1266 Research Article CREB activation induced by mitochondrial dysfunction triggers triglyceride accumulation in 3T3-L1 preadipocytes

Sébastien Vankoningsloo1, Aurélia De Pauw1, Andrée Houbion1, Silvia Tejerina1, Catherine Demazy1, Françoise de Longueville2, Vincent Bertholet2, Patricia Renard1, José Remacle1,2, Paul Holvoet3, Martine Raes1 and Thierry Arnould1,* 1Laboratory of Biochemistry and Cellular Biology, University of Namur (F.U.N.D.P.), Rue de Bruxelles, 61, 5000 Namur, Belgium 2Eppendorf Array Technologies, Rue du Séminaire, 12, 5000 Namur, Belgium 3Cardiovascular Research Unit of the Center for Experimental Surgery and Anesthesiology, Katholieke Universiteit Leuven (KUL), Belgium *Author for correspondence (e-mail: [email protected])

Accepted 12 December 2005 Journal of Cell Science 119, 1266-1282 Published by The Company of Biologists 2006 doi:10.1242/jcs.02848

Summary Several mitochondrial pathologies are characterized by protein ␣ (C/EBP␣), C/EBP homologous protein-10 lipid redistribution and microvesicular cell phenotypes (CHOP-10), mitochondrial glycerol-3-phosphate resulting from triglyceride accumulation in lipid- dehydrogenase (GPDmit), and stearoyl-CoA desaturase 1 metabolizing tissues. However, the molecular mechanisms (SCD1). We also demonstrate that overexpression of two underlying abnormal fat distribution induced by dominant negative mutants of the cAMP-response element- mitochondrial dysfunction remain poorly understood. In binding protein CREB (K-CREB and M1-CREB) and this study, we show that inhibition of respiratory complex siRNA transfection, which disrupt the factor activity and III by antimycin A as well as inhibition of mitochondrial expression, respectively, inhibit antimycin-A-induced protein synthesis trigger the accumulation of triglyceride triglyceride accumulation. Furthermore, CREB knock- vesicles in 3T3-L1 fibroblasts. We also show that treatment down with siRNA also downregulates the expression of with antimycin A triggers CREB activation in these cells. several genes that contain cAMP-response element (CRE) To better delineate how mitochondrial dysfunction induces sites in their promoter, among them one that is potentially triglyceride accumulation in preadipocytes, we developed a involved in synthesis of triglycerides such as SCD1. These low-density DNA microarray containing 89 probes, which results highlight a new role for CREB in the control of

Journal of Cell Science allows gene expression analysis for major effectors and/or triglyceride metabolism during the adaptative response of markers of adipogenesis. We thus determined gene preadipocytes to mitochondrial dysfunction. expression profiles in 3T3-L1 cells incubated with antimycin A and compared the patterns obtained with differentially expressed genes during the course of in vitro Supplementary material available online at adipogenesis induced by a standard pro-adipogenic http://jcs.biologists.org/cgi/content/full/119/7/1266/DC1 cocktail. After an 8-day treatment, a set of 39 genes was found to be differentially expressed in cells treated with Key words: CREB, Lipid metabolism, Mitochondrial dysfunction, antimycin A, among them CCAAT/enhancer-binding Gene expression, SiRNA, Adipocytes

Introduction accumulation in muscles and liver of healthy and lean elderly The large variety of metabolic disorders related to bio- people (Petersen et al., 2003). Reduced mitochondrial activity energetical stress underlines the essential role of mitochondrial and intramyocytic accumulation of TG were also found in the activity in cellular physiology. More particularly, several lines young and insulin-resistant offspring of parents with type 2 of evidence now show that defects in ␤-cells insulin secretion diabetes. Insulin-resistant patients usually have a lower ratio of as well as systemic insulin resistance in type 2 diabetes could type 1 muscle fibers to the more glycolytic type 2 muscle be attributable to mitochondrial dysfunction (Lowell and fibers, an observation that could be explained by the reduced Shulman, 2005). In human muscle cells, the major effectors expression of members of the peroxisome proliferator- involved in insulin resistance include adipokines (Lazar, 2005) activated receptor ␥ (PPAR␥)-coactivator-1 (PGC-1) family and fatty acids, which cause a direct inhibition of insulin- and the downregulation of their target genes involved in stimulated glucose transport activity through a decrease in mitochondrial biogenesis (Wu et al., 1999; Mootha et al., phosphoinositide 3-kinase (PI 3-kinase) signaling (Dresner et 2003). Hypoxic conditions that inhibit mitochondrial al., 1999). Furthermore, impairment of mitochondrial activity respiration also lead to TG accumulation in cardiomyocytes associated with ageing, which could result from alterations in (Huss et al., 2001). In addition, we recently showed that, the mitochondrial DNA (mtDNA), also leads to triglyceride (TG) impairment of mitochondrial activity by inhibitors of Mitochondrial dysfunction triggers triglyceride accumulation 1267

respiratory complexes also triggers TG accumulation in murine adipogenic markers that are potentially responsible for TG 3T3-L1 preadipocytes, resulting from a decrease in fatty acid accumulation in AA-treated preadipocytes. These results were ␤-oxidation and an increase in glucose uptake enhancing compared with differentially expressed genes obtained for glycerol 3-phosphate synthesis (Vankoningsloo et al., 2005). differentiating 3T3-L1 cells in the presence of a standard Changes in cellular metabolism due to a loss of hormone cocktail. The DNA microarray used in this study mitochondrial oxidative capacity lead to the activation of cell allows gene expression profiling for 89 genes related to signaling pathways and modifications in the expression of adipogenesis and lipid metabolism. These markers have been many nuclear genes. This process, known as mitochondria- carefully selected, based on the literature reporting on nucleus retrograde communication, has mainly been studied in differentiation-specific gene expression during 3T3-L1 yeast (Liao et al., 1991; Butow and Avadhani, 2004) and more adipogenesis (Burton et al., 2004; Guo and Liao, 2000; recently in mammalian cells depleted in mitochondrial DNA Kratchmarova et al., 2002). We also evidenced that, inhibition (mtDNA) (Amuthan et al., 2002; Biswas et al., 1999; Biswas of CREB expression with small interfering RNA (siRNA) and et al., 2005; Arnould et al., 2002). For example, we have reduction of its activity by overexpression of two dominant recently shown that depletion of mtDNA or inhibition of negative mutants (K-CREB and M1-CREB) diminishes the TG mitochondrial respiration activates the cAMP-response- accumulation induced by AA in 3T3-L1 preadipocytes. Finally, element binding protein (CREB) by phosphorylation of Ser133 combining RNA interference (RNAi) and microarray mediated through a Ca2+/calmodulin-dependent kinase IV technology, we identified several CREB-target genes that are (CaMK IV) pathway (Arnould et al., 2002). differentially regulated when 3T3-L1 cells are incubated with CREB is a transcription factor with pleiotropic effects that AA. Taken together, these results not only extend the role of has already been reported to play a role in the control of CREB in adipocyte biology and lipid metabolism but also memory (Scott et al., 2002), cell proliferation (Della Fazia et highlight the 3T3-L1 preadipocyte response to mitochondrial al., 1997), and in glucose and lipid metabolism (Zhou et al., dysfunction leading to TG accumulation, which might not only 2004; Reusch et al., 2000; Herzig et al., 2003). Previous impair adipocyte metabolism but also the physiology of studies showed that this transcription factor is also an early insulin-dependent tissues. regulator of adipocyte differentiation because it is activated by phosphorylation of Ser133 in the presence of adipogenic Results inducers, such as glucocorticoids, cyclic AMP analogues and Mitochondrial dysfunction induces TG accumulation in insulin-like growth factor-1 (IGF-1), or high concentrations of 3T3-L1 preadipocytes insulin (MacDougald and Lane, 1995). Furthermore, ectopic Differentiation of 3T3-L1 preadipocytes into adipocytes is expression of the chimeric and constitutively active VP16- easily triggered by a standard adipogenic cocktail comprising CREB is sufficient to trigger adipogenesis, whereas insulin, a cAMP-elevating agent and dexamethasone overexpression of a dominant negative form of CREB (K- (MacDougald and Lane, 1995). The main morphological CREB) inhibits the adipogenic program (Reusch et al., 2000) characteristic of adipogenesis is the progressive storage of and leads to apoptosis of mature adipocytes (Reusch and large amounts of cytosolic TG, whereas TG that accumulate in

Journal of Cell Science Klemm, 2002). These data suggest that CREB acts as pro- 3T3-L1 cells incubated with 10 nM AA form small but adipogenic and survival factor. It has also been reported that numerous vesicles, as revealed after the staining of neutral the positive effect of activated CREB on adipogenesis is lipids with Oil Red O (Fig. 1A) (Vankoningsloo et al., 2005). mediated by the overexpression of the CCAAT/enhancer- Quantitative analysis showed that TG accumulation in 3T3-L1 binding protein ␤ (C/EBP␤) gene, a key transcription factor cells treated for 8 days with AA depends on the concentration in the differentiation program that contains dual cAMP- of this metabolic inhibitor (Fig. 1B). A similar phenotype was response element (CRE)-like cis regulatory-elements in its observed for 3T3-L1 cells incubated 16 days with promoter (Zhang et al., 2004). Whereas defects in adipocyte chloramphenicol (a well-known inhibitor of mitochondrial metabolism induced by mitochondrial dysfunction might protein synthesis), although it took longer for TG to influence muscle and liver metabolism because it has been accumulate (Fig. 1C). associated with lipodystrophy and impairment of fatty acid ␤- oxidation in these tissues (Petersen et al., 2002), preadipocyte Characterization of CREB activation in AA-treated 3T3- response to mitochondrial dysfunction is still poorly L1 cells understood. We previously reported a constitutively enhanced CREB Here, we show that CREB is activated in 3T3-L1 activity in mtDNA-depleted L929 and rho0 143B cells, as well preadipocytes when the cells are incubated with antimycin A as phosphorylation of the CREB Ser133 in several cell lines (AA), an inhibitor of the complex III in the mitochondrial that had been incubated with oxidative phosphorylation electron transporter chain that triggers the accumulation of inhibitors (Arnould et al., 2002). Here, we extended these data cytosolic TG in these cells (Vankoningsloo et al., 2005). The by showing that preadipocytes also respond to the impairment fact that CREB can be activated by the inhibition of of mitochondrial activity by the activation of this transcription mitochondrial activity in several cell lines and acts as a survival factor. Indeed, using several approaches, we showed that and differentiating factor in adipocytes and preadipocytes, CREB is phosphorylated on Ser133 and localizes in the respectively, led us to hypothesize that CREB also plays a role nucleus of 3T3-L1 cells incubated with AA (Fig. 2A-B). in the accumulation of triglycerides in preadipocytes with Western blot analysis revealed that CREB phosphorylation is impaired mitochondrial activity. increased after 6 hours of treatment with 10 nM AA and We thus developped and used a low-density DNA remains sustained for at least 72 hours, whereas the microarray to study gene expression profiles of major adipogenic cocktail increases levels of Ser133-phosphorylated 1268 Journal of Cell Science 119 (7)

Fig. 1. Antimycin A and chloramphenicol induce triglyceride accumulation in 3T3-L1 preadipocytes. (A) Photomicrographs of 3T3-L1 cells (a) not treated or treated (b) for 8 days with 10 nM AA, (c) for 16 days with 100 ␮g/ml chloramphenicol and (d) for 8 days with an adipogenic cocktail. Cells were stained for the presence of neutral lipids with Oil Red O. (B-C) Quantitative determination of triglyceride accumulation in 3T3-L1 cells (B) incubated without a drug (controls, CTL) or incubated with the indicated concentrations for 8 days with antimycin A and (C) for 16 days with chloramphenicol. The absorbance of cell monolayers was spectrophotometrically determined at 490 nm after Oil Red O staining. Results are expressed in optical density (O.D.) as the mean ± s.d. for n=3 experiments. **P<0.01 and ***P<0.001, significantly different from control cells. Magnification, 150ϫ.

CREB (pCREB) for 24 to 72 hours. Increases in levels of CREB is involved in AA-induced TG accumulation

Journal of Cell Science pCREB are not observed after 8 days of treatment. The CREB is suspected to play a role in TG metabolism because it abundance of total CREB is similar in all tested conditions binds to the promoter of adipogenic marker genes, such as (Fig. 2A). These results clearly indicate that the C/EBP␤, during 3T3-L1 cell differentiation (Zhang et al., phosphorylation of CREB on Ser133 is enhanced in 3T3-L1 2004). To delineate a potential role for CREB in the AA- cells treated with AA. These results were also confirmed by induced TG accumulation, cells were transiently transfected immunofluorescence experiments and confocal microscopy, with plasmids encoding either dominant negative CREB which show that pCREB mainly accumulates in the nucleus mutants (K-CREB and M1-CREB) or enhanced green of cells incubated for 24 hours with the mitochondrial fluorescent protein (EGFP) as a negative control, and then inhibitor or the adipogenic cocktail (Fig. 2B). An enhanced incubated for 8 days with 10 nM AA followed by staining for phosphorylation of Ser133 strongly suggests that CREB is TG and spectrophotometric quantification. We found that AA- bound to DNA and transcriptionally active under these induced TG accumulation is significantly reduced in cells that conditions. Therefore, we next used a colorimetric assay overexpress either K-CREB or M1-CREB dominant negative allowing the quantification of CREB and also pCREB bound mutants (43.1 % or 44.8 %, respectively; data not shown). To to a synthetic oligonucleotide containing a CRE-site. We circumvent the rather low transfection efficiency of these cells observed that, whereas the total amount of CREB binding to with the Superfect reagent (ranging from 20 to 45 % as DNA remained unchanged, the relative amount of bound determined by a ␤-galactosidase reporter construct), which pCREB was increased (1.5- to three-fold increase after 24 might minimize the inhibitory effect of the dominant negative hours) by both AA and the adipogenic cocktail (Fig. 2C). The forms, we next used a specific siRNA to silence CREB gene resulting effect of pCREB on its ability to transactivate gene expression. expression in these conditions was demonstrated in transient Before testing the effect that CREB silencing has on transfection experiments with a CREB-sensitive luciferase- accumulation of TG in 3T3-L1 cells incubated for 8 days with reporter construct driven by the authentic ␣-inhibin promoter, 10 nM AA (Fig. 3), we verified by confocal microscopy that which contains four CRE sites (Pei et al., 1991; Fig. 2D). As FITC-labeled siRNA had been efficiently introduced into 3T3- expected, the transcriptional activity of CREB was L1 preadipocytes, and estimated that transfection efficiency significantly increased in cells incubated for 24 hours with 10 was at least 90% (Fig. 3A). Out of the three different siRNAs nM AA or the adipogenic cocktail (threefold or fourfold tested, only one inhibited CREB expression efficiently by more increase, respectively). than 80% (data not shown). Using western blot analysis, we Mitochondrial dysfunction triggers triglyceride accumulation 1269

Fig. 2. Antimycin A and the adipogenic cocktail trigger CREB activation by phosphorylation on Ser133. (A) Western blot analysis for CREB and CREB phosphorylated on Ser133 (pCREB) performed with 20 ␮g of nuclear proteins extracted from 3T3-L1 cells incubated for 6, 24 and 48 hours, and 3 and 8 days without a drug (controls, CTL), with 10 nM AA or with the adipogenic cocktail (DIFF); TBP served as a loading control. (B) Immunostaining and confocal microscopic analysis of abundance and localization of pCREB in 3T3-L1 cells incubated for 24 hours (a) without, (b) with 10 nM AA or (c) with adipogenic cocktail. Arrows indicate nuclear localization of pCREB. (C) Quantitative detection of pCREB and total CREB that binds to a DNA consensus sequence in a colorimetric assay (TransAM kit). Assays were performed on 10 ␮g of nuclear protein extract from 3T3-L1 cells incubated for 24 hours without (CTL), with 10 nM AA or with adipogenic cocktail (DIFF). Phosphorylated and total forms of CREB binding of pCREB and total CREB to DNA was detected with anti-Ser133-pCREB or anti-CREB antibodies, respectively, followed by a colorimetric reaction in the presence of a HRP-conjugated secondary antibody. Absorbance values were measured at 450 nm for DNA- binding of pCREB and CREB, and signals obtained for pCREB were normalized against total CREB bound to the capture probe (n=3). (D) Effect of AA and the adipogenic cocktail on CREB transcriptional activity in 3T3-L1. Cells were transiently co-transfected with a plasmid encoding ␤-galactosidase and a CREB- sensitive luciferase-reporter construct. The next day, cells were incubated for 24 hours without (CTL) or with 10 nM AA, or with the adipogenic cocktail (DIFF) and then processed for luciferase assay. Results

Journal of Cell Science were normalized against ␤-galactosidase activity and expressed as fold-increase of controls as the mean ± s.d. for n=3 experiments. *P<0.05, **P<0.01, ***P<0.001 are significantly different from control cells.

then checked that this CREB-specific siRNA reduces the Comparison of alterations in gene expression induced abundance of CREB protein in a concentration-dependent by the adipogenic cocktail or AA manner (Fig. 3B). The maximal inhibitory effect was observed The accumulation of TG in preadipocytes leading to the 24 to 48 hours post-transfection, whereas CREB knock-down adipocyte phenotype is controlled by numerous genes of was relieved 96 hours after transfection (data not shown), a several classes. Products of these genes either drive result in agreement with the transient effect of siRNA in differentiation (mainly C/EBP␤ and PPAR␥) or maintain a mammalian cells. The expression of TATA-box-binding differentiated state (C/EBP␣). We thus hypothesized that TG protein (TBP) was monitored by western blot analysis and was accumulation in 3T3-L1 preadipocytes with impaired found unchanged in these conditions, suggesting that siRNA mitochondrial activity is also caused by alterations in gene targeting CREB did not repress global protein synthesis by an expression. We then compared differences and similarities in ‘off-target’ effect. To test the potential role of CREB on TG gene expression induced by the adipogenic cocktail or AA. To that accumulate in AA-treated 3T3-L1 cells, 100 nM siRNA investigate the expression of genes that are differentially were transfected and cells were then incubated for 8 days with regulated by AA, a low-density DNA microarray was 10 nM AA. In these conditions, we observed that delivery of developed. This microarray allows gene expression analysis for siRNA into 3T3-L1 cells reduces the AA-induced TG a set of key genes related to adipogenesis and lipid metabolism accumulation by 75% (Fig. 3C-D). These results show that (supplementary material Table S1 and Fig. S1). 3T3-L1 cells CREB activation induced by AA is required for accumulation were incubated for 2, 4, 6 or 8 days with the adipogenic of TG – as observed in response to mitochondrial inhibition – cocktail or with 10 nM AA. Cells were harvested and total and suggest that CREB-mediated transcription at the early RNA was extracted and reverse transcribed by including stage of the mitochondria-impairing treatment is an important biotinylated nucleotides. The resulting cDNAs were hybridized mechanism, leading to the observed phenotype. on the microarray and stained with a cyanin-3-conjugated anti- 1270 Journal of Cell Science 119 (7)

Fig. 3. Silencing of CREB by using specific siRNA prevents triglyceride accumulation in antimycin-A- treated 3T3-L1 cells. (A) Visualization of siRNA transfection efficiency in 3T3-L1 preadipocytes. Cells were transfected for 4 hours with fluorescein- labeled siRNA (20 nM) and processed for confocal microscopy after (a) 24 hours or (b) 48 hours. (B) Effect of a CREB-specific siRNA on CREB protein expression. 3T3-L1 preadipocytes were transfected for 4 hours with different concentrations of siRNA or incubated for 4 hours with the transfection reagent (JetSI). CREB abundance was determined by western blotting of 40 ␮g of clear cell lysate proteins prepared 48 hours after transfection. TBP served as a loading control. (C) Effect of a CREB-specific siRNA on AA-induced triglyceride accumulation. Cells were transfected for 4 hours with 100 nM siRNA and then incubated for 8 days without (controls, CTL) or with 10 nM AA. The absorbance of cell monolayers was spectrophotometrically determined at 490 nm after Oil Red O staining. Results are expressed in optical density (O.D.) as the mean ± s.d. for n=3 or the mean of n=2 experiments. *P<0.05, significantly different from control cells. (D) Photomicrographs of 3T3-L1 cells transfected or not for 4 hours with 100 nM siRNA and incubated or not (CTL) for 8 days with 10 nM AA before Oil Red O staining. Magnification, 75ϫ.

biotin antibody. Three independent experiments were UCP-2), begin to be upregulated after 4 days (Acrp30, performed for each incubation time and each sample was adipsin, Cav-2, C/EBP␣, Clic4, cyclin D3, DHAPAT, hybridized to three submicroarrays, represented by the probes FABP4/aP2, GPAT, HSD, HSL, HSP 60, LPL-1, MCAD, p18, ␦ Journal of Cell Science spotted in triplicate. The array data were subjected to a simple PPAR , SCD2) or are only found to be differentially algorithm (Materials and Methods) to set a lower threshold and regulated after 6 days of treatment (CL, Plin, VEGF-A). The to normalize the data to internal-standard controls and house expression of the genes upregulated most is sustained during keeping genes. Then, average ratios and their standard the whole adipogenic program, but some genes also display deviations (s.d.) were calculated. We ended up with a category transient overexpression profiles as found for Gsn, MMP-2 of gene transcripts that were not detected owing to their low and RXR␣. As already reported, 3T3-L1 cell differentiation abundance, detected with no modification, or quantitatively or is also characterized by the downregulation of adipogenesis qualitatively up- or down-regulated. Genes were assigned to repressors such as Pref-1 and the transcription factors the latter category when their fluorescent signal was either GATA2 and GATA3 (Lee et al., 2003; Tong et al., 2005). saturated or less than 2.5 times that of the local background in Other downregulated genes in differentiating adipocytes one of the experimental conditions. include PEDF, SDF1, SDF2, Smad3, TF and VEGF-C. No changes were observed for C/EBP␤, a well-known early Adipogenic cocktail-induced gene expression profiles marker of adipogenesis (Darlington et al., 1998). However, Gene expression data for differentiating 3T3-L1 cells are due to inaccurate probe selectivity, C/EBP␤-derived cDNA presented in Table 1. The first list identified 36 genes found can cross-hybridize with the probe for C/EBP␦ (data not to be significantly upregulated during the time course of in shown). Therefore, we analyzed the expression profile for vitro adipogenesis. Many of these include genes involved in these two transcription factors in differentiating 3T3-L1 cells lipid metabolism (CPT-2, DHAPAT, FABP4/aP2, FAS, by real time PCR (RT-PCR) and found that C/EBP␤ and GPAT, HSL, LPL1, MCAD, SCD1, SCD2), in the C/EBP␦ are transiently upregulated during the first 2 to 4 transcriptional control of adipogenesis (C/EBP␣, PPAR␥, days of adipogenesis (Fig. 4). Several gene transcripts were SREBP-1) and in cell-cycle arrest (p18), as well as genes not detected on the microarray (ATR II, CaMK IV, CPT-1 M, encoding adipokines (Acrp30, AGT, resistin). Among the Gyk, IL-6, iNOS, leptin, renin, RXR␥) probably because low upregulated genes during preadipocyte differentiation, abundance makes their detection impossible below the several sets of genes (clusters) display various kinetic sensitivity threshold of the microarray technique. Indeed, profiles: genes are either significantly induced after 2 days when analyzed by RT-PCR assays, leptin was found to be (AAAT, AGT, Cav-1, Coll VI␣2, CPT-2, FAS, GPDcyt, Gsn, upregulated in differentiated 3T3-L1 adipocytes, whereas IL- Hp, MMP-2, PPAR␥, resistin, RXR␣, SCD1, SREBP-1, 6 was shown to be downregulated (Fig. 4). Mitochondrial dysfunction triggers triglyceride accumulation 1271

3T3-L1 fibroblasts, differentiated with a standard pro- Spiegelman, 2000; Guo and Liao, 2000; Burton et al., 2002; adipogenic cocktail, are a commonly used model to study Burton et al., 2004; Ross et al., 2002). The fact that our data differentiation for which a lot of experimental data on gene are in good agreement with previous studies that report expression can be found in the literature (Rosen and changes in gene expression during adipogenesis in vitro,

Table 1. Gene expression profiles of differentiating 3T3-L1 adipocytes

Day 2Day 4Day 6Day 8 Day 2Day 4Day 6Day 8 Genes M.R. S.D. M.R. S.D. M.R. S.D. M.R. S.D. Genes M.R. S.D. M.R. S.D. M.R. S.D. M.R. S.D. AAAT 2.87 0.35 4.60 0.57 4.35 0.55 3.85 0.41 HSP 60 1.53 0.10 3.14 0.84 4.36 0.72 3.63 0.82 Acrp30 0.63 0.17 24.16 16.68 ++++ ++++ HSP 84 1.32 0.29 1.49 0.34 1.11 0.10 1.05 0.29 Actin 0.91 0.05 0.79 0.07 0.79 0.05 0.77 0.11 HSP 86 1.06 0.60 1.50 0.72 1.58 0.41 1.08 0.42 ADD1 0.84 0.13 0.78 0.05 0.69 0.04 0.80 0.11 IL-6 ND ND ND ND Adipsin 0.50 0.13 5.84 4.02 34.80 14.91 49.33 13.38 iNOS ND ND ND ND AGT 1.80 18.12 6.99 20.22 4.83 12.67 1.90 Leptin ND ND ND ND ASP 0.65 0.23 1.03 0.06 1.29 0.06 1.25 0.12 L-PK 1.59 0.94 1.58 0.58 1.45 0.48 1.89 0.50 ATR I 1.82 0.20 1.31 0.50 1.02 0.21 0.87 0.13 LPL1 0.46 0.32 1.72 0.50 2.92 0.75 3.42 1.51 ATR II ND ND ND ND MCAD 1.18 0.44 3.13 0.03 4.31 0.44 3.97 0.86 β3AR ND ND ND + MMP-2 2.00 0.40 1.80 0.90 1.49 0.12 0.91 0.09 CaMK IIγ 0.59 0.03 0.81 0.17 0.71 0.07 0.62 0.24 NFATc2 ND ND ND 1.33 CaMK IV ND ND ND ND NFATc4 0.82 0.08 0.89 0.13 1.02 0.13 1.16 0.20 Cav-1 2.11 0.69 4.25 0.47 4.61 0.71 3.92 1.01 p110α 0.62 0.24 1.35 1.04 0.15 0.96 Cav-2 1.03 ++ 4.67 0.92 ++++ p18 1.01 0.18 2.89 1.73 3.40 0.40 3.62 0.57 C/EBPα 1.45 0.21 6.57 3.17 9.90 1.85 +++ PAI-1 1.68 + ND + C/EBPβ 1.10 0.12 1.05 0.08 1.17 0.30 1.00 0.18 PEDF 0.67 0.08 0.40 0.13 0.44 0.07 0.46 0.03 C/EBPδ 2.16 0.88 1.95 0.57 1.29 0.18 1.00 0.03 PEPCK1 ND ND ND + CHOP-10 0.49 0.07 0.74 0.20 0.76 0.15 1.12 0.40 Plin 0.85 0.19 1.23 0.14 2.57 1.29 2.02 0.79 CL 1.14 0.09 1.36 0.19 1.66 0.23 1.79 0.24 PPARδ 1.08 0.05 1.82 0.55 1.87 0.37 2.10 0.23 Clic4 1.54 0.30 2.22 0.67 2.56 0.21 2.27 0.40 PPARγ 1.98 0.37 6.80 1.35 15.68 3.76 20.73 7.64 Coll VIα2 2.15 0.37 2.19 0.42 2.39 0.24 1.91 0.01 Pref-1 0.58 0.07 0.33 0.10 0.31 0.09 0.27 0.05 CPT-1 L 0.64 0.05 0.76 0.29 0.87 0.11 0.63 0.14 RAB3D 1.09 0.16 1.41 0.22 1.61 0.83 + CPT-1 M ND ND ND ND Renin ND ND ND ND CPT-2 2.28 0.33 4.35 0.96 5.71 0.99 5.47 0.69 Resistin 1.93 ++++ ++++ ++++ CREB1 0.63 0.23 1.13 1.12 0.47 0.93 rRNA18s 1.12 0.24 0.76 0.15 0.70 0.29 0.71 0.11 Cst C 0.75 0.18 0.88 0.26 0.82 0.10 0.61 0.04 RXRα 1.74 0.14 1.80 0.31 2.28 0.57 1.27 0.18 Journal of Cell Science Cyclin D3 1.39 0.16 1.53 0.30 1.71 0.31 1.81 0.12 RXRγ ND ND ND ND DHAPAT 1.10 0.14 3.62 1.97 5.31 0.66 6.09 1.35 SCD1 1.83 0.18 17.39 5.16 ++++ ++++ eNOS 0,.86 1.24 0.15 1.39 0.37 1.30 SCD2 1.30 0.26 2.70 1.61 3.41 0.46 6.42 0.50 ERA 0.79 0.09 1.17 0.05 1.50 0.36 1.60 0.12 SDF1 0.50 0.19 0.66 0.13 0.86 0.12 0.66 0.25 FABP4/aP2 1.49 0.31 25.37 16.57 56.28 17.57 31.31 13.77 SDF2 0.29 0.10 0.31 0.04 0.46 0.09 0.37 0.18 FAS 1.96 0.16 3.93 1.27 6.44 1.34 6.03 0.34 Smad3 0.52 0.00 0.59 0.06 0.89 0.51 - GAPDH 1.75 0.48 1.25 0.19 1.39 0.21 1.60 0.20 SPARC 0.92 0.08 0.93 0.15 0.81 0.22 0.78 0.18 GATA-2 ----SREBP-1 1.77 0.38 1.68 0.19 2.30 0.25 1.82 0.24 GATA-3 -NDNDNDStat6 1.09 0.13 1.30 0.25 1.17 0.25 1.22 0.16 GLUT-4 ND 1,05 + + TBP 0.97 0.17 1.25 1.43 1.80 GPAT 1.11 0.24 2.15 0.28 3.03 0.12 3.32 0.58 TF 0.28 0.08 0.46 0.08 0.54 0.10 0.50 0.18 GPDcyt 1.91 +++ ++++ ++++ TGF-β1 1.11 0.42 1.47 0.13 1.40 0.11 1.52 GPDmit 0.87 0.16 1.47 0.07 1.51 0.05 1.24 0.22 TNFα ND ND ND ND Gsn 2.11 0.13 2.13 0.17 1.57 0.15 1.01 0.19 UCP-2 1.89 0.20 1.89 0.05 2.27 0.44 3.30 0.26 Gyk ND ND ND ND VEGF-A 0.89 0.34 1.24 0.12 1.83 0.49 3.50 0.99 HCNP 1.18 0.23 1.04 0.13 1.02 0.11 0.83 0.12 VEGF-B 0.72 0.12 1.05 0.04 1.14 0.20 0.94 0.07 Hp 6.81 3.18 7.45 2.56 6.59 2.92 6.33 5.04 VEGF-C 0.48 0.22 0.59 0.13 0.35 0.04 0.24 0.12 HSD ND +++ ++++ ++++ Wnt10b ND ND ND ND HSL 1.08 0.05 2.13 0.51 6.38 0.36 4.62 2.96

Gene expression profiling in differentiating 3T3-L1 adipocytes analyzed with the DNA microarray. Cells were incubated for 2, 4, 6 and 8 days with the adipogenic cocktail before total RNA extraction, reverse-transcription and cDNA hybridization, as described in Materials and Methods. Each value is the average of three ratio values calculated from three – or two, when no standard deviation (S.D.) is indicated – independent RNA extractions for both reference and test conditions. Mean ratios (M.R.) indicate a fold-increase or decrease in gene expression. Significant mean ratios, obtained from ratios falling out of the 95% confidence interval, determined on the basis of house-keeping gene variations, are shown on a grey background. ND, transcript not detected in both conditions (test and reference). Qualitative ratios are represented as (+) < 5; 5.1< (++) <10; 10.1< (+++) <25; (++++) >25.1; (-) >–5. For gene abbreviations, please refer to supplementary material Table S1. 1272 Journal of Cell Science 119 (7)

already validates the DNA microarray developed in this study. be differentially regulated in response to a mitochondrial To further validate our data, we also performed SYBR Green dysfunction. Several patterns of gene expression were quantitative RT-PCR assays for selected genes. Values obtained identified and some of them are illustrated in Fig. 7. In the first for a set of three genes upregulated in response to the pattern, expression of the gene was elevated at day 2 and then adipogenic cocktail were confirmed for different incubation declined (Fig. 7A). This group included adipsin, ATR I, Cav- times (Fig. 5A). For these genes we found a very good 1, CPT-2, cyclin D3, GLUT-4 and Gyk. In the second pattern, correlation of the relative transcript-abundance-data obtained gene expression was increased at day 2 and sustained during by DNA microarray and by RT-PCR. the whole programme, as for GPDmit (Fig. 7B). In the third group, gene expression was elevated at day 4 and maintained AA-induced gene expression profiles at high levels, as observed for CHOP-10, GATA-3, HSP60, We next analyzed the effect of AA-induced mitochondrial SCD-1 and TGF-␤1 (Fig. 7C). The last profile included genes dysfunction on gene expression in 3T3-L1 cells (Table 2). Few found to be downregulated from day 4 (AGT, C/EBP␣, CPT-1 genes were found to be continuously upregulated in cells L, MCAD, p18, Stat6, VEGF-C) or day 6 (ADD1, CL, NFATc2, responding to the inhibition of mitochondrial activity. These NFATc4, p110␣, Pref-1, resistin, SCD2, SDF1, SDF2, Smad3) genes included those encoding cytokines (PAI-1, TGF-␤1), of AA treatment (Fig. 7D). stress proteins (HSP 60), transcription factors (CHOP-10, GATA-3) and proteins involved in energy and lipid metabolism CREB-dependence of AA-regulated genes (GPDmit, FABP4/aP2, SCD1). Some genes were transiently The role of CREB in the modifications of gene expression upregulated in these conditions (adipsin, ATR I, Cav-1, cyclin induced by AA was further investigated using the powerful D3, GLUT-4, Gyk). We also found that AA reduces the combination of RNAi (to silence CREB) and microarray expression of many genes, such as ADD1, AGT, ASP, C/EBP␣, technology. This analysis was performed because CREB is an Coll VI␣2, CPT-1 L, FAS, GPDcyt, LPL1, MCAD, NFATc2, important transcription factor activated by mitochondrial NFATc4, p110␣, p18, Pref-1, resistin, SDF1, Smad3, Stat6 and dysfunction (Arnould et al., 2002), a primary regulator of VEGF-C. Relative transcript abundance for FAS and Clic4, adipogenesis leading to TG accumulation (Reusch et al., determined by RT-PCR at day 4 of AA treatment, is similar to 2000) and contributes to TG accumulation in AA-treated cells the values obtained with the microarray analysis on the same (Figs 3 and 4). 3T3-L1 cells were evenly divided into two samples (Fig. 5A). We also observed that AA increases the groups. One group was transfected with double-stranded abundance of mitochondrial glycerol-3-phosphate RNA olignucleotides directed against CREB transcripts, dehydrogenase (GPDmit) protein in 3T3-L1 cells (Fig. 5B), in whereas the other group was treated as a control with the accordance to upregulation of the GPDmit transcript (as siRNA delivery reagent JetSITM alone. Previous studies, determined with the microarray). targeted at the NF-␬B, HTLV-I tax and HIV-1 reverse The expression status of genes that were up- or down- transcriptase genes showed that unrelated siRNAs do not regulated by both AA and the adipogenic cocktail was compared after 2, 4, 6 and 8 days of treatment (Fig. 6).

Journal of Cell Science Although it is known that many stresses, including energetic stresses, trigger a shut-down of global transcription and protein synthesis (Buttgereit and Brand, 1995; Wieser and Krumschnabel, 2001), most of these genes were not known to

Up/Down- Gene Time regulation (fold change) C/EBP ␤ day 2 2.38 C/EBP ␤ day 4 1.27 C/EBP ␤ day 6 0.45 C/EBP ␦ day 2 3.36 C/EBP ␦ day 4 2.46 ␦ C/EBP day 6 0.57 Fig. 5. (A) Comparison of the results obtained with RT-PCR and Leptin day 8 6.30 DNA microarray analyses for FAS, Clic4 and CPT-2 genes. Cells were incubated for the indicated times with the adipogenic cocktail IL-6 day 8 0.11 (DIFF) or 10 nM antimycin A (AA) before RNA extraction, reverse- transcription and amplification in the presence of SYBR Green and Fig. 4. Effect of the adipogenic cocktail on the transcription levels of specific primers. TBP was used as a house keeping gene for data leptin, IL-6, C/EBP␤ and C/EBP␦ genes analyzed by RT-PCR. Cells normalization. (B) Western blot analysis for GPDmit performed on were incubated for the indicated times with the adipogenic cocktail 20 ␮g of clear cell lysate proteins prepared from 3T3-L1 cells before RNA extraction, reverse-transcription and amplification in the incubated or not (controls, CTL) for 2, 4, 6 or 8 days with 10 nM presence of SYBR Green and specific primers. TBP was used as a AA. Equal protein loading was controlled by the immunodetection of house-keeping gene for data normalization. PARP. Mitochondrial dysfunction triggers triglyceride accumulation 1273

impair gene expression that is specifically altered by TNF␣, that the JetSI reagent does not significantly modify the and give equivalent results to the transfection reagent alone expression of most genes analyzed by the microarray, when (Zhou et al., 2003). Thus, cells transfected or not with siRNA compared with the profiles obtained for two independent silencing CREB were incubated for 4 days with 10 nM AA RNA extractions prepared from 3T3-L1 cells that had been and processed for hybridization (Table 3). We first observed treated for 4 days with 10 nM AA (Table 3, AA1 and AA2

Table 2. Gene expression profiles of 3T3-L1 preadipocytes treated with antimycin A

Day 2Day 4Day 6Day 8 Day 2Day 4Day 6Day 8 Genes M.R. S.D. M.R. S.D. M.R. S.D. M.R. S.D. Genes M.R. S.D. M.R. S.D. M.R. S.D. M.R. S.D. AAAT 0.80 0.24 1.09 0.14 0.74 0.24 0.90 0.23 HSP 60 1.72 1.07 1.86 0.37 1.71 0.,18 2.02 0.67 Acrp30 1.06 0.44 ---HSP 84 1.09 1.35 0.31 1.08 0.15 1.07 0.16 Actin 1.25 0.29 0.83 0.16 0.81 0.27 0.84 0.21 HSP 86 ND 1.29 0.38 1.36 0.34 1.56 0.92 ADD1 1.39 0.17 0.68 0.09 0.48 0.09 0.52 0.05 IL-6 ND ++ + ++ Adipsin 3.07 1.32 0.47 0.28 0.09 0.20 0.13 iNOS 1.08 ND 1,02 ND AGT 1.27 0.39 0.63 0.25 0.35 0.07 0.49 0.04 Leptin ND 0.91 0.72 0.68 ASP 1.57 0.47 0.37 0.16 0.21 0.08 0.12 0.08 L-PK 0.77 1.19 0.09 1.08 0.09 1.17 0.39 ATR I 2.08 0.43 1.23 0.25 0.95 0.06 1.10 0.09 LPL1 1.17 0.01 1.07 0.29 0.69 0.04 0.53 0.23 ATR II 2.19 0.84 ND ------MCAD 1.10 0.31 0.46 0.14 0.26 0.06 0.32 0.08 β3AR - 0.99 0.86 0.85 MMP-2 1.05 1.26 0.34 1.03 0.17 0.65 0.34 CaMK IIγ - 0.91 0.16 0.51 0.09 0.75 0.18 NFATc2 1.22 0.13 0.91 0.05 0.68 0.11 0.61 CaMK IV 1.19 0.58 ND ND ND NFATc4 1.00 0.05 0.64 0.05 0.48 0.03 0.59 0.06 Cav-1 2.45 0.61 1.41 0.32 1.15 0.18 1.89 0.90 p110α 0.92 0.19 0.73 0.40 0.38 0.09 0.51 Cav-2 ++ 1.72 0.58 1.58 1.85 p18 0.89 0.17 0.52 0.06 0.39 0.07 0.41 0.08 C/EBPα 1.09 0.79 0.45 0.14 0.36 0.05 0.38 0.16 PAI-1 1.02 0.24 +++ 12.44 7.66 14.51 C/EBPβ 0.83 0.19 1.08 0.06 1.02 0.21 0.95 0.07 PEDF ND 0.77 0.17 0.67 0.07 0.52 0.08 C/EBPδ 1.32 0.24 0.74 0.29 0.42 0.13 0.59 0.28 PEPCK1 0.97 0.19 ND 0.91 ND CHOP-10 1.35 0.27 4.88 1.90 4.64 1.18 4.02 0.84 Plin ND 0.90 0.10 0.86 0.04 0.83 0.06 CL 1.22 0.45 0.67 0.03 0.51 0.10 0.72 0.29 PPARδ 0.95 0.02 1.28 0.12 1.05 0.08 1.07 0.10 Clic4 1.60 0.40 1.71 0.21 1.23 0.16 1.35 0.14 PPARγ 0.95 0.07 1.23 0.23 0.93 0.16 1.15 0.40 Coll VIα2 0.73 0.50 0.60 0.10 0.41 0.02 0.44 0.04 Pref-1 1.07 0.26 0.60 0.12 0.46 0.03 0.32 0.04 CPT-1 L 1.00 0.44 0.67 0.06 0.52 0.03 0.61 0.06 RAB3D 1.14 0.27 0.96 0.08 0.86 0.03 0.81 0.08 CPT-1 M 1.63 0.13 0.69 0.66 ND Renin 0.99 0.06 1.22 0.08 0.97 0.08 1.01 CPT-2 1.68 0.84 0.19 0.52 0.15 0.82 0.21 Resistin 0.97 0.85 0.57 0.57 CREB1 1.52 1.04 0.23 0.95 0.07 0.89 0.06 rRNA18s 1.01 0.19 0.67 0.44 0.80 0.08 0.74 0.25 Journal of Cell Science Cst C 1.48 0.31 1.25 0.17 1.03 0.11 0.94 0.22 RXRα ND 1.16 0.20 1.01 0.03 0.92 0.02 Cyclin D3 1.70 0.27 1.28 0.21 0.76 0.11 0.81 0.11 RXRγ 1.16 0.11 1.05 1.03 0.09 0.84 DHAPAT 1.61 0.43 1.10 0.24 0.78 0.11 0.97 0.19 SCD1 1.27 0.09 1.88 0.54 3.24 2.41 1.13 eNOS 2.05 1.09 0.05 0.81 0.09 0.93 0.11 SCD2 1.05 0.11 0.82 0.02 0.61 0.17 0.68 0.26 ERA ND 0.65 0.19 0.39 0.05 0.70 0.20 SDF1 0.79 0.10 0.87 0.07 0.54 0.10 0.37 0.19 FABP4/aP2 ND 3.26 0.82 2.23 0.41 2.44 0.17 SDF2 0.74 0.11 1.11 0.31 0.60 0.10 0.57 0.24 FAS ND 0.75 0.02 0.63 0.13 0.62 0.03 Smad3 0.91 0.09 0.78 0.22 0.53 0.02 0.55 0.14 GAPDH ND 1.11 0.14 1.08 0.06 1.05 0.13 SPARC 1.02 0.23 0.93 0.21 0.72 0.02 0.65 0.18 GATA-2 ND 0.70 0.20 0.55 0.27 0.67 SREBP-1 1.01 0.16 0.89 0.04 0.67 0.11 0.69 0.10 GATA-3 1.41 0.15 2.10 0.27 2.03 0.47 2.66 1.13 Stat6 0.91 0.10 0.54 0.16 0.34 0.02 0.45 0.07 GLUT-4 2.15 1.49 1.21 0.19 1.41 0.21 1.44 0.35 TBP 0.99 0.95 0.67 0.82 GPAT 2.42 2.11 0.77 0.19 0.50 0.06 0.55 TF 1.04 0.06 1.29 0.13 1.11 0.17 1.13 0.35 GPDcyt 1.33 0.60 0.74 0.50 0.18 0.55 TGF-β1 0.98 0.37 2.71 0.46 3.24 0.87 3.07 0.41 GPDmit 1.97 0.73 2.27 0.35 1.95 0.37 1.97 0.14 TNFα 0.88 0.18 ND ND ND Gsn 1.99 0.54 0.74 0.16 0.56 0.05 0.62 0.18 UCP-2 1.08 0.11 0.81 0.05 0.59 0.03 0.83 0.23 Gyk 2.25 1.17 1.50 1.49 1.53 VEGF-A 1.41 0.09 1.30 0.29 0.98 0.12 1.14 0.11 HCNP 0.83 0.25 1.13 0.12 0.97 0.04 1.11 0.11 VEGF-B 1.43 0.21 1.26 0.05 1.14 0.04 1.05 0.09 Hp 1.27 2.13 0.81 0.96 0.70 1.82 2.67 VEGF-C 1.18 0.12 0.58 0.11 0.34 0.05 0.37 0.01 HSD 1.08 0.35 ++ + ++ Wnt10b 0.80 0.17 ND ND ND HSL 1.56 1.15 0.95 0.12 1.04 0.22 0.80 0.17

Gene-expression profiling in 3T3-L1 preadipocytes treated with AA analyzed with the DNA microarray. Cells were incubated for 2, 4, 6 and 8 days with 10 nM AA before total RNA extraction, reverse-transcription and cDNA hybridization, as described in Materials and Methods. Each value is the average of three ratio values calculated from three – or two, when no standard deviation (S.D.) is indicated – independent RNA extractions for both reference and test conditions. Mean ratios (M.R.) indicate a fold-increase or decrease in gene expression. Significant mean ratios, obtained from ratios falling out of the 95% confidence interval, determined on the basis of house keeping gene variations are shown on a grey background. ND, transcript not detected in both conditions (test and reference). Qualitative ratios are represented as(+) <5; 5.1< (++) <10; 10.1< (+++) <25; (-) > –5; –10.1> (---) > –25; (----) <–25.1. For gene abbreviations, please refer to supplementary material Table S1. 1274 Journal of Cell Science 119 (7)

columns). We also found that, out of the 89 genes analyzed, Discussion the transcript abundance for eight genes (CHOP-10, Clic4, Numerous experimental data and observations reported from GPDmit, HSP 60, PAI-1, TF, VEGF-A and SCD1) was physiopathological situations and experimental models now significantly decreased by CREB-specific siRNA, suggesting clearly support a direct link between mitochondrial a role for CREB in the control of the transcription of these dysfunction and metabolic disorders, therefore addressing the genes in response to AA. On the opposite, the differential essential role of mitochondrial-activity impairment in expression of some genes, such as upregulation of FABP4 and alterations in lipid metabolism (Lowell and Shulman, 2005; downregulation of p18, is not affected by the inhibition of Petersen et al., 2003; Petersen et al., 2004). The myoclonic CREB expression in AA-treated cells. epilepsy with ragged red fibers (MERRF) syndrome that is

A 5 * * 4 * 3 * * * * * * * 2 * * 1 0 -1 -2 * Relative transcript abundance -3 * *

AAAT Cav-1 Pref-1 CPT-2 GPAT UCP-2 Adipsin PPARg C/EBPa GPDmit Resistin

DHAPAT CHOP-10 SREBP-1

10 45 B * * * 8 * 40 * 35 6 * * * * * 30 4 * * 25 * * * * 2 * * * * * 20 15 0 10 -2 * * 5 * Relative transcript abundance * -4 * Relative transcript abundance 0

CL Journal of Cell Science

FAS HSL

AAAT Cav-1 CPT-2 GPAT Pref-1 SCD2 SCD1 MCAD UCP-2 Adipsin HSP60 PPARd PPARg FABP4 C/EBPa GPDmit

DHAPAT CHOP-10 SREBP-1

20 80 C * * 70 15 60 * 50 * 10 * 40 * * * * 30 5 * * * * Fig. 6. Comparison of gene * * * 20 * * * * * * expression profiles as quantified 0 10 with the DNA microarray in * * * * 0 differentiating 3T3-L1 Relative transcript abundance * * * Relative transcript abundance -5 * * * -10 * adipocytes (white) and in 3T3-L1

CL Plin preadipocytes incubated with 10 FAS HSL

AAAT Cav-1 CPT-2 GPAT Pref-1 SCD2 MCAD UCP-2 HSP60 PPARd PPARg C/EBPa GPDmit nM antimycin A (grey). Cells Adipsin FABP4 DHAPAT CHOP-10 SREBP-1 were differentiated or treated D 10 70 with 10 nM AA for (A) 2, (B) 4, * (C) 6 and (D) 8 days; data are 8 60 * * * presented for some selected 6 * * 50 * * * * * genes to illustrate major 4 * * * 40 similarities and differences * * * * 2 * * * 30 * between both treatments. For the 0 20 other genes, see Tables 1 and 3. -2 10 Mean ratios indicate a fold- * * * * * -4 * increase or decrease in gene * ** 0 Relative transcript abundance Relative transcript abundance -6 -10 * expression. *, significant mean ratios, obtained from ratios CL

Plin FAS HSL

AAAT falling out of the 95% confidence Cav-1 Pref-1 SCD2 GPAT CPT-2 MCAD UCP-2 HSP60 FABP4 PPARg PPARd Adipsin GPDmit

DHAPAT SREBP-1 interval. CHOP-10 Mitochondrial dysfunction triggers triglyceride accumulation 1275

often caused by numerous point mutations (G611A, Transient up-regulation A A3243G, A8344G, G8361A, G12147A) in 3,0 at day 2 mtDNA, which affect genes encoding different 2,5 * Adipsin mitochondrial tRNAs (Mancuso et al., 2004; 2,0 ATR I 1,5 Mongini et al., 2002; Shoffner et al., 1990; Cav-1 Rossmanith et al., 2003; Melone et al., 2004), is 1,0

abundance CPT-2 also to some extent associated with lipid-storage 0,5

Relative transcript Cyclin D3 disorders and TG accumulation in muscles (Munoz- 0,0 2 4 6 8 days GLUT-4 Malaga et al., 2000; Naumann et al., 1997). It has Gyk also been shown that most of multiple symmetrical lipomatosis (MSL) patients also display B 3,0 * * mitochondrial dysfunction (Naumann et al., 1997; 2,5 * * Berkovic et al., 1991), lipomas that contain atypical 2,0 Sustained up-regulation multivacuolar white adipocytes (Zancanaro et al., 1,5 from day 2 1990) as well as ragged red fibers and TG 1,0 abundance GPDmit accumulation in muscles (Klopstock et al., 1997; 0,5 Munoz-Malaga et al., 2000). The role of Relative transcript 0,0 mitochondria in TG metabolism is also 2 4 6 8 days C strengthened by their implication in the 8 Sustained up-regulation lipodystrophy syndrome resulting from anti- * from day 4 retroviral therapies that combine drugs known to 6 * CHOP-10 inhibit mitochondrial DNA polymerase ␥ and * 4 GATA-3 mitochondrial processing protease (Kakuda, 2000; HSP 60

abundance 2 Brinkman et al., 1999). Cytosolic TG accumulation SCD-1 Relative transcript ␤ is also observed in cardiomyocytes incubated under 0 TGF- 1 hypoxia (Huss et al., 2001) and in preadipocytes 2468 days incubated with mitochondrial respiration inhibitors (Vankoningsloo et al., 2005). Both conditions lead to the downregulation of CPT-1 M (carnitine Sustained down-regulation palmitoyltransferase-1, muscle isoform) and a from day 4 from day 6 D 2,0 subsequent decrease in mitochondrial fatty acid ␤- AGT ADD1 1,0 C/EBPa CL oxidation. These data emphasize the link between 0,0 CPT-1 L NFATc2 mitochondrial dysfunction and abnormalities in TG MCAD NFATc4 -1,0 storage. However, even if TG accumulation in p18 p110a -2,0 * Stat6 Pref-1 abundance Journal of Cell Science response to mitochondrial alterations is of interest, * * -3,0 VEGF-C Resistin because it can modify cell sensitivity to agonists Relative transcript -4,0 SCD2 such as insulin (Lowell and Shulman, 2005), the 2 4 6 8 days SDF1 mechanisms leading to cellular TG accumulation in SDF2 these conditions remain largely unknown. Smad3 Cells with mitochondrial dysfunction provide an adaptative response mainly characterized by Fig. 7. Representative time-course profiles of gene expression in 3T3-L1 activation of glycolysis and a decrease in cell preadipocytes incubated with 10 nM antimcyin A, determined by the DNA proliferation. In addition, depending on cell type microarray is illustrated for (A) ATR I, (B) GPDmit, (C) CHOP-10 and (D) and model, several signaling pathways participate C/EBP␣. Similar profiles were obtained for the genes listed on the right in A-D. to the so-called ‘retrograde communication’ Mean ratios indicate a fold-increase or decrease in gene expression. *, between mitochondria and the nucleus, allowing the significant mean ratios, obtained from ratios falling out of the 95% confidence interval. cells to change the activity status of several transcription factors such as nuclear factor of activated T cells (NFAT), nuclear factor-␬B (NF- phosphorylated on Ser133 in PC12 cells incubated under ␬B) and CREB leading to modifications in gene expression hypoxia, another condition known to inhibit mitochondrial (Liu and Butow, 1999; Biswas et al., 1999; Butow and respiration (Beitner-Johnson and Millhorn, 1998; Beitner- Avadhani, 2004; Arnould et al., 2002). For example, we have Johnson et al., 2000). previously shown that CREB is activated by phosphorylation CREB is an ubiquitous transcription factor that regulates on Ser133 in the cell lines L929 and 143B, with impaired numerous cellular functions such as cell survival, proliferation mitochondrial activity induced either by mtDNA depletion or and differentiation, as well as glucose and lipid metabolism inhibitors of the oxidative phosphorylation such as AA, (Reusch and Klemm, 2002; Reusch et al., 2000; Della Fazia et oligomycin or FCCP (Arnould et al., 2002). A constitutive al., 1997; Zhou et al., 2004; Herzig et al., 2003). Here we activation of CREB was also found in cybrid cells, with the clearly show that CREB is phosphorylated on Ser133 and A8344G mutation in the mitochondrial genome described to transcriptionally more active in 3T3-L1 preadipocytes when be responsible for the MERRF syndrome (Arnould et al., mitochondrial activity is inhibited by AA, a complex-III 2002). Interestingly, CREB has also been reported to be inhibitor. The kinase that phosphorylates CREB in AA-treated 1276 Journal of Cell Science 119 (7)

Table 3. Determination of CREB-regulated genes among genes differentially expressed in 3T3-L1 preadipocytes treated with antimycin A

Genes AA 1 AA 2 AA+JetSI AA+siRNA Genes AA 1 AA 2 AA+JetSI AA+siRNA AAAT 1.11 1.26 1.38 -1.19 HSP 60 2.02 1.80 1.46 -1.92 Acrp30 ------ND ND HSP 84 1.11 -1.10 -1.04 -2.08 Actin 1.11 1.14 1.16 1.08 HSP 86 1.86 1.08 1.07 1.00 ADD1 -1.54 -2.08 -1.82 -1.45 IL-6 ND ND ND ND Adipsin - - - - - ND ND iNOS ND ND ND ND AGT - -2.86 - ND Leptin ND ND ND ND ASP -3.12 -10.00 -7.14 -1.85 L-PK 1.18 1.43 -1.07 -1.64 ATR I 1.13 -1.19 -1.11 -1.09 LPL1 -1.08 -2.22 -1.51 -3.12 ATR II ND ND ND ND MCAD - -2.63 -2.44 - β3AR ND ND ND ND MMP-2 -1.35 -1.59 -1.96 1.03 CaMK IIγ -1.16 -1.51 -1.35 -2.00 NFATc2 ND 1.22 - - CaMK IV ND ND ND ND NFATc4 -1.85 -1.79 -1.82 -1.33 Cav-1 2.40 1.35 1.09 -1.51 p110a -1.35 -1.79 - - Cav-2 ND ND ND ND p18 -1.02 -2.78 -1.96 -1.69 C/EBPα -- - NDPAI-1 ++++ ++++ +++ -1.75 C/EBPβ -1.04 -1.18 -1.18 1.03 PEDF -1.39 -1.23 -1.28 1.09 C/EBPδ -1.51 -1.32 -1.43 -1.18 PEPCK1 ND ND ND ND CHOP-10 6.61 5.81 3.68 -1.59 Plin -1.37 -1.12 -1.10 1.80 CL -1.26 -1.39 -1.28 -1.85 PPARd 1.01 1.02 -1.14 -1.30 Clic4 1.60 1.50 1.36 -1.82 PPARg -1.30 1.23 1.10 -1.75 Coll VIα2 -1.79 -2.32 -2.00 1.09 Pref-1 -1.85 -2.13 -1.96 1.25 CPT-1 L -1.27 -1.96 -1.72 -1.54 RAB3D 1.45 1.06 -1.06 - CPT-1 M ND ND ND ND Renin ND 1.05 ND ND CPT-2 -1.05 -1.27 -1.23 -1.09 Resistin - - ND ND ND CREB1 -1.14 -1.12 -1.14 - rRNA18s -1.04 -1.23 -1.14 1.01 Cst C -1.07 -1.05 -1.14 -1.23 RXRa -1.14 -1.03 1.18 -1.09 Cyclin D3 -1.10 -1.07 -1.11 -1.09 RXRg ND ND ND ND Journal of Cell Science DHAPAT ND 1.00 -1.12 1.61 SCD1 -2.00 1.30 1.07 -1.72 eNOS -1.33 1.18 -1.06 -1.33 SCD2 -1.75 -1.51 -1.59 -1.67 ERA -1.54 -2.04 -1.30 -1.19 SDF1 -1.20 -2.94 -2.32 -1.28 FABP4/aP2 -2.00 1.74 2.11 3.03 SDF2 -1.16 -2.00 -2.04 -1.72 FAS -2.08 -1.27 -1.89 -1.16 Smad3 -1.59 -1.67 1.01 -1.09 GAPDH 1.04 1.06 1.04 -1.04 SPARC -1.45 -1.22 -1.11 -1.11 GATA-2 - -1.59 -1.07 1.13 SREBP-1 -1.82 -1.51 -1.30 -1.23 GATA-3 ND + + -1,30 Stat6 - -1.56 -1.61 - GLUT-4 -1.05 1.20 ND - TBP ND ND ND - GPAT - -1.67 - - TF 1.03 -1.11 1.26 -2.56 GPDcyt - - - - ND ND TGF-b1 2.48 1.99 1.94 -1.01 GPDmit 1.64 1.65 1.66 -2.56 TNFa ND ND ND ND Gsn -1.79 -1.45 -1.43 -1.22 UCP-2 -1.56 -1.11 -1.19 -1.19 Gyk ND ND ND ND VEGF-A -1.11 1.14 1.50 -2.27 HCNP -1.27 -1.11 -1.02 -1.25 VEGF-B 1.05 1.00 1.12 -1.12 Hp -1.89 -5.88 -3.22 -1.51 VEGF-C -1.18 -1.85 -1.23 -2.00 HSD ND ND ND ND Wnt10b ND ND ND ND HSL -1.72 -1.20 -1.14 1.11

Effect of CREB knock-down induced by specific siRNA on gene expression in AA-treated 3T3-L1 cells analyzed with the DNA microarray. Cells were transfected for 4 hours with 100 nM siRNA (AA + siRNA) or incubated for 4 hours with JetSI (AA + JetSI) and then incubated for 4 days with 10 nM AA before RNA extraction, retro-transcription and hybridization. Results are compared with those of two independent experiments performed on 3T3-L1 cells incubated for 4 days with 10 nM antimycin A before RNA extraction, retro-transcription and hybridization (AA1 and AA2). Significant ratios falling out of the 95% confidence interval are shown in grey. Data are expressed as detailed in tables 1 and 3. Qualitative ratios are represented as (+) <5; 10.1< (+++) <25; (++++) >25.1; (-) >–5; -5.1> (--) >–10; –10.1> (---) >–25; (----) <–25.1. For gene abbreviations, please refer supplementary material Table S1. Mitochondrial dysfunction triggers triglyceride accumulation 1277

3T3-L1 cells remains to be identified but CaMK IV is a good adipogenesis, e.g. several transcription factors (C/EBP␣, candidate because it is the effector in mtDNA-depleted cells PPAR␥, RXR␣, SREBP-1), enzymes involved in fatty acid and (Arnould et al., 2002). However, several other kinases such as TG metabolism (DHAPAT, FABP4/aP2, FAS, GPAT, SCD1, PKA (protein kinase A), PKB/Akt, CaMK I/II or ribosomal S6 SCD2), and adipokines (AGT, resistin) (MacDougald and kinase 1/2 (RSK1/2) could also play a role because they Lane, 1995; Gregoire et al., 1998; Burton et al., 2004; Hajra et phosphorylate CREB in response to various stimuli al., 2000; Song et al., 2002). We also observed the (Johannessen et al., 2004; Shaywitz and Greenberg, 1999). A downregulation of anti-adipogenic markers, such as Pref-1, an decrease in PP1 or PP2A (protein phosphatase 1 or 2A, autocrine and/or paracrine inhibitor of adipogenesis, and the respectively) activity can also be considered because these transcription factors GATA-2 and GATA-3. These genes have enzymes dephosphorylate CREB (Hagiwara et al., 1992; been reported to be only highly expressed in preadipocytes Wadzinski et al., 1993). (Lee et al., 2003; Tong et al., 2005). Second, we used RT-PCR CREB activation that is induced by impaired mitochondrial to confirm the data obtained in the microarrays for FAS, Clic4 activity in different cell types, suggests an important role for and CPT-2. We observed in this study that, several proteins this transcription factor in the adaptative cell response to known to be overexpressed by differentiating 3T3-L1 cells energetical stress. Although the molecular mechanisms are still (Welsh et al., 2004) are also upregulated at the transcript level, unidentified, we clearly show that CREB is involved in the e.g. Acrp30 and GPDcyt. Third, by using a proteomic cytosolic accumulation of TG induced by a prolonged (several approach, Kratchmarova et al found that several proteins are days) exposure of 3T3-L1 preadipocytes to AA. Indeed, the secreted by differentiating 3T3-L1 cells (Kratchmarova et al., amount of TG accumulated in cells treated for 8 days with AA 2002); we found that mRNA levels of some of these proteins, is reduced by overexpression of the dominant negative forms such as Acrp30, adipsin, Gsn, Hp, resistin and MMP-2, were of either K-CREB or M1-CREB (by about 40%) and the also upregulated. By contrast, we observed that PEDF, known silencing of CREB expression in transiently transfected cells to be secreted mainly by undifferentiated preadipocytes with a specific siRNA (by 75%). The weaker inhibitory effect (Kratchmarova et al., 2002), is downregulated during 3T3-L1 of dominant negative mutants might be caused by a lower adipogenesis. transfection efficiency of plasmids (ranging from 20 to 40% as To highlight similarities and differences of gene expression determined in subconfluent cells transfected with a plasmid profiles in differentiating cells and also in preadipocytes with encoding a pCMV-␤-galactosidase as a reporter gene) impaired mitochondrial activity (cellular circumstances that compared with that of siRNA. However, a lesser inhibition of in both cases lead to the accumulation of TG) we next TG accumulation, observed in cells that overexpress dominant analyzed changes in gene expression in preadipocytes negative CREB mutants, might also be owing to a brief incubated with AA for different times and compared these inhibition of CREB activity, caused by dominant negative gene expression profiles with those observed during the mutants, whereas a longer-lasting effect is obtained in the differentiation of 3T3-L1 cells. For example, we found hat presence of siRNA. both AA and the adipogenic cocktail downregulate Pref-1 and CREB silencing was shown to take place during the first 48 upregulate some adipogenic genes involved in fatty-acid and

Journal of Cell Science hours post-transfection with siRNA but was transient because sterol metabolism, such as FABP4/aP2, SCD1 and HSD. We CREB expression is recovered after 96 hours (data not shown). found that many genes that are upregulated during in vitro Since TG accumulated significantly after 7 to 8 days of adipogenesis (such as those encoding the transcription factors treatment (Vankoningsloo et al., 2005), our data suggest that C/EBP␣, PPAR␦, PPAR␥, RXR␣ and SREBP-1, the lipid- the rapid CREB activation induced by AA triggers a cascade metabolizing enzymes DHAPAT, FAS, HSL and LPL1, or the of events, leading to TG accumulation later on. CREB adipokines AGT and resistin) are either unaffected or activation in 3T3-L1 cells responding to a pro-adipogenic downregulated by AA. Furthermore, AA also induces the cocktail was also detected very early in differentiation, before transcription of anti-adipogenic transcription factors, such as any TG started to accumulate (Reusch et al., 2000). We thus GATA-3 and CHOP-10 (an endogenous dominant negative identified CREB as a key-effector in cytosolic accumulation of protein that heterodimerizes with C/EBP family members and TG, induced by AA in 3T3-L1 cells. represses C/EBP-dependent transcription) (Ron and Habener, To better understand the metabolic origin of TG 1992). CHOP-10 overexpression in AA-treated 3T3-F442A accumulation in 3T3-L1 preadipocytes with impaired cells has been previously reported and shown to prevent mitochondrial activity, we developed and used a low-density adipogenesis (Carriere et al., 2004). All together, these data DNA microarray that allowed simultaneous gene-expression suggest that AA does not induce the expression of classic analysis for numerous adipogenic markers. We validated the adipogenic markers. It is therefore likely that the mechanisms data obtained in the array experiments by several means. First, leading to TG accumulation in response to a mitochondrial using the 3T3-L1 preadipocyte cell line was advantageous dysfunction are not the same as those described for cell because it has been used extensively to investigate differentiation into adipocytes, a conclusion that also differentiation-dependent gene expression in adipocytes emerged from our previous report (Vankoningsloo et al., (Rosen and Spiegelman, 2000; Guo and Liao, 2000; Burton et 2005). al., 2002; Burton et al., 2004; Ross et al., 2002). Since these Transcripts for Gyk (glycerol kinase) were not detected previous studies have led to the identification of several genes during adipogenesis, probably because of their very low that are differentially expressed during differentiation, any new abundance. However, Gyk mRNA levels raise to detectable approach should also successfully pick up these genes and, in levels in cells incubated with AA, and Gyk is transiently doing so, serve as a compelling control method. Indeed, we overexpressed under this condition. Since glycerol kinase found that many adipogenic markers were upregulated during converts glycerol into glycerol-3-phosphate, a direct precursor 1278 Journal of Cell Science 119 (7)

of TG (Lin, 1977), it might also contribute to the accumulation promoter, despite the fact that it seems to depend on CREB of TG in 3T3-L1 cells treated with AA. Moreover, the expression because it is downregulated when CREB is silenced downregulation of genes, such as CPT-1, that encode enzymes by specific siRNA), one can not exclude that the CREB- of the mitochondrial fatty acid ␤-oxidation, controlling the dependence of gene expression is an indirect effect. mitochondrial entry of free fatty acids, and MCAD, a fatty acyl Overexpression of GPDmit protein in AA-treated 3T3-L1 dehydrogenase, is in agreement with our previous findings, cells has been verified and GPDmit was considered a potential showing that AA-induced TG accumulation could result, at candidate linking CREB activation to TG accumulation in least partly, from a decrease in fatty acid ␤-oxidation response to mitochondrial dysfunction. Indeed, GPDmit (Vankoningsloo et al., 2005). Interestingly, MCAD knockout mice display reduced adiposity and body weight, transcription is controlled by PPAR transcription factors suggesting that this enzyme is involved in the control of TG (Gulick et al., 1994), and we have recently shown that the synthesis and/or storage (Brown et al., 2002). However, cells activity of PPAR␥ is decreased in cells treated with AA transfected – either before or after a 5-day treatment with AA (Vankoningsloo et al., 2005). Cav-1 has recently been shown – with an efficient GPDmit-specific siRNA that inhibits to associate with intracellular lipid droplets and to modulate, GPDmit expression at the protein and transcript level still in combination with perilipin, both lipolysis and vesicle accumulate the same amount of TG (as determined by Oil Red formation (Cohen et al., 2004). In this study, we showed that O staining) in response to an 8-day treatment with AA, when the Cav-1 gene is upregulated during 3T3-L1 cell adipogenesis compared with control cells (data not shown). These results and also (although to a lesser extent) during AA treatment. suggest that GPDmit is not involved in the lipid deposition in Therefore, these differencies in Cav-1 expression might also cells with impaired mitochondrial activity. contribute to the fact that TG vesicles accumulating in 3T3-L1 CREB has also been described to control hepatic lipid cells incubated with AA are smaller compared with those in metabolism by indirectly repressing PPAR␥ and by inducing differentiating 3T3-L1 cells. PGC-1␣ (Herzig et al., 2003). PGC-1␣ is a co-activator of By using siRNA to disrupt CREB expression, we found that numerous transcriptional regulators and is involved in several the transcription of several genes (CHOP-10, Clic4, GPDmit, cell functions such as mitochondrial biogenesis (Scarpulla, HSP 60, PAI-1, TF, SCD1 and VEGF-A) might depend on AA- 2002), gluconeogenesis (Herzig et al., 2001), and lipid induced CREB activation. Furthermore, it is interesting that catabolism because it controls the expression of genes some of these genes contain between one and six putative encoding mitochondrial fatty-acid-oxidation enzymes (Vega et CRE sites in their promoters [determined by in silico al., 2000). Although PGC-1␣ expression could not be analyzed promoter analysis with the Data Base for Transcriptional using the microrray, we monitored its expression in RT-PCR Start Sites (http://dbtss.hgc.jp) and TF Search and western blots, and found that PGC-1␣ mRNA and protein (http://molsun1.cbrc.aist.go.jp/research/db/TFSEARCH.html)]. levels remain stable – and even slightly decreased in cells However, in silico identification of potential consensus incubated for 24 or 48 hours with 10 nM AA or the adipogenic sequences for transcriptional regulators does not reveal any cocktail (data not shown), two conditions that activate CREB information concerning their biological relevance. To test the in 3T3-L1 cells. The absence of CREB-dependent PGC-1␣

Journal of Cell Science functionality of the CRE motifs, gene expression analysis regulation might seem surprising. However, various using the DNA array was performed in 3T3-L1 cells that had transcription factors have been identified to control PGC-1 been incubated for 48 hours with 1 mM dibutyryl cyclic AMP expression in tissues other than liver and among them, ATF-2 (db-cAMP) , a component of the adipogenic cocktail and a in brown adipocytes (Cao et al., 2004), MEF-2 in muscle tissue well-known activator of the PKA-CREB pathway (Boissel et (Czubryt et al., 2003), and orphan nuclear receptor ERR␥ in al., 2004; Chio et al., 2004). We first tested whether db-cAMP brown adipocytes (Wang et al., 2005). Furthermore, in cells can activate the CREB-responsive luciferase reporter gene. A transfected with a smart-pool of four siRNAs specific for PGC- 2.8-fold increase was found after 48 hours of treatment (data 1␣ [which reduce the expression of the gene by more than 50% not shown). Under these conditions, a significant upregulation (data not shown)] either before or during the treatment with of candidate genes was only found for VEGF-A and SCD1 (1.8- AA, no modification was found in the accumulation of TG in fold increase). Although the discrepancy of these two sets of 3T3-L1 preadipocytes treated with the metabolic inhibitor data is unknown we suggest that, either not all CRE sites are (data not shown). functional or they require the contribution of other regulators Finally, the SCD1 gene might also be an interesting as partners in the promoter to be fully active. These regulator candidate to explain TG accumulation in preadipocytes with sets might be different in db-cAMP- and AA-treated cells. It impaired mitochondrial activity. Indeed, this gene encodes the has been reported that, in liver, the cAMP-sensivity of several enzyme that catalyzes the ⌬9-cis desaturation of fatty acids genes, such as tyrosine aminotransferase (TAT) or PEPCK (e.g. palmitoyl-CoA and stearoyl-CoA to palmitoleoyl-CoA depends on the cooperative action of CREB and HNF4␣ or and oleoyl-CoA, respectively), altogether representing up to CREB and C/EBPs, respectively (Nitsch et al., 1993; Roesler, 60% of the fatty acids esterified into TGs in differentiated cells 2000). A similar cooperation between CREB and HNF4␣ has (Kasturi and Joshi, 1982). SCD1 is upregulated in AA-treated also been shown for the transcriptional control of CPT-1 L 3T3-L1 cells, is downregulated following the inhibition of (Louet et al., 2002). These data suggest that the molecular CREB expression and contains a cAMP-dependent regulatory mechanisms involved in the cAMP-mediated induction of element in its promoter sequence (position –285 to –278 target genes is more complex than the simple presence of a relative to the start of transcription) (Ntambi et al., 1988). CRE motif requiring a cooperation between several factors. In Recently, Miyazaki et al. showed that a lipogenic diet failed to addition, as for the expression of VEGF-A (a gene for which induce hepatic triglyceride synthesis in SCD1(–/–) mice, despite in silico analysis failed to reveal any potential CRE sites in the the induction of FAS and GPAT (Miyazaki et al., 2001). The Mitochondrial dysfunction triggers triglyceride accumulation 1279

authors suggested that SCD1 activity would thus help to Aliquots were frozen at –70°C and protein concentrations were determined produce substrates within the vicinity of GPAT to aid in the according to Bradford (Bradford, 1976). efficient esterification of glycerol 3-phosphate for TG Western blot analysis synthesis. Although the role of this enzyme in TG Samples corresponding to 20 ␮g or 40 ␮g of protein were prepared in Laemmli accumulation has been clearly established (Ntambi et al., SDS loading buffer, resolved on 10% SDS-PAGE and transferred to PVDF 2002), its regulation and potential implication as an effector in membranes (Millipore). For detection of phosphorylated CREB (pCREB), membranes were blocked for 3 hours in TBS-T (20 mM Tris pH 7.4, 150 mM NaCl, the accumulation of TG in response to mitochondrial 0.1% Tween-20) containing 5% bovine serum albumin (BSA, Sigma) and incubated dysfunction is awaiting future studies in cells with modified for 16 hours (4°C) with a rabbit antibody that recognizes Ser133 pCREB (Upstate) SCD1 gene expression. at a 1:1000 dilution. For detection of CREB, GPDmit, PGC-1␣, TBP and PARP, membranes were blocked for 3 hours in TBS-T containing 5% dry milk (Gloria) In conclusion, although the molecular mechanism(s) and and incubated for 1 hour with either an anti-CREB (Rockland) rabbit antibody at a target gene(s) by which activated CREB, a factor involved in 1:1000 dilution, an anti-GPDmit rabbit antibody at a 1:4000 dilution, an anti-PGC- many cellular processes and in the regulation of several 1␣ rabbit antibody at a 1:1000 dilution, an anti-TBP (Santa Cruz) rabbit antibody at a 1:1000 dilution or an anti-PARP (Pharmingen) mouse antibody at a 1:2000 hundred genes, leads to TG deposition in preadipocytes with dilution. The blots were washed and proteins were visualized with a horseradish impaired mitochondrial activity still await discovery, our study peroxidase (HRP)-conjugated anti-rabbit or anti-mouse IgG antibody (Dako) and clearly extends the role of the ubiquitous CREB transcription enhanced chemiluminescence (ECL) system (Pierce). Equal protein loading was factor. We bring some evidence for its contribution to lipid checked by the immunodetection of TBP or PARP. metabolism alterations in preadipocytes with mitochondrial CREB-DNA-binding assay dysfunction. We also show that the mechanisms leading to TG To detect the DNA-binding activity of a transcription factor we used the TransAM accumulation in response to mitochondrial dysfunction are ELISA kit (Active Motif) according to the manufacturer’s recommendations. The ELISA DNA-binding assays are based on multi-well plates coated with an different than those described for lipid accumulation observed oligonucleotide containing the consensus binding site of the transcription factor of during cell differentiation, which is triggered by a standard interest. The presence of the DNA-bound transcription factor is then detected by hormon cocktail; we identified new potential targets involved specific antibodies and revealed by colorimetry. The specificity, selectivity and high reproducibility of these assays have been previously demonstrated for nuclear in the acquisition of the phenotype. All together, these data factor-␬B (NF-␬B) (Renard et al., 2001), hypoxia-inducible factor-1 (HIF-1) contribute to a better molecular understanding of the (Mottet et al., 2002) and peroxisome proliferator-activated receptor ␥ (PPAR␥) mechanisms leading to TG accumulation in response to (Vankoningsloo et al., 2005). Briefly, 10 ␮g of nuclear proteins were incubated for 2 hours in a 96-well plate mitochondrial dysfunction in various pathologies such as MSL coated with a double-stranded oligonucleotide containing the consensus CRE site or lipodystrophy syndromes. (TGACGTCA). Total CREB bound to DNA was detected with a rabbit antibody raised against CREB (Rockland) and presence of the phosphorylated form was Materials and Methods determined with an anti-Ser133-pCREB rabbit antibody (Upstate). Colorimetric reaction was then performed with a HRP-conjugated anti-rabbit IgG antibody and Cell culture and experimental models absorbance was measured at 450 nm in a spectrophotometer (Biorad). 3T3-L1 fibroblasts, purchased from the American Type Culture Collection (ATCC), were grown to confluence in Dulbecco’s modified Eagle’s high glucose (DHG) Immunofluorescence staining and confocal microscopy medium containing 4.5 g/l glucose (Invitrogen) and 10% fetal calf serum (FCS, 3T3-L1 cells were seeded at 40,000 cells/well on coverslips (Assistent) in 24-well GibcoBRL). Differentiation of 3T3-L1 cells was initiated at confluence (day 0) by plates; 3 days later cells were incubated or not for 24 hours with the adipogenic addition of medium containing an adipogenic cocktail, DHG-L1 medium (DHG cocktail or with 10 nM AA. Cells were washed once with PBS, fixed and Journal of Cell Science containing 1.5 g/l NaHCO3), supplemented with 10% FCS, 5 ␮g/ml insulin (Sigma), ␮ ␮ permeabilized with methanol-acetone (1:4, v/v) at –20°C for 10 minutes. Cells were 300 M dibutyryl cyclic AMP (db-cAMP, Sigma) and 1 M dexamethasone then washed twice with PBS containing 1% BSA (Sigma) and incubated for 90 (Sigma). After 2 days, cells were transferred to adipocyte growth medium (DHG- minutes at room temperature with a specific rabbit antibody raised against ␮ L1 containing 10% FCS and 5 g/ml insulin) and re-fed every two days. To induce Ser133pCREB (Upstate) used at a 1:100 dilution in 1% BSA-PBS. Cells were a prolonged mitochondrial inhibition, confluent cells (day 0) were incubated in washed twice in PBS with 1% BSA, incubated for 60 minutes with an Alexa-Fluor- DHG-L1 supplemented with 10% FCS and AA) or chloramphenicol (Sigma). When 568-conjugated anti-rabbit IgG antibody (Molecular Probes) at a 1:500 dilution in needed, medium was replaced every other day with DHG-L1 containing the above 1% BSA-PBS and processed for fluorescence confocal microscopy (TCS confocal supplements at the same concentration. TG accumulation in cells was monitored by microscope Leica). Oil Red O staining as described previously (Vankoningsloo et al., 2005). Briefly, cell monolayers were washed with PBS and then fixed for 2 minutes with 0.5 ml Transient transfection and luciferase assay 3.7% paraformaldehyde (Sigma) in PBS. Oil red O (Sigma) was added for 30 3T3-L1 cells, seeded at 80,000 cells/well in 12-well plates 24 hours before minutes at room temperature and cells were washed twice with PBS. TGs were transfection, were transiently co-transfected for 6 hours with 0.75 ␮g of a luciferase visualized by light phase contrast microscopy and quantitative determination was reporter construct driven by the ␣-inhibin promoter and 0.25 ␮g of an expression obtained by measuring the absorbance of cell monolayers at 490 nm in a vector encoding ␤-galactosidase (Invitrogen) using SuperFect (5 ␮l/␮g DNA) spectrophotometer (Ultramark, Biorad). (Qiagen). The next day, cells were incubated for 24 hours with the adipogenic cocktail or 10 nM AA, or for 48 hours with 1 mM db-cAMP diluted in DHG-L1 Clear cell lysate preparation and nuclear proteins extraction medium. Cells were then harvested, luciferase activity was measured in cleared 3T3-L1 cells cultured in 75 cm2 flasks or in 12-well plates (both Corning) were lysates using the commercial Reporter Assay System (Promega) and results were rinsed with PBS and lysed in respectively 1 ml or 150 ␮l of cold lysis buffer (20 normalized against ␤-galactosidase activity. mM Tris pH 7.4, 150 mM NaCl, 1 mM EDTA, 1% Triton-X100) containing protease To determine the putative role of CREB in the accumulation of TG, cells were inhibitors (Roche) and phosphatase inhibitors (1 mM Na3VO4, 5 mM NaF, 10 mM seeded in 24-well plates and transiently transfected for 6 hours with 1 ␮g/well of p-nitrophenylphosphate, 10 mM ␤-glycerophosphate). Clear cell lysates were plasmids encoding M1-CREB and K-CREB, or EGFP (Clontech) as a negative prepared and protein contents was determined by the BCA method (Pierce). control, using SuperFect (5 ␮l/␮g DNA). The next day, cells were induced to Nuclear protein extractions in high-salt buffer were prepared as previously differentiate with the adipogenic cocktail or incubated with 10 nM of AA for 8 days described (Chen et al., 1996). Briefly, cells seeded in 75 cm2 flasks were incubated before neutral lipid content was determined by Oil Red O staining. with 10 nM AA or the pro-adipogenic cocktail for 24 hours. At the end of the incubations, 3T3-L1 cells were incubated on ice for 3 minutes with 10 ml cold Low-density DNA microarray hypotonic buffer (HB; 20 mM HEPES, 5 mM NaF, 1 mM Na2MoO4, 0.1 mM Array design EDTA) and harvested in 500 ␮l HB containing 0.2% NP-40 (Sigma), a protease We developed an ‘ADIPOCHIP’, a low-density DNA array allowing gene inhibitor cocktail and phosphatase inhibitors. Cell lysates were centrifuged 30 expression analysis of 89 murine genes related to adipocyte differentiation in seconds at 13,000 rpm in a tabletop centrifuge and sedimented nuclei were collaboration with Eppendorf (Germany) (see supplementary material Table S1 for resuspended in 50 ␮l HB containing 20% glycerol, and protease and phosphatase the list of genes, and Fig. S1 for the array design). Results using reliable and inhibitors. Extraction was performed for 30 minutes at 4°C by addition of 100 ␮l validated arrays developed by Eppendorf were reported elsewhere (de Longueville HB containing 20% glycerol, 0.8 M NaCl, and protease and phosphatase inhibitors. et al., 2002; de Longueville et al., 2003; de Magalhaes et al., 2004; Debacq- 1280 Journal of Cell Science 119 (7)

Chainiaux et al., 2005). The method is based on a system with two arrays (a control specific siRNA sense-orientation strand with the following sequence (5Ј- and a test) on a glass slide and three identical sub-arrays (triplicate spots) per array. UACAGCUGGCUAACAAUGGdTdT-3Ј) was selected. To investigate the potential Except for C/EBP␤ and C/EBP␦, no cross-hybridization was detected. The contribution of GPDmit and PGC-1␣, some experiments were performed with a reliability of hybridizations and experimental data was evaluated using several GPDmit-specific siRNA (Eurogentec: 5Ј-UCAGCUCCGUUGCCUAUCAdTdT-3Ј) positive and negative hybridization controls as well as detection controls spotted on or with a smart-pool of four specific siRNA for PGC-1␣ (Dharmacon). Cells were the microarray. transfected with the siRNA delivery reagent JetSITM (Eurogentec) at 3 ␮l/␮g of siRNA according to the manufacturer’s instructions. Transfection efficiency in cells RNA reverse transcription and cDNA hybridization plated on coverslips was determined with fluorescein isothiocyanate (FITC)-labeled 3T3-L1 cells cultured in 75 cm2 flasks were incubated for 2, 4, 6 or 8 days with 10 siRNA and evaluated by cell counting using a confocal microscope (Leica) to be nM AA, and the adipogenic cocktail, or for 2 days with 1 mM db-cAMP. In some 90-95% after 24 and 48 hours. experiments, cells were transfected with 100 nM CREB-specific siRNA before Efficiency of RNA interference on CREB, GPDmit and PGC-1␣ expression was being incubated for 4 days with 10 nM AA. At the end of the incubations, total determined by either western blot analysis or by RT-PCR with specific primers. 3T3- RNA was extracted with the Total RNAgents extraction kit (Promega), quality was L1 cells were seeded in 6-well plates at 200,000 cells/well 24 hours before being checked with a bioanalyzer (Agilent Technologies) and 20 ␮g were used for reverse transfected for 4 hours by using JetSI with 10, 20, 50 or 100 nM CREB siRNA, transcription in the presence of biotin-11-dCTP (Perkin-Elmer) and Superscript II 100 nM GPDmit siRNA, or 100 nM siRNA PGC-1␣. Medium was replaced and reverse transcriptase (Invitrogen), as described previously (de Longueville et al., gene silencing was verified 48 hours post-transfection. The effect of the disrupting 2002). Three synthetic poly(A)-tailed RNA standards (Eppendorf) were added at 10 the expression of CREB, GPDmit or PGC-1␣ by siRNA on AA-induced TG ng, 1 ng or 0.1 ng per reaction) into the purified RNA to quantify the experimental accumulation was analyzed as followed: 3T3-L1 cells (70-80% confluent) seeded variation introduced during labeling and analysis. For the kinetic profiles of gene in 24-well plates were treated or not for 5 days with 10 nM AA and then transiently expression, three independent experiments were performed in triplicate, providing transfected with 100 nM siRNA or an equivalent amount of JetSI alone. After hybridization on nine arrays that were carried out as described by the manufacturer transfection, cells were incubated for 3 and 8 days with or without 10 nM AA, and and reported previously (de Longueville et al., 2002). Detection was performed with TGs were stained with Oil Red O. To identify genes potentially regulated by CREB a cyanin 3-conjugated IgG anti-biotin (Jackson ImmunoResearch Laboratories). that might play a role in the cellular accumulation of TG in response to AA, CREB Fluorescence of hybridized arrays was scanned with the Packard ScanArray (Perkin- expression was disrupted with siRNA. 3T3-L1 cells were plated in 75 cm2 flasks at Elmer) at a resolution of 10 ␮m. To maximize the dynamic range of detection, the 50% confluence 3 days before transfection in the presence of 100 nM siRNA or same arrays were scanned with different photomultiplier gains to quantify both the were incubated with JetSI. After 24 hours, cells were incubated for 4 days with 10 high-copy and low-copy expression of genes. The scanned 16-bit images were nM AA before extraction of total RNA, reverse transcription of mRNA, biotin- imported into ImaGene 4.1 software (BioDiscovery) to quantify signal intensities. labeling of cDNA and hybridization on microarrays. The fluorescence intensity of each DNA spot (average intensity of each pixel present within the spot) was calculated by subtracting local mean background. A signal was T.A. is a research associate of the FNRS (Fonds National de la only accepted when the average intensity after background subtraction was at least 2.5ϫ higher than the local background around the spot. Intensity values of triplicate Recherche Scientifique, Belgium). S.V. is a recipient of a doctoral fluorescent signals were averaged and used to calculate the intensity ratio of fellowship from Fonds pour la Recherche dans l’Industrie et reference and test. l’Agriculture (FRIA). We are very grateful to Michael E. Greenberg (Harvard Medical School, Boston, MA, USA) for the constructs Data normalization encoding dominant negative forms of CREB (K-CREB and M1- The data were normalized in two steps. First, a correction was applied using a factor calculated from the intensity ratios of internal standards in the reference and test CREB). We also want to thank Joachim M. Weitzel samples. The presence of the internal standard probes at different locations of the (Universitätsklinikum, Hamburg-Eppendorf, Germany) for the anti- array allowed quantification of the local background and evaluation of the array GPDmit antibody and Daniel P. Kelly (Center for Cardiovascular homogeneity that is taken into account in the normalization. Furthermore, to Research, Washington University School of Medicine, St Louis, MI, consider the purity and quality of the mRNA, a second normalization step was USA) for the PGC-1␣ antibody. This text presents results of the performed based on the average of fluorescence intensities measured for a set of 9- 16 housekeeping genes. The variance of the normalized set of housekeeping genes Belgian Programme on Interuniversity Poles of Attraction (PAI5/02) Journal of Cell Science was used to generate an estimate of expected variance, leading to a predicted initiated by the Belgian State, Prime Minister’s Office Science Policy confidence interval for testing the significance of the ratios obtained. Ratios outside Programming. We also thank the French speaking community the 95% confidence interval were considered to be statistically significant, as governement for funding through an ARC (Action de Recherche determined by ANOVA (de Longueville et al., 2002; de Magalhaes et al., 2004). Concertée). The scientific responsibility is assumed by the authors. RT-PCR After various treatments, total RNA was extracted using the Total RNAgent References extraction kit (Promega). mRNA contained in 5 ␮g total RNA was reverse Amuthan, G., Biswas, G., Ananadatheerthavarada, H. K., Vijayasarathy, C., transcribed using SuperScript II reverse transcriptase (Invitrogen) according to the Shephard, H. M. and Avadhani, N. G. (2002). Mitochondrial stress-induced calcium signaling, phenotypic changes and invasive behavior in human lung carcinoma A549 manufacturer’s instructions. Forward and reverse primers, for C/EBP␤ (FP: cells. Oncogene 21, 7839-7849. GGTTTCGGGACTTGATGCAA, RP: GCAGGAACATCTTTAAGGTGAT- ␦ Arnould, T., Vankoningsloo, S., Renard, P., Houbion, A., Ninane, N., Demazy, C., TACTC); C/EBP (FP: CCGCCCGAATCGCTAGT, RP: GCAGTCCAGTGCC- Remacle, J. and Raes, M. (2002). CREB activation induced by mitochondrial CAAGCT); Clic4 (FP: AGAGCCCACAGCAAGCATTCT, RP: ATCAGCCG- dysfunction is a new signaling pathway that impairs cell proliferation. EMBO J. 21, CATGGAGACATC); CPT-2 (FP: CCTGATGGCTTTGGCATTG, RP: 53-63. GGGCATTGCGTCCTGAGTA); FAS (FP: GTGAAGAAGTGTCTGGACTGTGT- Beitner-Johnson, D. and Millhorn, D. E. (1998). Hypoxia induces phosphorylation of CAT, RP: TCGCTCACGTGCAGTTTAATTG); GPDmit (FP: GCAGCTGAT- the cyclic AMP response element-binding protein by a novel signaling mechanism. J. GAGCGCAGTT, RP: TCCAAGTTCTCCTCGGCAGTT); IL-6 (FP: CCTAGT- Biol. Chem. 273, 19834-19839. GCGTTATGCCTAAGCA, RP: TCGTAGAGAACAACATAAGTCAGATACCT); Beitner-Johnson, D., Rust, R. T., Hsieh, T. and Millhorn, D. E. (2000). Regulation of leptin (FP: GATCCCACGTGCCACAGTCT, RP: GGAACAAGCCATAGTG- CREB by moderate hypoxia in PC12 cells. Adv. Exp. Med. Biol. 475, 143-152. CAAGGT); PGC-1␣ (FP: CGGATTGCCCTCATTTGATG, RP: GAGGAAG- Berkovic, S. F., Andermann, F., Shoubridge, E. A., Carpenter, S., Robitaille, Y., GACTGGCCTCGTT) and TBP (FP: CAGTTACAGGTGGCAGCATGA, RP: Andermann, E., Melmed, C. and Karpati, G. (1991). Mitochondrial dysfunction in TAGTGCTGCAGGGTGATTTCAG) were designed using the Primer Express 1.5 multiple symmetrical lipomatosis. Ann. Neurol. 29, 566-569. software (Applied Biosystem). Amplification reaction assays contained 1ϫ SYBR Biswas, G., Adebanjo, O. A., Freedman, B. D., Anandatheerthavarada, H. K., Green PCR Mastermix (Applied Biosystem) and primers (Eurogentech) at the Vijayasarathy, C., Zaidi, M., Kotlikoff, M. and Avadhani, N. G. (1999). Retrograde optimal concentrations. A hot start at 95° C for 5 minutes was followed by 40 cycles Ca2+ signaling in C2C12 skeletal myocytes in response to mitochondrial genetic and at 95°C for 15 seconds each, terminated at 65°C for 1 minute, using an ABI PRISM metabolic stress: a novel mode of inter- organelle crosstalk. EMBO J. 18, 522-533. Biswas, G., Anandatheerthavarada, H. K. and Avadhani, N. G. 7000 SDS thermal cycler (Applied Biosystem). TBP was used as the reference gene (2005). Mechanism of mitochondrial stress-induced resistance to apoptosis in mitochondrial DNA-depleted for normalization and relative mRNA steady-state level quantification. Melting C2C12 myocytes. Cell Death Differ. 12, 266-278. curves were generated after amplification and data were analyzed using the thermal- Boissel, J. P., Bros, M., Schrock, A., Godtel-Armbrust, U. and Forstermann, U. cycler software. Each sample was tested in duplicate. (2004). Cyclic AMP-mediated upregulation of the expression of neuronal NO synthase in human A673 neuroepithelioma cells results in a decrease in the level of bioactive Gene silencing experiments NO production: analysis of the signaling mechanisms that are involved. Biochemistry siRNA transfection experiments were performed with double-stranded RNA 43, 7197-7206. designed and synthetized by Eurogentec. Out of three siRNA tested, a CREB- Bradford, M. M. (1976). A rapid and sensitive method for the quantitation of microgram Mitochondrial dysfunction triggers triglyceride accumulation 1281

quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, Herzig, S., Hedrick, S., Morantte i Koo, S. H., Galimi, F. and Montminy, M. (2003). 248-254. CREB controls hepatic lipid metabolism through nuclear hormone receptor PPAR- Brinkman, K., Smeitink, J. A., Romijn, J. A. and Reiss, P. (1999). Mitochondrial gamma. Nature 426, 190-193. toxicity induced by nucleoside-analogue reverse-transcriptase inhibitors is a key factor Huss, J. M., Levy, F. H. and Kelly, D. P. (2001). Hypoxia inhibits the peroxisome in the pathogenesis of antiretroviral-therapy-related lipodystrophy. Lancet 354, 1112- proliferator-activated receptor alpha/retinoid X receptor gene regulatory pathway in 1115. cardiac myocytes: a mechanism for O2-dependent modulation of mitochondrial fatty Brown, L. J., Koza, R. A., Everett, C., Reitman, M. L., Marshall, L., Fahien, L. A., acid oxidation. J. Biol. Chem. 276, 27605-27612. Kozak, L. P. and MacDonald, M. J. (2002). Normal thyroid thermogenesis but Johannessen, M., Delghandi, M. P. and Moens, U. (2004). What turns CREB on? Cell reduced viability and adiposity in mice lacking the mitochondrial glycerol phosphate Signal. 16, 1211-1227. dehydrogenase. J. Biol. Chem. 277, 32892-32898. Kakuda, T. N. (2000). Pharmacology of nucleoside and nucleotide reverse transcriptase Burton, G. R., Guan, Y., Nagarajan, R. and McGehee, R. E., Jr (2002). Microarray inhibitor-induced mitochondrial toxicity. Clin. Ther. 22, 685-708. analysis of gene expression during early adipocyte differentiation. Gene 293, 21-31. Kasturi, R. and Joshi, V. C. (1982). Hormonal regulation of stearoyl coenzyme A Burton, G. R., Nagarajan, R., Peterson, C. A. and McGehee, R. E., Jr (2004). desaturase activity and lipogenesis during adipose conversion of 3T3-L1 cells. J. Biol. Microarray analysis of differentiation-specific gene expression during 3T3-L1 Chem. 257, 12224-12230. adipogenesis. Gene 329, 167-185. Klopstock, T., Naumann, M., Seibel, P., Shalke, B., Reiners, K. and Reichmann, H. Butow, R. A. and Avadhani, N. G. (2004). Mitochondrial signaling: the retrograde (1997). Mitochondrial DNA mutations in multiple symmetric lipomatosis. Mol. Cell response. Mol. Cell 14, 1-15. Biochem. 174, 271-275. Buttgereit, F. and Brand, M. D. (1995). A hierarchy of ATP-consuming processes in Kratchmarova i Kalume, D. E., Blagoev, B., Scherer, P. E., Podtelejnikov, A. V., mammalian cells. Biochem. J. 312, 163-167. Molina, H., Bickel, P. E., Andersen, J. S., Fernandez, M. M., Bunkenborg, J. et al. Cao, W., Daniel, K. W., Robidoux, J., Puigserver, P., Medvedev, A. V., Bai, X., (2002). A proteomic approach for identification of secreted proteins during the Floering, L. M., Spiegelman, B. M. and Collins, S. (2004). p38 mitogen-activated differentiation of 3T3-L1 preadipocytes to adipocytes. Mol. Cell Proteomics 1, 213- protein kinase is the central regulator of cyclic AMP-dependent transcription of the 222. brown fat uncoupling protein 1 gene. Mol. Cell. Biol. 24, 3057-3067. Lazar, M. A. (2005). How obesity causes diabetes: not a tall tale. Science 307, 373-375. Carriere, A., Carmona, M. C., Fernandez, Y., Rigoulet, M., Wenger, R. H., Penicaud, Lee, K., Villena, J. A., Moon, Y. S., Kim, K. H., Lee, S., Kang, C. and Sul, H. S. L. and Casteilla, L. (2004). Mitochondrial reactive oxygen species control the (2003). Inhibition of adipogenesis and development of glucose intolerance by soluble transcription factor CHOP-10/GADD153 and adipocyte differentiation: A mechanism preadipocyte factor-1 (Pref-1). J. Clin. Invest. 111, 453-461. for hypoxia-dependent effect. J. Biol. Chem. 279, 40462-40469. Liao, X. S., Small, W. C., Srere, P. A. and Butow, R. A. (1991). Intramitochondrial Chen, Y., Takeshita, A., Ozaki, K., Kitano, S. and Hanazawa, S. (1996). functions regulate nonmitochondrial citrate synthase (CIT2) expression in Transcriptional regulation by transforming growth factor beta of the expression of Saccharomyces cerevisiae. Mol. Cell. Biol. 11, 38-46. retinoic acid and retinoid X receptor genes in osteoblastic cells is mediated through Lin, E. C. (1977). Glycerol utilization and its regulation in mammals. Annu. Rev. AP-1. J. Biol. Chem. 271, 31602-31606. Biochem. 46, 765-795. Chio, C. C., Chang, Y. H., Hsu, Y. W., Chi, K. H. and Lin, W. W. (2004). PKA- Liu, Z. and Butow, R. A. (1999). A transcriptional switch in the expression of yeast dependent activation of PKC, p38 MAPK and IKK in macrophage: implication in the tricarboxylic acid cycle genes in response to a reduction or loss of respiratory function. induction of inducible nitric oxide synthase and interleukin-6 by dibutyryl cAMP. Cell Mol. Cell. Biol. 19, 6720-6728. Signal. 16, 565-575. Louet, J. F., Hayhurst, G., Gonzalez, F. J., Girard, J. and Decaux, J. F. (2002). The Cohen, A. W., Razani, B., Schubert, W., Williams, T. M., Wang, X. B., Iyengar, P., coactivator PGC-1 is involved in the regulation of the liver carnitine Brasaemle, D. L., Scherer, P. E. and Lisanti, M. P. (2004). Role of caveolin-1 in the palmitoyltransferase I gene expression by cAMP in combination with HNF4 alpha and modulation of lipolysis and lipid droplet formation. Diabetes 53, 1261-1270. cAMP-response element-binding protein (CREB). J. Biol. Chem. 277, 37991-8000. Czubryt, M. P., McAnally, J., Fishman, G. I. and Olson, E. N. (2003). Regulation of Lowell, B. B. and Shulman, G. I. (2005). Mitochondrial dysfunction and type 2 diabetes. peroxisome proliferator-activated receptor gamma coactivator 1 alpha (PGC-1 alpha) Science 307, 384-387. and mitochondrial function by MEF2 and HDAC5. Proc. Natl. Acad. Sci. USA 100, MacDougald, O. A. and Lane, M. D. (1995). Transcriptional regulation of gene 1711-1716. expression during adipocyte differentiation. Annu. Rev. Biochem. 64, 345-373. Darlington, G. J., Ross, S. E. and MacDougald, O. A. (1998). The role of C/EBP genes Mancuso, M., Filosto, M., Mootha, V. K., Rocchi, A., Pistolesi, S., Murri, L., in adipocyte differentiation. J. Biol. Chem. 273, 30057-30060. DiMauro, S. and Siciliano, G. (2004). A novel mitochondrial tRNAPhe mutation de Longueville, F., Surry, D., Meneses-Lorente, G., Bertholet, V., Talbot, V., Evrard, causes MERRF syndrome. Neurology 62, 2119-2121. S., Chandelier, N., Pike, A., Worboys, P., Rasson, J. P. et al. (2002). Gene expression Melone, M. A., Tessa, A., Petrini, S., Lus, G., Sampaolo, S., di Fede, G., Santorelli, profiling of drug metabolism and toxicology markers using a low-density DNA F. M. and Cotrufo, R. (2004). Revelation of a new mitochondrial DNA mutation Journal of Cell Science microarray. Biochem. Pharmacol. 64, 137-149. (G12147A) in a MELAS/MERFF phenotype. Arch. Neurol. 61, 269-272. de Longueville, F., Atienzar, F. A., Marcq, L., Dufrane, S., Evrard, S., Wouters, L., Miyazaki, M., Kim, Y. C. and Ntambi, J. M. (2001). A lipogenic diet in mice with a Leroux, F., Bertholet, V., Gerin, B., Whomsley, R. et al. (2003). Use of a low-density disruption of the stearoyl-CoA desaturase 1 gene reveals a stringent requirement of microarray for studying gene expression patterns induced by hepatotoxicants on endogenous monounsaturated fatty acids for triglyceride synthesis. J. Lipid Res. 42, primary cultures. of rat hepatocytes. Toxicol. Sci. 75, 378-392. 1018-1024. de Magalhaes, J. P., Chainiaux, F., de Longueville, F., Mainfroid, V., Migeot, V., Mongini, T., Doriguzzi, C., Chiado-Piat, L., Silvestri, G., Servidei, S. and Palmucci, Marcq, L., Remacle, J., Salmon, M. and Toussaint, O. (2004). Gene expression and L. (2002). MERRF/MELAS overlap syndrome in a family with A3243G mtDNA regulation in H2O2-induced premature senescence of human foreskin fibroblasts mutation. Clin. Neuropathol. 21, 72-76. expressing or not telomerase. Exp. Gerontol. 39, 1379-1389. Mootha, V. K., Lindgren, C. M., Eriksson, K. F., Subramanian, A., Sihag, S., Lehar, Debacq-Chainiaux, F., Borlon, C., Pascal, T., Royer, V., Eliaers, F., Ninane, N., J., Puigserver, P., Carlsson, E., Ridderstrale, M., Laurila, E. et al. (2003). PGC- Carrard, G., Friguet, B., de Longueville, F., Boffe, S. et al. (2005). Repeated 1alpha-responsive genes involved in oxidative phosphorylation are coordinately exposure of human skin fibroblasts to UVB at subcytotoxic level triggers premature downregulated in human diabetes. Nat. Genet. 34, 267-273. senescence through the TGF-beta1 signaling pathway. J. Cell Sci. 118, 743-758. Mottet, D., Michel, G., Renard, P., Ninane, N., Raes, M. and Michiels, C. (2002). ERK Della Fazia, M. A., Servillo, G. and Sassone-Corsi, P. (1997). Cyclic AMP signalling and calcium in activation of HIF-1. Ann. New York Acad. Sci. 973, 448-453. and cellular proliferation: regulation of CREB and CREM. FEBS Lett. 410, 22-24. Munoz-Malaga, A., Bautista, J., Salazar, J. A., Aguilera i Garcia, R., Chinchon i Dresner, A., Laurent, D., Marcucci, M., Griffin, M. E., Dufour, S., Cline, G. W., Segura, M. D., Campos, Y. and Arenas, J. (2000). Lipomatosis, proximal myopathy, Slezak, L. A., Andersen, D. K., Hundal, R. S., Rothman, D. L. et al. (1999). Effects and the mitochondrial 8344 mutation. A lipid storage myopathy? Muscle Nerve 23, of free fatty acids on glucose transport and IRS-1-associated phosphatidylinositol 3- 538-542. kinase activity. J. Clin. Invest. 103, 253-259. Naumann, M., Kiefer, R., Toyka, K. V., Sommer, C., Seibel, P. and Reichmann, H. Gregoire, F. M., Smas, C. M. and Sul, H. S. (1998). Understanding adipocyte (1997). Mitochondrial dysfunction with myoclonus epilepsy and ragged-red fibers differentiation. Physiol. Rev. 78, 783-809. point mutation in nerve, muscle, and adipose tissue of a patient with multiple Gulick, T., Cresci, S., Caira, T., Moore, D. D. and Kelly, D. P. (1994). The peroxisome symmetric lipomatosis. Muscle Nerve 20, 833-839. proliferator-activated receptor regulates mitochondrial fatty acid oxidative enzyme Nitsch, D., Boshart, M. and Schutz, G. (1993). Activation of the tyrosine gene expression. Proc. Natl. Acad. Sci. USA 91, 11012-11016. aminotransferase gene is dependent on synergy between liver-specific and hormone- Guo, X. and Liao, K. (2000). Analysis of gene expression profile during 3T3-L1 responsive elements. Proc. Natl. Acad. Sci. USA 90, 5479-5483. preadipocyte differentiation. Gene 251, 45-53. Ntambi, J. M., Buhrow, S. A., Kaestner, K. H., Christy, R. J., Sibley, E., Kelly, T. J., Hagiwara, M., Alberts, A., Brindle, P., Meinkoth, J., Feramisco, J., Deng, T., Karin, Jr and Lane, M. D. (1988). Differentiation-induced gene expression in 3T3-L1 M., Shenolikar, S. and Montminy, M. (1992). Transcriptional attenuation following preadipocytes. Characterization of a differentially expressed gene encoding stearoyl- cAMP induction requires PP-1-mediated dephosphorylation of CREB. Cell 70, 105-113. CoA desaturase. J. Biol. Chem. 263, 17291-17300. Hajra, A. K., Larkins, L. K., Das, A. K., Hemati, N., Erickson, R. L. and Ntambi, J. M., Miyazaki, M., Stoehr, J. P., Lan, H., Kendziorski, C. M., Yandell, B. MacDougald, O. A. (2000). Induction of the peroxisomal glycerolipid-synthesizing S., Song, Y., Cohen, P., Friedman, J. M. and Attie, A. D. (2002). Loss of stearoyl- enzymes during differentiation of 3T3-L1 adipocytes. Role in triacylglycerol synthesis. CoA desaturase-1 function protects mice against adiposity. Proc. Natl. Acad. Sci. USA J. Biol. Chem. 275, 9441-9446. 99, 11482-11486. Herzig, S., Long, F., Jhala, U. S., Hedrick, S., Quinn, R., Bauer, A., Rudolph, D., Pei, L., Dodson, R., Schoderbek, W. E., Maurer, R. A. and Mayo, K. E. (1991). Schutz, G., Yoon, C., Puigserver, P. et al. (2001). CREB regulates hepatic Regulation of the alpha inhibin gene by cyclic adenosine 3Ј,5Ј-monophosphate after gluconeogenesis through the coactivator PGC-1. Nature 413, 179-183. transfection into rat granulosa cells. Mol. Endocrinol. 5, 521-534. 1282 Journal of Cell Science 119 (7)

Petersen, K. F., Oral, E. A., Dufour, S., Befroy, D., Ariyan, C., Yu, C., Cline, G. W., Onishi, Y., Ono, H., Inukai, K. et al. (2002). Resistin is regulated by C/EBPs, PPARs, DePaoli, A. M., Taylor, S. I., Gorden, P. et al. (2002). Leptin reverses insulin and signal-transducing molecules. Biochem. Biophys. Res. Commun. 299, 291-298. resistance and hepatic steatosis in patients with severe lipodystrophy. J. Clin. Invest. Tong, Q., Tsai, J., Tan, G., Dalgin, G. and Hotamisligil, G. S. (2005). Interaction 109, 1345-1350. between GATA and the C/EBP family of transcription factors is critical in GATA- Petersen, K. F., Befroy, D., Dufour, S., Dziura, J., Ariyan, C., Rothman, D. L., mediated suppression of adipocyte differentiation. Mol. Cell. Biol. 25, 706-715. DiPietro, L., Cline, G. W. and Shulman, G. I. (2003). Mitochondrial dysfunction in Vankoningsloo, S., Piens, M., Lecocq, C., Gilson, A., De Pauw, A., Renard, P., the elderly: possible role in insulin resistance. Science 300, 1140-1142. Demazy, C., Houbion, A., Raes, M. and Arnould, T. (2005). Mitochondrial Petersen, K. F., Dufour, S., Befroy, D., Garcia, R. and Shulman, G. I. (2004). Impaired dysfunction induces triglyceride accumulation in 3T3-L1 cells: role of fatty acid mitochondrial activity in the insulin-resistant offspring of patients with type 2 diabetes. {beta}-oxidation and glucose. J. Lipid Res. 46, 1133-1149. N. Engl. J. Med. 350, 664-671. Vega, R. B., Huss, J. M. and Kelly, D. P. (2000). The coactivator PGC-1 cooperates with Renard, P., Ernest, I., Houbion, A., Art, M., Le Calvez, H., Raes, M. and Remacle, peroxisome proliferator-activated receptor alpha in transcriptional control of nuclear J. (2001). Development of a sensitive multi-well colorimetric assay for active genes encoding mitochondrial fatty acid oxidation enzymes. Mol. Cell. Biol. 20, 1868- NFkappaB. Nucleic Acids Res. 29, E21. 1876. Reusch, J. E. and Klemm, D. J. (2002). Inhibition of cAMP-response element-binding Wadzinski, B. E., Wheat, W. H., Jaspers, S., Peruski, L. F., Jr, Lickteig, R. L., protein activity decreases protein kinase B/Akt expression in 3T3-L1 adipocytes and Johnson, G. L. and Klemm, D. J. (1993). Nuclear protein phosphatase 2A induces apoptosis. J. Biol. Chem. 277, 1426-1432. dephosphorylates protein kinase A-phosphorylated CREB and regulates CREB Reusch, J. E., Colton, L. A. and Klemm, D. J. (2000). CREB activation induces transcriptional stimulation. Mol. Cell. Biol. 13, 2822-2834. adipogenesis in 3T3-L1 cells. Mol. Cell. Biol. 20, 1008-1020. Wang, L., Liu, J., Saha, P., Huang, J., Chan, L., Spiegelman, B. and Moore, D. D. Roesler, W. J. (2000). What is a cAMP response unit? Mol. Cell Endocrinol. 162, 1-7. (2005). The orphan nuclear receptor SHP regulates PGC-1alpha expression and energy Ron, D. and Habener, J. F. (1992). CHOP, a novel developmentally regulated nuclear production in brown adipocytes. Cell Metab. 2, 227-238. protein that dimerizes with transcription factors C/EBP and LAP and functions as a Welsh, G. I., Griffiths, M. R., Webster, K. J., Page, M. J. and Tavare, J. M. (2004). dominant-negative inhibitor of gene transcription. Genes Dev. 6, 439-453. Proteome analysis of adipogenesis. Proteomics 4, 1042-1051. Rosen, E. D. and Spiegelman, B. M. (2000). Molecular regulation of adipogenesis. Annu. Wieser, W. and Krumschnabel, G. (2001). Hierarchies of ATP-consuming processes: Rev. Cell Dev Biol. 16, 145-171. direct compared with indirect measurements, and comparative aspects. Biochem. J. Ross, S. E., Erickson, R. L., Gerin, I., DeRose, P. M., Bajnok, L., Longo, K. A., Misek, 355, 389-395. D. E., Kuick, R., Hanash, S. M., Atkins, K. B. et al. (2002). Microarray analyses during Wu, Z., Puigserver, P., Andersson, U., Zhang, C., Adelmant, G., Mootha, V., Troy, adipogenesis: understanding the effects of Wnt signaling on adipogenesis and the roles A., Cinti, S., Lowell, B., Scarpulla, R. C. et al. (1999). Mechanisms controlling of liver X receptor alpha in adipocyte metabolism. Mol. Cell. Biol. 22, 5989-5999. mitochondrial biogenesis and respiration through the thermogenic coactivator PGC-1. Rossmanith, W., Raffelsberger, T., Roka, J., Kornek, B., Feucht, M. and Bittner, R. Cell 98, 115-124. E. (2003). The expanding mutational spectrum of MERRF substitution G8361A in the Zancanaro, C., Sbarbati, A., Morroni, M., Carraro, R., Cigolini, M., Enzi, G. and mitochondrial tRNALys gene. Ann. Neurol. 54, 820-823. Cinti, S. (1990). Multiple symmetric lipomatosis. Ultrastructural investigation of the Scarpulla, R. C. (2002). Nuclear activators and coactivators in mammalian mitochondrial tissue and preadipocytes in primary culture. Lab. Invest. 63, 253-258. biogenesis. Biochim. Biophys. Acta 1576, 1-14. Zhang, J. W., Klemm, D. J., Vinson, C. and Lane, M. D. (2004). Role of CREB in Scott, R., Bourtchuladze, R., Gossweiler, S., Dubnau, J. and Tully, T. (2002). CREB transcriptional regulation of CCAAT/enhancer-binding protein beta gene during and the discovery of cognitive enhancers. J. Mol. Neurosci. 19, 171-177. adipogenesis. J. Biol. Chem. 279, 4471-4478. Shaywitz, A. J. and Greenberg, M. E. (1999). CREB: a stimulus-induced transcription Zhou, A., Scoggin, S., Gaynor, R. B. and Williams, N. S. (2003). Identification of NF- factor activated by a diverse array of extracellular signals. Annu. Rev. Biochem. 68, kappa B-regulated genes induced by TNFalpha utilizing expression profiling and RNA 821-861. interference. Oncogene 22, 2054-2064. Shoffner, J. M., Lott, M. T., Lezza, A. M., Seibel, P., Ballinger, S. W. and Wallace, Zhou, X. Y., Shibusawa, N., Naik, K., Porras, D., Temple, K., Ou, H., Kaihara, K., D. C. (1990). Myoclonic epilepsy and ragged-red fiber disease (MERRF) is associated Roe, M. W., Brady, M. J. and Wondisford, F. E. (2004). Insulin regulation of hepatic with a mitochondrial DNA tRNA(Lys) mutation. Cell 61, 931-937. gluconeogenesis through phosphorylation of CREB-binding protein. Nat. Med. 10, Song, H., Shojima, N., Sakoda, H., Ogihara, T., Fujishiro, M., Katagiri, H., Anai, M., 633-637. Journal of Cell Science