Effect of MMP/ADAM Inhibitors on Goblet Cell Hyperplasia in Cultured Human Bronchial Epithelial Cells

Biosci. Biotechnol. Biochem., 68 (10), 2024–2031, 2004

Effect of MMP/ADAM Inhibitors on Goblet Cell Hyperplasia in Cultured Human Bronchial Epithelial Cells

y Hajime YOSHISUE and Kazuhide HASEGAWA

Pharmaceutical Research Laboratories, Kyowa Hakko Kogyo Co., Ltd., 1188 Shimotogari, Nagaizumi, Sunto, Shizuoka 411-8731, Japan

Received February 2, 2004; Accepted June 24, 2004

While epidermal growth factor receptor (EGFR) combination of goblet and ciliated cells plays a critical plays a pivotal role in the repair process of epithelial role in the body’s defense against inhaled particles and cells, it is also involved in the overproduction of mucus noxious substances.1) In the healthy lung, ciliated cells and goblet cell hyperplasia (GCH), which occurs in predominate in the conducting airways, representing chronic airway diseases such as asthma. Among the more than 80% of the total epithelial cell population, EGFR ligands, transforming growth factor (TGF)- is and are interspersed with goblet cells, but in chronic thought to be the most important in the synthesis of airway diseases such as asthma, cystic fibrosis, and mucus. Pro-TGF- is cleaved to give an active form by chronic bronchitis, the number of goblet cells increases. members of the matrix metalloproteinases (MMP)/a This is termed goblet cell hyperplasia (GCH).2–5) It disintegrin and metalloproteinases (ADAM) family. results in accelerated production and/or secretion of Thus MMP/ADAM inhibitors might prevent GCH by mucus, which in turn causes resistance to air flow and inhibiting transactivation of EGFR. Upon stimulation of abrogates normal mucociliary function. The consequen- differentiating normal human bronchial epithelial ces of these changes include increased sputum produc- (NHBE) cells by IL-13, GCH was induced. The mucin tion, airway narrowing, exacerbation, and asphyxiation genes MUC5AC, MUC5B, and MUC2 were upregulated in the case of fatal asthma attacks.2) Despite the severity whereas the expression of ciliated cell markers was of the clinical manifestations, the molecular mechanisms greatly repressed. GM6001, a broad-spectrum inhibitor underlining GCH remain poorly understood. for MMP/ADAM, inhibited IL-13-induced mucin gene It is well known that type 2 CD4þ T helper expression and mucus production as measured by lymphocytes (Th2 cells) play an important role in the periodic acid-Schiff staining. This was accompanied by pathogenesis of asthma. Among various cytokines an inhibition of TGF- release. These results suggest produced from Th2 cells, interleukin (IL)-13 is thought that MMP/ADAMs play a pivotal role in the develop- to be the most important, based on reports that intra- ment of GCH in lung epithelial cells. tracheal instillation of IL-13 causes bronchial hyper- responsiveness (BHR) and GCH, which can be blocked Key words: asthma; bronchial epithelial cells; matrix using a soluble form of IL-13 receptor alpha 2.6,7) metalloproteinase (MMP); mucin; trans- Recently Kuperman et al. have used genetically modi- forming growth factor- (TGF-) fied mice in which the expression of signal transducer and activator of transcription 6, an essential signalling The bronchial epithelium consists of the surface molecule activated by IL-13, is confined to the bronchial epithelium and mucus glands. The surface epithelium is epithelium, to show that epithelial cells are required and made up of the three principal cell types, basal, goblet, sufficient for IL-13 to induce BHR and GCH.8) The and ciliated cells, of which the latter two form a importance of IL-13 in GCH is supported by in vitro suprabasal columnar structure and are necessary for studies showing that direct stimulation of primary lung mucociliary clearance. The apical surface of columnar epithelial cells by IL-13 causes an increase in the cells is exposed to the airway lumen and is covered with population of goblet cells compared to ciliated cells.9,10) a protective mucus layer composed mainly of mucin Epidermal growth factor receptor (EGFR) is known to glycoproteins that are produced by goblet cells. Cilia be involved in GCH and mucus production. Takeyama propel mucus in order to clear trapped debris in the et al. showed that intratracheal instillation of trans- mucus from the airway to the pharynx. Thus the forming growth factor (TGF)-, one of the EGFR

y To whom correspondence should be addressed. Present address: Infection, Inflammation and Repair Division, School of Medicine, Southampton General Hospital, Tremona Road, Southampton, SO16 6YD, United Kingdom; Fax: +44-23-8079-4264; E-mail: [email protected] Abbreviations: ADAM, a disintegrin and metalloproteinase; ALI, air–liquid interface; BHR, bronchial hyperresponsiveness; EGFR, epidermal growth factor receptor; GCH, goblet cell hyperplasia; MMP, matrix metalloproteinase; NHBE, normal human bronchial epithelial; TACE, tumor necrosis factor- converting enzyme; TGF-, transforming growth factor- Effect of MMP/ADAM Inhibitors on Goblet Cell Hyperplasia 2025 ligands, induced GCH, and that pre-treatment with cells were trypsinized and seeded into 6.5 mm, 0.4 m BIBX1522, a selective kinase inhibitor for EGFR, pore size collagen-coated transwell culture inserts prevented not only GCH induced by TGF- but also (Corning Costar, Acton, Massachusetts, U.S.A.) at GCH induced by OVA in a murine model of asthma.11) 2:0 105 cells/well. The cells were grown submerged In addition they used NCI-H292, a human pulmonary in BEGM medium for 1–3 days, until 90–100% mucoepidermoid cell line, to show that stimulation with confluent. The apical medium was then removed to TGF- upregulates expression of the MUC5AC gene, expose the cells to the air–liquid interface, and 300 lof which encodes one of the major mucin proteins in the basal ALI medium was added to bottom wells compris- lung.11) Reports from several independent research ing a mixture of an equal volume of Dulbecco’s groups have indicated that expression of EGFR is Modified Eagle’s Medium (Invitrogen, Carlsbad, Cal- upregulated in the bronchial epithelium of asthmat- ifornia, U.S.A.) and Bronchial Epithelial Basal Medium ics.12,13) (BEBM; Biowhittaker) containing 52 g/ml Bovine Recently Booth et al. used in vitro differentiated lung Pituitary Extract, 5 g/ml insulin, 0.5 ng/ml human epithelial cells on an air–liquid interface (ALI) culture to epidermal growth factor (EGF), 0.5 g/ml hydrocorti- show that stimulation with IL-13 induced epithelial cell sone, 10 g/ml transferrin, 0.5 g/ml epinephrine, growth. This was accompanied by release of the soluble 6.5 ng/ml triiodothyronine, 1.5 g/ml bovine serum form of TGF- into the culture supernatant. Pretreat- albumin (Sigma, St. Louis, Missouri, U.S.A.), and ment with a neutralizing antibody for TGF-, but not 50 nM retinoic acid (Sigma). This basal ALI medium one for EGF or heparin-binding (HB)-EGF, prevented was changed every 1–2 days, and differentiation this IL-13-induced overgrowth. The same inhibitory proceeded in a manner similar to that previously effect was seen with AG1478, a selective kinase described.19) GCH was induced by the addition of IL- inhibitor for EGFR.14) Lordan et al. have recently 13 (Sigma) at a concentration 20 ng/ml in the basal ALI reported that IL-13- or IL-4-stimulated monolayer- medium. This treatment was repeated with every change cultured primary bronchial epithelial cells from asth- of ALI medium. Cells were treated with drugs one hour matics, but not cells from normal subjects, produced before stimulation with IL-13. more TGF- than cells without stimulation.15) These results indicate that in asthma Th2 cytokines released RNA isolation and semi-quantitative RT-PCR analy- from Th2 cells and/or other cells (e.g., mast cells and sis. Total RNA was isolated from monolayer- or ALI- basophiles), especially IL-13, may induce release of the cultured NHBE cells using RNeasy (Qiagen, German- soluble form of TGF- from the lung epithelium, which town, Maryland, U.S.A.), and treated with RNase-free in turn can transactivate EGFR to induce mucin gene DNase I (Qiagen) in order to remove possible contam- expression. ination of chromosomal DNA. cDNAs were synthesized Membrane-bound TGF- is inactive and shed to be an from 1 g of total RNA with SuperScript II Reverse active form by members of the matrix metalloprotei- Transcriptase (Invitrogen) according to the manufactur- nases (MMP)/a disintegrin and metalloproteinases er’s instructions. One eightieth of each cDNA solution (ADAM) protein family. Shedding of TGF- has been was used for each PCR reaction. The PCR regimen shown to be mediated by tumor necrosis factor- consisted of a 94 C, 2 min initial denaturation step converting enzyme (TACE),16) which is indispensable followed by a cycle reaction at 94 C for 1 min, 60 C for for normal lung branching morphogenesis.17) In addi- 1 min, and 72 C for 1 min on GeneAmp PCR System tion, there is evidence to suggest that other members of 9700 (Perkin Elmer, Wellesley, Massachusetts, U.S.A.). the MMP/ADAM family may also be important in TGF- The reaction products were subjected to an agarose gel shedding.18) Thus we hypothesized that inhibition of electrophoresis, stained with SYBR Green I (Takara MMP/ADAM metalloproteinase activity would prevent Shuzo, Shiga, Japan), visualized using LAS-1000plus IL-13-triggered effects on bronchial epithelial cells. (Fujifilm, Tokyo, Japan), and the intensities of the Hence in this study we assessed the effects of MMP amplified fragments were quantified by a software inhibitors on IL-13-induced GCH in vitro. system, Image Gauge Ver. 3.11 (Fujifilm). The appro- priate numbers of PCR cycles for the semiquantitative Materials and Methods analysis were established from the plotting curve of density of each PCR-amplified product. Four independ- Materials. GM6001 was purchased from Calbiochem ent experiments were done in order to gain averaged (San Diego, California, U.S.A.), and marimastat was values with standard deviations. The specific primers synthesized in our laboratories. used are shown in Table 1.

Primary cells on air–liquid interface. Normal human Assessment of mucus production. NHBE cells on ALI bronchial epithelial cells (NHBE) were purchased from culture were suspended in phosphate buffered saline and Biowhittaker (Walkersville, Maryland, U.S.A.) and attached to a slide glass by centrifugation using maintained in Bronchial Epithelial Growth Medium cytospin. After fixation by ethanol, the cells were (BEGM; Biowhittaker). For ALI cultures, passage 2 or 3 subjected to the periodic acid-Schiff (PAS) staining 2026 H. YOSHISUE and K. HASEGAWA Table 1. Primers Used for RT-PCR

Gene Forward primer Reverse primer Base Base (accession) (50 > 30) (50 > 30) MUC5AC TTCTCCGGCCTCATCTTCTCC 1280–1300 CAGACTTGGGCACTGGTGCTG 1945–1965 (U06711) MUC5B GGCCACATCCACCCTTCCAACACG 1094–1117 TCAAGGGGCTCATTGTCGTCTCTG 1324–1347 (Z72496) MUC2 ACAGAGGGCAGAACCCGATACC 100–121 TCCAGCTCCAGCATGAGTGCATC 478–500 (L21998) CLCA1 CTCCCATACCTGATCTCTTCC 2585–2605 GACGTTTCATCAGGACTAGGTG 2972–2993 (NM 001285) CCSP ATGAAACTCGCTGTCACCCTCACC 10–33 TGGGGATCTTCAGCTTCTAAATGC 285–308 (U01101) tektin AGCTGGCTGATCATCTGGCCAAG 940–962 GGATTTCCTCATCTGCATACACAG 1275–1298 (NM 053285.1) foxj1 ATTCTCCATTCTCAACGCCAAGGC 213–236 TTGAATTCTGCCAGGTGGGATCTG 572–595 (U69537) DNAH9 AAGAGCCCTAGATTTTGCAACCTC 11711–11734 CACTCATGAAGACCCTGAACTCTG 12042–12019 (NM 001372) G3PDH CCCATCACCATCTTCCAGGAGC 1096–1117 TTCACCACCTTCTTGATGTCATCATA 1642–1667 (BC014085) using Schiff’s Periodic Acid Staining Kit (Polysciences, Warrington, Pennsylvania, U.S.A.) according to the manufacture’s instructions.

ELISA. Release of TGF- into culture supernatants of the differentiating NHBE cells was measured using an ELISA Kit (Oncogene Research Products, San Diego, California, U.S.A.) according to the manufacture’s instructions. The concentration of TGF- in each sample was determined by a duplicate assay, which was repeated in three independent experiments in order to gain averaged values with standard deviations.

Statistical analysis. Analysis of the data was per- formed by Student’s t test when the variances from the comparing two groups were statistically equal (P > 0:05), or the Aspin-Welch test when they were statistically unequal (P < 0:05). Differences were con- sidered significant at P < 0:05.

Results Fig. 1. Increased Expression of the MUC5AC Gene in NHBE Cells by IL-13. IL-13 induces GCH in NHBE cells on ALI Total RNA was isolated from monolayer-cultured or ALI-differ- To confirm the effect of IL-13 on GCH, we treated entiating NHBE cells for semi-quantitative RT-PCR analysis of differentiating NHBE cells with IL-13 and examined the MUC5AC. PCR cycles were 27 for MUC5AC and 20 for the house- keeping gene glyceraldehyde-3-phosphate dehydrogenase (G3PDH). expression level of the MUC5AC gene, whose product is The data obtained by SYBR Green I staining were quantified and the 20) the major mucin expressed in the lung. Semi-quanti- expression level of the MUC5AC mRNA was normalized to that of tative RT-PCR analysis showed that little or no ex- G3PDH. Results are presented as averaged arbitrary units with pression occurred in monolayer-cultured and ALI-treated standard deviations obtained from three independent experiments. cells at days 1 and 8, although expression was signifi- Comparisons were made using Student’s t test, *P < 0:05; **P < 0:01. cantly upregulated by IL-13 at day 8 (Fig. 1). After 14 days of ALI culture, expression of MUC5AC was clearly upregulated upon stimulation with IL-13 (Fig. 1), which markers. Figure 2 shows that additional mucin genes, led us to examine the expression of other goblet cell MUC5B and MUC2, were also transcriptionally upregu- Effect of MMP/ADAM Inhibitors on Goblet Cell Hyperplasia 2027

Fig. 2. Effect of GM6001 (A–K) or Marimastat (L–N) on Expression of Epithelial Genes during Mucocilia Differentiation Modulated by IL-13. NHBE cells on ALI culture were treated by GM6001 at a concentration of 4 M (3) or 40 M (4), marimastat at 1 M (5) or 10 M (6), or DMSO (1 and 2), followed by the addition of IL-13 (2–6) at a concentration of 20 ng/ml after one h. This treatment was repeated every day for 14 d, and total RNA was isolated from the cells for semi-quantitative RT-PCR analysis using specific primers for MUC5AC (C), MUC5B (D, M), MUC2 (E), CLCA1 (F), CCSP (G), tektin (H), foxj1 (I), DNAH9 (J), and G3PDH (K, N). For quantification, PCR cycles were 27 for MUC5AC and MUC5B and 20 for G3PDH. The data obtained by SYBR Green I staining were quantified and the expression level of MUC5AC or MUC5B was normalized to that of G3PDH (A, B, L). The results are presented as averaged arbitrary units with standard deviations obtained from four independent experiments. Comparisons were made using Student’s t test, **P < 0:01; ***P < 0:001, or the Aspin-Welch test, $P < 0:05. NS, not significant. The PCR cycles used for the other genes are as follows: 33 for MUC2, 25 for CCSP, and 35 for CLCA1, tektin, foxj1, and DNAH9. lated by IL-13 at day 14 (Fig. 2D, E). In addition, the that IL-13 increased the population of granulated mRNA of the calcium-activated chloride channel (mature) goblet cells and accordingly decreased the ratio (CLCA1), which has been reported to be expressed in of nongranulated secretory cells. goblet cells,21) was abundant in IL-13-stimulated cells whereas it was negligible in untreated cells (Fig. 2F). In MMP inhibitors prevent GCH contrast, the expression of tektin, foxj1 (hepatocyte In order to investigate the role MMP/ADAMs play in nuclear factor-3/forkhead homolog 4), and DNAH9 GCH, we treated the ALI-differentiating NHBE cells (dynein, axonemal, heavy polypeptide 9), marker genes with a prototype inhibitor of MMP/ADAMs, GM6001 for ciliated cells, was dramatically repressed by IL-13 or marimastat. Pretreatment with GM6001, a broad- treatment (Fig. 2H–J). This indicates that, as reported spectrum inhibitor of MMP/ADAMs, at a concentration previously, IL-13 modulates the differentiation process of 40 M, clearly abrogated upregulation of three mucin of bronchial epithelial cells to deviate cell fate toward gene expression by IL-13 (Fig. 2A–E). Treatment with goblet cells rather than ciliated cells,9,10) mimicking the GM6001 at 4 M, however, did not significantly prevent in vivo situation of GCH. The expression of CCSP, which upregulation of MUC5AC or MUC5B expression codes for the Clara cell secretory protein, also known as (Fig. 2A, B). IL-13-induced expression of CLCA1 also uteroglobin or CC10, was slightly downregulated, not diminished upon pretreatment of GM6001 at 40 M upregulated, by IL-13 (Fig. 2G). This might reflect the (Fig. 2F). In contrast, treatment with GM6001 did not fact that CCSP is expressed in nongranulated secretory prevent the IL-13-induced downregulation of ciliated cells (Clara cells) rather than mature goblet cells,22) and cell specific transcripts (Fig. 2H–J). Marimastat, a 2028 H. YOSHISUE and K. HASEGAWA

Fig. 3. Effect of GM6001 on Mucus Production. NHBE cells on ALI culture at day 14, which had been treated with only DMSO (A), DMSO and IL-13 (B), or GM6001 (40 M) and IL-13 (C), were subjected to cytospin centrifugation followed by PAS staining (red) with hematoxylin and eosin counter staining (blue). Representative results from two independent experiments are shown.

prototype inhibitor for TACE, also known to have an inhibitory activity toward various MMPs, significantly abrogated expression of MUC5B at 10 M (Fig. 2L, M). In order to confirm the effects of the inhibitors on mucin gene expression, we stained NHBE cells 14 d after culture on ALI with PAS. As expected, given the transcriptional upregulation of mucin genes, stimulation by IL-13 for 14 d greatly increased the intensity of PAS- positive signals, reflecting the abundant expression of mucins and induction of GCH. Pretreatment of the cells with GM6001 at 40 M one hour before IL-13 stim- ulation, which was repeated for 14 d, completely abrogated the overproduction of mucus (Fig. 3). The values of transcellular electrical resistance of ALI-cultured NHBE cells at days 8 and 14 were not different between drug-treated and non-treated cells, indicating that chronic treatment with GM6001 (40 M) or marimastat (10 M) does not affect the integrity of the polarized NHBE cells (data not shown). Fig. 4. Effect of GM6001 on TGF- Shedding from Differentiating NHBE Cells. Inhibition of GCH is accompanied by reduced TGF- NHBE cells on ALI culture at day 10 were treated by GM6001 at a concentration of 4 M (3) or 40 M (4), or by DMSO (1, 2), shedding followed by the addition of IL-13 (2–4) after one h. After 24-hour The importance of the EGFR in the induction of stimulation, ALI medium was collected and assayed by ELISA. mucin synthesis and the remarkable inhibition of GCH Comparisons were made using Student’s t test, *P < 0:05; by MMP/ADAM inhibitors prompted us to hypothesize **P < 0:01. NS, not significant. The results are presented as that shedding of some EGFR ligands might have been averaged values with standard deviations obtained from three independent experiments. abrogated by the inhibitors. Hence we assessed the concentration of TGF- in the supernatants, which had been exposed for 24 h to NHBE cells on ALI at day 10. concentration that caused downregulation of IL-13- Figure 4 shows that IL-13 treatment increased the induced MUC genes, significantly repressed shedding of concentration of TGF- (197%, P ¼ 0:0159) as previ- TGF- (11.3%, P ¼ 0:0013), while treatment with 14) ously reported by Booth et al. Furthermore, pretreat- GM6001 at 4 M did not cause a significant reduction ment of the cells with GM6001 at 40 M, the same in the amount of TGF- (72.5%, P ¼ 0:1122). Effect of MMP/ADAM Inhibitors on Goblet Cell Hyperplasia 2029 Discussion specific transcription factor,30) and DNAH9, encoding a component of the dynein arm of cilia.31) To our Recently, several reports have indicated that primary knowledge, this is the first report showing that IL-13 bronchial or nasal epithelial cells cultivated in differ- modulates the expression profile of the genes in ex vivo entiating conditions are induced to differentiate into differentiating lung epithelial cells. goblet cells more readily than ciliated cells upon GM6001 is widely used in both in vitro and in vivo stimulation with IL-13. Laoukili et al. used human studies as a MMP inhibitor. A recent report by nasal epithelial cells to show that not only IL-13 but also Lemjabbar and Basbaum indicated that lipoteichoic acid IL-4 increases the population of goblet cells and (LTA) binds to the platelet-activating factor receptor on decreases that of ciliated cells, with a decrease in ciliary lung epithelial cells to activate ADAM10, and that this beat frequency.9) Kondo et al. used primary lung results in shedding of HB-EGF and transactivation of the epithelial cells from guinea pig ALI culture to indicate EGFR, leading to induction of mucin production. In clearly that IL-13 induced GCH with consequent over- addition, they found that GM6001 inhibits LTA-induced production of the MUC5AC protein. No similar effect shedding of HB-EGF at a concentration of 40 M, was seen with IL-4.10) On the other hand, Chen et al. accompanied by inhibition of mucus production. Given reported that both IL-6 and IL-17 stimulate transcription that LTA is a component of the infectious bacterium of both MUC5AC and MUC5B in well differentiated Staphylococcus aureus, they considered this in vitro NHBE cells, whereas the Th2 cytokines IL-4, IL-9, and model useful for the study of cystic fibrosis.32) Extrap- IL-13 upregulated neither mucin gene.23) Furthermore, olating from this model, it is reasonable to hypothesize there are reports that treatment with IL-4 or IL-13 that in asthma, IL-13 might activate a member(s) of the reduces mucin secretion rather than stimulating it in MMP/ADAM protein family (e.g., TACE) on bronchial ALI-cultured NHBE cells, although the reduction ratio epithelial cells, resulting in release of TGF-, trans- of mucin secretion is approximately 50% and down- activation of the EGFR, GCH, and hypersecretion of regulation of the mRNA of MUC5AC and MUC5B is not mucus. The results of this study support this hypothesis, so evident.24,25) Hence we first assessed whether NHBE since GM6001 at 40 M inhibited IL-13-induced upre- cells on ALI culture respond to IL-13 by differentiation gulation of MUC genes and CLCA1 and overproduction into goblet cells. In our model, 14 days after being of mucus. placed at the ALI, they upregulated not only the In order to test this hypothesis further, we measured MUC5AC gene but also other mucin genes (MUC5B levels of TGF- in the supernatant of the differentiating and MUC2) in response to chronic stimulation with IL- NHBE cells on ALI using ELISA. This indicated that 13. Cells at days 1 and 8 showed little expression of the amount of TGF- increased approximately two-fold MUC5AC regardless of the presence or absence of IL- upon stimulation by IL-13. This level of increase is not 13. This is consistent with previous reports showing that as marked as that found by Booth et al., although they IL-13-induced GCH in vitro takes two to three used NHBE cells on day 9 of ALI.14) The differentiation weeks.9,10) Cells might be able to respond to IL-13 only stages appeared to be similar to those used in this study. at later differentiation stages, or chronic treatment with This may be due to differences in the cells’ origin and/ IL-13 at earlier differentiation stages might render cells or the culture conditions, and/or differences in the more responsive to IL-13. Overproduction of mucus by experimental design. Specifically, they stimulated IL-13 was confirmed by PAS staining, and CLCA1, NHBE cells with IL-13 from both the apical and basal whose expression is reported to increase in asthmatics,26) faces of the ALI culture while in this study it was from was also induced by IL-13. A murine ortholog of the basal side, because we did not want to change the CLCA1, gob5, has been stated to be implicated not only usual culture conditions for ALI and it has been reported in GCH but also in BHR.21) The unchanged or slightly that TGF- is delivered preferentially to the basolateral reduced CCSP expression in response to IL-13 observed surface of the polarized epithelial cells.33) As expected, appears contradictory to previous observations that GM6001 at 40 M prevented shedding of TGF- from intratracheal instillation of IL-13 increases expression the differentiating NHBE cells. The lack of significant of both CCSP mRNA and protein in the epithelial cells inhibition at 4 M is consistent with the effect of this of pathogen-free rat airways.27) But CCSP is generally drug on mucin gene expression. Since the concentration thought to be expressed predominantly in nongranulated of TGF- in the supernatant of the cells treated with secretory cells in normal human lung epithelium22) and GM6001 (40 M) and IL-13 was only 22.2% compared therefore not to be a marker of goblet cells. Furthermore, to that of the cells with only DMSO (P ¼ 0:020), it is expression of CCSP is reported to decrease in areas of clear that this MMP/ADAM inhibitor prevented not GCH,28) which is consistent with our in vitro results. On only IL-13-induced shedding, but also the basal level of the other hand, expression of the mRNA for tektin, shedding. This reduction in basal TGF- levels was not encoding a structural component of cilia,29) was dimin- accompanied by repression of basal expression of the ished completely by the addition of IL-13. A similar MUC genes, raising the possibility that basal expression expression pattern was observed for other ciliated cell of MUC genes is independent of TGF- and/or MMP/ marker genes: foxj1, which codes for a ciliated cell- ADAMs. On the other hand, CCSP expression was 2030 H. YOSHISUE and K. HASEGAWA downregulated in a concentration-dependent manner by M., Donaldson, D. D., Locksley, R. M., and Corry, D. B., GM6001, indicating that basal level expression of CCSP Requirement for IL-13 independently of IL-4 in exper- in differentiating NHBE cells depends on MMP/ imental asthma. Nature, 282, 2261–2263 (1998). ADAMs, TGF-, and/or other EGFR ligands. 7) Wills-Karp, M., Luyimbazi, J., Xu, X., Schofield, B., Although a member(s) of the MMP/ADAM protein Neben, T. Y., Karp, C. L., and Donaldoson, D. D., Interleukin-13: central mediator of allergic asthma. family are probably involved in the increase of soluble Nature, 282, 2258–2261 (1998). TGF- in supernatant in response to IL-13, its precise 8) Kuperman, D. A., Huang, X., Koth, L. L., Chang, G. H., molecular mechanism has not been well defined. Dolganov, G. M., Zhu, Z., Elias, J. A., Sheppard, D., and Because Booth et al. reported that an increase in soluble Erle, D. J., Direct effects of interleukin-13 on epithelial TGF- in the supernatant was observed only 1 h after cells cause airway hyperreactivity and mucus overpro- stimulation with IL-13, it is unlikely that a member(s) of duction in asthma. Nat. Med., 8, 885–889 (2002). the MMP/ADAM protein family affect transcription 9) Laoukili, J., Perret, E., Willems, T., Minty, A., and/or translation of the TGF- gene. Rather, it is Parthoens, E., Houcine, O., Coste, A., Jorissen, M., probably activated by an intracellular signaling triggered Marano, F., Caput, D., and Tournier, F., IL-13 alters by IL-13, and hence its extracellular catalytic domain mucociliary differentiation and ciliary beating of human cleaves the membrane-bound pro-TGF-. In this study, respiratory epithelial cells. J. Clin. Invest., 108, 1817– 1824 (2001). however, we did not detect significant shedding of TGF- 10) Kondo, M., Tamaoki, J., Takeyama, K., Nakata, J., and at 1 h after stimulation with IL-13 (data not shown). Nagai, A., Interleukin-13 induces goblet cell differ- This might be due to the difference in methods noted entiation in primary cell culture from guinea pig tracheal above. The possibility that the de novo synthesis of pro- epithelium. Am. J. Respir. Cell Mol. Biol., 27, 536–541 TGF- is affected by IL-13 and/or GM6001 remains to (2002). be clarified. 11) Takeyama, K., Dabbagh, K., Lee, H.-M., Agusti, C., During the preparation of this manuscript, Shao et al. Lausier, J. A., Ueiki, I. F., Grattan, K. M., and Nadel, J. reported that an endogenous knockdown of TACE A., Epidermal growth factor system regulates mucin expression by small interfering RNA blocked phorbol production in airways. Proc. Nat. Acad. Sci., 96, 3081– 12-myristate 13-acetate-induced TGF- shedding, 3086 (1999). EGFR transactivation, and MUC5AC expression in 12) Amishima, M., Munakata, M., Nasuhara, Y., Sato, A., Takahashi, T., Homma, Y., and Kawakami, Y., Expres- H292 cells.34) Given that TGF--mediated mucus 11) sion of epidermal growth factor and epidermal growth production has also been reported in H292 cells, it factor receptor immunoreactivity in the asthmatic human is likely that TACE is also involved in EGFR-mediated airway. Am. J. Respir. Crit. Care Med., 157, 1907–1912 expression of mucin genes in primary epithelial cells. (1998). Pharmacological inhibition of TACE might be a novel 13) Puddicombe, S. M., Polosa, R., Richer, A., Krishna, M. strategy for GCH and mucus hypersecretion. T., Howarth, P. H., Holgate, S. T., and Davies, D. E., Involvement of the epithermal growth factor receptor in Acknowledgment epithelial repair in asthma. FASEB J., 14, 1362–1374 (2000). We thank Dr. J. W. Holloway for a critical reading of 14) Booth, B. W., Adler, K. B., Bonner, J. C., Tounier, F., this manuscript. and Martin, L. D., Interleukin-13 induces proliferation of human airway epithelial cells in vitro via a mechanism mediated by transforming growth factor-. Am. J. References Respir. Cell Mol. Biol., 25, 739–743 (2001). 15) Lordan, J. L., Bucchieri, F., Richter, A., Konstantinidis, 1) Mills, P. R., Davies, R. J., and Devalia, J. L., Airway A., Holloway, J. W., Thornber, M., Puddicombe, S. M., epithelial cells, cytokines, and pollutants. Am. J. Respir. Buchanan, D., Wilson, S. J., Djukanovic, R., Holgate, S. Crit. Care Med., 160, S38–S43 (1999). T., and Davies, D. E., Cooperative effects of Th2 2) Aikawa, T., Shimura, S., Sasaki, H., Ebina, M., and cytokines and allergen on normal and asthmatic bron- Takishima, T., Marked goblet cell hyperplasia with chial epithelial cells. J. Immunol., 169, 407–414 (2002). mucus accumulation in the airways of patients who died 16) Peschon, J. J., Slack, J. L., Reddy, P., Stocking, K. L., of severe acute asthma attack. Chest, 101, 916–921 Sunnarborg, S. W., Lee, D. C., Russell, W. E., Castner, (1992). B. J., Johnson, R. S., Fitzner, J. N., Boyce, R. W., 3) Rose, M. C., Nickola, T. J., and Voynow, J. A., Airway Nelson, N., Kozlosky, C. J., Wolfson, M. F., Rauch, C. mucus obstruction: mucus glycoproteins, MUC gene T., Cerretti, D. P., Paxton, R. J., March, C. J., and Black, regulation and goblet cell hyperplasia. Am. J. Respir. R. A., An essential role for ectodomain shedding in Cell Mol. Biol., 25, 533–537 (2001). mammalian development. Science, 282, 1281–1284 4) Fahy, J. V., Goblet cell and mucin gene abnormalities in (1998). asthma. Chest, 122, 320S–326S (2002). 17) Zhao, J., Chen, H., Wang, Y.-L., and Warburton, D., 5) Rogers, D. F., The airway goblet cell. Int. J. Biochem. Abrogation of tumor necrosis factor- converting en- Cell Biol., 35, 1–6 (2003). zyme inhibits embryonic lung morphogenesis in culture. 6) Grunig, G., Warnock, M., Wakil, A. E., Venkayya, R., Int. J. Dev. Biol., 45, 623–631 (2001). Brombacher, F., Rennick, D. M., Sheppard, D., Mohrs, 18) Merlos-Suarez, A., Ruiz-Paz, S., Baselga, J., and Effect of MMP/ADAM Inhibitors on Goblet Cell Hyperplasia 2031 Arribas, J., Metalloprotease-dependent protransforming T., Nakanishi, A., Ashida, Y., Nishimura, O., Fujisawa, growth factor- ectodomain shedding in the absence of Y., and Fujino, M., Increased expression of the human tumor necrosis factor--converting enzyme. J. Biol. Ca2þ-activated Cl channel 1 (CaCC1) gene in the Chem., 276, 48510–48517 (2001). asthmatic airway. Am. J. Respir. Crit. Care Med., 165, 19) Gray, T. E., Guzman, K., Davis, C. W., Abdullah, L. H., 1132–1136 (2002). and Nettesheim, P., Mucociliary differentiation of 27) Kim, S., Shim, J. J., Burgel, P. R., Ueki, I. F., Dao-Pick, serially passaged normal human tracheobronchial epi- T., Tam, D. C., and Nadel, J. A., IL-13-induced clara cell thelial cells. Am. J. Respir. Cell Mol. Biol., 14, 104–112 secretory protein expression in airway epithelium: role (1996). of EGFR signaling pathway. Am. J. Physiol. Lung Cell. 20) Ordonez, C. L., Khashayar, R., Wong, H. H., Ferrando, Mol. Physiol., 283, L67–L75 (2002). R., Wu, R., Hyde, D. M., Hotchkiss, J. A., Zhang, Y., 28) Jensen, S. M., Jones, J. E., Pass, H., Steinberg, S. M., and Novikov, A., Dolganov, G., and Fahy, J. V., Mild and Linnoila, R. I., Clara cell 10 kDa protein mRNA in moderate asthma is associated with airway goblet cell normal and atypical regions of human respiratory hyperplasia and abnormalities in mucin expression. Am. epithelium. Int. J. Cancer, 58, 629–637 (1994). J. Respir. Crit. Care Med., 163, 517–523 (2001). 29) Ostrowski, L. E., Blackburn, K., Radde, K. M., Moyer, 21) Nakanishi, A., Morita, S., Iwashita, H., Sagiya, Y., M. B., Schlatzer, D. M., Moseley, A., and Boucher, R. Ashida, Y., Shirafuji, H., Fujisawa, Y., Nishimura, O., C., A proteomic analysis of human cilia: identification of and Fujino, M., Role of gob-5 in mucus overproduction novel components. Mol. Cell. Proteomics, 1, 451–465 and airway hyperresponsiveness in asthma. Proc. Natl. (2002). Acad. Sci., 98, 5175–5180 (2001). 30) Brody, S. L., Yan, X. H., Wuerffel, M. K., Song, S. K., 22) Boers, J. E., Ambergen, A. W., and Thunnissen, F. B. J. and Shapiro, S. D., Ciliogenesis and left-right axis M., Number and proliferation of Clara cells in normal defects in forkhead factor HFH-4-null mice. Am. J. human airway epithelium. Am. J. Respir. Crit. Care Respir. Cell Mol. Biol., 23, 45–51 (2000). Med., 159, 1585–1591 (1999). 31) Carson, J. L., Reed, W., Lucier, T., Brighton, L., 23) Chen, Y., Thai, P., Zhao, Y.-H., Ho, Y.-S., DeSouza, M. Gambling, T. M., Huang, C.-H., and Collier, A. M., M., and Wu, R., Stimulation of airway mucin gene Pre- and postnatal lung development, maturation, and expression by interleukin (IL)-17 through IL-6 para- plasticity axonemal dynein expression in human fetal crine/autocrine loop. J. Biol. Chem., 278, 17036–17043 tracheal epithelium. Am. J. Physiol. Lung Cell. Mol. (2003). Physiol., 282, L421–L430 (2002). 24) Jayawickreme, S. P., Gray, T., Nettesheim, P., and Eling, 32) Lemjabbar, H., and Basbaum, C., Platelet-activating T., Regulation of 15-lipoxygenase expression and mucus factor receptor and ADAM10 mediate responses to secretion by IL-4 in human bronchial epithelial cells. Staphylococcus aureus in epithelial cells. Nat. Med., 8, Am. J. Physiol. Lung Cell. Mol. Physiol., 276, L596– 41–46 (2002). L603 (1999). 33) Harris, R. C., Chung, E., and Coffery, R. J., EGF 25) Brown, C. D., Kilty, I., Yeadon, M., and Jenkinson, S., receptor ligands. Exp. Cell Res., 284, 2–13 (2003). Regulation of 15-lipoxygenase isozymes and mucin 34) Shao, M. X. G., Ueki, I. F., and Nadel, J. A., Tumor secretion by cytokines in cultured normal human necrosis factor -converting enzyme mediates MUC5AC bronchial epithelial cells. Inflamm. Res., 50, 321–326 mucin expression in cultured human airway epithelial (2001). cells. Proc. Natl. Acad. Sci., 100, 11618–11623 (2003). 26) Hoshino, M., Morita, S., Iwashita, H., Sagiya, Y., Nagi,