Desmin Interacts Directly with Mitochondria

International Journal of Molecular Sciences

Article Desmin Interacts Directly with Mitochondria

Alexander A. Dayal 1, Natalia V. Medvedeva 1, Tatiana M. Nekrasova 1, Sergey D. Duhalin 1, Alexey K. Surin 1,2 and Alexander A. Minin 1,* 1 Institute of Protein Research of Russian Academy of Sciences, Vavilova st., 34, 119334 Moscow, Russia; [email protected] (A.A.D.); [email protected] (N.V.M.); [email protected] (T.M.N.); [email protected] (S.D.D.); [email protected] (A.K.S.) 2 Pushchino Branch, Shemyakin–Ovchinnikov Institute of Bioorganic Chemistry, Russian Academy of Sciences, Prospekt Nauki 6, Pushchino, 142290 Moscow Region, Russia * Correspondence: [email protected]

Received: 14 October 2020; Accepted: 26 October 2020; Published: 30 October 2020

Abstract: Desmin intermediate filaments (IFs) play an important role in maintaining the structural and functional integrity of muscle cells. They connect contractile myofibrils to plasma membrane, nuclei, and mitochondria. Disturbance of their network due to desmin mutations or deficiency leads to an infringement of myofibril organization and to a deterioration of mitochondrial distribution, morphology, and functions. The nature of the interaction of desmin IFs with mitochondria is not clear. To elucidate the possibility that desmin can directly bind to mitochondria, we have undertaken the study of their interaction in vitro. Using desmin mutant Des(Y122L) that forms unit-length filaments (ULFs) but is incapable of forming long filaments and, therefore, could be effectively separated from mitochondria by centrifugation through sucrose gradient, we probed the interaction of recombinant human desmin with mitochondria isolated from rat liver. Our data show that desmin can directly bind to mitochondria, and this binding depends on its N-terminal domain. We have found that mitochondrial cysteine protease can disrupt this interaction by cleavage of desmin at its N-terminus.

Keywords: mitochondria; desmin; intermediate ﬁlaments; calpain

1. Introduction Intermediate filament (IF) networks are one of three cytoskeletal components along with microtubules and actin microfilaments. IFs provide mechanical strength and elasticity to cells and tissues and regulate intracellular positioning of nucleus and organelles [1]. It has been shown that one of the important roles of IFs inside animal cells is to ensure normal mitochondrial functioning [2–7]. Desmin, a major constituent of the IF network inside muscle cells, is a good example of such factors controlling mitochondria. A plethora of pathological conditions, collectively known as desminopathies, is caused by mutations in desmin and results in abnormalities in mitochondrial distribution and morphology as well as reduced mitochondrial respiratory function [5,7–9]. These data suggest that interaction with desmin is a prerequisite for normal mitochondrial functioning. However, the nature of interaction between desmin IFs and mitochondria is not fully elucidated. For example, one question that needs to be asked is whether desmin is able to bind directly to these organelles or some intermediary proteins are necessary. Previously, in G. Wiche’s lab, it was demonstrated that one such intermediary is plectin, particularly its 1b isoform, which interacts both with desmin and mitochondria [10]. However, experimental evidence showed certain desmin mutations which do not interfere with native IF structure or apparently with binding of plectin yet cause pathological conditions [11], including mitochondrial dysfunction [7]. A direct association between desmin IFs and mitochondria could explain these phenomena. In this study, we examined the possibility of a direct interaction between purified recombinant desmin and isolated rat liver mitochondria. We performed centrifugation in the sucrose

Int. J. Mol. Sci. 2020, 21, 8122; doi:10.3390/ijms21218122 www.mdpi.com/journal/ijms Int. J. Mol. Sci. 2020, 21, x FOR PEER REVIEW 2 of 10 Int. J. Mol. Sci. 2020, 21, 8122 2 of 9 the possibility of a direct interaction between purified recombinant desmin and isolated rat liver mitochondria. We performed centrifugation in the sucrose gradient to separate desmin and a gradientheavier mitochondrial to separate desmin fraction. and a To heavier prevent mitochondrial sedimentation fraction. of unbound To prevent desmin, sedimentation we used of its unbound mutant desmin,form Des(Y122L). we used its This mutant point form mutation Des(Y122L). in desmin This arrests point mutationits polymerization in desmin at arrests the stage its polymerization of unit-length atfilaments the stage (ULFs) of unit-length consisting filaments of approximately (ULFs) consisting 30–40 ofpolypeptides approximately of desmin 30–40 polypeptides that are much of desminlighter thatthan arelong much IFs and lighter sediment than long only IFs at high-speed and sediment centrifugation. only at high-speed Figure centrifugation.1 shows that Des(Y122L) Figure1 shows when / thatexpressed Des(Y122L) in rat fibroblasts when expressed REF-52(Vim in rat− fibroblasts/−) devoid of REF-52(Vim IFs is unable− − )to devoid form filaments. of IFs is unableIt rather to forms form filaments.ULFs evenly It distributed rather forms throughout ULFs evenly the distributedcytoplasm, similarly throughout to mutant the cytoplasm, vimentin(Y117L) similarly [12,13]. to mutant vimentin(Y117L) [12,13].

/ Figure 1. Immunofluorescence of REF-52(Vim− −) cells transfected with plasmid pIRES-EGFP- Des(Y122L).Figure 1. ExpressionImmunofluorescence of EGFP (left) andof desmin(Y122L) REF-52(Vim (right)−/−) cells in rat fibroblasttransfected stained with with antibodiesplasmid againstpIRES-EGFP-Des(Y122L). desmin shows evenly Expression distributed of unit-length EGFP (left) filaments and desmin(Y122L) (ULFs) but not long (right) intermediate in rat fibroblast filament (IF).stained Scale with 10 µantibodiesm. against desmin shows evenly distributed unit-length filaments (ULFs) but not long intermediate filament (IF). Scale 10 µm. Our results demonstrate that desmin in the form of ULFs binds to mitochondria directly, and the N-terminusOur results of its demonstrate molecule is responsiblethat desmin for in this the interaction.form of ULFs binds to mitochondria directly, and 2.the Results N-terminus of its molecule is responsible for this interaction.

2.1.2. Results Desmin Binds to Mitochondria In Vitro

2.1. DesminPreviously, Binds we to hypothesizedMitochondria In [6] Vitro that, similarly to vimentin, an N-terminal part of desmin molecule could contain a targeting signal which localizes desmin to the outer mitochondrial membrane (OMM). Its moderatelyPreviously, hydrophobic we hypothesized region spanning[6] that, fromsimilarly threonine-17 to vimentin, to proline-36 an N-terminal is ﬂanked part by twoof desmin groups ofmolecule positively could charged contain amino a targeting acids—a characteristicsignal which patternlocalizes of manydesmin proteins to the known outer tomitochondrial be localized tomembrane OMM [14 (OMM).]. To predict Its moderately the presence hydrophobic of mitochondrial region targetingspanning peptidefrom threonine-17 in the molecule to proline-36 of human is desmin,flanked by we two used groups the online of positively program charged TargetP amino 1.1 [15 acids—a] to analyze characteristic its sequence pattern and of found many that proteins such signalknown is to present be localized with a highto OMM probability [14]. To (mTP—0.864). predict the presence Therefore, of accordingmitochondrial to the targeting analysis of peptide desmin’s in primarythe molecule structure, of human it belongs desmin, tothe we proteinsused the predisposed online program to localize TargetP in 1.1 mitochondria. [15] to analyze its sequence and foundTo test that the possibilitysuch signal of is the present direct with binding a high of desminprobability to mitochondria, (mTP—0.864). we Therefore, probed the according interaction to ofthe mitochondria analysis of desmin’s from a rat primary liver with structure, a recombinant it belongs human to the Des(Y122L) proteins predisposedin vitro. The to protein localize was in expressedmitochondria. and puriﬁed from bacterial lysate (see Supplementary Methods and Figure S1A). The bound Des(Y122L)To test was the determined possibility using of the Western direct blotting binding of mitochondrialof desmin to pellets mitochondria, obtained bywe centrifugation probed the ofinteraction their mixtures of mitochondria through sucrose fromcushion. a rat liver with a recombinant human Des(Y122L) in vitro. The proteinWhen was centrifuged expressed and through purified a sucrose from bacteria cushion,l lysate such desmin (see Supplementary mutant did not Methods sediment and by Figure itself andS1A). completely The bound stayed Des(Y122L) in the supernatant was determined (Figure 2usinA,B,g lines Western S1 and blotting P1). However, of mitochondrial when the samplepellets containedobtained by mitochondria, centrifugation some of their Des(Y122L) mixtures wasthrough found sucrose in the cushion. pellet, but only in the case where the proteaseWhen inhibitor centrifuged cocktail through was present a sucrose in thecushion, mixture such (Figure desmin2A,B, mutant lines S3did and not P3).sediment Incubation by itself of thisand proteincompletely with stayed mitochondria in the supernatant without protease (Figure inhibitors 2A,B, lines led S1 to and partial P1). protein However, degradation, when the andsample the shortenedcontained Des(Y122L)mitochondria, was some found Des(Y122L) only in the was supernatant found in (Figure the pellet,2A,B, but lines only S2 andin the P2). case COX-IV where was the usedprotease as a inhibitor marker of cocktail mitochondrial was present proteins in the in themixt pelletsure (Figure and the 2A,B, loading lines control S3 and (Figure P3). Incubation2C). Hence, of this protein with mitochondria without protease inhibitors led to partial protein degradation, and the shortened Des(Y122L) was found only in the supernatant (Figure 2A,B, lines S2 and P2). COX-IV

Int. J. Mol. Sci. 2020, 21, x FOR PEER REVIEW 3 of 10 Int. J. Mol. Sci. 2020, 21, x FOR PEER REVIEW 3 of 10 Int. J. Mol. Sci. 2020, 21, 8122 3 of 9 was used as a marker of mitochondrial proteins in the pellets and the loading control (Figure 2C). Hence,was used full-size as a Des(Y122L)marker of mitochondrial bound to mitochondria proteins in and the co-sedimentedpellets and the with loading them control through (Figure sucrose 2C). cushion,full-sizeHence, whilefull-size Des(Y122L) cleaved Des(Y122L) bound desmin to bound did mitochondria not. to mitochondria and co-sedimented and co-sedimented with them with through them sucrosethrough cushion, sucrose whilecushion, cleaved while desmin cleaved did desmin not. did not.

Figure 2. Desmin and mitochondria co-sedimentation. (A) SDS-PAGE of supernatants (S1, S2, S3) Figure 2. Desmin and mitochondria co-sedimentation. (A) SDS-PAGE of supernatants (S1, S2, S3) andFigure pellets 2. (P1,Desmin P2, P3)and after mitochondria centrifugation co-sedimentation. through sucrose (A )cushion SDS-PAGE of mixtures of supernatants of Des(Y122L) (S1, S2, and S3) and pellets (P1, P2, P3) after centrifugation through sucrose cushion of mixtures of Des(Y122L) and mitochondria.and pellets (P1, Des(Y122L) P2, P3) after was centrifugationincubated without thro ughmitochondria sucrose cushion (S1, P1), of with mixtures mitochondria of Des(Y122L) (S2, P2), and mitochondria. Des(Y122L) was incubated without mitochondria (S1, P1), with mitochondria (S2, P2), ormitochondria. with mitochondria Des(Y122L) and protease was incubate inhibitord without cocktail mitochondria (S3, P3). Western (S1, P1), blotting with ofmitochondria the same samples (S2, P2), or with mitochondria and protease inhibitor cocktail (S3, P3). Western blotting of the same samples as asor in with (A) mitochondriawith antibodies and against protease desmin inhibitor or COX-IV cocktail is(S3, shown P3). Western in (B,C ),blotting respectively. of the sameThe desmin samples in (A) with antibodies against desmin or COX-IV is shown in (B,C), respectively. The desmin molecule moleculeas in (A )approximately with antibodies 10 against kD smaller desmin after or COX-IVthe incubation is shown with in (Bmitochondria,C), respectively. (S2) Thedoes desmin not approximately 10 kD smaller after the incubation with mitochondria (S2) does not co-sediment with co-sedimentmolecule approximately with mitochondria 10 kD (P 2),smaller while after the theaddition incubation of protease with mitochondriainhibitor cocktail (S2) preventsdoes not mitochondria (P2), while the addition of protease inhibitor cocktail prevents desmin cleavage (S3) and desminco-sediment cleavage with (S3) mitochondria and ensures its (P co-sedimentati2), while the onaddition with mitochondria of protease (P3).inhibitor COX-IV cocktail is detectable prevents ensures its co-sedimentation with mitochondria (P3). COX-IV is detectable only in lines P2 and P3 onlydesmin in lines cleavage P2 and (S3) P3 andwhich ensures shows its the co-sedimentati presence of mitochondron with mitochondriaial proteins (P3).in the COX-IV pellets. is detectable which shows the presence of mitochondrial proteins in the pellets. only in lines P2 and P3 which shows the presence of mitochondrial proteins in the pellets. MoreMore than than 40 40 mitochondrial mitochondrial proteases proteases are are known known to to maintain maintain normal normal functioning functioning of of these these More than 40 mitochondrial proteases are known to maintain normal functioning of these organellesorganelles [16]. [16]. We We proposed proposed that that one one (or (or several) several) of of these these mito-proteases mito-proteases may may cleave cleave Des(Y122L) Des(Y122L) organelles [16]. We proposed that one (or several) of these mito-proteases may cleave Des(Y122L) whenwhen it it interacts interacts with with mitochondria. mitochondria. To To discover discover a a candidate candidate protease, protease, we we performed performed an an inhibitory inhibitory when it interacts with mitochondria. To discover a candidate protease, we performed an inhibitory analysis.analysis. We examinedexamined several several protease protease inhibitors, inhibitors, including including PMSF (phenylmethylsulfonylPMSF (phenylmethylsulfonyl ﬂuoride), analysis. We examined several protease inhibitors, including PMSF (phenylmethylsulfonyl fluoride),aprotinin, aprotinin, TAME (Tosyl-L-Arginine TAME (Tosyl-L-Arginine Methyl Ester), Methyl leupeptin, Ester), leupeptin, and E-64, andand found E-64, thatand onlyfound the that last fluoride), aprotinin, TAME (Tosyl-L-Arginine Methyl Ester), leupeptin, and E-64, and found that onlytwo the inhibited last two desmin inhibited degradation desmin (Figuredegradation3). Since (Figure leupeptin 3). Since and leupeptin E-64 are known and E-64 to inhibit are known cysteine to only the last two inhibited desmin degradation (Figure 3). Since leupeptin and E-64 are known to inhibitproteases, cysteine in contrast proteases, toserine in contrast protease to serine inhibitors protease PMSF, inhibitors aprotinin, PMSF, and aprotinin, TAME, we and inferred TAME, that we a inhibit cysteine proteases, in contrast to serine protease inhibitors PMSF, aprotinin, and TAME, we inferredcandidate that belongs a candidate to the cysteinebelongs proteases.to the cysteine Figure proteases.3B shows thatFigure protection 3B shows of Des(Y122L)that protection against of inferred that a candidate belongs to the cysteine proteases. Figure 3B shows that protection of Des(Y122L)cysteine proteases against allowscysteine its proteases co-sedimentation allows its with co-sedimentation mitochondria. with mitochondria. Des(Y122L) against cysteine proteases allows its co-sedimentation with mitochondria.

Figure 3. Inhibitory analysis of desmin degradation. Protease inhibitors are indicated. (A) Samples Figure 3. Inhibitory analysis of desmin degradation. Protease inhibitors are indicated. (A) Samples stained with Coomassie Brilliant Blue after electrophoresis in 15% SDS-PAGE of desmin and stainedFigure with3. Inhibitory Coomassie analysis Brilliant of desmin Blue afterdegradatio electrophoresisn. Protease in inhibito 15% SDS-PAGErs are indicated. of desmin (A) Samples and mitochondria mixtures after centrifugation through sucrose cushion. Only leupeptin and E-64 mitochondriastained with mixtures Coomassie after Brilliant centrifugation Blue after thro elughectrophoresis sucrose cushion. in 15% OnlySDS-PAGE leupeptin of desmin and E-64 and inhibitors prevent the formation of 45 kD desmin cleavage product. (B) Immunoblotting of desmin inhibitorsmitochondria prevent mixtures the formation after centrifugation of 45 kD desmin thro cleavageugh sucrose product. cushion. (B) Immunoblotting Only leupeptin of anddesmin E-64 and mitochondria mixtures after centrifugation through sucrose cushion. Only intact desmin molecule inhibitors prevent the formation of 45 kD desmin cleavage product. (B) Immunoblotting of desmin andco-sediments mitochondria with mitochondriamixtures after (leupeptin centrifugation and E-64 through lines in sucrose pellets). cushion. (C) Immunoblotting Only intact of desmin COX-IV and mitochondria mixtures after centrifugation through sucrose cushion. Only intact desmin moleculein the pellet co-sediments fractions with of the mitochondria samples. COX-IV (leupeptin is detectable and E-64 inlines all in lines pellets). which (C show) Immunoblotting the presence molecule co-sediments with mitochondria (leupeptin and E-64 lines in pellets). (C) Immunoblotting ofof COX-IV mitochondria. in the pellet fractions of the samples. COX-IV is detectable in all lines which show the presenceof COX-IV of mitochondria. in the pellet fractions of the samples. COX-IV is detectable in all lines which show the presence of mitochondria.

Int. J. Mol. Sci. 2020, 21, x FOR PEER REVIEW 4 of 10 Int. J. Mol. Sci. 2020, 21, 8122 4 of 9 To determine which type of cysteine protease was involved in desmin degradation, we used moreTo specific determine inhibitors—calpeptin which type of cysteine and protease PD150606. was involvedIt turned in out desmin that degradation,calpeptin, which we used inhibits more specificcalpains inhibitors—calpeptin and cathepsins L and and K PD150606. [17,18], effectivel It turnedy protected out that calpeptin, desmin (Figure which inhibits 4, lines calpains S1 and andP1), cathepsinswhile PD150606, L and K which [17,18 ],specifically effectively protectedinhibits desmincalpains (Figure I and4 ,II lines [19], S1 anddid P1),not whileprevent PD150606, protein whichdegradation specifically (Figure inhibits 4, lines calpains S2 and I and P2). II Since [19], didPD150606 not prevent inhibits protein only degradation typical calpains (Figure that4, linespossess S2 anddomain P2). IV, Since we PD150606 proposed inhibits that the only protease typical responsi calpainsble that for possess desmin domain cleavage IV, is we atypical proposed calpain-10, that the proteasewhich has responsible been found for desminin mitochondria cleavage isearlier atypical [20]. calpain-10, Although which the contamination has been found of in mitochondria earlierwith lysosomal [20]. Although cathepsins the contaminationcannot be completely of mitochondria ruled out, with their lysosomal participation cathepsins is unlikely cannot since be completelyavailable data ruled on out,degradation their participation of desmin is by unlikely cathepsin since [21] available show no data clear on degradationelectrophoretic of desminfragments by cathepsinbut rather [ 21smear-like] show no pattern. clear electrophoretic fragments but rather smear-like pattern.

FigureFigure 4.4. EffectsEﬀects of of calpeptin and PD150606 on desmin andand mitochondriamitochondria co-sedimentation.co-sedimentation. ImmunoblottingImmunoblotting ofof desmindesmin inin supernatantssupernatants (S1,(S1, S2)S2) andand pelletspellets (P1,(P1, P2)P2) afterafter centrifugationcentrifugation throughthrough sucrosesucrose cushion.cushion. Desmin(Y122L) Desmin(Y122L) was was incubated incubated with mitochondriawith mitochondria and calpeptin and calpeptin (S1, P1) or(S1, PD150606 P1) or (S2,PD150606 P2). Non-cleaved (S2, P2). Non-cleaved desmin is seen desmin both is in seen supernatant both in supernatant and pellet only and whenpellet calpeptinonly when was calpeptin added (S1,was P1). added Allosteric (S1, P1). inhibitor Allosteric PD150606 inhibitor did PD150606 not protect did desminnot protect from desmin proteolysis from (S2,proteolysis P2). (S2, P2). 2.2. N-terminus of Desmin is Necessary for Binding to Mitochondria 2.2. N-terminus of Desmin is Necessary for Binding to Mitochondria N- and C-termini of the desmin molecule are the most protease-sensitive regions, whereas N- and C-termini of the desmin molecule are the most protease-sensitive regions, whereas the the central alpha-helical domain is relatively stable [10,21]. Our data (Figures2–4) show that the central alpha-helical domain is relatively stable [10,21]. Our data (Figures 2–4) show that the main main product of desmin degradation resulting from the incubation with mitochondria was smaller product of desmin degradation resulting from the incubation with mitochondria was smaller than than the initial polypeptide by approximately 10 kD. To identify which part of desmin molecule is the initial polypeptide by approximately 10 kD. To identify which part of desmin molecule is cleaved, we performed mass-spectrometry analysis of the protein band in the gel corresponding to the cleaved, we performed mass-spectrometry analysis of the protein band in the gel corresponding to cleavage product. The data demonstrated that desmin molecule was full-length when protected by the cleavage product. The data demonstrated that desmin molecule was full-length when protected leupeptin (Figure S1A) but lost its 70 amino acid-long fragment from N-terminus when incubated with by leupeptin (Figure S1A) but lost its 70 amino acid-long fragment from N-terminus when incubated mitochondria in the absence of inhibitors (Figure S1B). Hence, the cleavage of N-terminus might be with mitochondria in the absence of inhibitors (Figure S1B). Hence, the cleavage of N-terminus responsible for the loss of ability of desmin to interact with mitochondria. Interestingly, the analysis might be responsible for the loss of ability of desmin to interact with mitochondria. Interestingly, the of such shortened desmin using TargetP 1.1 showed very low probability of a mitochondrial target analysis of such shortened desmin using TargetP 1.1 showed very low probability of a mitochondrial peptide in it (mTP—0.122). target peptide in it (mTP—0.122). To further elucidate the role of the N-terminal domain of desmin in its binding to mitochondria, To further elucidate the role of the N-terminal domain of desmin in its binding to mitochondria, we probed the interaction of the headless ∆N-Des(Y122L) obtained by the aforementioned procedure, we probed the interaction of the headless ΔN-Des(Y122L) obtained by the aforementioned including the incubation with mitochondria and subsequent centrifugation through sucrose gradient. procedure, including the incubation with mitochondria and subsequent centrifugation through We preferred such an approach to the expression of shortened polypeptide in bacteria because the sucrose gradient. We preferred such an approach to the expression of shortened polypeptide in formation of the dimers of type III IFs as well as the subsequent steps leading to generation of ULFs is bacteria because the formation of the dimers of type III IFs as well as the subsequent steps leading to strongly dependent on the intact N-terminal domain [22]. The analysis of the truncated ∆N-Des(Y122L) generation of ULFs is strongly dependent on the intact N-terminal domain [22]. The analysis of the from the supernatants after centrifugation using SDS-PAGE showed that it was pure enough and truncated ΔN-Des(Y122L) from the supernatants after centrifugation using SDS-PAGE showed that it in suﬃcient amount (Figures2A and3A). The data in Figure5A demonstrate that ∆N-Des(Y122L) was pure enough and in sufficient amount (Figures 2A and 3A). The data in Figure 5A demonstrate lacking N-terminus does not co-sediment with mitochondria in contrast to the entire non-truncated that ΔN-Des(Y122L) lacking N-terminus does not co-sediment with mitochondria in contrast to the molecule that was treated similarly but in the presence of protease inhibitor leupeptin. Thus, the loss entire non-truncated molecule that was treated similarly but in the presence of protease inhibitor of N-terminal fragment of desmin molecule disrupts its binding to mitochondria. leupeptin. Thus, the loss of N-terminal fragment of desmin molecule disrupts its binding to To rule out the possibility of participation of the C-terminal domain in this interaction, mitochondria. we constructed the deletion mutant of desmin with the truncated C-terminal region 53 amino

Int. J. Mol. Sci. 2020, 21, 8122 5 of 9

Int. J. Mol. Sci. 2020, 21, x FOR PEER REVIEW 5 of 10 acids long. This ∆C-Des(Y122L) mutant also containing the point mutation Y122L was expressed in bacteria and puriﬁed similarly to the original protein (see Supplementary Methods and Figure S1B). Our data show that desmin missing C-terminus bound to mitochondria when its N-terminal part was protected from proteolysis by leupeptin (Figure6, line P3). However, incubation in the absence of inhibitor led to its shortening and to the loss of the ability to co-sediment with mitochondria (Figure5, lines S2 and P2). This protein did not sediment without mitochondria in these conditions (Figure5, lines S1 and P1). The analysis of ∆C-Des(Y122L) by mass-spectrometry in the presence (Figure S1C) or in the absence of leupeptin (Figure S1D) showed that proteolysis led to the cleavage of the identical fragment (70 amino acids) to that of the whole Des(Y122L). Thus, N-terminal domain of desmin is necessary forFigure the interaction5. Headless Δ withN-Des(Y122L) mitochondria, does not whilebind to C-terminus mitochondria. is ( unimportant.A) Western blotting of Int. J. Mol. Sci. 2020, 21, x FOR PEER REVIEW 5 of 10 supernatants (S1, S2, S3) and pellets (P1, P2, P3) after centrifugation through sucrose cushion of mixtures of ΔN-Des(Y122L) (S2, P2) or Des(Y122L) (S3, P3) and mitochondria. The truncated protein ΔN-Des(Y122L) does not sediment without mitochondria (S1, P1). (B) Western blotting of the same samples as in A with antibodies against COX-IV shows the loading control of mitochondrial pellets.

To rule out the possibility of participation of the C-terminal domain in this interaction, we constructed the deletion mutant of desmin with the truncated C-terminal region 53 amino acids long. This ΔC-Des(Y122L) mutant also containing the point mutation Y122L was expressed in bacteria and purified similarly to the original protein (see Supplementary Methods and Figure S1B). Our data show that desmin missing C-terminus bound to mitochondria when its N-terminal part was protected from proteolysis by leupeptin (Figure 6, line P3). However, incubation in the absence of inhibitor led to its shortening and to the loss of the ability to co-sediment with mitochondria Figure(FigureFigure 5. Headless 5, lines5. Headless S2∆ andN-Des(Y122L) P2).ΔN-Des(Y122L) This protein does notdoes did bind notnot tosedimentbind mitochondria. to mitochondria. without (mitochondriaA) Western(A) Western blotting in theseblotting of conditions supernatants of (S1,(Figure S2,supernatants S3) 5, andlines pellets S1(S1, and S2, (P1,P1).S3) andThe P2, pellets P3)analysis after (P1, of P2, centrifugation Δ C-Des(Y122L)P3) after centrifugation through by mass-spect through sucroserometry sucrose cushion incushion the of mixturespresence of of ∆N-Des(Y122L)(Figuremixtures S1C) ofor (S2, Δ inN-Des(Y122L) P2)the orabsence Des(Y122L) (S2, of leupeptinP2) (S3,or Des(Y122L) P3) (Figure and mitochondria. (S3, S1D) P3 )showed and mitochondria. Thethat truncatedproteolysis The truncated protein led to ∆ theproteinN-Des(Y122L) cleavage doesof the notΔ N-Des(Y122L)identical sediment fragment without does not (70 mitochondriasediment amino acids) without (S1,to mitochondriathat P1). of the (B) whole Western (S1, P1). Des(Y122L). blotting(B) Western ofThus, blotting the sameN-terminal of the samples same domain as in A withof antibodiesdesminsamples is as necessary againstin A with COX-IVfor antibodies the interaction shows against the COX-IV with loading mitochondria, shows control the loading of while mitochondrial control C-terminus of mitochondrial pellets. is unimportant. pellets.

of desmin is necessary for the interaction with mitochondria, while C-terminus is unimportant. FigureFigure 6. Interaction 6. Interaction of taillessof tailless desmin desmin and mitochondria. mitochondria. (A) Western (A) Western blotting blotting of ΔC-Des(Y122L) of ∆C-Des(Y122L) in in supernatantssupernatants (S1, (S1, S2, S2, S3) S3) andand pelletspellets (P1, (P1, P2, P2, P3 P3)) after after centrifugation centrifugation through through sucrose sucrose cushion. cushion. ΔC-Des(Y122L) was incubated 20 min without mitochondria (S1, P1), with mitochondria but without ∆C-Des(Y122L) was incubated 20 min without mitochondria (S1, P1), with mitochondria but without protease inhibitors (S2, P2), or with mitochondria and leupeptin (S3, P3). (B) Western blotting of proteaseCOX-IV inhibitors in the same (S2, P2),samples or withshows mitochondrialoading control in and mitochondrial leupeptin pellets. (S3, P3). (B) Western blotting of COX-IV in the same samples shows loading control in mitochondrial pellets. 3. Discussion 3. Discussion Our results show that pure recombinant Des(Y122L) can bind to isolated rat liver mitochondria Ourwithout results any show intermediary that pure proteins. recombinant More specifically, Des(Y122L) desmin can bind uses to its isolated N-terminal rat liverdomain mitochondria for withoutinteraction any intermediary with mitochondria. proteins. These More data are speciﬁcally, in good agreement desmin with uses the its results N-terminal of analysis domain of for interactiondesmin with polypeptide mitochondria. with TargerP These data1.1, which are in pr goodedict agreementmitochondrial with targeting the results signal ofin analysisits of N-terminus. Such signals are recognized by special protein complexes TOM and TIM localized in the desmin polypeptide with TargerP 1.1, which predict mitochondrial targeting signal in its N-terminus. Such signalsFigure are recognized6. Interaction of by tailless special desmin protein and mitochondria. complexes TOM(A) Western and TIMblotting localized of ΔC-Des(Y122L) in the outer in and inner mitochondrialsupernatants membranes, (S1, S2, respectively. S3) and pellets These (P1, P2, complexes P3) after centrifugation are responsible through for sucrose translocation cushion. of proteins ΔC-Des(Y122L) was incubated 20 min without mitochondria (S1, P1), with mitochondria but without carrying targetingprotease inhibitors signals and(S2, P2), participate or with mitochondria in their subsequent and leupeptin distribution (S3, P3). (B) Western into di ﬀblottingerent mitochondrialof compartmentsCOX-IV [23 in]. the However, same samples desmin, shows similarlyloading control to otherin mitochondrial IF proteins, pellets. forms large polymeric structures, the smallest of which, tetramers, contain a coiled-coil core structure of four polypeptides. Thus, 3. Discussion

Our results show that pure recombinant Des(Y122L) can bind to isolated rat liver mitochondria without any intermediary proteins. More specifically, desmin uses its N-terminal domain for interaction with mitochondria. These data are in good agreement with the results of analysis of desmin polypeptide with TargerP 1.1, which predict mitochondrial targeting signal in its N-terminus. Such signals are recognized by special protein complexes TOM and TIM localized in the

Int. J. Mol. Sci. 2020, 21, 8122 6 of 9 upon the binding of the targeting peptide to the TOM complex, further translocation may be impeded due to the large sizes of these particles. This is true for ULFs formed by Des(Y122L) in our experiments. It suggests that interaction of desmin filaments with mitochondria can depend on the binding of its N-terminus to the mitochondrial import complex. Whether such interaction is common to other IF proteins is an intriguing question to be examined in future studies. Nevertheless, our previous experiments that involved vimentin IFs [6,13] argue in favor of universality of such mechanism. The presence of mitochondrial targeting peptide in the N-terminus of desmin could have one more important implication—it is this part of the molecule that appears inside the mitochondrion, whereas central and C-terminal domains reside in the cytoplasm. This is indirectly confirmed by the N-terminus cleavage occurring in the first place. According to our inhibitory analysis, the most probable mito-protease responsible for this cleavage is atypical calpain-10, which was detected in mitochondrial matrix and intermembrane space [20]. An additional argument in favor of the participation of calpain is the cut site at arginine-70 of desmin, which is revealed in the product of proteolysis by mass-spectroscopy (Figure S2B,D). This site in the desmin polypeptide is predicted for calpains by the DeepCalpain web server (http://deepcalpain.cancerbio.info/index.php) based on the deep learning method [24]. Importantly, lysosomal cathepsin activity, which can also be inhibited by calpeptin [17,18] and could be present in mitochondria preparations as a contamination, would have likely resulted in C-terminus cleavage. However, we did not observe it in our experiments. Thus, calpain-10 being a Ca2+-dependent protease can be involved in regulation of the binding of mitochondria to desmin IFs by Ca2+ level, which is high in the mitochondrial matrix and low in the intermembrane space and in cytosol. Depolarization of the inner mitochondrial membrane causing the Ca2+ efflux would lead to calpain activation and as a result to the cleavage of desmin’s N-terminus, which is responsible for the interaction. Therefore, the binding of mitochondria to desmin IFs could be dependent on their membrane potential, and the disruption of this bond by calpain-10 due to a decrease of potential might play a role in the quality control, though it should be verified directly in future studies.

4. Materials and Methods

4.1. Cell Culture, Plasmids and Antibodies

/ The cells REF-52(Vim− −) that were generated earlier using the CRISPR-Cas9 system [25] were cultured in DMEM (Dulbecco’s Modified Eagle Medium) with 10% fetal bovine serum containing 100 µg/mL penicillin and 100 µg/mL streptomycin at 37 ◦C in the humid atmosphere with 5% CO2. For the expression of recombinant desmin in bacteria, we used pET-23b(+) vector. First, to make the intermediary plasmid pET-23b(+)-Desm, we amplified cDNA encoding human desmin (Addgene, IMAGE:4905678) by PCR using primers TTTCATATGAGCCAGGCCTACTCG and TTTAAGCTTTTAGAGCACTTCATGCTGCT and inserted it into the vector at sites Nde I and Hind III. The plasmid pET-23b(+)-Desm (Y122L) encoding desmin with the substitution of tyrosine-122 to leucine was generated using the inverse PCR [26] of the plasmid pET-23b(+)-Desm with primers TTAATCGAGAAGGTGCGCTTCCTGG and GTTGGCGAAGCGGTCATTGAGC and the ligation of its blunt ends. The plasmid pET-23b(+)-(deltaC)-Desm(Y122L) encoding desmin, missing the 53 amino acids at its C-terminus, was generated also using the inverse PCR of the plasmid pET-23b(+)-Desm(Y122L) with the primers TTAATCGAGAAGGTGCGCTTCCTGG and GTTGGCGAAGCGGTCATTGAGC followed by the ligation of product’s blunt ends. pIRES-EGFP-Des(Y122L) plasmid was constructed via standard cloning into the corresponding vector in the EcoR1 site by using cDNA from pET-23b(+)-Desm(Y122L) plasmid. The accuracy of / the products was checked by sequencing. The transfection of the cells REF-52(Vim− −) with plasmid pIRES-EGFP-Desm(Y122L) was performed using TransIT-LT1 reagent (Mirus Bio, Madison, WI, USA) according to the instruction. Monoclonal mouse antibodies DE-U-10 against desmin (Sigma, St. Louis, MO, USA), kindly gifted by Dr. G. Agnetti (Baltimore, MD, USA), were used for Western blotting and for immunofluorescence; Int. J. Mol. Sci. 2020, 21, 8122 7 of 9 and monoclonal rabbit antibodies 3E11 against COX-IV (Cell Signalling, Danvers, MA, USA) for Western blotting. As secondary antibodies, we used TRITC-labeled goat anti-mouse antibodies, and horseradish peroxidase-linked anti-mouse and anti-rabbit IgG, (The Jackson Laboratory, Bar Harbor, ME, USA).

4.2. Transfection of Cells and Immunoﬂuorescence

/ Transfection of REF-52(Vim− −) cells with plasmid pIRES-EGFP-Des(Y122L) was performed using TransIT-LT1 Transfection Reagent (Mirus Bio, USA). DNA (1 mg) was used for a 40 mm plate of cells containing 2 mL of a culture medium. A total of 16–20 h after transfection, cells were ﬁxed with 4% formaldehyde in PBS followed by permeabilization with 0.1% Triton X-100, and stained with anti-desmin antibodies DE-U-10 and secondary TRITC-labeled goat anti-mouse antibodies as previously described [6]. Microscopy was carried out with a Keyence BZ-9000 (USA) equipped with a PlanApo 63x, 1.4 NA objective. Images were captured with inbuilt 12-bit camera and processed ImageJ software. The experiment was performed 3 times.

4.3. Isolation of Mitochondria Mitochondria were isolated from rat liver. Animals were maintained in compliance with regulations on the use and care of laboratory animals. The liver was immediately removed and put into ice-cold PBS, cut to small pieces with scissors, and washed. Homogenization was performed in Potter homogenizer in isolation buffer—10 mM K-Hepes pH 7.4 with 220 mM mannitol, 70 mM sucrose, 1 mM EDTA). Homogenate was centrifuged at 3000 rpm for 10 min in a JA-20 rotor. The supernatant was filtered through the gauze and then centrifuged at 9500 rpm for 20 min in a JA-20 rotor. The mitochondria pellet was homogenized in isolation buffer and then centrifuged at 9500 rpm for 20 min in a JA-20 rotor. The pellet was re-suspended in minimal volume of isolation buffer (1 mL total) and layered onto sucrose gradient which consisted of 1.2 M sucrose and 1.6 M sucrose in 10 mM K-Hepes buffer (pH 7.4) with 1 mM of EDTA and centrifuged at 30,000 rpm for 20 min in a TLS-55 rotor. Brownish fraction containing mitochondria, clearly distinguishable at the interphase between the two sucrose layers, was carefully collected, diluted with isolation buffer, and pelleted at 9500 rpm for 10 min in JA-21 rotor. The pellet was re-suspended minimal volume of isolation buffer and contained 60 20 mg/mL ± of mitochondrial protein.

4.4. Interaction of Mitochondria with Desmin To determine the interaction of mitochondria with Des(Y122L), we used the centrifugation through a sucrose cushion. Desmin bound to mitochondria appeared in the pellet, while an unbound protein stayed in supernatant. Incubation mixture (total volume of 480 µL) contained 0.1 mg/mL of desmin and 2 mg/mL of mitochondria in 10 mM K-Hepes buffer pH 7.4 with 220 mM mannitol, 70 mM sucrose, and 1 mM EDTA. Final concentrations of protease inhibitors when mentioned were: PMSF—0.35 mg/mL; aprotinin—1 µg/mL; TAME—1 µg/mL; E-64—10 µg/mL; leupeptin—1 µg/mL; calpeptin—15 µg/mL; PD150606—20 µg/mL. After incubation at 25 ◦C for 20 min, 400 µL of each sample was layered on 500 µL of sucrose cushion (1.2 M sucrose, 10 mM K-Hepes pH 7.4, and 1 mM EDTA) and centrifuged in a TLS-55 rotor at 30,000 rpm for 10 min. A total of 200 µL of supernatant (upper phase), containing unbound desmin, was collected for analysis or further usage in binding experiments. The sucrose cushion was carefully washed with distilled water and removed by aspiration. The mitochondrial pellet was re-suspended in 100 µL of water. Samples of supernatants and the pellets were mixed with Laemmli sample buffer, incubated for 10 min at 98 ◦C, and separated using 15% SDS-PAGE. Protein bands in gels were revealed by Coomassi Brilliant Blue staining or transferred to nitrocellulose membrane for subsequent Western blot analysis with anti-desmin [1:1000] and anti-COX-IV antibodies [1:1000], and secondary HRP-conjugated antibodies [1:2000], using 3,30-Diaminobenzidine as a substratum. Each experiment was performed at least 3 times. The exact same procedure was used to determine the interaction of mitochondria with ∆C-Des(Y122L). To study the binding of ∆N-Des(Y122L) to mitochondria, we used the truncated Int. J. Mol. Sci. 2020, 21, 8122 8 of 9 protein provided by incubation of Des(Y122L) with mitochondria in the absence of protease inhibitors. For that, we collected supernatant containing unbound desmin after centrifugation, added leupeptin to avoid further protein degradation, and mixed with a fresh portion of mitochondria. To make a control with the full-length Des(Y122L), we added leupeptin during the first incubation with mitochondria and used supernatant containing non-truncated protein for the second incubation with mitochondria.

4.5. Detection of Mitochondrial Targeting Signals To detect possible mitochondrial targeting signal, we used the tool TargetP 1.1, available online (http://www.cbs.dtu.dk/services/TargetP-1.1/index.php). This method uses two-layer artiﬁcial neural networks trained on UniProt annotated sequences with experimentally established localization signals [15]. The result of TargetP 1.1 analysis is an mTP score which predicts the presence of mitochondrial targeting peptide in sequences of proteins. The value of mTP that exceeds 0.55 indicates a high probability of the presence of such signal.

Supplementary Materials: The following are available online at http://www.mdpi.com/1422-0067/21/21/8122/s1. Supplementary Methods: purification of desmin; mass-spectrometry. Supplementary Figures: Figure S1. Expression and purification of recombinant desmin variants in bacteria. SDS-PAGE of (A) Des(Y122) and (B) ∆C-Des(Y122L) samples at the steps of purification. 1—homogenates; 2—supernatants obtained after the sedimentation of inclusion bodies; 3—inclusion bodies pellets; 4—inclusion bodies after washing with 1% Triton X-100; 5—inclusion bodies after washing with 1 M NaCl; Figure S2. Mass-spectroscopy of Des(Y122L) and ∆C-Des(Y122L) after incubation with mitochondria. The protein bands in gels corresponding to Des(Y122L) (A) before and (B) after incubation with mitochondria in the absence of protease inhibitors were processed for analysis as described in Supplemental Methods. C, D—similar results obtained for the shortened protein ∆C-Des(Y122L). Revealed peptides are shown as red rectangles superimposed on the sequence of the human desmin. Author Contributions: Conceptualization, A.A.M.; methodology and experiments, A.A.D., N.V.M.,T.M.N., S.D.D., and A.K.S.; formal analysis, A.A.M., A.K.S., and A.A.D.; data curation, A.A.M. and A.K.S.; writing—original draft preparation, A.A.M.; writing—review and editing, A.A.M. and A.A.D.; supervision, A.A.M.; project administration, A.A.M.; funding acquisition, A.A.M. All authors have read and agreed to the published version of the manuscript. Funding: This work was funded by the Russian Foundation for Basic Research (# 17-04-01775 to AM). Acknowledgments: The authors are grateful to Giulio Agnetti (Baltimore, USA), Konstantin Lyamzaev (MSU, Russia) and Alexis Gautreau (Ecole Polytechnique, France) for the help in purchasing of reagents, and Natalia Minina for excellent technical assistance. Mass spectrometric analysis was performed in facilities of United Pushchino Center "Structural and functional studies of proteins and RNA" (584307). Conflicts of Interest: The authors declare no conflict of interest.

References

1. Etienne-Manneville, S. Cytoplasmic intermediate ﬁlaments in cell biology. Annu. Rev. Cell Dev. Biol. 2018, 34, 1–28. [CrossRef][PubMed] 2. Steen, K.; Chen, D.; Wang, F.; Majumdar, R.; Chen, S.; Kumar, S.; Lombard, D.B.; Weigert, R.; Zieman, A.G.; Parent, C.A.; et al. A role for keratins in supporting mitochondrial organization and function in skin keratinocytes. Mol. Biol. Cell 2020.[CrossRef][PubMed] 3. Lehmann, S.M.; Leube, R.E.; Schwarz, N. Keratin 6a mutations lead to impaired mitochondrial quality control. Br. J. Dermatol. 2020, 182, 636–647. [CrossRef] 4. Milner, D.J.; Mavroidis, M.; Weisleder, N.; Capetanaki, Y. Desmin cytoskeleton linked to muscle mitochondrial distribution and respiratory function. J. Cell Biol. 2000, 150, 1283–1297. [CrossRef] 5. Capetanaki, Y. Desmin cytoskeleton: A potential regulator of muscle mitochondrial behavior and function. Trends Cardiovasc. Med. 2002, 12, 339–348. [CrossRef] 6. Chernoivanenko, I.S.; Matveeva, E.A.; Gelfand, V.I.; Goldman, R.D.; Minin, A.A. Mitochondrial membrane potential is regulated by vimentin intermediate ﬁlaments. FASEB J. 2015, 29, 820–827. [CrossRef][PubMed] 7. Smolina, N.; Khudiakov, A.; Knyazeva, A.; Zlotina, A.; Sukhareva, K.; Kondratov, K.; Gogvadze, V.; Zhivotovsky, B.; Sejersen, T.; Kostareva, A. Desmin mutations result in mitochondrial dysfunction regardless of their aggregation properties. Biochim. Biophys. Acta (BBA) Mol. Basis Dis. 2020, 1866, 165745. [CrossRef] [PubMed] Int. J. Mol. Sci. 2020, 21, 8122 9 of 9

8. Fountoulakis, M.; Soumaka, E.; Rapti, K.; Mavroidis, M.; Tsangaris, G.; Maris, A.; Weisleder, N.; Capetanaki, Y. Alterations in the heart mitochondrial proteome in a desmin null heart failure model. J. Mol. Cell Cardiol. 2005, 38, 461–474. [CrossRef] 9. Cohen, S. Role of calpains in promoting desmin filaments depolymerization and muscle atrophy. BBA Mol. Cell Res. 2020.[CrossRef] 10. Winter, L.; Abrahamsberg, C.; Wiche, G. Plectin isoform 1b mediates mitochondrion-intermediate filament network linkage and controls organelle shape. J. Cell. Biol. 2008, 181, 903–911. [CrossRef] 11. Taylor, M.R.; Slavov, D.; Ku, L.; Di Lenarda, A.; Sinagra, G.; Carniel, E.; Haubold, K.; Boucek, M.M.; Ferguson, D.; Graw, S.L.; et al. Prevalence of desmin mutations in dilated cardiomyopathy. Circulation 2007, 115, 1244–1251. [CrossRef] 12. Meier, M.; Padilla, G.P.; Herrmann, H.; Wedig, T.; Hergt, M.; Patel, T.R.; Burkhard, P. Vimentin coil 1A-A molecular switch involved in the initiation of filament elongation. J. Mol. Biol. 2009, 390, 245–261. [CrossRef] [PubMed] 13. Nekrasova, O.E.; Mendez, M.G.; Chernoivanenko, I.S.; Tyurin-Kuzmin, P.A.; Kuczmarski, E.R.; Gelfand, V.I.; Goldman, R.D.; Minin, A.A. Vimentin intermediate filaments modulate the motility of mitochondria. Mol. Biol. Cell 2011, 22, 2282–2289. [CrossRef][PubMed] 14. Rapaport, D. Finding the right organelle. Targeting signals in mitochondrial outer-membrane proteins. EMBO Rep. 2003, 4, 948–952. [CrossRef] 15. Emanuelsson, O.; Brunak, S.; von Heijne, G.; Nielsen, H. Locating proteins in the cell using TargetP, SignalP and related tools. Nat. Protoc. 2007, 2, 953–971. [CrossRef][PubMed] 16. Quirós, P.M.; Langer, T.; López-Otín, C. New roles for mitochondrial proteases in health, ageing and disease. Nat. Rev. Mol. Cell Biol. 2015, 16, 345–359. [CrossRef] 17. Ebisui, C.; Tsujinaka, T.; Kido, Y.; Iijima, S.; Yano, M.; Shibata, H.; Tanaka, T.; Mori, T. Role of intracellular proteases in differentiation of L6 myoblast cells. Biochem. Mol. Biol. Int. 1994, 32, 515–521. [PubMed] 18. Siklos, M.; BenAissa, M.; Thatcher, G.R. Cysteine proteases as therapeutic targets: Does selectivity matter? A systematic review of calpain and cathepsin inhibitors. Acta Pharm. Sin. B 2015, 5, 506–519. [CrossRef] 19. Wang, K.K.; Nath, R.; Posner, A.; Raser, K.J.; Buroker-Kilgore, M.; Hajimohammadreza, I. An alpha-mercaptoacrylic acid derivative is a selective nonpeptide cell-permeable calpain inhibitor and is neuroprotective. Proc. Natl. Acad. Sci. USA 1996, 93, 6687–6692. [CrossRef] 20. Arrington, D.D.; Van Vleet, T.R.; Schnellmann, R.G. Calpain 10: A mitochondrial calpain and its role in calcium-induced mitochondrial dysfunction. Am. J. Physiol. Cell Physiol. 2006, 291, C1159–C1171. [CrossRef] 21. Baron, C.P.; Jacobsen, S.; Purslow, P.P. Cleavage of desmin by cysteine proteases: Calpains and cathepsin B. Meat Sci. 2004, 68, 447–456. [CrossRef][PubMed] 22. Herrmann, H.; Hofmann, I.; Franke, W.W. Identification of a nonapeptide motif in the vimentin head domain involved in intermediate filament assembly. J. Mol. Biol. 1992, 223, 637–650. [CrossRef] 23. Pfanner, N.; Warscheid, B.; Wiedemann, N. Mitochondrial proteins: From biogenesis to functional networks. Nat. Rev. Mol. Cell Biol. 2019, 20, 267–284. [CrossRef] 24. Liu, Z.; Yu, K.; Dong, J.; Zhao, L.; Liu, Z.; Zhang, Q.; Li, S.; Du, Y.; Cheng, H. Precise prediction of calpain cleavage sites and their aberrance caused by mutations in cancer. Front. Genet. 2019, 10, 715. [CrossRef] [PubMed] 25. Vakhrusheva, A.; Endzhievskaya, S.; Zhuikov, V.; Nekrasova, T.; Parshina, E.; Ovsiannikova, N.; Popov, V.; Bagrov, D.; Minin, A.A.; Sokolova, O.S. The Role of Vimentin in Directional Migration of Rat Fibroblasts. Cytoskeleton 2019, 76, 467–476. [CrossRef] 26. Erster, O.; Liscovitch, M. A modified inverse PCR procedure for insertion, deletion, or replacement of a DNA fragment in a target sequence and its application in the ligand interaction scan method for generation of ligand-regulated proteins. Methods Mol. Biol. 2010, 634, 157–174.

Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional aﬃliations.

© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).