DOCSLIB.ORG

Oligonucleotide Microarray Analysis of Distinct Gene Expression Patterns in Colorectal Cancer Tissues Harboring BRAF and K-Ras Mutations

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Oligonucleotide Microarray Analysis of Distinct Gene Expression Patterns in Colorectal Cancer Tissues Harboring BRAF and K-Ras Mutations Carcinogenesis vol.27 no.3 pp.392–404, 2006 doi:10.1093/carcin/bgi237 Advance Access publication October 11, 2005 Oligonucleotide microarray analysis of distinct gene expression patterns in colorectal cancer tissues harboring BRAF and K-ras mutations Il-Jin Kim1,y, Hio Chung Kang1,2,y, Sang-Geun Jang1, Introduction Kun Kim1, Sun-A Ahn1, Hyun-Ju Yoon1, Sang Nam Yoon3 and Jae-Gahb Park1,2,3,Ã Colorectal cancer (CRC) is an important human cancer, and incidence rates of this cancer are increasing in Asian countries 1 Korean Hereditary Tumor Registry, Cancer Research Institute and such as Korea (1). CRC development is a multi-step process Downloaded from https://academic.oup.com/carcin/article/27/3/392/2476120 by guest on 27 September 2021 Cancer Research Center, Seoul National University, Seoul, Korea, (2) involving microsatellite instability (MSI), mutations in 2Research Institute and Hospital, National Cancer Center, 809 Madu-dong, Ilsan-gu, Goyang, Gyeonggi 411-764, Korea mismatch repair (MMR) of genes such as MLH1 and MSH2, and 3Department of Surgery, Seoul National University College of and mutations in APC, SMAD4,K-ras, TP53 and b-catenin Medicine, Seoul, Korea (2–9). Somatic BRAF mutations have been reported in ÃTo whom correspondence should be addressed. 5.1–18% of CRCs (10–12). BRAF is one of three serine/ E-mail: [email protected] threonine kinases (ARAF, BRAF, CRAF/RAF1) that act within Various types of human cancers harbor BRAF somatic the RAS–RAF–MEK–ERK–MAPK signaling pathway (13). mutations, leading researchers to seek molecular targets BRAF mutations have also been reported in 80% of primary for BRAF inhibitors. A mutually exclusive relationship melanomas (10), 68% of metastatic melanomas (14) and has been observed between the BRAF-V600E mutation 14–33% of ovarian carcinomas (10,15). Interestingly, a mutu- and K-ras mutations, suggesting that the BRAF-V600E ally exclusive relationship between the BRAF-V600E muta- mutation may differ from the other BRAF mutant types. tion and K-ras mutations has been found in most human Here, we used microarray analysis to examine differences cancers (10,12,16). In CRCs, BRAF-V600E mutations between the BRAF and K-ras mutant colorectal samples appeared to be associated with MMR deficiency and were and within the BRAF group (V600E versus non-V600E), not found in samples with K-ras mutations (12). This suggests in the hope that the identified gene sets could form the that the BRAF-V600E and K-ras mutations may have equival- basis for new target development. Eleven colorectal can- ent effects on tumorigenesis (12). However, other studies have cers (CRCs) with BRAF mutations and nine with K-ras shown that BRAF mutations were associated with MLH1 mutations were examined by high-density microarray promoter methylation but not MMR deficiency (17–19). analysis. We also tested whether other significant genetic Moreover, BRAF mutations were not found in MMR-deficient or clinical status involved in CRC development, such as hereditary non-polyposis colorectal cancer (HNPCC) samples APC and TP53 mutations, MSI and TNM-Duke’s staging, (18,19) but were found in sporadic CRCs, suggesting that were related with the observed BRAF-orK-ras associated BRAF may be involved in the carcinogenesis of non- expression profiles. Unsupervised two-way hierarchical inheritable CRCs (18,19). This is unexpected because it was clustering and multidimensional scaling revealed that believed that MMR-deficient phenotypes were associated with the differentially expressed genes clustered according to both sporadic and hereditary CRCs (18). Thus, researchers the mutation status of BRAF and K-ras, and that postulated that HNPCC patients could be screened for BRAF samples with the BRAF-V600E and non-V600E mutants mutations prior to MMR gene screening, as a weed-out tech- could be distinguished from each other by gene profiling. nique (18). Finally, BRAF mutations have been closely correl- Examination of TNM–Duke’s staging, MSI and mutations ated with methylator phenotypes in several genes including in APC and TP53 revealed that these significant muta- MLH1 (20), and BRAF mutations have been associated with tions could not account for the hierarchical clustering longer disease-free survival and a shorter duration of response results observed in our study. We herein identified to treatment was reported (21). Collectively, these observa- distinct gene expression patterns and gene sets that may tions seem to indicate that BRAF mutations could be used as form the basis for identification of BRAF-targeting therapeutic markers (18,20,21) and/or could be molecularly molecules or provide researchers with a better understand- targeted for development of new anticancer strategies. ing of the molecular pathogenesis underlying RAS–RAF A good example for molecularly targeted anti-cancer drug is signaling. imatinib (formerly STI-571), which inhibits the BCR–ABL kinase in chronic myeloid leukemia and KIT in gastrointestinal stromal tumors (GIST) (22). In fact, several candidate molecu- lar BRAF inhibitors have entered clinical trials (23,24). However, the V600E BRAF mutation clearly differs from the non-V600E BRAF mutations (10) in that V600E is independ- Abbreviations: CRC, colorectal cancer; GIST, gastrointestinal stromal ent of Ras signaling and elevates basal kinase activity without tumors; HNPCC, hereditary non-polyposis colorectal cancer; LOOCV, leave-one-out cross validation; MDS, multidimensional scaling; MMP1, K-ras mutations (10), while the non-V600E BRAF mutations matrix metalloproteinase 1; MMR, mismatch repair; MSI, microsatellite are Ras-dependent and are not mutually exclusive with K-ras instability; PAM, prediction analysis of microarrays; ROC, receiver operating mutations (10). As the V600E mutation accounts for 80% of characteristic; SPRED2, sprouty-related, EVH1 domain containing 2. all BRAF mutations (10), it would seem logical to search for yThese authors contributed equally to this work. V600E-specific molecular inhibitors. Carcinogenesis vol.27 no.3 # Oxford University Press 2005; all rights reserved. 392 Microarray analysis of CRCs with BRAF and K-ras mutations Microarray analysis is commonly used to screen genome- samples were run on an ABI 3100 sequencer (Applied Biosystems), and the wide gene expression profiles in human diseases, including Genescan software (Genotyper 2.1, ABI, Foster City, CA) was used to calcu- cancers (25–27). This technique can also be used to identify late the size of each fluorescent PCR product for MSI determination (38). new cancer subgroups (class discovery), to classify samples Sample hybridization using oligonucleotide microarrays into known cancer subgroups (class prediction) (28) and to The microarray experiments were performed according to our previous experi- predict the prognosis or therapeutic responsiveness of cancer mental protocol (39) with the addition of 10% DMSO (dimethyl sulfoxide) to patients (29,30). A previous microarray study revealed distinct the hybridization mixture. Briefly, the extracted total RNA was quantified by spectrophotometer (Beckman Coulter, Fullerton, CA), checked by 1% agarose gene expression patterns in BRCA1/2 mutant tissues sampled gel electrophoresis and then purified with an RNeasy kit (Qiagen, Valencia, from hereditary ovarian/breast cancer patients versus the non- CA). An aliquot of 40 ml of purified RNA was ethanol-precipitated with 3 M mutant group (BRCAx) (31,32). In CRCs, microarray analysis sodium acetate (pH 5.2), 1 ml of glycogen (5 mg/ml) and 100 ml of 100% was used to divide samples into two groups based on the ice-cold ethanol, and 20 mg of purified RNA was used to synthesize double- existence of MSI, which is an important marker in CRC (33). strand cDNAs using SuperScript II reverse transcriptase (Life Technologies, Rockville, MD) and an HPLC-purified T7-(dT)24 primer (Metabion, Germany). Recently, BRAF mutant melanoma samples were distinguished The synthesized double-strand cDNA was purified with a Qiagen DNA puri- from BRAF wild-type samples by supervised microarray ana- fication kit (Qiagen) and ethanol-precipitated with 1 ml of glycogen, 20 ml Downloaded from https://academic.oup.com/carcin/article/27/3/392/2476120 by guest on 27 September 2021 lysis (34), suggesting that gene expression profiling according of 7.5 M of ammonium acetate, and 100 ml of 100% ethanol. Biotinylated to BRAF status might be useful for the identification of cRNA was synthesized from the double-stranded cDNA using the GeneChip Expression 30-Amplification Reagents (Affymetrix), and then purified and molecular markers involved in RAS–RAS–MEK–ERK– fragmented. The fragmented cRNA was quantified, and 10 mg of cRNA was MAPK signaling. However, no previous work has used hybridized to the oligonucleotide microarray, which was subsequently washed microarray analysis to investigate the molecular differences and stained with streptavidin-phycoerythrin. Scanning was performed with an among samples with BRAF-V600E and non-V600E mutations, Affymetrix Scanner (Affymetrix). and K-ras mutations. Microarray data analysis Here, we examined whether microarray analysis was The scanned GeneChip data were analyzed with the GCOS 1.1 (GeneChip capable of distinguishing colorectal samples according to Operating Software, Affymetrix) and DMT 3.0 (Data Mining Tool, Affymet- BRAF and K-ras mutation status. Once these divisions were rix) programs. All genes present on the GeneChip were globally normalized established, we tested whether other significant genetic and adjusted to a user-specific target signal value (500). The Universal Human Reference RNA (Stratagene) sample was also hybridized to the microarray, changes involved in CRC development, such as APC and and its values served as the base line (control) for calculating the signal log TP53 mutations, MSI and TNM-Duke’s staging, were related ratios in the 20 CRC samples. After normalization, the present calls (P-calls) with the observed BRAF-orK-ras-associated expression generated by the DMT software were calculated for each gene in the 20 profiles. samples. Probes without a P-call from any of 20 samples were excluded from the analysis and 16 332 probes were left.
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Gene Symbol Gene Description ACVR1B Activin a Receptor, Type IB
    Table S1. Kinase clones included in human kinase cDNA library for yeast two-hybrid screening Gene Symbol Gene Description ACVR1B activin A receptor, type IB ADCK2 aarF domain containing kinase 2 ADCK4 aarF domain containing kinase 4 AGK multiple substrate lipid kinase;MULK AK1 adenylate kinase 1 AK3 adenylate kinase 3 like 1 AK3L1 adenylate kinase 3 ALDH18A1 aldehyde dehydrogenase 18 family, member A1;ALDH18A1 ALK anaplastic lymphoma kinase (Ki-1) ALPK1 alpha-kinase 1 ALPK2 alpha-kinase 2 AMHR2 anti-Mullerian hormone receptor, type II ARAF v-raf murine sarcoma 3611 viral oncogene homolog 1 ARSG arylsulfatase G;ARSG AURKB aurora kinase B AURKC aurora kinase C BCKDK branched chain alpha-ketoacid dehydrogenase kinase BMPR1A bone morphogenetic protein receptor, type IA BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) BRAF v-raf murine sarcoma viral oncogene homolog B1 BRD3 bromodomain containing 3 BRD4 bromodomain containing 4 BTK Bruton agammaglobulinemia tyrosine kinase BUB1 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) BUB1B BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast) C9orf98 chromosome 9 open reading frame 98;C9orf98 CABC1 chaperone, ABC1 activity of bc1 complex like (S. pombe) CALM1 calmodulin 1 (phosphorylase kinase, delta) CALM2 calmodulin 2 (phosphorylase kinase, delta) CALM3 calmodulin 3 (phosphorylase kinase, delta) CAMK1 calcium/calmodulin-dependent protein kinase I CAMK2A calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha CAMK2B calcium/calmodulin-dependent
    [Show full text]
  • Reframing Psychiatry for Precision Medicine
    Reframing Psychiatry for Precision Medicine Elizabeth B Torres 1,2,3* 1 Rutgers University Department of Psychology; [email protected] 2 Rutgers University Center for Cognitive Science (RUCCS) 3 Rutgers University Computer Science, Center for Biomedicine Imaging and Modelling (CBIM) * Correspondence: [email protected]; Tel.: (011) +858-445-8909 (E.B.T) Supplementary Material Sample Psychological criteria that sidelines sensory motor issues in autism: The ADOS-2 manual [1, 2], under the “Guidelines for Selecting a Module” section states (emphasis added): “Note that the ADOS-2 was developed for and standardized using populations of children and adults without significant sensory and motor impairments. Standardized use of any ADOS-2 module presumes that the individual can walk independently and is free of visual or hearing impairments that could potentially interfere with use of the materials or participation in specific tasks.” Sample Psychiatric criteria from the DSM-5 [3] that does not include sensory-motor issues: A. Persistent deficits in social communication and social interaction across multiple contexts, as manifested by the following, currently or by history (examples are illustrative, not exhaustive, see text): 1. Deficits in social-emotional reciprocity, ranging, for example, from abnormal social approach and failure of normal back-and-forth conversation; to reduced sharing of interests, emotions, or affect; to failure to initiate or respond to social interactions. 2. Deficits in nonverbal communicative behaviors used for social interaction, ranging, for example, from poorly integrated verbal and nonverbal communication; to abnormalities in eye contact and body language or deficits in understanding and use of gestures; to a total lack of facial expressions and nonverbal communication.
    [Show full text]
  • Profiling Data
    Compound Name DiscoveRx Gene Symbol Entrez Gene Percent Compound Symbol Control Concentration (nM) JNK-IN-8 AAK1 AAK1 69 1000 JNK-IN-8 ABL1(E255K)-phosphorylated ABL1 100 1000 JNK-IN-8 ABL1(F317I)-nonphosphorylated ABL1 87 1000 JNK-IN-8 ABL1(F317I)-phosphorylated ABL1 100 1000 JNK-IN-8 ABL1(F317L)-nonphosphorylated ABL1 65 1000 JNK-IN-8 ABL1(F317L)-phosphorylated ABL1 61 1000 JNK-IN-8 ABL1(H396P)-nonphosphorylated ABL1 42 1000 JNK-IN-8 ABL1(H396P)-phosphorylated ABL1 60 1000 JNK-IN-8 ABL1(M351T)-phosphorylated ABL1 81 1000 JNK-IN-8 ABL1(Q252H)-nonphosphorylated ABL1 100 1000 JNK-IN-8 ABL1(Q252H)-phosphorylated ABL1 56 1000 JNK-IN-8 ABL1(T315I)-nonphosphorylated ABL1 100 1000 JNK-IN-8 ABL1(T315I)-phosphorylated ABL1 92 1000 JNK-IN-8 ABL1(Y253F)-phosphorylated ABL1 71 1000 JNK-IN-8 ABL1-nonphosphorylated ABL1 97 1000 JNK-IN-8 ABL1-phosphorylated ABL1 100 1000 JNK-IN-8 ABL2 ABL2 97 1000 JNK-IN-8 ACVR1 ACVR1 100 1000 JNK-IN-8 ACVR1B ACVR1B 88 1000 JNK-IN-8 ACVR2A ACVR2A 100 1000 JNK-IN-8 ACVR2B ACVR2B 100 1000 JNK-IN-8 ACVRL1 ACVRL1 96 1000 JNK-IN-8 ADCK3 CABC1 100 1000 JNK-IN-8 ADCK4 ADCK4 93 1000 JNK-IN-8 AKT1 AKT1 100 1000 JNK-IN-8 AKT2 AKT2 100 1000 JNK-IN-8 AKT3 AKT3 100 1000 JNK-IN-8 ALK ALK 85 1000 JNK-IN-8 AMPK-alpha1 PRKAA1 100 1000 JNK-IN-8 AMPK-alpha2 PRKAA2 84 1000 JNK-IN-8 ANKK1 ANKK1 75 1000 JNK-IN-8 ARK5 NUAK1 100 1000 JNK-IN-8 ASK1 MAP3K5 100 1000 JNK-IN-8 ASK2 MAP3K6 93 1000 JNK-IN-8 AURKA AURKA 100 1000 JNK-IN-8 AURKA AURKA 84 1000 JNK-IN-8 AURKB AURKB 83 1000 JNK-IN-8 AURKB AURKB 96 1000 JNK-IN-8 AURKC AURKC 95 1000 JNK-IN-8
    [Show full text]
  • TSPY and Its X-Encoded Homologue Interact with Cyclin B but Exert Contrasting Functions on Cyclin-Dependent Kinase 1 Activities
    Oncogene (2008) 27, 6141–6150 & 2008 Macmillan Publishers Limited All rights reserved 0950-9232/08 $32.00 www.nature.com/onc ORIGINAL ARTICLE TSPY and its X-encoded homologue interact with cyclin B but exert contrasting functions on cyclin-dependent kinase 1 activities Y Li and Y-F Chris Lau Department of Medicine, VA Medical Center, University of California, San Francisco, San Francisco, CA, USA Testis-specific protein Y-encoded (TSPY) is the putative in XY sex-reversed patients and intersex individuals to gene for the gonadoblastoma locus on the Y chromosome gonadoblastoma development (Page, 1987; Lau, 1999). (GBY). TSPY and an X-homologue, TSPX, harbor a The 2.8-kbTSPY transcriptional unit is embedded in a conserved domain, designated as SET/NAP domain, but 20.4-kbDNA fragment that is repeated tandemly at the differ at their C termini. Ectopic expression of TSPY critical region for GBY on the short arm, proximal to accelerates cell proliferation byabbreviating the G 2/M the centromere, of the human Y chromosome (Skaletsky stage, whereas overexpression of TSPX retards cells et al., 2003). The number of TSPY repeats varies from at the same stage of the cell cycle. Previous studies B23 to 64 among phenotypically normal individual demonstrated that the SET oncoprotein is capable males (Repping et al., 2006), but could change under of binding to cyclin B. Using various protein interaction certain disease conditions (Vijayakumar et al., 2006), techniques, we demonstrated that TSPY and TSPX suggesting the possibility of genomic instability in this indeed bind competitivelyto cyclinB at their SET/NAP region of the chromosome.
    [Show full text]
  • 14-3-3 Proteins Inactivate DAPK2 by Promoting Its Dimerization And
    ARTICLE https://doi.org/10.1038/s42003-021-02518-y OPEN 14-3-3 proteins inactivate DAPK2 by promoting its dimerization and protecting key regulatory phosphosites ✉ ✉ Matej Horvath 1,2, Olivia Petrvalska1,2, Petr Herman 3, Veronika Obsilova 2 & Tomas Obsil 1,2 Death-associated protein kinase 2 (DAPK2) is a CaM-regulated Ser/Thr protein kinase, involved in apoptosis, autophagy, granulocyte differentiation and motility regulation, whose activity is controlled by autoinhibition, autophosphorylation, dimerization and interaction with scaffolding proteins 14-3-3. However, the structural basis of 14-3-3-mediated DAPK2 reg- ulation remains unclear. Here, we structurally and biochemically characterize the full-length 1234567890():,; human DAPK2:14-3-3 complex by combining several biophysical techniques. The results from our X-ray crystallographic analysis revealed that Thr369 phosphorylation at the DAPK2 C terminus creates a high-affinity canonical mode III 14-3-3-binding motif, further enhanced by the diterpene glycoside Fusicoccin A. Moreover, concentration-dependent DAPK2 dimerization is disrupted by Ca2+/CaM binding and stabilized by 14-3-3 binding in solution, thereby protecting the DAPK2 inhibitory autophosphorylation site Ser318 against depho- sphorylation and preventing Ca2+/CaM binding. Overall, our findings provide mechanistic insights into 14-3-3-mediated DAPK2 inhibition and highlight the potential of the DAPK2:14- 3-3 complex as a target for anti‐inflammatory therapies. 1 Department of Physical and Macromolecular Chemistry, Faculty of Science, Charles University, Prague, Czech Republic. 2 Department of Structural Biology of Signaling Proteins, Division BIOCEV, Institute of Physiology of the Czech Academy of Sciences, Vestec, Czech Republic. 3 Institute of Physics, Faculty of ✉ Mathematics and Physics, Charles University, Prague, Czech Republic.
    [Show full text]
  • (P -Value<0.05, Fold Change≥1.4), 4 Vs. 0 Gy Irradiation
    Table S1: Significant differentially expressed genes (P -Value<0.05, Fold Change≥1.4), 4 vs. 0 Gy irradiation Genbank Fold Change P -Value Gene Symbol Description Accession Q9F8M7_CARHY (Q9F8M7) DTDP-glucose 4,6-dehydratase (Fragment), partial (9%) 6.70 0.017399678 THC2699065 [THC2719287] 5.53 0.003379195 BC013657 BC013657 Homo sapiens cDNA clone IMAGE:4152983, partial cds. [BC013657] 5.10 0.024641735 THC2750781 Ciliary dynein heavy chain 5 (Axonemal beta dynein heavy chain 5) (HL1). 4.07 0.04353262 DNAH5 [Source:Uniprot/SWISSPROT;Acc:Q8TE73] [ENST00000382416] 3.81 0.002855909 NM_145263 SPATA18 Homo sapiens spermatogenesis associated 18 homolog (rat) (SPATA18), mRNA [NM_145263] AA418814 zw01a02.s1 Soares_NhHMPu_S1 Homo sapiens cDNA clone IMAGE:767978 3', 3.69 0.03203913 AA418814 AA418814 mRNA sequence [AA418814] AL356953 leucine-rich repeat-containing G protein-coupled receptor 6 {Homo sapiens} (exp=0; 3.63 0.0277936 THC2705989 wgp=1; cg=0), partial (4%) [THC2752981] AA484677 ne64a07.s1 NCI_CGAP_Alv1 Homo sapiens cDNA clone IMAGE:909012, mRNA 3.63 0.027098073 AA484677 AA484677 sequence [AA484677] oe06h09.s1 NCI_CGAP_Ov2 Homo sapiens cDNA clone IMAGE:1385153, mRNA sequence 3.48 0.04468495 AA837799 AA837799 [AA837799] Homo sapiens hypothetical protein LOC340109, mRNA (cDNA clone IMAGE:5578073), partial 3.27 0.031178378 BC039509 LOC643401 cds. [BC039509] Homo sapiens Fas (TNF receptor superfamily, member 6) (FAS), transcript variant 1, mRNA 3.24 0.022156298 NM_000043 FAS [NM_000043] 3.20 0.021043295 A_32_P125056 BF803942 CM2-CI0135-021100-477-g08 CI0135 Homo sapiens cDNA, mRNA sequence 3.04 0.043389246 BF803942 BF803942 [BF803942] 3.03 0.002430239 NM_015920 RPS27L Homo sapiens ribosomal protein S27-like (RPS27L), mRNA [NM_015920] Homo sapiens tumor necrosis factor receptor superfamily, member 10c, decoy without an 2.98 0.021202829 NM_003841 TNFRSF10C intracellular domain (TNFRSF10C), mRNA [NM_003841] 2.97 0.03243901 AB002384 C6orf32 Homo sapiens mRNA for KIAA0386 gene, partial cds.
    [Show full text]
  • Stroke Genetics and Genomics
    Faculdade de Medicina da Universidade de Lisboa Unidade Neurológica de Investigação Clínica PhD Thesis Stroke Genetics and Genomics Tiago Krug Coelho Host Institution: Instituto Gulbenkian de Ciência Supervisor at Instituto Gulbenkian de Ciência: Doctor Sofia Oliveira Supervisor at Faculdade de Medicina da Universidade de Lisboa: Professor José Ferro PhD in Biomedical Sciences Specialization in Neurosciences 2010 Stroke Genetics and Genomics A ciência tem, de facto, um único objectivo: a verdade. Não esgota perfeitamente a sua tarefa se não descobre a causa do todo. Chiara Lubich i Stroke Genetics and Genomics ii Stroke Genetics and Genomics A impressão desta dissertação foi aprovada pela Comissão Coordenadora do Conselho Científico da Faculdade de Medicina de Lisboa em reunião de 28 de Setembro de 2010. iii Stroke Genetics and Genomics iv Stroke Genetics and Genomics As opiniões expressas são da exclusiva responsabilidade do seu autor. v Stroke Genetics and Genomics vi Stroke Genetics and Genomics Abstract ABSTRACT This project presents a comprehensive approach to the identification of new genes that influence the risk for developing stroke. Stroke is the leading cause of death in Portugal and the third leading cause of death in the developed world. It is even more disabling than lethal, and the persistent neurological impairment and physical disability caused by stroke have a very high socioeconomic cost. Moreover, the number of affected individuals is expected to increase with the current aging of the population. Stroke is a “brain attack” cutting off vital blood and oxygen to the brain cells and it is a complex disease resulting from environmental and genetic factors.
    [Show full text]
  • The Role of Hnrnps in Frontotemporal Dementia and Amyotrophic Lateral Sclerosis
    Acta Neuropathologica https://doi.org/10.1007/s00401-020-02203-0 REVIEW The role of hnRNPs in frontotemporal dementia and amyotrophic lateral sclerosis Alexander Bampton1,2 · Lauren M. Gittings3 · Pietro Fratta4 · Tammaryn Lashley1,2 · Ariana Gatt1,2 Received: 25 June 2020 / Revised: 27 July 2020 / Accepted: 27 July 2020 © The Author(s) 2020 Abstract Dysregulated RNA metabolism is emerging as a crucially important mechanism underpinning the pathogenesis of fron- totemporal dementia (FTD) and the clinically, genetically and pathologically overlapping disorder of amyotrophic lateral sclerosis (ALS). Heterogeneous nuclear ribonucleoproteins (hnRNPs) comprise a family of RNA-binding proteins with diverse, multi-functional roles across all aspects of mRNA processing. The role of these proteins in neurodegeneration is far from understood. Here, we review some of the unifying mechanisms by which hnRNPs have been directly or indirectly linked with FTD/ALS pathogenesis, including their incorporation into pathological inclusions and their best-known roles in pre-mRNA splicing regulation. We also discuss the broader functionalities of hnRNPs including their roles in cryptic exon repression, stress granule assembly and in co-ordinating the DNA damage response, which are all emerging patho- genic themes in both diseases. We then present an integrated model that depicts how a broad-ranging network of pathogenic events can arise from declining levels of functional hnRNPs that are inadequately compensated for by autoregulatory means. Finally, we provide a comprehensive overview of the most functionally relevant cellular roles, in the context of FTD/ALS pathogenesis, for hnRNPs A1-U. Keywords hnRNP · Frontotemporal dementia · Amyotrophic lateral sclerosis · RNA · Autoregulation Introduction RNA and protein homeostasis have been identifed as con- verging mechanisms of neurotoxicity in both disorders.
    [Show full text]
  • Genetically Modified Macrophages and Renal Regeneration
    Genetically Modified Macrophages and Renal Regeneration Chrysoula Mastora ADVERTIMENT. La consulta d’aquesta tesi queda condicionada a l’acceptació de les següents condicions d'ús: La difusió d’aquesta tesi per mitjà del servei TDX (www.tdx.cat) i a través del Dipòsit Digital de la UB (diposit.ub.edu) ha estat autoritzada pels titulars dels drets de propietat intel·lectual únicament per a usos privats emmarcats en activitats d’investigació i docència. No s’autoritza la seva reproducció amb finalitats de lucre ni la seva difusió i posada a disposició des d’un lloc aliè al servei TDX ni al Dipòsit Digital de la UB. No s’autoritza la presentació del seu contingut en una finestra o marc aliè a TDX o al Dipòsit Digital de la UB (framing). Aquesta reserva de drets afecta tant al resum de presentació de la tesi com als seus continguts. En la utilització o cita de parts de la tesi és obligat indicar el nom de la persona autora. ADVERTENCIA. La consulta de esta tesis queda condicionada a la aceptación de las siguientes condiciones de uso: La difusión de esta tesis por medio del servicio TDR (www.tdx.cat) y a través del Repositorio Digital de la UB (diposit.ub.edu) ha sido autorizada por los titulares de los derechos de propiedad intelectual únicamente para usos privados enmarcados en actividades de investigación y docencia. No se autoriza su reproducción con finalidades de lucro ni su difusión y puesta a disposición desde un sitio ajeno al servicio TDR o al Repositorio Digital de la UB.
    [Show full text]
  • Supplementary Table 1 Genes Tested in Qrt-PCR in Nfpas
    Supplementary Table 1 Genes tested in qRT-PCR in NFPAs Gene Bank accession Gene Description number ABI assay ID a disintegrin-like and metalloprotease with thrombospondin type 1 motif 7 ADAMTS7 NM_014272.3 Hs00276223_m1 Rho guanine nucleotide exchange factor (GEF) 3 ARHGEF3 NM_019555.1 Hs00219609_m1 BCL2-associated X protein BAX NM_004324 House design Bcl-2 binding component 3 BBC3 NM_014417.2 Hs00248075_m1 B-cell CLL/lymphoma 2 BCL2 NM_000633 House design Bone morphogenetic protein 7 BMP7 NM_001719.1 Hs00233476_m1 CCAAT/enhancer binding protein (C/EBP), alpha CEBPA NM_004364.2 Hs00269972_s1 coxsackie virus and adenovirus receptor CXADR NM_001338.3 Hs00154661_m1 Homo sapiens Dicer1, Dcr-1 homolog (Drosophila) (DICER1) DICER1 NM_177438.1 Hs00229023_m1 Homo sapiens dystonin DST NM_015548.2 Hs00156137_m1 fms-related tyrosine kinase 3 FLT3 NM_004119.1 Hs00174690_m1 glutamate receptor, ionotropic, N-methyl D-aspartate 1 GRIN1 NM_000832.4 Hs00609557_m1 high-mobility group box 1 HMGB1 NM_002128.3 Hs01923466_g1 heterogeneous nuclear ribonucleoprotein U HNRPU NM_004501.3 Hs00244919_m1 insulin-like growth factor binding protein 5 IGFBP5 NM_000599.2 Hs00181213_m1 latent transforming growth factor beta binding protein 4 LTBP4 NM_001042544.1 Hs00186025_m1 microtubule-associated protein 1 light chain 3 beta MAP1LC3B NM_022818.3 Hs00797944_s1 matrix metallopeptidase 17 MMP17 NM_016155.4 Hs01108847_m1 myosin VA MYO5A NM_000259.1 Hs00165309_m1 Homo sapiens nuclear factor (erythroid-derived 2)-like 1 NFE2L1 NM_003204.1 Hs00231457_m1 oxoglutarate (alpha-ketoglutarate)
    [Show full text]
  • Characterization of Intellectual Disability and Autism Comorbidity Through Gene Panel Sequencing
    bioRxiv preprint doi: https://doi.org/10.1101/545772; this version posted February 10, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Characterization of Intellectual disability and Autism comorbidity through gene panel sequencing Maria Cristina Aspromonte 1, 2, Mariagrazia Bellini 1, 2, Alessandra Gasparini 3, Marco Carraro 3, Elisa Bettella 1, 2, Roberta Polli 1, 2, Federica Cesca 1, 2, Stefania Bigoni 4, Stefania Boni 5, Ombretta Carlet 6, Susanna Negrin 6, Isabella Mammi 7, Donatella Milani 8 , Angela Peron 9, 10, Stefano Sartori 11, Irene Toldo 11, Fiorenza Soli 12, Licia Turolla 13, Franco Stanzial 14, Francesco Benedicenti 14, Cristina Marino-Buslje 15, Silvio C.E. Tosatto 3, 16, Alessandra Murgia 1, 2, Emanuela Leonardi 1, 2 1. Molecular Genetics of Neurodevelopment, Dept. of Woman and Child Health, University of Padova, Padova, Italy 2. Fondazione Istituto di Ricerca Pediatrica (IRP), Città della Speranza, Padova, Italy 3. Dept. of Biomedical Sciences, University of Padova, Padova, Italy 4. Medical Genetics Unit, Ospedale Universitario S. Anna, Ferrara, Italy 5. Medical Genetics Unit, S. Martino Hospital, Belluno, Italy 6. Child Neuropsychiatry Unit, IRCCS Eugenio Medea, Conegliano, Italy 7. Medical Genetics Unit, Dolo General Hospital, Venezia, Italy 8. Pediatric Highly Intensive Care Unit, Department of Pathophysiology and Transplantation, University of Milano, Fondazione IRCCS, Ca' Granda Ospedale Maggiore Policlinico, Milan, Italy 9. Child Neuropsychiatry Unit, Epilepsy Center, Santi Paolo-Carlo Hospital, Dept. of Health Sciences, University of Milano, Milano, Italy 10. Department of Pediatrics, Division of Medical Genetics, University of Utah School of Medicine, Salt Lake City, UT, USA 11.
    [Show full text]