org/citations/12598329" target="_blank">12598329</a>). Plays a role in the establishment of the epidermal barrier on plantar skin (By similarity). Tissue Location Expressed in the upper spinous and granular suprabasal layers of normal adult epidermal tissues from most body sites including thigh, breast nipple, foot sole, penile shaft and axilla.