TISSUE LIVER X-RECEPTOR ALPHA (LXRα) LEVEL IN ACNE VULGARIS

Thesis

Submitted for the fulfillment of Master Degree in Dermatology and

Venereology

BY Eman Abdelhamed Aly Nada

(M.B.B.Ch)

Supervisors Dr. Shereen Osama Tawfic

Assistant prof.of Dermatology

Faculty of Medicine

Cairo University Dr. Marwa Ahmed Ezzat

Lecturer of Dermatology

Faculty of Medicine

Cairo University Dr. Olfat Gamil Shaker

Professor of Medical Biochemistry

Faculty of Medicine

Cairo University Faculty of Medicine Cairo University 2012

1

Acknowledgment

First and foremost, I am thankful to God, for without his help I could not finish this work. I would like to express my sincere gratitude and appreciation to Dr. Shereen Osama Tawfic, Assistant Professor of Dermatology, Faculty of Medicine, Cairo University, for giving me the honor for working under her supervision and for her great support and stimulating views. Special thanks and deepest gratitude to Dr. Marwa Ahmed Ezzat, Lecturer of Dermatology, Faculty of Medicine, Cairo University, for her advice, support and encouragement all the time for a better performance. I am deeply thankful to Prof. Dr. Olfat Gamil Shaker, Professor of Medical Biochemistry, Faculty of Medicine, Cairo University for her sincere scientific and moral help in accomplishing the practical part of this study. I would like to extend my warmest gratitude to Prof. Dr. Manal Abdelwahed Bosseila, Professor of Dermatology, Faculty of Medicine, Cairo University, whose hard and faithful efforts have helped me to do this work. Furthermore, I would like to thank my family who stood behind me to finish this work and for their great support to me.

2

Contents

Page

List of abbreviations……………………………...... I - II

List of tables………………………………………..... III

List of figures………………………………………… IV

Abstract…………………………………………..…..V-VI

Introduction and aim of the work ………………..…..1

ReviewU of literature U

Chapter 1: Acne Vulgaris……………………….. .5

Chapter 2: Liver x receptors…………………….. 38

Subjects and methods………………………………....60

Results………………………………………………….67

Discussion………………………………………………80

Conclusions and Recommendations………………….89

Summary……………………………………………….90

References……………………………………………...94

Arabic Summary

3

List of Abbreviations

ApoE : Apolipoprotein E. cDNA : Complementary deoxyribonucleic acid.

COX-2 : Cyclooxygenase-2.

DBD : DNA- binding domain.

DHEAS : Dehydroepiandrosterone sulphate.

DHT : Dihydrotestoterone.

DNA : Deoxyribonucleic acid.

EcR : Ecdysone receptor.

EFA : Essential fatty acids.

FXR : farnesoid X receptor.

GR : Glucocorticoid receptor.

HSD : hydroxysteroid dehydrogenase.

IGF : Insulin-like growth factor.

IL : Interleukin.

LBD : Ligand binding domain.

LRH : Liver receptor homologue.

LXR : Liver X receptors.

LXREs : Lxr response elements. mRNA : Messenger Ribonucleic acid.

NCoR : Nuclear receptor corepressor.

NF-kB : Nuclear Factor-Kappa B.

NO synthase : Nitric oxide synthase.

4

NR : Nuclear receptor.

P. acnes : Propionobacterium acnes.

PCR : Polymerase chain reaction.

PPAR : Peroxisome proliferator-activated receptor.

PPRE : Peroxisome proliferator response element.

PUFA : Polyunsaturated fatty acids.

PXR : Pregnane x receptor.

RT-PCR : Reverse transcription polymerase chain reaction.

RXR : Retinoid x receptor.

SHP : short heterodimer partner.

SREBP : Sterol regulatory element binding proteins.

TLR : Toll like receptor.

TNF : Tumor necrosis factor.

5

List of Tables

Table No. Title Page

Table (1) Clinical data of the acne vulgaris 68 patients

Table (2) Summary of clinical and 69 demographic data of patients

Table (3) Data of the control group 70

Table (4) Summary of the values of LXRα in 72 both types of acne vulgaris lesions and in controls

Table (5) the level of LXRα in both types of 74 acne vulgaris lesions and the control

Table (6) LXRα level in the inflammatory and 75 comedonal lesions of acne vulgaris

Table (7) LXRα with age of patients and 76 duration of the disease

Table (8) LXRα with the sex of the patients 77

Table (9) LXRα with the severity of the 78 disease

Table (10) LXRα with the course of the 79 disease

6

List of Figures Figure No. Title Page Figure (1) Steroid hormone metabolism 11 Figure (2) The acnegenic cascade 14 Figure (3) Structure/function organization of nuclear 40 receptors Figure (4) The nuclear receptor superfamily 42 Figure (5) Mechanism of transcriptional 44 regulation by LXRs Figure (6) LXR-mediated transcriptional 46 activation of target genes Figure (7) Transcriptional activities of liver X 48 receptors Figure (8) LXR in stratum corneum formation 56 Figure (9) LXRα level in acne vulgaris and 74 control Figure (10) LXRα level in inflammatory and 75 comedonal acne Figure (11) LXRα with the sex of the patients 77 Figure (12) LXRα with the severity of the 78 disease Figure (13) LXRα with the course of the disease 79

7

ABSTRACT

Background: Acne vulgaris is a disease of the pilosebaceous unit. Increased sebum lipogenesis by sebaceous gland is the major factor in the pathophysiology of acne. LXRα have been recognized in the regulation of genes involved in lipid biosynthesis. Activation of LXRα inhibits proliferation, increase lipogenesis and improve differentiation of sebocytes.

Aim: To investigate the level of tissue expression of LXRα in inflammatory and non inflammatory acne lesions and in comparison with normal skin.

Patients and methods: Seventeen patients with inflammatory and non inflammatory acne lesions and sixteen age and sex comparable healthy volunteers as control were included in the study. Punch skin biopsies were taken from the acne lesions and normal skin of the volunteers for detection of gene expression of LXRα by RT- PCR.

Results: the level of LXRα was significantly higher in the lesional skin either inflammatory (with a mean of 1188.52 ± 129.5) or comedonal acne (with a mean of 892.52 ± 66.08) in a statistically significant manner than the controls (with a mean of 600.50 ± 95.30) where the P value was <0.001. In addition, the level of LXRα was significantly higher in inflammatory acne (with a mean of 1188.52 ± 129.5) in a statistically significant manner) than comedonal acne (with a mean of 892.52 ± 66.08) where the P value was <0.001.

Conclusion: the significant increase in the level of LXRα in acne lesions compared to controls suggesting that LXRα may have a role in the pathogenesis of acne vulgaris itself and is not a consequence of inflammation. In addition, it may play a role in the progression of the

8 disease from comedonal to inflammatory. Further studies are recommended to evaluate the therapeutic benefits of the use of LXRα antagonists as a new therapeutic modality for acne vulgaris.

Keywords: Acne vulgaris, Pathogenesis, Liver x receptors (LXR), Polymerase chain reaction (PCR).

9

Introduction

Acne vulgaris is a disease of the pilosebaceous unit resulting from the interplay of different factors: seborrhea, P. acnes colonization, hyperkeratinization of the follicular duct and release of inflammatory mediators. Increased sebum lipogenesis by sebaceous gland is considered, among all features, the major one involved in the pathophysiology of acne. On average, acne subjects excrete more sebum than normal ones and secretion rates correlate well with the severity of clinical manifestations (Picardo et al, 2009).

It was thought that the primary change in the sebaceous follicle is the alteration in the pattern of keratinization within the follicle. Initial alteration is in the infrainfundibular portion where there is hyperproliferation. The keratin is also qualitatively altered as it tends to become densely packed along with monofilaments and lipid droplets (Gollnick et al, 2003).

Propionobacterium acnes colonises the follicular duct and proliferates, breaking down the sebum to triglycerides, irritants that contribute to the development of inflammation. When the follicular epithelium is invaded by lymphocytes it ruptures, releasing sebum, micro‐organisms, and keratin into the dermis. Neutrophils, lymphocytes, and foreign body giant cells accumulate and produce the erythematous papules, pustules, and nodular swelling characteristic of inflammatory acne (Ayer and Burrows, 2006).

Inflammation is the key component of acne and the major reason for its morbidity and sequelae (pigmentary disturbances and scarring). Inflammation, for a long time was believed to be a secondary process in the pathogenesis of acne. New data indicates that immunological events

10 led by perifollicular helper T-cells in genetically predisposed individuals may in fact be a primary process, initiating comedogenesis through elaboration of IL-1. Further; inflammation may upregulate sebum production through production of inflammatory mediator leukotriene B4 that binds to receptors on the sebocytes (Kubba et al, 2009).

It was indicated that sebocytes, as major components of pilosebaceous unit, may act as immune cells and may be activated by P. acnes that recognize altered lipid content in sebum, followed by the production of inflammatory cytokines (Knor, 2005).

Liver X-receptor (LXR) is a member of the nuclear receptor family of transcription factors and closely related to nuclear receptors such as peroxisome proliferator-activated receptors (PPAR), retinoid X receptors (Rxr). Two isoforms are present LXRα and LXRβ (Willy et al, 1995).

LXRα have been widely recognized in the regulation of genes involved in innate immunity, inflammation and lipid biosynthesis, whereas LXRβ have been shown to be involved in keratinocyte differentiation and epidermal permeability barrier function (Gupta et al, 2010).

Activation of LXRs stimulates keratinocyte differentiation and improves permeability barrier homeostasis by a number of mechanisms, including stimulating epidermal lipid synthesis, increasing lamellar body formation and secretion, and increasing the activity of enzymes required for the extracellular processing of lipids in the stratum corneum, leading to the formation of lamellar membranes that mediate permeability barrier function (Schmuth et al, 2008).

Differentiation of sebocytes is strongly associated with enhanced lipid synthesis and accumulation in the cells. Sebocytes express LXRα, the

11 application of natural 22(R)-hydroxycholesterol or synthetic ligands of LXRα significantly inhibit proliferation, increase lipogenesis and improve differentiation of sebocytes (Hong et al, 2008).

Aim of the work:

Based on these findings, the aim of this study was to investigate the level of tissue expression of LXRα in inflammatory versus non inflammatory acne lesions and in comparison with normal skin. Suggesting that LXRα could be one of the most important therapeutic targets for the treatment of acne. Thus, it would be advantageous to develop selective LXR antagonists to regulate sebaceous lipogenesis and inflammation.

12

ChapterU One

AcneU Vulgaris

Definition:U

Acne is a term derived from the Greek word “acme” in which the Greeks used this word to mean a point or a spot on the face. In the sixth century AD the term “acne” was first used by the emperor Justinian’s physician, Aetius Amidenus who translated it from Greek into Latin, and through these translations confusion arose regarding its original meaning (Goolamali and Andison, 1977).

Acne is a chronic disease of the pilosebaceous follicle that causes polymorph cutaneous lesions, among them comedones (as a primary lesion), papules, cysts, pustules, and abscesses, which after regression may leave scars (Degitz et al, 2007).

The face, anterior trunk, and upper back are the most commonly affected areas due to their greater concentration of sebaceous glands in these areas It is characterized by periods of exacerbation alternated with periods of stability (Ramos-e-Silva and Carneiro 2009).

EU pidemiology:

Acne is one of the most prevalent skin conditions, affecting more than 85% of teenagers. It is typically thought as a disease of youth but, 12% of women and 3% of men will continue to have clinical acne until 44 years of age. Caucasian boys and men have been shown to have more severe nodulocystic disease than do their black counterparts (Goulden et al, 1999).

13

Acne is an easily treatable cause of disfigurement and psychological morbidity. It affects more than 80% of people at some point in their life. Morbidity can be high and associated with disfigurement, pain, loss of confidence, and impairment of normal social and workplace function, with documented effects on quality of life including depression, dysmorphophobia, and even suicide (Purdy and De Berker, 2009).

Genetic predisposition:

The role of genetic predisposition in the development of acne is uncertain, but is decidedly multifactorial. It is well known that the number and size of sebaceous glands and their subsequent activity is inherited, in addition, the concordance rate for the prevalence and severity of acne among identical twins is extremely high. It is also widely held that acne, including nodulocystic acne runs in families, but because of the extremely high prevalence of acne, it is difficult to attribute its presence exclusively to genetic factors (Zaenglein and Thiboutot, 2008).

Individuals at increased risk for the development of acne include those with an XYY chromosomal genotype or endocrine disorders such as polycystic ovarian syndrome, hyperandrogenism, hypercortisolism and precocious puberty. Patients with these conditions tend to have more severe acne that is unresponsive to standard therapy (Zaenglein and Thiboutot, 2008).

PathogenesisU :

The pathogenesis of acne vulgaris is multifactorial and involves four main pathways. These include the following:

1) Excess sebum production.

2) Abnormal keratinization of the follicles.

14

3) Propionibacterium acnes colonization.

4) Inflammation of the follicle and surrounding dermis (Ebede et al, 2009).

1)ExcessU sebum production by androgen-mediated stimulation of sebaceous glands:

The pilosebaceous unit has four distinct components: the hair follicle, the keratinized follicular infundibulum, the sebaceous gland, and the sebaceous duct that connects the gland to the infundibulum. The number, size, and activity of sebaceous glands may be inherited. Although the number of sebaceous glands remains stable throughout life, the size increases with age (Clarke et al, 2007).

The principal activity of mature sebaceous glands is producing and secreting sebum, which is a complex mixture of lipids. Sebum discharge represents a major step in the final stages of differentiation of sebaceous specialized cells, namely sebocytes, and it is the result of accumulation of cytoplasmic lipid droplets and subsequent cell disintegration and release of their content into the follicle. Among the functions attributed to sebum in humans are photoprotection, antimicrobial activity, delivery of fat- soluble anti-oxidants to the skin surface and pro- and anti-inflammatory activity exerted by specific lipids (Zouboulis et al, 2008).

Human sebum consists of squalene, esters of glycerol, wax and cholesterol, as well as free cholesterol and fatty acids. Triglycerides and fatty acids, taken together, account for the predominant proportion (57.5%), followed by wax esters (26%) and squalene (12%). The least abundant lipid in sebum is cholesterol, which with its esters, accounts for

15 the 4.5% of total lipids. The most characteristic products of sebaceous secretion are squalene and wax esters, they are unique to sebum and not found anywhere else in the body, even among the epidermal surface lipids. Moreover, they correspond to major components supplying the skin with protection (Greene et al, 1970; Smith and Thiboutot, 2008).

Increased sebum secretion is considered among all features, the major one involved in the pathophysiology of acne. Acne subjects excrete more sebum than normal ones and secretion rates correlate well with the severity of clinical manifestations (Cunliffe, 1989).

Androgens stimulate sebum production, which begins at adrenarche, when there is increased production of serum dehydroepiandrosterone sulphate (DHEAS). The skin like other steroidogenic organs can synthesize androgens de novo from cholesterol or by locally converting weaker androgens to the more potent ones. Although serum androgen levels correlate to the severity of acne, yet acne can occur in people with normal serum androgen levels (Thiboutot et al, 1999; Chen et al, 2002).

The pilosebaceous unit contains the steroid metabolizing enzyme (steroid sulphatase) that convert DHEAS to testosterone and dihydrotestosterone. Steroid sulphatase is widely distributed in human tissues; it is present in the lesional skin of acne patients, but not in the unaffected skin (Zaidi 2009).

The enzyme converts DHEAS to DHEA. The enzyme 3β-hydroxy steroid dehydrogenase (3β-HSD), acts on DHEA and converts it into androstanedione. The conversion may take place in the adrenal glands and tissues such as sebaceous glands. There are two forms of 3β-HSD; type 1 isoenzyme is active in the skin and type 11 in the adrenal glands and gonads (Thiboutot et al, 2000).

16

Figure (1): Steroid hormone metabolism (Tobechi et al, 2009).

The main influence of androgen on acne pathogenesis concerns the proliferation and differentiation of sebocytes and infrainfundibular keratinocytes: (Kurokawa et al, 2009).

A. Sebocyte proliferation: By the stimulatory effect of testosterone and 5α dihydrotestosterone (DHT) on sebocyte proliferation. In cultured sebocytes, testosterone and DHT may show a stimulatory effect on cell proliferation. Androgens are effective on human sebocytes in vitro in concentrations above the physiological ones. B. Sebocyte differentiation and lipogenesis: In the sebaceous gland, testosterone and DHT at nearly physiological concentrations

17

demonstrated no effect or inhibitory effect on cell division rates and lipogenesis. In cultured sebocytes, the combination of testosterone and linoleic acid exhibited a synergistic effect on sebaceous lipids. C. Comedogenesis: Formation of microcomedones is caused by hyperproliferation and hyperkeratinization of the infrainfundibulum part of the follicular canal. It remains to be determined if higher activity of the type I 5α reductase detected in the follicular infrainfundibulum is related to the abnormal differentiation of keratinocytes in acne.

2) Abnormal keratinization of the follicles:

The primary change in the sebaceous follicle is the alteration in the pattern of keratinization within the follicle. Initial alteration is in the infrainfundibular portion where there is hyperproliferation. The keratin is also qualitatively altered as it tends to become densely packed along with monofilaments and lipid droplets (Gollnick et al, 2003).

Comedogenesis occurs when abnormally desquamated corneocytes accumulate in the sebaceous follicle and form a keratinous plug. When the keratinous plug enlarges below a very small follicular pore at the skin surface, it becomes visible as a closed comedone (whitehead). An open comedone (blackhead) occurs if the follicular pore dilates. The small pore closed comedones are the precursors of inflammatory lesions; they are the most frequent noninflamed clinical lesions and outnumber open comedones four times (Kubba et al, 2009).

Immunohistochemical studies have shown an increase in the proliferation rate of the basal keratinocytes and abnormal differentiation of the follicular keratinocytes in the follicle wall of microcomedones and comedones. These abnormalities may possibly be due to a relative decrease in sebaceous linoleic acid. Follicular hyperproliferation is also

18 associated with abnormal lipid inclusions (indicating abnormal differentiation) (Thielitz et al, 2001).

High levels of biologically active interleukin-1α (IL-1α) have been detected in comedones, believed to be expressed by follicular keratinocytes and triggered by changes in sebum composition and secretion. IL- 1α may compromise follicular barrier thus inducing inflammation (Kubba et al, 2009).

Figure (2): The acnegenic cascade: interactions among the numerous hormones, growth factors, enzymes and their targets (Kurokawa et al, 2009).

3) Propionibacterium acnes colonization:

Propionibacterium acnes, has been implicated in the pathogenesis of acne for more than 100 years, it was involved in acne pathogenesis in the early 1960s, when a study showed that P. acne also resides on healthy human skin and that the surface concentrations of P. acne were similar in both patients with acne and controls. Also, it was found that numbers of viable P. acne within follicles did not correlate with the severity of

19 inflammation and some inflamed lesions did not contain viable bacteria (Dessinioti and Katsambas 2010).

Further evidence to support the hypothesis that microorganisms are involved in acne was provided when antibiotics that reduced skin surface P. acne (such as erythromycin and clindamycin) were shown clinically to improve acne and when the presence of resistant P. acnes strains was associated with reduced efficacy of these treatments (Ross et al, 2003).

Colonization of the pilosebaceous follicle by P. acnes is a major factor for the inflammatory reaction in acne vulgaris. There are several mechanisms by which P. acnes may lead to the disruption of the follicular epithelium and subsequent inflammatory reaction:

• P. acnes acnes can result in the production of the proinflammatory cytokines such as tumor necrosis factor-α (TNF-α), interleukin (IL)-1α, and IL-8. P. acnes contribute to the inflammatory stage of acne by inducing monocytes to secrete these proinflammatory cytokines (Jeremy et al, 2003).

Interleukin 1α (IL-1α) causes hypercornification of the infundibulum of isolated pilosebaceous follicles, which is one of the processes involved in comedone formation, TNF-α is involved in the maturation and migration of Langerhans cells from the skin and the presentation of antigen in the local lymph node while IL-8 attracts neutrophils to the pilosebaceous unit, and release of lysosomal enzymes by neutrophils leads to rupture of follicular epithelium and further inflammation (Dessinioti and Katsambas 2010).

• Inflammation triggered through the toll-like receptor 2 (TLR2) is important in the pathogenesis of acne, and P. acnes trigger inflammatory cytokine responses in acne by activation of TLR2. TLR2 is expressed on

20 the cell surface of macrophages surrounding pilosebaceous follicles in acne lesions (Kim et al, 2002; Heymann 2006).

4) Inflammation of the follicle and surrounding dermis:

Inflammation is the key component of acne and the major reason for its morbidity and sequelae (pigmentary disturbances and scarring). Inflammation, for a long time was believed to be a secondary process in the pathogenesis of acne. New data indicates that immunological events led by perifollicular helper T-cells in genetically predisposed individuals may in fact be a primary process, initiating comedogenesis through elaboration of IL-1.Further; inflammation may upregulate sebum production through production of inflammatory mediator leukotriene B4 that binds to receptors on the sebocytes (Kubba et al, 2009).

Propionobacterium acnes colonises the follicular duct and proliferates, breaking down the sebum to triglycerides, which are irritants that contribute to the development of inflammation. When the follicular epithelium is invaded by lymphocytes it ruptures, releasing sebum, micro‐organisms, and keratin into the dermis. Neutrophils, lymphocytes, and foreign body giant cells accumulate and produce the erythematous papules, pustules, and nodular swelling characteristic of inflammatory acne (Ayer and Burrows, 2006).

21

Clinical Picture of Acne Vulgaris

Acne is most often a polymorphic disease with two main patterns of disease. The first pattern is that of essentially noninflammatory disease, which tends to be an early phase often seen in the peri-pubertal age group where there is increased oil production on the face, chest, back and shoulders. The second clinical pattern is that of inflammatory disease, which may leads to more scarring. This may include papules, pustules, nodules and cysts and any combination of them (Goodman 2006).

In most cases it is not difficult to diagnose acne but history and physical examination are keys to know if there is a cause of acne and to organize an appropriate and maximally effective treatment plan. The physician should ask about history of previous medications used for acne or other conditions. A review of cosmetics and sunscreens is also helpful. In female patients, a menstrual and oral contraceptive history is important in determining hormonal influences on acne (Zaenglein and Thiboutot, 2008).

The inflammatory lesions of acne originate with comedo formation but then expand to form papules, pustules, nodules and cysts of varying severity. Erythematous papules range from 1 to 5 mm in diameter. Pustules tend to be approximately equal in size and are filled with pus. As the severity of lesions progresses, nodules form and become markedly inflamed, indurated and tender. The cysts of acne are deeper and filled with a combination of pus and serosanginous fluid (Zaenglein and Thiboutot 2008).

22

Clinical Types of acne

1-Acne vulgaris:

Acne vulgaris is the common type of acne which occurs during puberty and affects the seborrhic areas of the face, back and chest. Patients with acne often complain of excessive greasiness of the skin with blackheads developing. These may be associated with inflammatory papules and pustules developing into larger cysts and nodules (Buxton, 1999). 2-Acne fulminans:

Acne fulminans is the most severe form of cystic acne characterized by abrupt onset of nodular and suppurative acne with variable systemic manifestations. These lesions become markedly inflamed and coalesce into painful and oozing friables plaque with hemorraghic crusts. The face,neck,chest,back and arms are all affected. The ulcerated lesions can lead to significant scarring (Placzek et al, 1999).

Osteolytic bone lesions may accompany the cutaneous findings: the clavicle and sternum are most commonly affected, followed by the ankles, humerus and iliosacral joints. Laboratory abnormalities are variable include elevated ESR, proteinuria, leukocytosis and/or anemia. They are not helpful in establishing the diagnosis but may be predictive for therapeutic response (Zaenglein and Thiboutot, 2008).

3- Acne Conglobata:

A severe eruptive form of nodulocystic acne without systemic manifestations where lesions are part of the follicular occlusion tetrad, along with dissecting cellulitis of the scalp, hidradenitis suppurativa and pilonidal cysts. The association of sterile pyogenic arthritis,pyoderma

23 gangrenosum and acne (PAPA syndrome) is part of a related group of inflammatory disorders that includes inflammatory bowel disease,uveitis and psoriases (Wise et al, 2002).

4-Acne mechanica:

It occurs secondary to repeated mechanical and frictional obstruction of the pilosebaceous outlet.Well described mechanical factors include rubbing by helmets, chin straps, suspenders and collars. A classic example of acne mechanica is fiddler’s neck, where repetitive trauma from violin placement on the lateral neck results in a well defined lichenified, hyperpigmented plaque with scattered comedones (Zaenglein and Thiboutot, 2008). 5-Drug induced acne:

Acne lesions can be seen as a side effect of a number of medications including anabolic steroids (e.g. danazol, testosterone), corticosteroids, corticotrophin, phenytoin, lithium, iso-niazid, iodides, bromides and inhibitors of the epidermal growth factor receptor (EGFR). An abrupt, monomorphous eruption of inflammatory papules and pustules is often observed in drug induced acne (Buxton, 1999).

Intravenous dexamethasone and high dose oral corticosteroids commonly induce characteristic acneiform eruptions with a concentration of lesions on the chest and back. Steroid induced acne can also result from the inappropriate use of topical corticosteroid on the face .Inflamed papules and pustules develop on a background of erythema. Lesions resolve with discontinuation of the corticosteroid, although steroid dependency can lead to prolonged and severe flares post withdrawal (Zaenglein and Thiboutot, 2008).

24

6-Acne excoriee:

Acne excoriee, a neurotic (psychogenic) excoriation which occurs mostly in women, as a result of excessive scratching, picking or squeezing of the skin using teeth, tweezers, nail files, pins and knives. The lesions are usually found on face and also on upper limbs and upper back, areas patients can easily reach. They may occur in absence or in response to skin pathology or sensation of itching (Sharma 2008).

7-Neonatal acne:

It occurs in more than 20% of healthy newborns. Lesions appear at 2 weeks of age and generally resolve within the first 3 months. Typically small inflamed papules arise on the cheeks and across the nasal bridge (Zaenglein and Thiboutot, 2008).

8- Infantile acne:

If acne presents at 3-6 months of age, it is classified as infantile acne. Clinically, comedo formation is much more prominent than in the neonatal form and may lead to pitted scarring. Infantile acne is due to high androgens of adrenal origin in girls and of adrenal and testes in boys (Herane and Ando 2003).

9-Tropical acne:

Tropical acne is an acne form, follicular eruption that results from exposure to extreme heat. Clinically; markedly inflamed nodulocystic acne involving the trunk and buttocks is frequently seen and secondary staph infection may complicate the picture (Zaenglein and Thiboutot, 2008).

10-Radiation acne:

25

Radiation acne is characterized by comedo-like papules occurring at sites of previous exposure to therapeutic ionizing radiation (e.g. external beam). The lesions begin to appear as the acute phase of radiation dermatitis begins to resolve. The ionizing rays induce epithelial metaplasia within the follicle, creating stubbornly adherent hyperkeratotic plugs that are resistant to expression (Zaenglein and Thiboutot, 2008). 11-Occupational acne:

Tars, oils and oily cosmetics can cause or exacerbate acne. Chloracne is a term used to define occupational acne caused by chlorinated aromatic hydrocarbons, the malar, retroauricular and mandibular regions as well as the axillae and scrotum are most commonly affected by small cystic papules and nodules. The extremities, buttocks and trunk are variably involved. Cystic lesions can heal with scarring and recurrent outbreaks can occur for many years following exposure (Zaenglein and Thiboutot, 2008).

26

Nutrition and Acne

Acne is driven by hormones and growth factors [particularly insulin- like growth factor (IGF-1)] acting on the sebaceous glands and the keratinocytes lining the pilary canal. Dairy products (foods produced from cow's or domestic buffalo's milk) contain 5α reduced steroid hormones and other steroid precursors of dihydrotestosterone (DHT) that drive sebaceous gland function, Drinking milk causes a direct rise in IGF- 1 through a disproportionate elevation in blood sugar and serum insulin levels. IGF-1 levels during teenage years closely parallel acne activity and are likely synergistic with the steroid hormones (Charakida et al, 2007).

Acne can be improved by controlling hormones and inflammation, both of which are influenced by diet; so full acne control requires dietary control Concurrent with standard anti-acne therapy. Vitamin A supplementation may help reduce plugging of pores in deficient individuals. Foods containing omega-3 essential fatty acids (EFAs) and EFA supplements may help to control inflammation (Kurokawa et al, 2009). Scoring Systems in Acne

The basic morphology of acne (comedones, papules, pustules, and nodules) and the extent of involvement do not permit simple evaluation due to the number of variables involved. Because these acne lesions may vary in number during the natural course of the disease, various measurements have been developed, based on clinical examination and photographic documentation (Witkowski and Parish 2004).

Methods of measuring the severity of acne vulgaris include simple grading based on clinical examination, lesion counting, and those that

27 require complicated instruments such as photography, fluorescent photography, polarized light photography, video microscopy and measurement of sebum production. The two commonly used measures are grading and lesion counting (Adityan et al, 2009).

Grading is a subjective method, which involves determining the severity of acne based on observing the dominant lesions, evaluating the presence or absence of inflammation, and estimating the extent of involvement. Lesion counting involves recording the number of each type of acne lesion and determining the overall severity (Witkowski and Parish 2004).

Comparison between grading and lesion counting

Grading Lesion counting

• Involves observing the dominant • Involves recording the numbers of lesions and estimating the extent each type of acne lesion and of involvement. determining the overall severity.

• Subjective method • Objective method.

• .Simple and quick method. • Time consuming method.

• Less accurate. • More accurate.

• Doesn't distinguish small • Distinguish small differences in differences in therapeutic therapeutic response. response. • Effect of treatment on individual • Effect of treatment on individual lesions can be estimated. lesions can't be estimated. • Used in clinical trials. • Used in offices and clinical settings.

(Adityan et al, 2009).

28

Although acne vulgaris has plagued human kind since antiquity, the need for grading acne was felt when therapies available for treating acne increased in the 1950s. Probably, the first person to use a scoring system for acne vulgaris was Carmen Thomas of PhiladelPhia. She used lesion counting in her office in the 1930s (Witkowski and parish 1999).

Several systems for grading the severity of acne were used previousely in 1956 by Pillsbury, Shelley, and Kligman who published the earliest known grading system then changed in 1958 by James and Tisserand who provided an alternative grading scheme (Quoted from Witkowski and Parish 2004).

Then in 1966, Witkowski and Simons initiated lesion counts for assessing the severity of acne vulgaris while in 1977, Michaelson, Juhlin, and Vahlquist counted the numbers of lesions on face, chest and back (Witkowski and Simons, 1966; Michaelson et al, 1977).

In 1979, Cook, Centner, and Michaels evaluated the overall severity of acne on a 0-8 scale anchored to photographic standards that illustrate grades 0,2,4,6 and 8 while in 1984, Burke, Cunliffe, and Gibson presented the Leeds technique. They described two scoring systems. The first is an overall assessment of acne severity for use in routine clinic and the second, a counting system for detailed work in therapeutic trials (Quoted from Adityan et al, 2009).

In 1996, Lucky et al, assessed the reliability of acne lesion counting (Lucky et al, 1999).

In 1997, Doshi, Zaheer, and Stiller devised a global acne grading system (GAGS) (Doshi et al, 1997).

But there is a simple grading system used by Indian authors which classify acne as:

29

• Grade 1: Comedones and occasional papules.

• Grade 2: Papules, comedones and few pustules.

• Grade 3: Predominant pustules, nodules and abscesses.

• Grade 4: Mainly cysts, abscesses and widespread scarring. (Tutakne and Chari 2003).

In 2008, Hayashi et al, used standard photographs and lesion counting to classify acne into four groups. They classified acne based on the number of inflammatory eruptions on half of the face as 0-5 'mild'; 6-20 'moderate', 21-50 'severe'; and more than 50 'very severe' (Hayashi et al, 2008).

30

Management of Acne

Management should comprise safe treatment, reduction of the psychological burden through emotional and social support, and clarifying popular misconceptions about the disease. Treatment should start as early as possible to minimise the risks of scarring or adverse psychological effects. It should be aimed at reducing non-inflammatory lesions that may be precursors to inflammatory lesions, improving existing inflammation, and decreasing the complications of acne. Treatment must be tailored to the individual patient, the type of acne, its severity, the patient’s ability to use the treatment, and their psychological state

It is very important to emphasize to the patient from the outset that the treatment of acne is a long term affair. Advice on the use of cosmetics, moisturizers, sunscreens, and hair gels may be appropriate, as some formulations are greasy and could exacerbate existing acne or even cause acne-type lesions (Ayer and Burrows 2006). Treatment of mild acne

Topical preparations are the mainstay therapy, and their main action is the prevention of new lesions. Their effect is slow and treatment should be maintained to prevent recurrence. Topical agents are active only where and when they are applied, and should therefore be applied daily to all areas of the skin prone to acne. Maintenance therapy is crucial to prevent recurrence. The topical agents available are benzoyl peroxide, antibiotics, azelaic acid, or retinoids (Cunliffe and Holland 1980; James, 2005).

Benzoyl peroxide is bactericidal for Propionibacterium acne (P acne) and improves both inflammatory and non-inflammatory lesions. It is an oxidizing agent that works by introducing oxygen into follicles, which

31 then kills P acne. Because of this mechanism of action, P acne never develops resistance to benzoyl peroxide; however there can be adverse side effects such as irritant dermatitis and bleaching of hair, clothes, and linen. Topical antibiotics such as clindamycin, tetracycline, and erythromycin are bacteriostatic for P acne and are effective for mild to moderate inflammatory acne (Berson and Shalita, 1995; Haider and Shaw, 2004).

Topical retinoids such as tretinoin and adapalene correct abnormalities in follicular keratinocytes. They are effective in both the treatment of inflammatory lesions and in the prevention of the formation of comedones. They may also reduce inflammation by interfering with the interaction between toll-like receptor and external products of P acne on the surface of antigen presenting cells (Vega et al, 2002).

In addition, topical retinoids improve the penetration of other topical medications and may also help to improve the hyperpigmentation that is left in dark skin types after the resolution of inflammatory lesions. The maximum therapeutic response to topical retinoids occurs over about 12 weeks. They may produce local irritation, increased sensitivity to sunlight, and exacerbation of inflammatory lesions (Gollnick and Schram, 1998; Thiboutot, 2000).

Combined agents such as erythromycin/zinc, erythromycin/ tretinoin, erythromycin/isotretinoin, erythromycin/benzoyl peroxide, and clindamycin/benzoyl peroxide are increasingly being used and are useful in reducing the development of antibacterial resistance in P acne. Most of these topical preparations are available in a variety of strengths and delivery systems. Drying agents (gels, washes, and solutions) are particularly suited to oily skin, whereas creams, lotions, and ointments are more suited to patients with dry, easily irritated skin (James, 2005).

32

Treatment of moderate acne

Oral antibiotics are the standard treatment for moderate acne and for cases where topical combinations are not tolerated or are ineffective. They have been shown to reduce the number of P acne. In addition to interfering with the growth and metabolism of propionobacteria, antibiotics have an anti-inflammatory activity by reducing and inhibiting cytokine production, affecting macrophage functions, and inhibiting neutrophil chemotaxis. The main systemic antibiotics used are erythromycin and different types of tetracyclines. They have a long history of verified efficacy in the management of inflammatory acne (Ayer and Burrows 2006).

Erythromycin (macrolide) should be reserved for cases where tetracyclines are not tolerated or are contraindicated: for example in pregnancy, with breast feeding, and in children below the age of 8–12 years. First generation tetracyclines (tetracycline hydrochloride, oxytetracycline) or second generation tetracyclines (doxycycline, lymecycline, or minocycline) should be considered as first line oral antibiotic therapy. Tetracycline is inexpensive and is often effective in previously untreated cases; however gastrointestinal side effects and the need to take it on an empty stomach are disadvantageous (Layton, 2004).

One advantage of the second generation of tetracyclines relates to improved absorption that is unaffected by food. This may improve compliance when second generation tetracyclines are used, particularly for adolescents. Doxycycline is cleared by the liver, allowing this

33 treatment to be used in patients with renal impairment (Ayer and Burrows, 2006).

Co-trimoxazole and trimethoprim have been used as third line agents in the treatment of acne when other systemic antibiotics are contraindicated or there is verified resistance to other agents. It is recommended to continue treatment for up to three months. If little response is seen after six weeks, the addition of a topical non-antibiotic medication or a switch to an alternative oral antibiotic should be considered (Cunliffe et al, 2003; Layton, 2004).

After control of acne is achieved and maintained for at least two months, a reduction in the dose can be attempted. Eventual withdrawal is the goal, followed by long term topical therapy. Resistance to antibiotics is a problem which may be due to widespread inappropriate use (such as inadequate potency, inadequate duration of treatment, and/or poor compliance) (Eady et al, 1989; Coates et al, 2002).

Hormonal therapy

This can be very effective in women irrespective of their serum androgen levels. Oral contraceptives may decrease free testosterone level, and the estrogen component may decrease the production of ovarian androgens by suppressing the secretion of pituitary gonadotropins. The adverse effects of oral contraceptives include nausea, breakthrough bleeding, weight gain, and breast tenderness. Available scientific evidence does not support the hypothesis that antibiotics lower the contraceptive efficacy of oral contraceptives (Archer and Archer, 2002).

Antiandrogen therapy may be of use to treat acne in women, particularly those with deep seated nodules of the lower face and neck.

34

Combination of cyproterone acetate and ethinyl estradiol (Dianette) is often effective, but its effect may be delayed for three to six months. Side effects of cyproterone include menstrual abnormalities, breast tenderness, nausea, vomiting, fluid retention, headache, and melasma. Pregnancy should be avoided during therapy with cyproterone, because of potential for feminization of the male fetus (Layton et al, 1993; Gollnick et al, 2003).

Spironolactone in doses of 50–100 mg twice daily seems to reduce sebum production and improves acne. It acts as an androgen receptor blocker and inhibits 5-a reductase. There is a theoretical risk of carcinogenicity and is therefore used only rarely. The starting dose should be around 25–50 mg daily and, provided the patient does not experience breast tenderness or headaches, can be increased to the maximum of 200 mg. It can be combined with the oral contraceptive in sexually active women to avoid the risk of pregnancy and feminization of the fetus (Ayer and Burrows, 2006). Treatment of severe acne

Patients with severe acne that does not clear with combined oral and topical therapy are considered for treatment with oral isotretinoin. Isotretinoin is a member of the retinoid class of compounds related to retinol (vitamin A). It is the only treatment that has an effect on all four of the major factors involved in the pathogenesis of acne, and it is the only treatment that may lead to permanent remission. It is also more cost effective than oral antibiotics (Peck et al, 1982; King et al, 1982).

As it is a lipid soluble drug, its absorption is increased when given with food. The recommended starting dose is 0.5 mg/kg/day, which is gradually increased according to side effects and clinical response. Minor

35 side effects of isotretinoin, such as dryness and soreness of eyes, skin, oral mucosa, nasal mucosa, muscle aches and pains, hypertriglyceridemia, and impaired night vision are reversible upon reducing the dose or withdrawal of treatment. Mucocutaneous drying can be managed by emollients and false tears (Leyden and James, 1987; Simpson, 1994).

Retinoid induced hyperlipidemia occurs more frequently in patients with underlying predisposing factors such as obesity, alcoholism, diabetes, or familial hyperlipidemia. Pre-treatment levels are not necessarily predictive of increased levels of triglycerides and cholesterol during retinoid treatment. The high levels can be managed at least partially by an appropriate diet and lipid lowering drugs. Severe potential side effects such as depression and suicide have been reported to occur within the first two months of treatment, however this was not seen in population based studies (Jacobs et al, 2001; Hull and D`Arcy, 2003).

The risk of inducing depression should be balanced with the psychological benefit of effective treatment. Pseudotumour cerebri and benign intracranial hypertension with papilloedema is a rare complication of isotretinoin therapy and has been reported when combined with oral tetracycline. The drug is only to be prescribed by dermatologists and a pregnancy prevention programme should be followed (Layton, 2004).

Signed consent should be obtained confirming that the patient knows not to get pregnant during therapy and for two months afterwards. A pre- treatment pregnancy test is required and monthly pregnancy testing throughout treatment is a recommended option. Treatment should be started on the second or third day of menstruation and reliable contraceptives should be used where necessary. Isotretinoin is

36 metabolized by cytochrome P450 enzymes, and thus it may have potential interaction with other drugs (Ng and Schweitzer, 2003).

Physical, rather than pharmacological, forms of therapy that result in rapid relief of acne include the removal of comedones and the direct injection of corticosteroids into inflamed cysts. Other modalities that are currently being evaluated include the application of topical aminolevulinic acid (ALA) followed by exposure to broadband UV light, and the N-Lite laser (Pepall et al, 1991; Oringer et al, 2004).

37

ChapterU Two

LiverU X Receptors (LXRs) The LXRs are members of the nuclear receptor (NR) superfamily. The NR superfamily is the most abundant family of transcription factors that, in general, are ligand activated transcription factors. Their natural ligands are lipophilic endocrine hormones and small signaling molecules like fatty acids, cholesterol derivatives, retinoic acid, prostaglandins and leukotrienes. These signaling molecules easily penetrate the cellular membrane and bind their cognate NR. Nuclear receptor target genes are involved in diverse biological functions, such as aging, reproduction, development and metabolism (Steffensen KR, 2006). The transcriptional effects of these receptors are mediated via two critical functional domains: the DNA-binding domain (DBD) and the ligand-binding domain (LBD). The DBD recognizes specific target genes, whereas the LBD modulates the gene transcription by interacting with transcriptional regulatory complexes in a ligand-dependent fashion (Maglich et al, 2001).

Nuclear acting hormones such as steroid and thyroid hormones were identified nearly a century ago. These signaling molecules are secreted into the bloodstream at nanomolar concentrations and ultimately regulate transcription in distant target tissues. Tissues that respond to these hormones express receptors whose ligand-binding affinity closely matches the circulating concentration of the hormone. The combination of secreted hormones and high-affinity targets is a characteristic that defines the classical endocrine signaling system. This signaling provides

38 an efficient means to simultaneously regulate gene expression at multiple sites throughout the body (Forman, 2003). About 48 members of the NR superfamily have been identified in humans. The first receptors to be cloned were the endocrine nuclear hormone receptors which were discovered in an effort to define the mechanism of action of known hormones such as the thyroid hormone; the steroidal glucocorticoid, mineralocorticoid and sex hormones; and the vitamins A and D. Several of these endocrine receptors have established or emerging roles for influencing metabolic and mitochondrial function (Alaynick, 2008).

Figure (3): Structure/function organization of nuclear receptors. The six domains (A-F) of nuclear receptors comprise regions of conserved function and sequence. All of the nuclear receptors contain a central DBD (region C), which is the most highly conserved domain and includes two zinc finger modules. A LBD (region E) is contained in the C-terminal half of the receptor. Situated between the DBD and LBD is a variable length hinge domain (region D), and variable N-terminal region (A/B)

39 contains ampF-I activation function. Most receptors also contain a variable length C- terminal region F, the function of which is poorly understood. Many members of the nuclear receptor family form homo- or heterodimers, and amino acid sequences important for dimerization are contained within the DBD and LBD (Olefsky, 2001).

Subsequent to the molecular identification of classical endocrine receptors, additional members of the nuclear hormone receptor superfamily, so called ‘‘adopted orphan receptors”, were discovered to respond with low-affinity to physiologic ligands derived from dietary and metabolic sources, such as bile salts, fatty acids and eicasanoids, present in concentrations (micromolar) orders of magnitude higher than classic endocrine hormones (nanomolar). Both the endocrine and adopted orphan receptors may have evolved from a phylogenetically transcriptional regulator that underwent multiple duplications and divergences. As a result, the NR superfamily is divided into two broad groups: (1) The transcription factors for which physiologic ligand-dependent activities have been identified (2) The orphan nuclear receptors for which physiologic ligands have yet to be identified (Escriva et al, 2004).

40

Figure (4): The nuclear receptor superfamily (Chawla et al, 2001).

Liver X Receptors (LXRs):

Liver X receptors (LXRs) are ligand-activated transcription factors that belong to the nuclear receptor superfamily. They were first identified in 1994 by screening a rat liver DNA library. LXRs were initially classified as orphan nuclear receptors because their natural ligands were unknown. In the past years identification of several physiological ligands has "adopted" these receptors. The LXR subfamily consists of two isoforms, LXR (NR1H3) and LXRß (NR1H2) that are highly related and share ~78% identity of their amino acid sequences in both DNA and ligand-binding domains. High expression of LXR is restricted to spleen, liver, adipose tissue, intestine, kidney and lung, whereas LXRß is expressed in all tissues examined. Upon ligand-induced activation both isoforms form obligate heterodimers with the retinoid X receptor (RXR) and regulate gene expression through binding to LXR response elements (LXREs) in the promoter regions of the target genes. LXRE consists of 41 two idealized hexanucleotide sequences (AGGTCA) separated by four bases (DR-4 element). LXR/RXR is a so called "permissive heterodimer" that may be activated by ligands for either partner in an independent manner. In the absence of ligands, LXR renews complexes of corepressors that are exchanged with coactivators upon receptor activation (Baranowski, 2008).

Figure (5): Mechanism of transcriptional regulation mediated by LXRs. RXR - retinoid X receptor, LXRE - LXR response element (Baranowski, 2008).

General mechanisms of LXR signaling: The LXRs are highly conserved between rodents and humans. Human LXRα and rat LXRα show up to 100% homology in amino acid composition in the DNA and LBDs while human LXRα and LXRβ show almost 80% homology in the same domains. This indicates that both LXRs belong to the same family of NRs and that they might serve the

42 same biological functions. There is a close evolutionary relationship between the LXRs and both ecdysone receptor (EcR; the Drosophila LXR) and the farnesoid X receptor (FXR). The LXRs and FXR work in concert as sensors of cholesterol homeostasis as they both regulate transcription of genes involved in cholesterol, bile acid, lipoprotein and lipid metabolism but other NRs including the glucocorticoid receptor

(GR), peroxisome proliferator-activated receptors (PPAR), liver receptor homologue 1 (LRH1) and short heterodimer partner (SHP) also have important roles in nutrient metabolism (Edwards et al, 2002). High expression of LXRα is restricted to tissues with high metabolic activity including liver, kidney, adipose tissue, small intestine and macrophages whereas LXRβ is expressed in all tissues examined. The increasing number of identified LXR target genes demonstrates that the LXRs regulate expression of genes with multiple biological functions. However, the fact that most of the identified target genes are involved in metabolic processes indicates that proper LXR signaling is vital to metabolic homeostasis in the body (Steffensen KR, 2006).

Figure (6): LXR-mediated transcriptional activation of target genes. LXR functions as an obligate RXR heterodimer that binds to its target DNA sequence, The LXR/RXR heterodimer 43 can be activated by either LXR ligands (oxysterols, synthetic ligands), the RXR ligand (9-cis- retinoic acid), or synergistically by ligands of both receptors. Upon ligand binding, the heterodimer undergoes a conformational change that recruits co-activators and results in the transactivation of LXR target genes (Millatt et al, 2003).

Molecular mechanisms underlying LXR signaling: The LXRs bind to their cognate liver X response element (LXRE), consisting of two direct hexanucleotide repeats separated by 4 nucleotides (DR4), in the promoter of the target gene where they preferentially heterodimerize with the RXR. The LXR/ RXR heterodimer is activated upon binding of either 9-cis-retinoic acid (RXR agonist) or LXR agonist or synergistically by binding of both ligands. A dimerization- induced transactivation of RXR/LXR in the absence of ligand that is mainly dependent on the LBD of LXR has also been proposed (Steffensen, 2006). Principally, ligand-activated nuclear receptors bind to their cognate response element, which then interact with several coactivator complexes to activate transcription. Numerous cofactor proteins have been identified as participants of transcriptional complexes that mediate the transcriptional activity of nuclear receptors on target genes (Brendel et al, 2002). LXRα interacts with the atypical nuclear receptors short heterodimer partner that lacks a DBD and works as one of the few repressors of ligand-activated nuclear receptors. Furthermore, LXRα was shown to interact with the PPARɣ coactivator 1α (PGC-1α) leading to increased LXRα-mediated transactivation (Oberkofler et al, 2003).

44

A: In the absence of ligands, LXR/RXR heterodimers can bind to target genes and actively repress transcription through the recruitment of corepressor complexes that contain NCoR, SMRT, and histone deacetylases (HDACs).

B: In the presence of ligands, LXR/RXR heterodimers activate transcription through recruitment of diverse coactivator complexes. These complexes contain enzymatic functions that include nucleosome remodeling activity, histone acetyltransferase and histone methyltransferase activities, and directly or indirectly recruit core transcriptional machinery to the promoter.

C: LXR agonists can inhibit the activities of other signal- dependent transcription factors, such as nuclear factor κB (NF-κB) amd activator protein-1 (AP-1). This transrepression function contributes to anti-inflammatory actions of PPARs and LXRs.

Figure (7): Transcriptional activities of liver X receptors (LXRs). LXRs possess the conserved DNA binding domain (black) and C-terminal ligand binding domain (white) characteristic of nuclear hormone receptors. PPARs and LXRs bind to specific response elements in target genes as heterodimers with retinoid X receptors (RXRs), which are also members of the nuclear receptor superfamily (Li and Glass, 2004).

LXR agonists and antagonists: It is widely accepted that endogenous LXR agonists are oxidized cholesterol derivatives referred to as oxysterols. The most potent activators of this group are 22(R)-hydroxycholesterol and 20(S)- hydroxycholesterol (intermediates in steroid hormone synthesis), 24(S)- hydroxycholesterol (produced in the brain, the major oxysterol of human

45 plasma) and 24(S), 25-epoxycholesterol (abundant in the liver) which were shown to bind to and stimulate transcriptional activity of LXRs at concentrations within the physiological range. Most oxysterols have similar affinity toward both LXR isoforms with the exception of 5, 6,

24(S), 25-dieopxy cholesterol and 6 -hydroxy bile acids which are somewhat selective for LXR (Bjorkhem et al, 2002). D-glucose and D-glucose-6-phosphate are endogenous LXR agonists with efficacy comparable to that of oxysterols. However, this finding was recently questioned on the basis of inability of glucose and its metabolites to influence the interaction of cofactors with either LXR or LXRß and the lack of involvement of LXRs in regulation of glucose-sensitive genes in liver (Denechaud et al, 2008).

In addition to natural ligands, a number of potent synthetic LXR agonists have been developed. The two most commonly used in experimental studies are T0901317 and GW3965 which show EC50 values for both LXR and LXRß in the low nanomolar range. It should be noted, however, that T0901317 was reported to activate also pregnane X receptor (PXR). The lack of widely available isoform-specific LXR agonists slows the progress of research on the function of individual LXR subtypes (Mitro,1997). In contrast to oxysterols that stimulate transcriptional activity of LXRs, geranylgeranylpyrophosphate, an intermediate of cholesterol biosynthesis pathway, inhibits both LXR isoforms by antagonizing their interaction with coactivators. Transcriptional activity of LXRs was also shown to be inhibited by distinct oxidized cholesterol 3-sulfates normally found in human plasma. Moreover, polyunsaturated fatty acids (PUFA) were reported to be competitive LXR antagonists in various cell lines. However, their antagonistic effect on LXRs was not confirmed in rodent

46 liver and hepatocytes. Although PUFA have been shown to suppress transcription of sterol regulatory element binding protein 1 (SREBP-1), one of the major LXR target genes, this action is independent of LXR (Baranowski, 2008). LXR activity is regulated not only by agonists and antagonists but also by changes in receptor expression. Several studies have demonstrated that expression of LXR (but not LXRß) is controlled by an autoregulatory mechanism. A functional LXR element activated by both LXR isoforms was identified in the human LXR gene promoter. Synthetic as well as natural LXR agonists were shown to increase LXR expression in human macrophages, adipocytes, hepatocytes, skin fibroblasts and myotubes (Kase et al, 2007). Human and rodent LXR gene promoter contains also functional peroxisome proliferator response element (PPRE) and peroxisome proliferator-activated receptor (PPAR) and agonists were shown to stimulate LXR expression in rodent as well as human macrophages, adipocytes and hepatocytes (Hammarstedt et al, 2005). Another factor controlling LXR expression is insulin which was shown to increase receptor mRNA in rat hepatocytes in a dose-dependent manner, primarily by stabilization of the transcripts. Transcriptional activity of LXR is also regulated posttranslationally by protein kinase A that phosphorylates receptor protein at two sites thereby impairing its dimerization and DNA-binding (Yamamoto et al, 2007).

LXRα auto-up-regulation Several studies have demonstrated the existence of an auto-up- regulatory loop controlling the expression of LXRα, but not LXRβ. It was found that natural and synthetic LXR ligands induce the expression of LXRα in multiple human cell types, including primary human

47 macrophages, via three functional LXREs identified in the human LXRα promoter. One of these LXREs was strongly activated by both LXRα and LXRβ, while the other two LXREs were selectively but more weakly activated by LXRα. Interestingly, LXRα auto-up-regulation appeared to be limited to human cell types (macrophages, preadipocytes, and hepatoma cells), and did not occur in murine macrophages or preadipocytes. As a result, the induction of an LXR target gene, apolipoprotein E (ApoE), by LXR ligands was significantly greater in human than in murine macrophages, indicating that humans may be more responsive than mice to treatment with LXR agonists. It is possible that such a difference may be an evolutionary response to the cholesterol-rich diet of humans as compared to rodents. This response may be particularly important during lipid loading of human macrophages, when LXRα is dramatically up-regulated and becomes the predominant LXR isoform, in contrast to the situation in resting macrophages (Millatt et al, 2003).

LXRs and the Skin LXR Expression in the Skin The epidermis is a very active site of lipid metabolism, and liver X receptor (LXR) isoforms are expressed in the epidermis (Bookout et al, 2006). LXRs are expressed in the skin, with these receptors localizing to a number of different cutaneous sites. Although there is little expression in the dermis in vivo, constitutive expression has been reported for LXRα and LXRβ in cultured fibroblasts. Furthermore, strong expression of LXRα and LXRβ is present in sebaceous glands. LXRα and LXRβ are also expressed in sweat gland epithelia. In hair follicles, LXR isoforms have been shown to be expressed not only in the outer root sheath but

48 also in the dermal papilla, connective tissue sheath, and the hair bulb (Russell et al, 2007). Role of LXR in the skin: Activation of LXRs stimulates keratinocyte differentiation and improves permeability barrier homeostasis by a number of mechanisms, including stimulating epidermal lipid synthesis, increasing lamellar body formation and secretion, and increasing the activity of enzymes required for the extracellular processing of lipids in the stratum corneum, leading to the formation of lamellar membranes that mediate permeability barrier function. The stimulation of keratinocyte differentiation and permeability barrier formation also occurs during fetal development, resulting in accelerated epidermal development. LXR activation regulates keratinocyte proliferation and apoptosis, and studies have shown that these receptors play a role in cutaneous carcinogenesis (Schmuth et al, 2008). LXR activation is anti-inflammatory, reducing inflammation. Because of their broad profile of beneficial effects on skin homeostasis, LXR have great potential to serve as drug targets for common skin diseases (Lu et al, 2006). Factors affecting LXR expression: It is well recognized that LXR expression is modulated by inflammation both in the epidermis and in other organs, such as the liver, heart, and adipose tissue. In cultured human keratinocytes, cytokines and ultraviolet light reduced the expression of LXRα, whereas the expression of LXRβ was unchanged (Lu et al, 2006).

49

LXR Activation regulates stratum corneum formation: The formation of a normal stratum corneum requires both corneocytes and the extracellular lipid matrix. The formation of these two components was viewed as concurrent but independent processes. However, as lipids accumulate within the keratinocyte for the formation of lamellar bodies, it is possible that these lipids or metabolites of these lipids will activate LXR, which could then stimulate the expression of the proteins required for keratinocyte differentiation. In addition, the activation of LXR would also increase epidermal lipid synthesis, lamellar body formation (by increasing ABCA12 expression), lamellar body secretion, and the enzymes required for the metabolism of precursor lipids to those present in the lamellar membranes. Hence, the increase in lipids that occurs during keratinocyte differentiation to facilitate lamellar body formation could activate LXR, by serving as a signal that could coordinately regulate the formation of the stratum corneum by stimulating both the formation of corneocytes and the extracellular lipid matrix (Schmuth et al, 2008).

50

Figure (8): liver X receptor (LXR) in stratum corneum formation. (Schmuth et al, 2008).

LXRα Enhances Lipid Synthesis in Sebocytes In the sebaceous glands, sebum is produced within specialized cells, which are called sebocytes, and is released as these cells burst. Sebaceous lipogenesis resulting in accumulation of lipid droplets and subsequent sebum secretion represents a major step in the terminal differentiation of Sebocytes (Zouboulis, 2004). The growth and differentiation of sebaceous gland are regulated by several nuclear receptors. For example, androgen receptor is activated by active androgens, such as dehydroepiandrosterone, androstenedione, and testosterone, which have been shown to stimulate sebum secretion in human skin.LXR is known to regulate the metabolism of lipid and cholesterol, both LXRα and LXRβ form heterodimers with the retinoid X receptor and bind specific DNA

51 sequences, that is the LXR response element (LXRE) (Alberti et al, 2000). Although many experimental results suggest that the mechanisms involved in adipogenesis are similarly utilized for sebocyte differentiation, the role of LXRs has not been illustrated for sebocytes. It was found that activation of LXRα induces lipid synthesis in sebocytes that was accompanied with the induction of SREBP-1 and PPAR (Hong et al, 2008). LXR ligands activated the expression of all three subtypes of PPARs and downstream target genes indicating that PPARs may mediate the lipogenic function of LXRα in sebocytes, at least in part. These data have currently been confirmed by a preliminary independent report indicating that both LXR isotypes are expressed in the SZ95 sebocytes and that LXRα agonists simulate lipogenesis and inhibit proliferation of the SZ95 sebocytes (Russell et al, 2006). During the last decade, considerable progress has been made in our understanding of the molecular events regulating lipogenesis in adipose tissues and the liver. Several transcriptional factors have been identified, which act cooperatively and sequentially trigger lipogenesis steps in pre- adipocytes. Among them, CCAAT/enhancer binding proteins, peroxisome proliferator activated receptors (PPAR) and sterol regulatory element binding protein -1 (SREBP-1), are thought to play crucial roles in adipogenesis. LXRα is highly expressed in tissues such as the liver, kidney, small intestine, spleen, skeletal muscle, and adipose tissue so, studies demonstrated that both LXRα and LXRβ were expressed in the SZ95 sebocytes and that LXRα plays a critical role in sebaceous lipid production (Lu et al, 2001; Hong et al, 2008). Therefore, studies were made to indicate the role of LXR in sebaceous lipogenesis and cellular lipid accumulation by employing the

52 immortalized human sebaceous gland cell line SZ95, which shows the same characteristics, morphology, and phenotype as normal human Sebocytes (Hong et al, 2008). Excess sebum and inflammation which have been currently accused to initiate acne lesions are associated with the expression of LXRα, indicating that LXRα could be one of the most important therapeutic targets for the treatment of acne. Thus, it would be advantageous to develop selective LXR antagonists to regulate sebaceous lipogenesis and inflammation (Hong et al, 2008). ARTICLE

53

SUBJECTS AND METHODS

SUBJECTS

This study was carried out on seventeen (17) patients with acne vulgaris and sixteen healthy volunteers who served as controls. All patients were candidates presenting at Kasr El Aini Dermatology Department's outpatient clinic.

Patients:

Seventeen patients with acne vulgaris were included in the study. They included 10 males & 7 females, with their ages ranged from 15-30 years. All patients received no topical or systemic therapy at least 4 weeks before inclusion in the study.

The grading score of acne used in this study:

By using lesion counting to classify acne into four groups based on the number of inflammatory eruptions on half of the face as: 0-5 'mild' ; 6-20 'moderate', 21-50 'severe'; and more than 50 'very severe' (Hayashi et al, 2008).

Controls:

Sixteen healthy volunteers served as controls. They included 6 males & 11 females, and their ages ranged from 20-27 years.

All the included subjects were informed according to the Helsinki Declaration of biomedical ethics; verbal consent was obtained after proper orientation of the subjects regarding the objectives of the study. The data's confidentiality as well as the impact of the study was respected and maintained.

Every patient was subjected to the following:

54

1-History taking:

- Personal history: name, age, sex, marital status, address, occupation, telephone number and special habits of medical importance.

- History of the present illness: onset, course, duration of illness and presence of any precipitating or aggravating factors as trauma, infection or drugs and previous treatment.

- History of other skin or systemic diseases.

- Past history of similar conditions as well as family history of skin diseases was also checked for.

2- Clinical examination:

1- Distribution: - Face - Chest - Back

2- type of the lesion:

- Inflammatory

- Non inflammatory

3-Severity of disease:

- Mild - Moderate - Severe

3- Skin biopsy:

Two punch skin biopsies were taken from the back of each acne patient (one inflammatory and another non inflammatory) each measuring 1.5mm while one punch skin biopsy measuring 1.5mm was taken from normal skin of each individual of the control group. The skin biopsy was 55 stored as a frozen section at -80 ˚C for quantitative PCR examination of LXRα mRNA.

METHODS

1-Detection of liver x receptor alpha gene expression by reverse transcriptase-Polymerase Chain Reaction (RT-PCR):

For the detection of liver x receptor alpha, RNA was extracted, reverse transcripted into cDNA and amplified by PCR.

A) Total RNA extraction:

Total RNA was extracted from the skin biopsy using RNA extraction kit provided by Qiagene extraction kit. RNA purity and quantity was measured by spectrophotometer at 260 nm.

B) Primers sequence:

Two sets of primers were used for amplification of LXRα and GHPDA genes.

LXRα sense: CGGGCTTCCACTACAATGTT

LXRα antisense: TCAGGCGGATCTGTTCTTCT

GHPDA Sense :ATGGGGAAGGTGAAGGTCGG

GHPDA antisense : TGGTGAAGACGCCAGTGGAC

C) RT-PCR for LXR α mRNA:

Reverse transcription was performed using 0.5 μg of total pure RNA, 100 ng of antisense specific primer, 100 units M-MLV reverse transcriptase (Promega, Madison, WI, USA), 20 units RNasin (Promega), 800μM PCR Nucleotide Mix (Promega) as described by the manufacturers. The cDNA were amplified by PCR using the specific

56 sense and antisense, GoTaq Green Master Mix 2X (Promega), 5 μL RT- product, in a final volume of 50 μL.

Amplifications were performed in a thermal cycler, under the following conditions: 30 cycles at 93°C 30 s, 58°C 45 s, 72°C 1 min for LXRα. GAPDH was expressed in the extracted RNA as housekeeping gene with 25 cycles at 93 °C 30 s, 56 °C 45 s, 72 °C 1 min.

D) Agarosegel electrophoresis:

All the PCR products were electrophoresed on 2% agarose gel stained with ethidium bromide and visualized by UV transilluminator. Gene expression of LxR produced sharp bands at 213bpand the GAPDA at 300bp.

* Procedure: a) 2% agarose gel was prepared as follows: one gram of agarose was dissolved in 50 ml of TAE buffer in a flask covered with aluminium foil for 5 minutes in a microwave adjustable to medium temperature. b) When the agarose solution cooled to 60°C, 2.5 μl of EB was added to allow subsequent visualization of the DNA. The gel was poured into a clean and dry gel mold. When the agarose had set completely (20-30 min), the comb was carefully removed and the gel was placed in the electrophoresis champer. The sample wells positioned at the negative electrode end of the gel tank so that DNA migrates through the gel towards the positive electrode. TAE buffer was added just enough to cover the gel. c) For loading the gel, 9 μl from the amplified DNA was added with 3 μl of loading dye. Samples were loaded carefully into the wells without hitting the gel to avoid diffusion. The gel control marker

57

was also loaded to determine the size of PCR product. 5 μl from the marker and 3 μl loading dye was used. d) The lid of electrophoresis champer was closed, the gel run at 100 Volts, 250 Ampere for 20 minutes. e) Semiquantitation by Densitometer:

The PCR products were semi-quantitated using the Densitometer system (USA)

2-Data management and statistical analysis:

IBM statistical package for social sciences (SPSS) (V.19.0, IBM Corp., USA, 2010) was used for data analysis. Data were expressed as Mean ± standard deviation for quantitative parametric measures in addition to Median Percentiles for quantitative non-parametric measures and both number and percentage for categorized data. The following tests were done:

1- Comparison of quantitative variables between the study groups using Mann Whitney U test.

2- The association between each 2 variables or comparison between 2 independent groups as regards the categorized data using Chi- square test (X²).

3- Kruskal-Wallis Test which was used for comparison between 3 or more groups.

4- Correlation between the different study variables was done using Spearman rank correlation test and the correlation coefficiencey was expressed as r value.

58

Significance level (P) value was expressed as follows:

P > 0.05 = Insignificant.

P < 0.05 = Significant.

P < 0.01 = Highly significant.

59

RESULTS

Patient's data (Table 1):

The study included 17 patients with acne vulgaris, each patient was subjected to full history and proper examination.

Patient's ages ranged from 15 to 30 years with a mean of 20.29 yr (±3.93). As regards the sex, 10 patients were males (58.8%) and 7 patients were females (41.2%).

As regards the degree of severity of the disease, 4 patients were mild (23.5%), 10 patients were moderate (58.8%) and 3 patients were severe (17.6%). While as regards the course of the disease, 2 patients were stationary (11.8%), 12 patients were progressive (70.6%) and 3 patients were cyclic (17.6%). As regard the previous treatment, 10 patients with no previous treatment (66.7%), 1 patient with topical treatment (6.7%) and 2 patients with topical and systemic (26.7%).Disease duration varied from 6 to 84 months, with a mean of 26.11 months (±26.06).

Table 2 is representing summary of clinical data of the patients.

Control's data (Table 3):

Sixteen healthy volunteers were served as control. Their ages ranged from 20 to 27 years with a mean 23.56 (±2.12), including 11 females (68.8%) and 5 males (31.2%).

60

Table (1): Clinical data of the acne vulgaris patients (n=17)

LXRα in LXRα in inflammatory comedonal Case Age Duration Sex Severity course lesions lesions No (y) (months) (ug/mg tissue) (ug/mg tissue)

1 21 male moderate 24 Progressive 1038 854

2 15 female moderate 12 Stationary 1327 842

3 30 male moderate 60 Progressive 1204 957

4 24 male severe 12 progressive 1327 947

5 18 female moderate 12 progressive 964 751

6 17 female mild 24 progressive 1008 842

7 22 female moderate 6 progressive 1204 957

8 15 male mild 12 progressive 1044 823

9 23 male severe 36 progressive 1285 945

10 22 female moderate 6 progressive 1365 1005

11 22 female moderate 84 progressive 1288 888

12 16 male moderate 6 stationary 1255 845

13 17 male mild 12 progressive 1276 852

14 19 male mild 36 cyclic 1144 934

15 23 male severe 84 cyclic 1295 935

16 23 female moderate 6 progressive 1155 944

17 18 male moderate 12 cyclic 1026 852

61

Table (2): Summary of the clinical and demographic data of the patients:

Age (years) Min: 15 Max: 30 Mean ± SD: 20.29 ± 3.93

Sex M: n = 10, (58.8%) F: n = 7, (41.2%)

Severity Mild: n = 4, (23.5%) Moderate: n = 10, (58.8%) Severe: n = 3, (17.6%)

Course Stationary: n = 2, (11.8%) Progressive: n = 12, (70.6%) Cyclic: n = 3, (17.6%)

Duration Min: 6 (months) Max: 84 Mean ± SD: 26.11 ± 26.06

Previous treatment No: 10, (66.7%) Topical: n = 1, (6.7%) Topical + systemic: n = 4, (26.7%)

Min: Minimum, Max: Maximum, SD: Standard deviation

62

Table (3): Data of the control group (n=16)

Control Age Sex LXRα no. (y) (ug/mg tissue)

1 22 male 641

2 20 female 426

3 24 female 742

4 26 female 534

5 22 female 650

6 25 male 648

7 24 female 459

8 27 male 610

9 21 female 644

10 25 male 705

11 22 female 485

12 23 female 572

13 24 female 635

14 27 male 492

15 24 female 655

16 21 female 710

63

Results of quantitative PCR in patients and control:

Patients with acne vulgaris were divided into two types:

Type 1: the inflammatory lesions

Type 2: the comedonal lesions

The level of LXRα in the inflammatory lesions ranged from 964 to 1365 with a mean of 1188.52 (±129.5) ug/mg tissue, while the level of LXRα in the comedonal lesions ranged from 751 to 1005 with a mean of 892.52 (±66.08) ug/mg tissue.

The level of LXRα in the control group ranged from 426 to 742 with a mean of 600.50 (±95.30) ug/mg tissue.

64

Table (4): Summary of the values of LXRα in both types of acne vulgaris lesions and in controls:

LXRα (ug/mg tissue)

Inflammatory Minimum 964 lesions Maximum 1365 (n=17) Median 1204

Mean ± SD 1188.52 ± 129.57

Comedonal Minimum 751 lesions Maximum 1005 (n=17) Median 888

Mean ± SD 892.52 ± 66.08

Control Minimum 426

biopsies Maximum 742 (n=16) Median 638

Mean ± SD 600.50 ± 95.30

65

Analysis of the results:

1): The level of LXRα in acne vulgaris lesions and the control:

The level of LXRα was significantly higher in both types of acne, the inflammatory acne with a mean of 1188.52 (± 129.5)ug/mg tissue and the comedonal acne with a mean of 892.52 (± 66.08) ug/mg tissue in a statistically significant manner than the controls with a mean of 600.50 (± 95.30) ug/mg tissue where the P value is 0.000

Table (5): showing the level of LXRα in both types of acne vulgaris lesions and the control: Inflammatory Comedonal Control biopsies P Value lesions (n=17) lesions(n=17) (n=16) (ug/mg (ug/mg tissue) (ug/mg tissue) tissue)

Minimum 964 751 426

Maximum 1365 1005 742

Median 1204 888 638

Mean±SD 1188.52±129.57 892.52 ±66.08 600.50 ±95.30 ٭0.000

.(P Value < 0.05 (statistically significant٭

LXRα 1400

1200

1000

800

600 LXRα

400

200

0 inflammatory acne comedonal control

Fig (9): LXR α level (ug/mg tissue) in acne vulgaris and control, P=0.000

66

2): LXRα level in the inflammatory and comedonal lesions of acne vulgaris:

The level of LXRα in the inflammatory lesions with a mean of 1188.52 (±129.57) ug/mg tissue was significantly higher than in the comedonal lesions with a mean of 892.52 (± 66.08) ug/mg tissue where the P Value is 0.000.

Table (6): LXRα level in the inflammatory and comedonal lesions of acne vulgaris:

Inflammatory Comedonal lesions P Value lesions (n=17) (n=17) (ug/mg (ug/mg tissue) tissue)

Minimum 964 751

٭Maximum 1365 1005 0.000

Median 1204 888

Mean±SD 1188.52 ± 129.57 892.52 ± 66.08

(P Value < 0.05 (statistically significant٭

LXRα 1500

1000

500 LXRα

0 inflammatory acne comedonal acne

Fig (10): LXR α level (ug/mg tissue) in the inflammatory and comedonal acne vulgaris, P=0.000

67

3): The level of LXRα with the age of the patients and the duration of disease:

Correlating the level of LXRα with the disease duration was not found to be statistically significant, where the P value is 0.114 while there was an inverse correlation between the level of LXRα and the age of patients, which was insignificant where the P value is 0.138

Table (7): LXR α with age of patients and duration of the disease

LXR α (ug/mg tissue)

Acne Vulgaris (n=17)

P Value Pearson correlation (r-value)

Age (years) 0.138 -0.213

Duration of disease 0.114 0.523 (months)

68

4): The level of LXRα with the sex of the patients:

The level of LXRα was insignificantly correlated with the sex of the patients where the P value is 0.119, where the mean in acne male patients was 967.36 ± 234.88 ug/mg tissue while in acne female patients was 842.1 ± 276.6 ug/mg tissue.

Table (8): LXRα with the sex of the patients

LXRα (ug/mg tissue) P Value Mean ± SD

Males (n=10) 967.36 ± 234.88

Females 0.119 (n=7) 842.1 ± 276.6

LXR α 1000

950

900

850 LXR α

800

750 Males Females

Fig (11): LXRα (ug/mg tissue) with the sex of the patients.

69

5): The level of LXRα and the severity of the disease:

The level of LXRα was insignificantly correlated to the disease severity where the P value is 0.378, where the mean in mild acne was 990.37 ± 160.67ug/mg tissue while in moderate acne was 1036 ± 184.45ug/mg tissue and in severe acne was 1122.33 ± 197.7ug/mg tissue.

Table (9): LXRα with the severity of the disease

Mild Moderate Severe

LXRα

Mean±SD 990.37±160.67 1036±184.45 1122.33±197.7 (ug/mg tissue)

X² 1.947

P Value 0.378

LXR α 1150

1100

1050

1000 LXR α

950

900 Mild Moderate Severe

Fig (12): LXRα (ug/mg tissue) with the severity of the disease.

70

6): The level of LXRα and the course of the disease:

The level of LXRα was insignificantly correlated to the course of the disease where the P value is 0.979, where the mean in the stationary course was 1067.25 ± 260 ug/mg tissue while in the progressive course was 1038.45 ± 179.8 ug/mg tissue and in the cyclic course was 1031 ± 163.19 ug/mg tissue.

Table (10): LXRα with the course of the disease

Stationary Progressive Cyclic

LXRα

Mean±SD (ug/mg tissue) 1067.25±260 1038.45±179.8 1031±163.19

X² 0.043

P Value 0.979

LXRα 1070 1060 1050 1040 LXRα 1030 1020 1010 stationary progressive cyclic Fig (13): LXRα (ug/mg tissue) with the course of the disease.

71

Discussion

Acne vulgaris is a disease of the pilosebaceous unit resulting from the interplay of different factors as seborrhea, P. acnes colonization, hyperkeratinization of the follicular duct and release of inflammatory mediators. Increased sebum lipogenesis by sebaceous gland is considered, among all features, the major one involved in the pathophysiology of acne. On average, acne subjects excrete more sebum than normal ones and secretion rates correlate well with the severity of the disease and the clinical manifestations (Picardo et al, 2009).

It was indicated that sebocytes, as major components of pilosebaceous unit, may act as immune cells and may be activated by P. acnes that recognize altered lipid content in sebum, followed by the production of inflammatory cytokines (Knor, 2005).

Considerable progress has been made in our understanding of the molecular events regulating lipogenesis in the adipose tissues and the liver. Several transcriptional factors have been identified, which act cooperatively and sequentially trigger lipogenesis steps in pre-adipocytes among them, PPAR and (sterol regulatory element-binding proteins) SREBP-1, are thought to play crucial roles in adipogenesis (Wu et al, 1999; Rosen et al, 2000). LXRα is highly expressed in tissues known to play important roles in lipid metabolism such as the liver, kidney, small intestine, spleen, skeletal muscle, adipose tissue and macrophages (Repa and Mangelsdorf, 2000; Lu et al, 2001).

Liver X receptors (LXRs) are ligand-activated transcription factors that belong to the nuclear receptor superfamily. Strong expression of LXRα is present in the sebaceous glands which play a critical role in the sebaceous lipid production; as it was expressed in the skin and has been

72 widely recognized in the regulation of genes involved in innate immunity, inflammation and lipid biosynthesis (Gupta et al, 2010).

Sebaceous lipogenesis resulting in accumulation of lipid droplets and subsequent sebum secretion represents a major step in the terminal differentiation of sebocytes (Downie and Kealey, 1998). Excessive sebum production from the sebaceous glands is one of the major causes of acne (Brown and Shalita, 1998; Zouboulis, 2004).

LXRα expression has been studied in sebocyte cell lineages but not in acne lesions in vivo. The aim of this study was to investigate the level of tissue expression of LXRα in different types of acne lesions in correlation to the clinical settings observed in acne cases and in comparison to normal skin of controls, in order to clarify the role of LXR in the pathogenesis of acne. Seventeen acne patients were recruited for this study and according to the biopsies obtained, lesions were subcategorized into 2 groups, inflammatory and comedonal, for which the level of LXRα was measured by PCR technique. The same technique was used to detect expression of LXRα in normal skin biopsies obtained from 16 age-and-sex matched healthy volunteers who served as control population.

Our results showed that the mean level of LXRα was significantly higher in lesional acne skin in a statistically significant manner than in the control population, where the P value was <0.001. This supports the fact that increased LXR expression has a key role in acne pathogenesis. It is proposed to be through its action on inducing lipogenesis; as activation of LXRα inhibits proliferation, increases lipogenesis and improves differentiation of sebocytes (Hong et al, 2008).

Our results agree with the findings of Russell et al (2007) who demonstrated the increased lipogenesis in sebocytes by synthetic

73 stimulation of LXR which was significantly increased by 1.5 folds following incubation for 2 days with synthetic LXR agonists; which also increased by 5 folds following incubation for 5 days when compared with untreated control cells. Furthermore, Russell et al (2006) indicated that both LXR isotypes are expressed in the SZ95 sebocytes, and that LXRα stimulate lipogenesis and inhibit proliferation of the SZ95 sebocytes.

PPAR and LXR are related to the same subfamily of the nuclear receptors; and strong expression of PPARα, PPARβ/δ, PPARγ1, LXRα, and LXRβ is present in sebaceous glands (Russel et al, 2007; Schmuth et al, 2008). LXR ligands activate the expression of all three subtypes of PPARs and downstream target genes indicating that PPARs may mediate the lipogenic function of LXRα in sebocytes, at least in part. It has been reported that activation of LXR involves the induction of PPARγ and downstream adipogenic gene expression in adipose tissue (Seo et al, 2004).

Our results support the findings of Elmongy and Shaker (2011) who demonstrated that sebum production is the key factor in the pathophysiology of acne, and lipid mediators are able to interfere with sebocyte differentiation and sebogenesis through the activation of pathways related to PPAR. Their results showed a highly statistically significant increase in PPAR β/δ expression in acne patients compared to controls and this expression was also significantly increased in lesional compared to non-lesional skin in patients; and that the increased PPAR β/δ expression could have a role in the pathogenesis of acne vulgaris through an increase in lipogenesis.

In addition to their key role in cholesterol homeostasis, LXRs have emerged as important regulators of inflammatory gene expression and innate immunity. Hong et al (2008) showed that activation of LXR

74 blunts the induction of classical inflammatory genes such as iNOS and COX-2 in the SZ95 sebocytes. The expression of COX-2 and iNOS is largely controlled by NF-kB in response to a variety of inflammatory signals, suggesting that LXRα may antagonize the activation of NF-kB in sebocytes. (Hayden and Ghosh, 2004; Zelcer and Tontonoz, 2006). COX-2 is normally expressed in the SZ95 sebocytes, and COX-2 expression is upregulated in the sebaceous glands of acne-involved skin (Alestas et al, 2006; Zhang et al, 2006).

It was demonstrated that LXR activators have potent anti-inflammatory activity in both the irritant and allergic contact models of cutaneous inflammation via inhibition of cytokine production upon topical treatment with LXR endogenous and synthetic agonists. LXR activators did not reduce inflammation in LXRβ-deficient or LXRα/β-deficient mice, indicating that LXRβ was required for this anti-inflammatory effect (Fowler et al, 2003). Further studies with analysis of purified primary lymphoid cultures established that activation of LXRβ by physiologic or pharmacologic ligands diminishes the proliferative capacity of B and T cells (Bensinger et al, 2008).

In this study acne lesions were subcategorized into two groups, inflammatory (papules) and non-inflammatory (open and closed comedones), for which the level of LXRα was measured. The level proved to be higher in inflammatory than comedonal acne in a statistically significant manner (p=0.000). This indicates that LXRα may play a role in the progression of disease from comedonal to inflammatory phase, as most inflammatory acne lesions arise from comedones (54%) and in 28% of lesions from normal skin (Do et al, 2008). This is possibly through excess induction of sebaceous lipogenesis.

75

However, it suggests that in sebaceous glands in vivo LXRα does not play an anti-inflammatory role. LXRβ levels were not measured in this study. It could be speculated that an unchanged or even reduced level might aid in the disease progress from non-inflammatory phase to the inflammatory phase. Further studies on LXRβ in acne should be performed to clarify this component.

On the other hand, PPARs may mediate the lipogenic function of LXRα in sebocytes, at least in part (Hong et al, 2008). It was recently proven by Elmongy and Shaker (2011) that inflammatory acne did not show a significant increase in PPAR β/δ expression compared to non- inflammatory acne, although its level was significantly elevated in lesional versus non-lesional acne skin. So, the increased PPAR β/δ was not simply due to inflammation and it is directly related to the pathogenesis of acne vulgaris itself.

Therefore, we assume that the effects of LXR on induction of acne vulgaris are not due to transrepression of inflammatory signaling pathways; rather they are related to control of cellular cholesterol metabolism inducing excess lipogenesis, which promotes the progress of the disease state into the papulopustular phase. It is established that LXRs regulate gene expression linked to cholesterol metabolism in a tissue- specific manner, according to whether it is in the liver, intestine or in macrophages (Hong and Tontonoz, 2008).

Additionally, our results showed that the level of LXRα was significantly higher in the comedonal (non inflammatory) acne in a statistically significant manner than in controls biopsies, where the P value was <0.001 so. This result established that the increased LXRα expression is directly related to the pathogenesis of acne vulgaris itself and is not a consequence of inflammation.

76

Hong et al, 2010 examined whether LXRα and its ligands regulate lipid synthesis in HaCaT cells (a transformed human keratinocyte cell lineage) depending on previous studies which demonstrated that ligands of LXRα are important in the maintenance of the normal epidermal barrier function and keratinocyte differentiation. When HaCaT cells were treated with the LXRα ligand TO901317, lipid droplets accumulated in the majority of cells, this lead to lipogenesis in keratinocytes, which may enhance the epidermal barrier function of the skin. This further indicates that LXR has a role in lipid synthesis in these cells.

In our study, the level of LXRα was insignificantly correlated to the disease severity whether it was mild, moderate or severe so, it cannot be used as a clinical marker for the disease, nor its level as a predictor for disease severity. Also, no statistically significant correlations were found between the level of LXRα and the disease duration or the sex of the patients, while there was insignificant inverse correlation between the level of LXRα and the age of patients. This substantiates further the results of Elmongy and Shaker (2011) who demonstrated no correlations between age, disease duration and mean PPAR mRNA levels in lesional skin of acne vulgaris patients.

The course of the acne whether it was stationary, progressive or it was remitting and exacerbating (cyclic) was as well insignificantly correlated to the level of LXRα.

77

Conclusions

1-Excess sebum and inflammation, which been accused of initiating acne lesions are associated with the function of LXR.

2- LXRα could be one of the most important therapeutic targets for the treatment of acne, as its main role in acne pathogenesis is increased sebaceous lipogenesis, induction of comedogenesis in addition to its role in the progression from comedonal to inflammatory acne.

Recommendations

1- It would be advantageous to develop selective LXRα antagonists to regulate sebaceous lipogenesis in acne vulgaris.

2- A better understanding of the molecular control of the LXR-induced sebocyte differentiation and inflammation may lead to improved pharmacological interventions for the treatment of sebaceous gland- associated disorders.

3- Further studies of the role of LXR-beta in inflammatory versus non- inflammatory acne lesions in vivo are needed.

78

Summary

Acne vulgaris is a disease of the pilosebaceous unit characterized by: seborrhea, Propionobacterium acnes colonization, hyperkeratinization of the follicular duct and release of inflammatory mediators. Increased sebum lipogenesis by sebaceous gland is considered, among all features, the major one involved in the pathophysiology of acne. On average, acne subjects excrete more sebum than normal ones and secretion rates correlate well with the severity of the disease and the clinical manifestations.

It was indicated that sebocytes, as major components of pilosebaceous unit, may act as immune cells and may be activated by P. acnes that recognize altered lipid content in sebum, followed by the production of inflammatory cytokines.

The growth and differentiation of sebaceous gland is regulated by several nuclear receptors. Liver X receptors (LXRs) are ligand-activated transcription factors that belong to the nuclear receptor superfamily. There are two isoforms of LXR: LXRα and LXRβ. LXRα have been widely recognized in the regulation of genes involved in innate immunity, inflammation and lipid biosynthesis. Activation of LXRα inhibits proliferation, increase lipogenesis and improve differentiation of sebocytes.

The aim of this study was to investigate the level of tissue expression of LXRα in inflammatory versus non inflammatory acne vulgaris lesions and in comparison with normal skin to clarify the role of LXR in the pathogenesis of acne and thereby the effect of its agonists and antagonists in treatment of different types of acne.

79

The study included 17 patients with acne vulgaris, 10 males (58.8%) and 7 females (41.2%). Patient's ages ranged from 15 to 30 years with a mean of 20.29 years ±3.93. Disease duration varied from 6 to 84 months, with a mean of 26.11 months ± 26.06. In comparison with 16 healthy volunteers served as control. Their ages ranged from 20 to 27 years with a mean of 23.56 ±2.12, including 11 females (68.8%) and 5 males (31.2%).

Punch skin biopsies were taken from the back of the acne patient's; one inflammatory and another non inflammatory as well as from the normal skin of the volunteers for detection of gene expression of LXRα by RT- PCR.

The level of LXRα was significantly higher in the lesional skin either inflammatory (with a mean of 1188.52 ± 129.5) or comedonal acne (with a mean of 892.52 ± 66.08) in a statistically significant manner than the controls (with a mean of 600.50 ± 95.30) where the P value was <0.001. As activation of LXRα inhibits proliferation, increase lipogenesis and improve differentiation of sebocytes. So, the increased LXR expression could have a role in acne pathogenesis through an increase in lipogenesis.

In this study, the level of LXRα was higher in inflammatory than comedonal acne in statistically significant manner indicating it may plays a role in the progression of disease from comedonal to inflammatory.

In this study, the level of LXRα was insignificantly correlated to the disease severity whether it was mild, moderate or severe so, it cannot be a clinical marker for the disease. Also, no statistically significant correlations were found between the level of LXRα and the disease duration or the sex of the patients, while there was insignificant inverse correlation between the level of LXRα and the age of patients.

80

The course of the acne whether it was stationary, progressive or it was remitting and exacerbating (cyclic) was insignificantly correlated to the level of LXRα.

Excess sebum and inflammation, been currently accused to initiate acne lesions are associated with the function of LXRα, indicating that LXRα could be one of the most important therapeutic targets for the treatment of acne.

A better understanding of the molecular control of the LXR-induced sebocyte differentiation and inflammation may lead to improved pharmacological interventions for the treatment of sebaceous gland- associated disorders.

81

References

Adityan B, Kumari R and Thappa DM (2009): scoring system in acne vulgaris. Indian J Dermatol Venereol Leprol; 75: 323-326.

Alaynick WA (2008): Nuclear receptors, mitochondria and lipid metabolism. Mitochondrion; 8:329-37. Alberti S, Steffensen KR and Gustafsson JA (2000): Structural characterisation of the mouse nuclear oxysterol receptor genes LXRalpha and LXRbeta. Gene; 43:93–103.

Alestas T, Ganceviciene R, Fimmel S, Muller-Decker K and Zouboulis CC (2006): Enzymes involved in the biosynthesis of leukotriene B(4) and prostaglandin E(2) are active in sebaceous glands. J Mol Med; 84:75–87.

Archer J and Archer D (2002): Oral contraceptive efficacy and antibiotic interaction: a myth debunked. J Acad Dermatol; 46:917–23.

Ayer J and Burrows N (2006): Acne: more than skin deep. Postgrad Med J; 82:500–506.

Baronowski M (2008): Biological role of liver x receptors. Journal of physiology and pharmacology; 59:31–55.

Bensinger SJ, Bradley MN, Joseph SB, Zelcer N, JansJen EM,4 Hausner MA, Shih R, Parks JS, Edwards PA, Jamieson BD and Tontonoz P (2008): LXR signaling couples sterol metabolism to proliferation in the acquired immune response. Cell; 134: 97-111.

Berson DS and Shalita AR (1995): The treatment of acne; the role of combination therapies. J Acad Dermatol; 32:532–41.

82

Bjorkhem I, Meaney S and Diczfalusy U (2002): Oxysterols in human circulation: which role do they have? Curr Opin Lipidol; 13: 247-253.

Bookout AL, Jeong Y, Downes M, Yu RT, Evans RM and Mangelsdorf DJ (2006): Anatomical profiling of nuclear receptor expression reveals a hierarchical transcriptional network.Cell;126:789-99.

Brendel C, Schoonjans K, Botrugno OA, Treuter E and Auwerx J (2002): The small heterodimer partner interacts with the liver X receptor alpha and represses its transcriptional activity. Mol Endocrinol; 16: 2065– 2076.

Brown SK and Shalita AR (1998): Acne vulgaris. Lancet; 351:1871–6.

Buxton PK (1999): Acne vulgaris. ABC book of dermatology: 47 - 51.

Charakida A, Charakida M and Chu AC (2007): Double-blind, randomized, placebo-controlled study of a lotion containing triethyl citrate and ethyl linoleate in the treatment of acne vulgaris. J Dermatol; 157:569-74.

Chawla A, Repa JJ, Evans RM and Mangelsdorf DJ (2001): Nuclear receptors and lipid physiology: opening the X-files. Science; 294: 1866– 1870.

Chen CW, Thiboutot D and Zouboulis CC (2002): Cutaneous androgen metabolism: basic research and clinical perspectives. J Invest Dermatol; 119: 992-1003.

Clarke S, Nelson A, George R and Thiboutot DM (2007): Pharmacologic modulation of sebaceous gland activity. Dermatol Clin; 25:137–146.

83

Coates P, Vyakrnams S, Eady EA, Jones CE, Cove JH and Cunliffe WJ (2002): Prevalence of antibiotic resistant P bacteria on the skin of acne patients. Br J Dermatol; 146:840–8.

Cunliffe WJ (1989): Acne. In: Dunitz M, ed. London.

Cunliffe WJ and Holland KT (1980): The effect of benzoyl peroxide in acne. Acta Derm Venereol; 61:267–9.

Cunliffe WJ, Meynadier J, Alirezai M, George SA, Coutts I and Roseeuw DI (2003): Is combined oral and topical therapy better than oral therapy alone in patients with moderate to severe acne vulgaris. J Am Acad Dermatol; 49:218–26.

Degitz K, Placzek M, Borelli C and Plewig G (2007): Pathophysiology of acne. J Dtsch Dermatol Ges; 4: 316 – 323.

Denechaud PD, Bossard P, Lobaccaro JM, Millatt L and Staels B (2008): LXRs, required for the induction of glucose-regulated genes in mouse liver. J Clin Invest; 118: 956-964.

Dessinioti C and Katsambas AD (2010): The role of Propionibacterium acnes in acne pathogenesis: facts and controversies. Clin Dermatol; 28:2- 7.

Do TT, Zarkhin S, Orringer JS, Nemeth S, Hamilton T, Sachs D, Voorhees JJ and Kang S (2008): Computer-assisted alignment and tracking of acne lesions indicate that most inflammatory lesions arise from comedones and de novo. J Am Acad Dermatol; 58:603-8.

Doshi A, Zaheer A and Stiller MJ (1997): A comparison of current grading systems. Int J Dermatol; 36:416-8.

84

Downie MM and Kealey T (1998): Lipogenesis in the human sebaceous gland: glycogen and glycerophosphate are substrates for synthesis of sebum lipids. J Invest Dermatol; 111:199–205.

Eady EA, Cove JH, Holland KT and Cunliffe WJ (1989): Erythromycin resistant P bacteria in antibiotics treated acne patients; association with therapeutic failure. Br J Dermatol; 121:51–7.

Ebede TL, Arch EL and Berson D (2009): Hormonal treatment of acne in women. J Clin Dermatol; 2:16–22.

Edwards PA, Kast HR and Anisfeld AM (2002): The adoption of LXR and FXR and their roles in lipid homeostasis. J Lipid Res; 43: 2–12.

Elmongy NN and Shaker O (2011): Expression of Peroxisome

Proliferator Activator Receptor β/δ (PPAR β/δ) in acne vulgaris. Eur J Dermatol; epub ahead of print.

Escriva H, Bertrand S and Laudet V (2004): The evolution of the nuclear receptor superfamily. Essays Biochem; 40: 11–26.

Forman BM (2003): Orphan nulear receptors. Handbook of Cell Signaling; 3:47-52.

Fowler AJ, Sheu MY, Schmuth M, Kao J, Fluhr JW, Rhein L and Collins JL (2003): Liver X receptor activators display anti-inflammatory activity in irritant and allergic contact dermatitis models. J Invest Dermatol; 120: 246–255.

Gollnick H and Schram M (1998): Topical drug treatment for acne. Dermatology; 196:119–25.

85

Gollnick H, Cunliffe WJ, Berson D, Dreno B and Finlay A (2003): Management of acne, a report from a global alliance to improve outcomes in Acne. J A Acad Dermatol; 49:S1–37.

Goodman G (2006): Acne-natural history, facts and myths. Aust fam physician; 35:613-6.

Goolamali SK and Andison AC (1977): The origin and use of the word ‘Acne’.Br J Dermatol; 96: 291-294.

Goulden V, Stables GI and Cunliffe WJ (1999): Prevalence of facial acne in adults. J Acad Dermatol; 41: 577-580.

Greene RS, Downing DT, Pochi PE and Strauss JS (1970): Anatomical variation in the amount and composition of human skin surface lipid. J Invest Dermatol; 54:240-7.

Gupta DS, Kaul D, Kanwar AJ and Parsad D (2010): Psoriasis, crucial role of LXR-alpha RNomics. Genes Immun; 11:37-44.

Haider A and Shaw JC (2004): Treatment of acne vulgaris. JAMA; 292:726–35.

Hammarstedt A, Sopasakis VR, Gogg S, Jansson PA and Smith U (2005): Improved insulin sensitivity and adipose tissue dysregulation after short-term treatment with pioglitazone in non-diabetic, insulin- resistant subjects. Diabetologia; 48: 96-104.

Hanley K, Ng DC, He SS, Lau P, Min K and Elias PM (2000): Oxysterols induce differentiation in human keratinocytes and increase AP-1-dependent involucrin transcription. J Invest Dermatol; 114:545- 553.

86

Hayatshi N, Akamatsu H and Kawashima M (2008): Acne study group, establishment of grading criteria. J Dermatol; 35:255-60.

Hayden MS and Ghosh S (2004): Signaling to NF-kB. Genes Dev; 18: 2195–224.

Herane MI and Ando I (2003): Acne in infancy and acne genetics. Department of dermatology, chile university; 206:24-8.

Heymann WR (2006): Toll-like receptors in acne vulgaris. J Acad Dermatol; 55:691-2.

Hong C and Tontonoz P (2008): Coordination of inflammation and metabolism by PPAR and LXR nuclear receptors. Curr Opin Genet Dev; 18: 461–467.

Hong I, Lee MH, NA TY, Zouboulis CC and Lee MO (2008): LXR alpha enhances lipid synthesis in SZ95 sebocytes.Jinvest Dermatol; 128:1266-1272.

Hull PR and D’Arcy C (2003): Isotretinoin use and subsequent depression and suicide presenting the evidence. J Clin Dermatol; 4:493– 505.

Hunter J, Savin J and Dahl M (2002): Sebaceous and sweat gland disorders. Blackwell science, Denmark; 148–156.

Jacobs DG, Deutsch NL and Brewer M (2001): Suicide, depression and isotretinoin. Is there a causal link? J Acad Dermatol; 45:S168–75.

James WD (2005): Acne. N Engl J Med; 352:1463–72.

Jeremy AH, Holland DB and Roberts SG (2003): Inflammatory events are involved in acne lesion initiation. J Invest Dermato; 121:20-7.

87

Kase ET, Thoresen GH, Westerlund S, Hojlund K, Rustan AC and Gaster M (2007): Liver X receptor antagonist reduces lipid formation and increases glucose metabolism in myotubes from lean, obese and type 2 diabetic individuals. Diabetologia; 50: 2171-2180.

Kim J, Ochoa MT, Krutzik SR, Takeuchi O and Uematsu S (2002): Activation of toll-like receptor 2 in acne triggers inflammatory cytokine response. J Immunol; 169:1535-41.

King K, Jones DH, Daltry DC and Cunliffe WJ (1982): double blind study of effects of retinoic acid on acne sebum excretion and microbial population. Br J Dermatol; 107:583–90.

Knor T (2005): The pathogenesis of acne. Acta Dermavenerol; 13:44-49.

Komuves LG, Schmuth M, Fowler AJ, Elias PM and Hanley K (2002): Oxysterol stimulation of epidermal differentiation is mediated by liver-X-receptor α in murine epidermis. J Invest Dermatol; 118:25-34.

Kubba R, Bajaj AK, Thappa DM, Sharma R, Vedamurthy M, Dhar S and Criton S (2009): Acne in India: guidelines for management. Indian J Dermatol; 75:1-62.

Kurokawa I, Danby FW, Ju Q, Wang X, Xiang LF, Xia L, Chen W, Nagy I, Picardo M and Suh DH (2009): New developments in our understanding of acne pathogenesis and treatment. Exp Dermatol; 18:821-32. Layton A (2004): Systemic therapy of acne vulgaris. Br J Hosp Med; 65:80–5.

Layton AM, Knaggs H, Taylor J and Cunliffe WJ (1993): Isotretinoin for acne vulgaris-10 years later- a safe and successful treatment. Br J Dermatol; 129:292–6.

88

Leyden J and James WD (1987): Staphylococcal infection as a complication of isotretinoin therapy. Arch Dermatol; 123:606–8.

Li AC and Glass CK (2004): PPAR- and LXR-dependent pathways controlling lipid metabolism and the development of atherosclerosis. Journal of Lipid Research; 45:2161-2173.

Lu B, Moser AH, Shigenaga JK, Feingold KR and Grunfeld C (2006): Type II nuclear hormone receptors, coactivator and target gene repression in adipose tissue in the acute-phase response. J Lipid Res; 47: 2179–2190.

Lu TT, Repa JJ and Mangelsdorf DJ (2001): Orphan nuclear receptors. J Biol Chem; 276:37735–8.

Lucky AW, Barber BL, Girman CJ and Williams J (1996): Multirater validation study to assess the reliability of acne lesion counting. J Acad Dermatol; 35:559-65.

Maglich, Sluder JM, GuanA, Shi X, McKee Y, Carrick K,

Willson T M and Moore JT (2001): Genome Biol 2 research: 291-297.

Michaelsson G, Juhlin L and Vahlquit A (1977): Oral zinc sulphate therapy for acne vulgaris. Acta Derm Venerol; 57:372.

Millatt LJ, Bochera V, Jean-Charles and Staels B (2003): Liver X receptors and the control of cholesterol homeostasis: potential therapeutic targets for the treatment of atherosclerosis. Biochimica et Biophysica Acta; 1631:107–118.

Mitro N, Mak PA, and Vargas L, Godio C and Hampton E (2007): The nuclear receptor LXR is a glucose sensor. Nature; 445: 219-223.

89

Ng CH and Schweitzer I (2003): The association between depression and isotretinoin use in acne. Aust N Z J Psychiatry; 37:78–84.

Oberkofler H, Schraml E, Krempler F and Patsch W (2003): Potentiation of liver X receptor transcriptional activity by peroxisome- proliferator-activated receptor gamma co-activator 1 alpha. J Biochem; 371:89–96.

Olefsky JM (2001): Nuclear Receptor Minireview Series. The journal of biological chemistry; 276: 36863–36864.

Oringer JS, Kang S, Hamilton T, Schumacher W and Cho S (2004): Treatment of acne vulgaris with a pulsed dye laser. JAMA; 29:2834–9.

Peck GL, Olsen TG, Butkus D and Pandya M (1982): Isotretinoin versus placebo in the treatment of cystic acne, a randomised double blind study. J Acad Dermatol; 6:735–45.

Pepall LM, Cosgrove MP and Cunliffe WJ (1991): Ablation of whiteheads by cautery under topical anaesthesia. Br J Dermatol; 125:256–9.

PicardoM, Ottaviani M, Camera E, and Mastrofrancesco A (2009): Sebaceous gland lipids. Dermatoendocrinol; 1: 68–7.

Placzek M, Degitz K, Schmidt H and Plewig G (1999): Acne fulminans in late onset congenital adrenal hyperplasia. Lancet; 354: 739 - 740.

Purdy S and De Berker D (2009): Acne. BMJ; 333: 949 – 953.

Ramos-e-Silva M and Carneiro SC (2009): Acne vulgaris: review and guidelines. Dermatol Nurs.; 21(2):63-8.

90

Repa JJ and Mangelsdorf DJ (2000): The role of orphan nuclear receptors in the regulation of cholesterol homeostasis. Annu Rev Cell Dev Biol; 16:459–481.

Rosen ED, Walkey CJ, Puigserver P, Spiegelman BM (2000): Transcriptional regulation of adipogenesis. Genes Dev; 14:1293–307.

Ross JI, Snelling AM, Carnegie E, Coates P and Cunliffe WJ (2003): Antibiotic-resistant acne, lessons from Europe. Br J Dermatol; 148:467- 78.

Russell LE, Harrison WJ, Bahta AW, Zouboulis CC, Burrin JM, and Philpott MP (2007): Characterization of liver X receptor expression and function in human skin and the pilosebaceous unit. Exp Dermatol; 16: 844–852.

Russell L, Harrison W, Zouboulis CC, Burrin J and Philpott MP (2006): Characterisation of liver X receptors within the pilo-sebaceous unit. Exp Dermatol; 213:69-75.

Schmuth M, Jiang YJ, Dubrac S, Elias PM, and Feingold KR (2008): Peroxisome proliferator-activated receptors and liver X receptors in epidermal biology. Journal of Lipid Research; 49:499-509.

Seo JB, Moon HM, Kim WS, Lee YS, Jeong HW, Yoo EJ and Ham J (2004): Activated liver X receptors stimulate adipocyte differentiation through induction of peroxisome proliferator-activated receptor expression. Mol Cell Biol; 24:3430–44.

Sharma H (2008): Psychogenic excoriation responding to fluoxetine, case report. J Indian Med Assoc.; 106(4):245, 262.

91

Simpson N (1994): Effect of isotretinoin on the quality of life of patients with acne. Pharmacoeconomics; 6:108–13.

Smith KR and Thiboutot DM (2008): Sebaceous Gland lipids: Friends or foe?. J Lip Res; 49:271-8.

Steffensen KR (2006): Liver X receptors as potential drug targets for diabetes and its disorders. Mol Endocrinol; 256:9-16.

Thiboutot D (2000): New treatment and therapeutic strategies for Acne. Arch Fam Med; 9:179–87.

Thiboutot D, Bayne E, Thorne J, Gilland K, Flanagan J, Shao O, Light J and Helm K (2000): Immunolocalization of 5 alpha-reductase isozymes in acne lesions and normal skin. Arch Dermatol; 136: 1125-9.

Thiboutot D, Gilliland K, Light J and Lookingbill D (1999): Androgen metabolism in sebaceous glands from subjects with and without acne. Arch Dermatol; 135: 1041-5.

Thielitz A, Helmdach M, Roepke EM and Gollnick H (2001): Lipid analysis of follicular casts from cyanoacrylate strips as a new method for studying therapeutic effects of antiacne agents. Br J Dermatol; 145:19-27.

Tutakne MA and Chari KVR (2003): Acne, rasacea and perioral dermatitis. Bhalani publishing house; 689-710.

Vega B, Jomard A and Michael S (2002): Regulation of toll-like receptor 2 expression by adapaline. J Eur Acad Dermatol Venereol; 16:123–4.

Willy PJ, Umesono K, Ong ES, Evans RM, Heyman RA and Mangelsdorf DJ (1995): LXR, a nuclear receptor that defines a distinct retinoid response pathway. Genes Dev.

92

Wise GA, Gillum JD and Seideman CE (2002): Mutations in CD2BP1 disrupt binding to PTP PEST are responsible for PAPA syndrome, an autoinflammatory disorder. Hum Mol GENETICS; 11: 961 - 969.

Witkowski JA and Simons HM (1966): Objective evaluation of demethylchortetracycline hydrochloride in the treatment of acne. JAMA; 196:397-400.

Witkowski JA and Parish LC (1999): from the ghosts of the past: acne lesion counting. J Acad Dermatol; 40-131.

Witkowski JA and Parish LC (2004): The assessment of acne. Clin Dermatol; 22:394-7.

Wu Z, Puigserver P and Spiegelman BM (1999): Transcriptional activation of adipogenesis. Curr Opin Cell Biol; 11:689–94.

Yamamoto T, Shimano H, Inoue N, Nakagawa Y and Matsuzaka T (2007): Protein kinase A suppresses sterol regulatory elementbinding protein-1C expression via phosphorylation of liver X receptor in the liver. J Biol Chem; 282: 11687-11695.

Zaenglein AL and Thiboutot DM (2008): Acne Vulgaris. JV Schaffer; 1: 495.

Zaidi Z (2009): Acne vulgaris - an update on pathophysiology and treatment. J Park med assoc; 59:635-7.

Zelcer N and Tontonoz P (2006): Liver X receptors as integrators of metabolic and inflammatory signaling. J Clin Invest; 116: 607–14.

Zhang Q, Seltmann H, Zouboulis CC and Konger RL (2006): Involvement of PPARγ in oxidative stress-mediated prostaglandin E2

93 production in SZ95 human sebaceous gland cells. J Invest Dermatol; 126: 42–8.

Zouboulis CC (2004): Acne, Sebaceous gland action. Clin Dermatol; 22: 360–366.

Zouboulis CC, Baron JM, Bohm M, Kippenberger S, Kurzen H, Reichrath J and Thielitz A (2008): Frontiers in sebaceous gland biology and pathology. Exp Dermatol; 17:542-51.

Zouboulis CC, Eady A, Philpott M, Goldsmith LA, Orfanos C, Cunliffe WC and Rosenfield R (2005): What is the pathogenesis of acne?. Exp Dermatol; 14: 143–152.

94

ﺍﻟﻤﻠﺨﺺ Uﺍﻟﻌﺮﺑﻰ

ﺣﺐ ﺍﻟﺸﺒﺎﺏ ﻫﻮ ﻣﺮﺽ ﺍﻟﻮﺣﺪﺓ ﺍﻟﺸﻌﺮﻳﺔ ﺍﻟﺪﻫﻨﻴﺔ ﻭﺍﻟﺬﻯ ﻳﺘﻤﻴﺰ ﺏﺍﻟﺰﻫﻢ ، ﺍﻻﺳﺘﻌﻤﺎﺭ ﻟﺒﻜﺘﻴﺮﻳﺎ ﺍﻟﺒﺮﻭﺑﻴﻮﻧﻴﺔ ﺍﻟﻌﺪﻳﺔ ، ﻓﺮﻁ ﺗﺸﻜﻞ ﺍﻟﻜﻴﺮﺍﺗﻴﻦ ﻣﻦ ﺍﻟﻘﻨﺎﺓ ﺍﻟﺠﺮﻳﺒﻲ ﻭﺍﻹﻓﺮﺍﺝ ﻋﻦ ﻭﺳﻄﺎء ﺍﻟﺘﻬﺎﺑﺎﺕ. ﺗﻌﺘﺒﺮ ﺯﻳﺎﺩﺓ ﺗﻜﻮﻥ ﺍﻟﺪﻫﻮﻥ ﺍﻟﺰﻫﻤﻴﺔ ﻣﻦ ﺍﻟﻐﺪﺓ ﺍﻟﺪﻫﻨﻴﺔ ﺍﺣﺪ ﺍﻟﻌﻮﺍﻣﻞ ﺍﻟﺮﺋﻴﺴﻴﺔ ﺍﻟﻤﺸﺎﺭﻛﺔ ﻓﻲ ﺍﻟﻔﻴﺰﻳﻮﻟﻮﺟﻴﺎ ﺍﻟﻤﺮﺿﻴﺔ ﻣﻦ ﺣﺐ ﺍﻟﺸﺒﺎﺏ. ﻓﻲ ﺍﻟﻤﺘﻮﺳﻂ، ﻣﺮﺿﻰ ﺣﺐ ﺍﻟﺸﺒﺎﺏ ﺗﻔﺮﺯ ﺍﻟﻤﺰﻳﺪ ﻣﻦ ﺍﻟﺰﻫﻢ ﻣﻦ ﺗﻠﻚ

ﺍﻟﻌﺎﺩﻳﺔ، ﻭﻣﻌﺪﻻﺕ ﺍﻹﻓﺮﺍﺯ ﺗﺘﻄﺎﺑﻖ ﺟﻴﺪﺍ ﻣﻊ ﺷﺪﺓ ﺍﻟﻤﺮﺽ ﻭﺍﻷﻋﺮﺍﺽ ﺍﻹﻛﻠﻴﻨﻴﻜﻴﺔ.

ﻭ ﻓﺪ ﺃﺷﻴﺮ ﺇﻟﻰ ﺃﻥ ﺍﻟﺨﻠﻴﺔ ﺍﻟﺪﻫﻨﻴﺔ ﺑﺈﻋﺘﺒﺎﺭﻫﺎ ﻣﻦ ﺍﻟﻤﻜﻮﻧﺎﺕ ﺍﻟﺮﺋﻴﺴﻴﺔ ﻟﻠﻮﺣﺪﺓ ﺍﻟﺸﻌﺮﻳﺔ ﺍﻟﺪﻫﻨﻴﺔ، ﻗﺪ ﻳﻜﻮﻥ ﺑﻤﺜﺎﺑﺔ ﺍﻟﺨﻼﻳﺎ ﺍﻟﻤﻨﺎﻋﻴﺔ ﻭ ﺍﻟﺘﻰ ﻳﻤﻜﻦ ﺗﻔﻌﻴﻠﻬﺎ ﻣﻦ ﺧﻼﻝ ﺍﻟﺒﻜﺘﻴﺮﻳﺎ ﺍﻟﺒﺮﻭﺑﻴﻮﻧﻴﺔ ﺍﻟﻌﺪﻳﺔ ﺍﻟﺘﻲ ﺗﺘﻌﺘﺮﻑ ﻋﻠﻰ ﺗﻐﻴﺮ ﺍﻟﻤﺤﺘﻮﻯ ﺍﻟﺪﻫﻨﻲ ﻓﻲ ﺍﻟﺰﻫﻢ، ﻳﻠﻴﻪ ﺇﻧﺘﺎﺝ ﺍﻟﺴﻴﺘﻮﻛﻴﻨﺎﺕ ﺍﻻﻟﺘﻬﺎﺑﻴﺔ.

ﺍﻟﻨﻤﻮ ﻭﺍﻟﺘﻤﺎﻳﺰ ﻟﻠﻐﺪﺩ ﺍﻟﺪﻫﻨﻴﺔ ﻳﻨﻈﻢ ﺑﻮﺍﺳﻄﺔ ﺍﻟﻌﺪﻳﺪ ﻣﻦ ﺍﻟﻤﺴﺘﻘﺒﻼﺕ ﺍﻟﻨﻮﻭﻳﺔ. ﻣﺴﺘﻘﺒﻼﺕ ﺧﻼﻳﺎ ﺍﻟﻜﺒﺪ ﺍﻛﺲ ﻫﻰ ﻋﻮﺍﻣﻞ ﻧﺴﺦ ﺗﻨﺘﻤﻰ ﺍﻟﻰ ﻋﺎﺋﻠﺔ ﺍﻟﻤﺴﺘﻘﺒﻼﺕ ﺍﻟﻨﻮﻭﻳﺔ ﻭﻫﻨﺎﻙ ﻧﻮﻋﺎﻥ ﻣﻦ ﻫﺬﻩ ﺍﻟﻤﺴﺘﻘﺒﻼﺕ: ﺍﻟﻔﺎ ﻭ ﺑﻴﺘﺎ. ﻣﺴﺘﻘﺒﻼﺕ ﺧﻼﻳﺎ ﺍﻟﻜﺒﺪ ﺍﻛﺲ ﺍﻟﻔﺎ ﻗﺪ ﺗﻢ ﺍﻻﻋﺘﺮﺍﻑ ﺑﻬﺎ ﻋﻠﻰ ﻧﻄﺎﻕ ﻭﺍﺳﻊ ﻓﻲ ﺗﻨﻈﻴﻢ ﺍﻟﺠﻴﻨﺎﺕ ﺍﻟﻤﺴﺆﻭﻟﺔ ﻋﻦ ﺍﻟﻤﻨﺎﻋﺔ ﺍﻟﻔﻄﺮﻳﺔ، ﺍﻻﻟﺘﻬﺎﺑﺎﺕ ﻭﺍﻟﺪﻫﻮﻥ ﺓﺍﻟﺤﻴﻮﻱ. ﺗﻨﺸﻴﻂ ﻫﺬﻩ

ﺍﻟﻤﺴﺘﻘﺒﻼﺕ ﻳﻤﻨﻊ ﺍﻧﺘﺸﺎﺭ ﻭﺯﻳﺎﺩﺓ ﺗﻜﻮﻥ ﺍﻟﺪﻫﻮﻥ ﻓﻰ ﺍﻟﺨﻼﻳﺎ ﺍﻟﺪﻫﻨﻴﺔ ﻭﺗﺤﺴﻴﻦ ﺗﻤﺎﻳﺰ ﻫﺬﻩ ﺍﻟﺨﻼﻳﺎ.

ﻓﻲ ﺍﻟﻬﺪﻑ ﻣﻦ ﺍﻟﺪﺭﺍﺳﺔ ﻫﻮ ﺍﻟﺘﺤﻘﻴﻖ ﻓﻲ ﻣﺴﺘﻮﻯ ﺗﻌﺒﻴﺮ ﺃﻧﺴﺠﺔ ﻣﺴﺘﻘﺒﻼﺕ ﺧﻼﻳﺎ ﺍﻟﻜﺒﺪ ﺍﻛﺲ ﺍﻟﻔﺎ ﺍﻵﻓﺎﺕ ﺍﻻﻟﺘﻬﺎﺑﻴﺔ ﻭ ﺍﻟﻐﻴﺮ ﺍﻟﺘﻬﺎﺑﻴﺔ ﻓﻰ ﻣﺮﺽ ﺣﺐ ﺍﻟﺸﺒﺎﺏ ﺍﻟﺸﺎﺋﻊ ﻭﺑﺎﻟﻤﻘﺎﺭﻧﺔ ﻣﻊ ﺍﻟﺠﻠﺪ ﺍﻟﻄﺒﻴﻌﻲ ﻝﺗﻮﺿﻴﺢ ﺩﻭﺭ ﻣﺴﺘﻘﺒﻼﺕ ﺧﻼﻳﺎ ﺍﻟﻜﺒﺪ ﺍﻛﺲ ﺍﻟﻔﺎ ﻓﻲ ﻛﻴﻔﻴﺔ ﺣﺪﻭﺙ ﺣﺐ ﺍﻟﺸﺒﺎﺏ، ﻭﺑﺎﻟﺘﺎﻟﻲ ﺗﺄﺛﻴﺮ ﺍﻟﻨﺎﻫﻀﺎﺕ ﻭﺍﻟﻤﻀﺎﺿﺎﺕ ﻓﻲ ﻋﻼﺝ ﺃﻧﻮﺍﻉ ﻣﺨﺘﻠﻔﺔ ﻣﻦ ﺣﺐ ﺍﻟﺸﺒﺎﺏ.

ﺷﻤﻠﺖ ﻫﺬﻩ ﺍﻟﺪﺭﺍﺳﺔ ﺳﺒﻌﺔ ﻋﺸﺮ ﻣﺮﻳﻀﺎ ﺑﺤﺐ ﺍﻟﺸﺒﺎﺏ، 10 ﻣﻦ ﺍﻟﺬﻛﻮﺭ ( 58.8%) ﻭ 7 ﻣﻦ ﺍﻟّﺈﻧﺎﺙ ( 41.2%) ﻭ ﺗﺮﺍﻭﺣﺖ ﺃﻋﻤﺎﺭﻫﻢ ﺑﻴﻦ 15ﻭ 30 ﺳﻨﺔ ﺑﻤﺘﻮﺳﻂ ﻗﺪﺭﻩ 20.29 ± 3.93 ﺳﻨﺔ ﺑﻴﻨﻤﺎ ﺗﺮﺍﻭﺣﺖ ﻣﺪﺓ ﺍﻟﻤﺮﺽ ﺑﻴﻦ 6 ﺇﻟﻰ 84 ﺷﻬﺮ ﺑﻤﺘﻮﺳﻂ ﻗﺪﺭﻩ 26.11 ± 26.06 ﺷﻬﺮ. ﺑﺎﻟﻤﻘﺎﺭﻧﺔ ﻣﻊ ﺳﺘﺔ ﻋﺸﺮ ﻣﻦ ﺍﻻﻓﺮﺍﺩ ﺍﻷﺻﺤﺎء ﻛﻤﺠﻤﻮﻋﺔ ﺿﺎﺑﻄﺔ ﺗﺮﺍﻭﺣﺖ ﺃﻋﻤﺎﺭﻫﻢ ﺑﻴﻦ 20 ﺍﻟﻰ 27 ﺳﻨﺔ ﺑﻤﺘﻮﺳﻂ ﻗﺪﺭﻩ 23.56 ± 2.12 ﺳﻨﺔ ﺑﻴﻨﻬﻢ 11 ﻣﻦ ﺍﻹﻧﺎﺙ (68.8%) ﻭ 5 ﻣﻦ ﺍﻟﺬﻛﻮﺭ (%31.2).

ﺗﻢ ﺃﺧﺬ ﻋﻴﻨﺎﺕ ﻣﻦ ﺍﻟﺠﻠﺪ ﺍﻟﻤﺼﺎﺏ ﺑﺤﺐ ﺍﻟﺸﺒﺎﺏ ﻣﻦ ﺍﻟﻈﻬﺮ ﻣﻦ ﺍﻵﻓﺎﺕ ﺍﻻﻟﺘﻬﺎﺑﻴﺔ ﻭ ﺍﻟﻐﻴﺮ ﺍﻟﺘﻬﺎﺑﻴﺔ ﻭ ﻛﺬﻟﻚ ﻣﻦ ﺍﻟﺠﻠﺪ ﺍﻟﻄﺒﻴﻌﻰ ﻣﻦ ﺍﻟﻤﺠﻤﻮﻋﺔ ﺍﻟﻀﺎﺑﻄﺔ ﻟﻘﻴﺎﺱ ﺍﻟﺘﻌﺒﻴﺮ ﺍﻟﺠﻴﻨﻰ ﻟﻤﺴﺘﻘﺒﻼﺕ ﺧﻼﻳﺎ ﺍﻟﻜﺒﺪ ﺍﻛﺲ ﺍﻟﻔﺎ ﻋﻦ ﻃﺮﻳﻖ ﺗﻘﻨﻴﺔ ﺗﻔﺎﻋﻞ ﺍﻟﺒﻠﻤﺮﺓ ﺍﻟﻤﺘﺴﻠﺴﻞ (ﺑﻰ ﺳﻰ ﺍﺭ).

95

ﻭ ﻛﺎﻥ ﻣﺴﺘﻮﻯ ﻣﺴﺘﻘﺒﻼﺕ ﺍﻟﻜﺒﺪ ﺍﻛﺲ ﺍﻟﻔﺎ ﺃﻋﻠﻰ ﺑﻜﺜﻴﺮ ﺳﻮﺍء ﻓﻰ ﺍﻵﻓﺎﺕ ﺍﻻﻟﺘﻬﺎﺑﻴﺔ (ﺑﻤﺘﻮﺳﻂ ﻗﺪﺭﻩ 1188.52 ± 129.5) ﺃﻭ ﺍﻟﻐﻴﺮ ﺍﻟﺘﻬﺎﺑﻴﺔ (ﺑﻤﺘﻮﺳﻂ ﻗﺪﺭﻩ 892.52 ± 66.08) ﻣﻦ ﻣﺮﺿﻰ

ﺣﺐ ﺍﻟﺸﺒﺎﺏ ﺑﻄﺮﻳﻘﺔ ﺫﺍﺕ ﺩﻻﻟﺔ ﺇﺣﺼﺎﺋﻴﺔ .ﻣﻤﺎ ﻛﺎﻥ ﻋﻠﻴﻪ ﻓﻰ ﺍﻟﻤﺠﻤﻮﻋﺔ ﺍﻟﻀﺎﺑﻄﺔ (ﺑﻤﺘﻮﺳﻂ ﻗﺪﺭﻩ 600.50 ± 95.30)ﺣﻴﺚ ﻛﺎﻧﺖ ﻗﻴﻢ ﻑ ﺃﻗﻞ ﻣﻦ 0.001. ﻭﺣﻴﺚ ﺃﻥ ﺗﻨﺸﻴﻂ ﻣﺴﺘﻘﺒﻼﺕ ﺍﻟﻜﺒﺪ ﺍﻛﺲ ﺍﻟﻔﺎ ﻳﻤﻨﻊ ﺍﻧﺘﺸﺎﺭ ﻭﺯﻳﺎﺩﺓ ﺗﻜﻮﻥ ﺍﻟﺪﻫﻮﻥ ﻓﻰ ﺍﻟﺨﻼﻳﺎ ﺍﻟﺪﻫﻨﻴﺔ ﻭﻳﺤﺴﻦ ﻣﻦ ﺗﻤﺎﻳﺰ ﻫﺬﻩ ﺍﻟﺨﻼﻳﺎ, ﻟﺬﻟﻚ ﻳﻤﻜﻦ ﺇﻋﺘﺒﺎﺭ ﺍﻟﺰﻳﺎﺩﺓ ﻓﻰ ﻣﺴﺘﻮﻯ ﻣﺴﺘﻘﺒﻼﺕ ﺍﻟﻜﺒﺪ ﺍﻛﺲ ﺍﻟﻔﺎ ﺃﻥ ﻳﻜﻮﻥ ﻟﻬﺎ ﺩﻭﺭ ﻓﻲ ﻛﻴﻔﻴﺔ ﺣﺪﻭﺙ ﻣﺮﺽ ﺣﺐ ﺍﻟﺸﺒﺎﺏ ﻣﻦ ﺧﻼﻝ ﺍﻟﺰﻳﺎﺩﺓ ﻓﻲ ﺗﻜﻮﻥ ﺍﻟﺪﻫﻮﻥ.

ﻓﻲ ﻫﺬﻩ ﺍﻟﺪﺭﺍﺳﺔ، ﻛﺎﻥ ﻣﺴﺘﻮﻯ ﻣﺴﺘﻘﺒﻼﺕ ﺍﻟﻜﺒﺪ ﺍﻛﺲ ﺍﻟﻔﺎ ﺃﻋﻠﻰ ﻓﻲ ﺍﻵﻓﺎﺕ ﺍﻻﻟﺘﻬﺎﺑﻴﺔ ﻋﻨﻪ ﻓﻰ ﺍﻵﻓﺎﺕ ﺍﻟﻐﻴﺮ ﺍﻟﺘﻬﺎﺑﻴﺔ ﺑﻄﺮﻳﻘﺔ ﺫﺍﺕ ﺩﻻﻟﺔ ﺇﺣﺼﺎﺋﻴﺔ ﻣﺸﻴﺮﺍ ﺇﻟﻰ ﺃﻧﻪ ﻗﺪ ﻳﻠﻌﺐ ﺩﻭﺭﺍ ﻓﻲ ﺗﻄﻮﺭﺍﻟﻤﺮﺽ ﻣﻦ ﻓﻰ ﺍﻵﻓﺎﺕ ﺍﻟﻐﻴﺮ ﺍﻟﺘﻬﺎﺑﻴﺔ ﺇﻟﻰ ﺍﻵﻓﺎﺕ ﺍﻻﻟﺘﻬﺎﺑﻴﺔ.

ﻓﻲ ﻫﺬﻩ ﺍﻟﺪﺭﺍﺳﺔ ، ﻟﻢ ﻳﺘﻢ ﺍﻟﻌﺜﻮﺭ ﻋﻠﻰ ﺭﺍﺑﻂ ﺫﻭ ﺩﻻﻟﺔ ﺇﺣﺼﺎﺋﻴﺔ ﺑﻴﻦ ﻣﺴﺘﻮﻯ ﻣﺴﺘﻘﺒﻼﺕ ﺍﻟﻜﺒﺪ ﺍﻛﺲ ﺍﻟﻔﺎ ﻭ ﺷﺪﺓ ﺍﻟﻤﺮﺽ ﺳﻮﺍء ﻛﺎﻧﺖ ﺧﻔﻴﻔﺔ، ﻣﻌﺘﺪﻟﺔ ﺃﻭ ﺷﺪﻳﺪﺓ ﻭ ﻟﺬﻟﻚ ﻻ ﻳﻤﻜﻦ ﺃﻥ ﺗﻜﻮﻥ ﻋﻼﻣﺔ ﺇﻛﻠﻴﻨﻴﻜﻴﺔ ﻟﻠﻤﺮﺽ. ﺃﻳﻀﺎ، ﻟﻢ ﻳﺘﻢ ﺍﻟﻌﺜﻮﺭ ﻋﻠﻰ ﺍﺭﺗﺒﺎﻃﺎﺕ ﺫﺍﺕ ﺩﻻﻟﺔ ﺇﺣﺼﺎﺋﻴﺔ ﺑﻴﻦ ﻣﺴﺘﻮﻯ ﻣﺴﺘﻘﺒﻼﺕ ﺍﻟﻜﺒﺪ ﺍﻛﺲ ﺍﻟﻔﺎ ﻭﻣﺪﺓ ﺍﻟﻤﺮﺽ ﺃﻭ ﺟﻨﺲ ﺍﻟﻤﺮﺿﻰ، ﻓﻲ ﺣﻴﻦ ﻛﺎﻥ ﻫﻨﺎﻙ ﺗﺮﺍﺑﻂ ﻋﻜﺴﻲ ﻭ ﻟﻜﻦ ﺩﻭﻥ ﺩﻻﻟﺔ ﺇﺣﺼﺎﺋﻴﺔ ﺑﻴﻦ ﻣﺴﺘﻮﻯ ﻣﺴﺘﻘﺒﻼﺕ ﺍﻟﻜﺒﺪ ﺍﻛﺲ ﺍﻟﻔﺎ ﻭﻋﻤﺮ ﺍﻟﻤﺮﺿﻰ.

ﺍﻝﻣﺴﺎﺭ ﺍﻟﻤﺮﺿﻰ ﻟﺤﺐ ﺍﻟﺸﺒﺎﺏ ﺳﻮﺍء ﻛﺎﻥ ﺛﺎﺑﺖ, ﻣﺘﻘﺪﻡ ﺃﻭ ﺃﻧﻪ ﻳﺘﺤﻮﻳﻞ ﻭﻳﺘﻔﺎﻗﻢ (ﺩﻭﺭﻱ) ﻟﻢ ﻳﺘﻢ ﺍﻟﻌﺜﻮﺭ ﻟﻪ ﻋﻠﻰ ﺭﺍﺑﻂ ﺫﻭ ﺩﻻﻟﺔ ﺇﺣﺼﺎﺋﻴﺔ ﺑﻴﻨﻪ ﻭ ﺑﻴﻦ ﻣﺴﺘﻮﻯ ﻣﺴﺘﻘﺒﻼﺕ ﺍﻟﻜﺒﺪ ﺍﻛﺲ ﺍﻟﻔﺎ.

ﻓﺎﺋﺾ ﺍﻟﺰﻫﻢ ﻭﺍﻻﻟﺘﻬﺎﺑﺎﺕ، ﻭﺍﻟﻤﺘﻬﻢ ﺣﺎﻟﻴﺎ ﻟﺒﺪء ﺁﻓﺎﺕ ﺣﺐ ﺍﻟﺸﺒﺎﺏ ﻳﺮﺗﺒﻂ ﻣﻊ ﻭﻇﻴﻔﺔ ﻣﺴﺘﻘﺒﻼﺕ ﺍﻟﻜﺒﺪ ﺍﻛﺲ ﺍﻟﻔﺎ ، ﻣﺸﻴﺮﺍ ﺇﻟﻰ ﺃﻥ ﻣﺴﺘﻘﺒﻼﺕ ﺍﻟﻜﺒﺪ ﺍﻛﺲ ﺍﻟﻔﺎ ﻳﻤﻜﻦ ﺃﻥ ﻳﻜﻮﻥ ﻭﺍﺣﺪﺍ ﻣﻦ ﺍﻷﻫﺪﺍﻑ ﺍﻟﻌﻼﺟﻴﺔ ﺍﻷﻛﺜﺮ ﺃﻫﻤﻴﺔ ﻟﻌﻼﺝ ﺣﺐ ﺍﻟﺸﺒﺎﺏ.

ﺍﻟﻔﻬﻢ ﺍﻷﻓﻀﻞ ﻟﻠﺘﺤﻜﻢ ﺍﻟﺠﺰﻳﺌﻰ ﺍﻟﺬﻯ ﺗﺴﺒﺒﻪ ﻣﺴﺘﻘﺒﻼﺕ ﺍﻟﻜﺒﺪ ﺍﻛﺲ ﻓﻰ ﺗﻤﺎﻳﺰ ﺍﻟﺨﻼﻳﺎ ﺍﻟﺪﻫﻨﻴﺔ ﻭﺍﻹﺗﻬﺎﺏ ﻗﺪ ﻳﺆﺩﻱ ﺇﻟﻰ ﺗﺤﺴﻦ ﺍﻟﺘﺪﺧﻼﺕ ﺍﻟﺪﻭﺍﺋﻴﺔ ﻟﻌﻼﺝ ﺍﻻﺿﻄﺮﺍﺑﺎﺕ ﺍﻟﻤﺮﺗﺒﻄﺔ ﺑﺎﻟﻐﺪﺓ ﺍﻟﺪﻫﻨﻴﺔ.

96

ﻣﺴﺘﻮﻱ ﻣﺴﺘﻘﺒﻼﺕ ﺃﻧﺴﺠﺔ ﺧﻼﻳﺎ ﺍﻟﻜﺒﺪ ﺍﻛﺲ ﺍﻟﻔﺎ ﻓﻰ ﻣﺮﺽ ﺣﺐ ﺍﻟﺸﺒﺎﺏ ﺍﻟﺸﺎﺋﻊ

ﺑﺤﺚ ﻣﻘﺪﻡ ﺗﻮﻃﺌﻪ ﻟﻠﺤﺼﻮﻝ ﻋﻠﻲ ﺩﺭﺟﺔ ﺍﻟﻤﺎﺟﺴﺘﻴﺮ ﻓﻲ ﺍﻷﻣﺮﺍﺽ ﺍﻟﺠﻠﺪﻳﺔ ﻭﺍﻟﺘﻨﺎﺳﻠﻴﺔ ﻣﻦ ﺍﻟﻄﺒﻴﺒﺔ ﺇﻳﻤﺎﻥ ﻋﺒﺪﺍﻟﺤﻤﻴﺪ ﻋﻠﻰ ﻧﺪﺍ

ﺑﻜﺎﻟﻮﺭﻳﻮﺱ ﺍﻟﻄﺐ ﻭﺍﻟﺠﺮﺍﺣﺔ- ﻛﻠﻴﺔ ﺍﻟﻄﺐ ﺟﺎﻣﻌﺔ ﺍﻟﻘﺎﻫﺮﺓ ﺗﺤﺖ ﺇﺷﺮﺍﻑ ﺩ. ﺷﻴﺮﻳﻦ ﺃﺳﺎﻣﺔ ﺗﻮﻓﻴﻖ

ﺃﺳﺘﺎﺫ ﻣﺴﺎﻋﺪ ﺍﻷﻣﺮﺍﺽ ﺍﻟﺠﻠﺪﻳﺔ- ﻛﻠﻴﺔ ﺍﻟﻄﺐ ﺟﺎﻣﻌﺔ ﺍﻟﻘﺎﻫﺮﺓ ﺩ. ﻣﺮﻭﺓ ﺃﺣﻤﺪ ﻋﺰﺕ

ﻣﺪﺭﺱ ﺍﻷﻣﺮﺍﺽ ﺍﻟﺠﻠﺪﻳﺔ- ﻛﻠﻴﺔ ﺍﻟﻄﺐ ﺟﺎﻣﻌﺔ ﺍﻟﻘﺎﻫﺮﺓ ﺩ. ﺃﻟﻔﺖ ﺟﻤﻴﻞ ﺷﺎﻛﺮ

ﺃﺳﺘﺎﺫ ﺍﻟﻜﻴﻤﻴﺎء ﺍﻟﺤﻴﻮﻳﺔ ﺍﻟﻄﺒﻴﺔ- ﻛﻠﻴﺔ ﺍﻟﻄﺐ ﺟﺎﻣﻌﺔ ﺍﻟﻘﺎﻫﺮﺓ ﻛﻠﻴﺔ ﺍﻟﻄﺐ ﺟﺎﻣﻌﺔ ﺍﻟﻘﺎﻫﺮﺓ 2012

97