1 Neural Cell Adhesion Protein CNTN1 Promotes the Metastatic

Author Manuscript Published OnlineFirst on January 21, 2016; DOI: 10.1158/0008-5472.CAN-15-1898 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.

Neural cell adhesion protein CNTN1 promotes the metastatic progression of prostate cancer

Judy Yan,1 Diane Ojo,1 Anil Kapoor,2 Xiaozeng Lin,1 Jehonathan H. Pinthus,2 Tariq Aziz,3 Tarek A. Bismar,4 Fengxiang Wei,1,5 Nicholas Wong,1 Jason De Melo,1 Jean-Claude Cutz,3 Pierre Major,6 Geoffrey Wood,7 Hao Peng,8 and Damu Tang 1 *

1Division of Nephrology, Department of Medicine, 2Department of Surgery, 3Department of Pathology and Molecular Medicine, McMaster University, Hamilton, Canada; 4Department of Pathology and Laboratory Medicine, University of Calgary, Calgary, Canada; 5The Genetics Laboratory, Institute of Women and Children’s Health, Longgang District, Shenzhen, China; 6Department of Oncology, McMaster University, Hamilton, Canada; 7Department of Veterinary Pathology, University of Guelph, Guelph, Canada; 8Department of Medical Physics & Applied Radiation Sciences, McMaster University, Hamilton, Canada

Correspondence: Damu Tang 50 Charlton Ave East Hamilton Canada L8N 4A6 Tel: (905) 522-1155, x35168 Fax: (9050 540-6549; (905) 521-6181 Email: [email protected]

Running title: CNTN1 promotes prostate cancer progression

Keywords: Contactin 1, prostate cancer, xenograft tumor, prostate cancer progression, and prostate cancer metastasis

Conflicts of interest: A US provisional patent has been filed. J.Y., D.O., and D.T. hold the ownership

Downloaded from cancerres.aacrjournals.org on September 27, 2021. © 2016 American Association for Cancer Research. Author Manuscript Published OnlineFirst on January 21, 2016; DOI: 10.1158/0008-5472.CAN-15-1898 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.

Abstract

Prostate cancer (PC) metastasis is the main cause of disease-related mortality. Elucidating the mechanisms underlying PC metastasis is critical for effective therapeutic intervention. In this study, we performed gene expression profiling of PC stem-like cells (PCSCs) derived from

DU145 human PC cells to identify factors involved in metastatic progression. Our studies revealed contactin 1 (CNTN1), a neural cell adhesion protein, to be a PC-promoting factor.

CNTN1 knockdown reduced PCSC-mediated tumor initiation, whereas CNTN1 overexpression enhanced PC cell invasion in vitro and promoted xenograft tumor formation and lung metastasis in vivo. Additionally, CNTN1 overexpression in DU145 cells and corresponding xenograft tumors resulted in elevated AKT activation and reduced E-cadherin (CDH1) expression. CNTN1 expression was not readily detected in normal prostate glands, but was clearly evident on PC cells in primary tumors and lymph node and bone metastases. Tumors from 637 patients expressing CNTN1 were associated with PC progression and worse biochemical recurrence-free survival following radical prostatectomy (p<0.05). Collectively, our findings demonstrate that

CNTN1 promotes PC progression and metastasis, prompting further investigation into the mechanisms that enable neural proteins to become aberrantly expressed in non-neural malignancies.

Introduction

Prostate cancer (PC) is the most frequently diagnosed malignancy and the second/third leading cause of cancer-associated deaths for men in the developed world (1). The disease progresses from high grade prostatic intra-epithelial neoplasia (HGPIN), to locally invasive carcinoma and finally to metastatic cancer. PC predominantly metastasizes to the bone (2).

While local tumors can be well controlled through watchful waiting, surgery and radiation; metastatic PC remains incurable. Therefore, identification of key molecules involved in PC metastasis is of an utmost importance for prognostic and therapeutic purposes. The capacity of primary tumor cells to metastasize relies on the integration of a complex network of signals, including those of the environment. As a result of signal integrations, cellular alterations occur that promote PC progression and metastasis. The typical changes for epithelium-originated tumors include the downregulation of E-cadherin leading to a reduction of cell-cell adhesion, a characteristic event of epithelial-mesenchymal transition (3, 4).

In addition to the reduction of E-cadherin, elevation of cell adhesion molecules (CAMs), especially Ig-like neural cell adhesion molecules play an important role in cancer progression and metastasis. The Ig-like CAMs include contactins, the neural cell adhesion molecule

(NCAM), and L1CAMs comprising of cell adhesion molecule L1-like (CHL1), neuronal cell adhesion molecule (NrCAM) and neurofascin (5, 6). Increases in L1CAM are associated with poor prognosis in patients with ovarian, uterine, colon, breast, and lung cancers (7-10).

Interestingly, in addition to L1CAM, increased expression of contactin 1 (CNTN1, F3/contactin) was detected in lung carcinoma. CNTN1 promoted lung cancer metastasis (11, 12) and its expression associated with poor prognosis for patients with lung carcinoma, esophageal and oral squamous cell carcinomas (11, 13, 14). Nevertheless, to the best of our knowledge the role of

CNTN1 in PC progression and metastasis is unknown. CNTN1 is a neural cell adhesion protein consisting of 6 N-terminal Ig domains followed by 4 fibronectin (FN) like repeats (15) and plays important roles in the development of the central nervous system, including lineage commitment and precursor proliferation (16, 17). CNTN1 also promotes axon elongation in the cerebellum, the formation of the septate-like junctions between axons and myelinating glial cells and the formation of the neuromuscular junction (5, 18, 19). Collectively, it appears that the physiological functions of the Ig-like CAMs in neuron guidance and migration are commonly hijacked by tumors for metastasis.

The above observations would suggest contributions of an Ig-like CAM to PC metastasis. To pursue this possibility, we have taken advantage of our recently established conditions to isolate

PCSCs, a cell population that plays a major role in cancer metastasis (20, 21). Specifically, we were able to culture PCSCs as suspension spheres from DU145 cells. These sphere cells are likely PCSCs because of their elevated (100 fold) ability to initiate tumors in NOD/SCID mice

(22). With the availability of PCSCs and their isogenic non-PCSCs, we have profiled the respective gene expression, and intriguingly, CNTN1 was specifically identified in DU145 cell- derived PCSCs and in PC3 cells cultured under PCSC conditions. Based on the reported role of

CNTN1 in promoting lung cancer metastasis (11, 12), we proceeded to determine CNTN1's ability to stimulate PC invasion and metastasis. Lastly, we examined the association of CNTN1 expression with PC progression and BCR-free survival using clinical specimens.

Materials and Methods

Cell lines and plasmids

DU145, PC3 and LNCaP cells were from American Type Culture Collection and cultured

accordingly in Minimum Essential Medium, F12 Medium and RPMI-1640 Medium

supplemented with 10% fetal bovine serum (FBS, Sigma) and 1% Penicillin-Streptomycin (Life

Technologies). The androgen-independent LNCaP derivative C4-2 cell line was kindly provided by Dr. Martin Gleave at The University of British Columbia, Canada (23). All cell lines were thawed fresh every two months; no further authentication was performed. CNTN1 shRNA and control shRNA were from Santa Cruz Biotechnology. CNTN1 shRNA is a pool of 3 different plasmids with the following short hairpin sequences (5'-3'): (A)

GATCCGGGTGATAATTGAATGCAATTCAAGAGATTGCATTCAATTATCACCCTTTTT

(B) GATCCCAAGAGCAGTGGACTTAATTTCAAGAGAATTAAGTCCACTGCTCTTGTTT

TT (C)GATCCGCATCCTTGTCTACTTGGATTCAAGAGATCCAAGTAGACAAGGATGCT

TTTT. The sequence for the scrambled control shRNA is proprietary and could not be provided

by the company. CNTN1 isoform 3 cDNA was from Open Biosystems (GE Healthcare).

Generation of DU145 spheres

DU145 spheres were isolated as described (22). DU145 monolayer cells were individualized

and resuspended at a density of 5,000 cells/mL in serum-free (SF) media supplemented with

0.4% bovine serum albumin (Bioshop Canada Inc) and 0.2× B27 minus Vitamin A (4mL/L, Life

Technologies).

Knockdown of CNTN1 in spheres

Hairpin shRNAs were expressed by a retroviral-based shRNA vector as described (24).

Briefly, a gag-pol, a rev and an envelope expressing vector (Stratagene) were transiently co-

transfected with a designed retroviral plasmid into HEK293T cells. The viral vector-containing medium was harvested 48 hours later, filtered through a 0.45µm filter and centrifuged at 20,000g for 120 minutes to concentrate the viral vectors. The quality and titers of viral vectors were not determined. However, by visual inspection we consistently had less than 30% cell death following transduction and selection. Cells were selected for stable integration with puromycin

(1µg/mL, Sigma).

Gene expression analysis

RNA was isolated with TRIzol (Life Technologies). Gene expression was examined using the Affymetrix Human Gene 1.0 ST microarrays by the University Health Network Microarray

Center in Toronto. Microarray data are available in the ArrayExpress database

(www.ebi.ac.uk/arrayexpress) under accession number E-MTAB-4118. Functional analysis of gene expression was performed using Ingenuity Pathway Analysis (Ingenuity).

Western blot analysis

Western blots were performed as described (24). The antibodies used were: anti-CNTN1

(1:200, R&D), Anti-AKT Ser473 phosphorylation (1:1000, Cell Signaling), anti-AKT (1:1000,

Santa Cruz), anti-E-cadherin (1:2500, BD Biosciences), anti-actin (1:1000, Santa Cruz), anti- goat (1:3000, Santa Cruz), anti-mouse (1:3000, GE Healthcare) and anti-rabbit (1:3000, GE

Healthcare).

Collection of primary PC

Prostate tissues were collected from patients who underwent biopsies or radical prostatectomy at St. Joseph's Hospital in Hamilton, Ontario, Canada under the approval from the local Research Ethics Board (REB#11-3472) and with consent from patients.

Immunohistochemistry (IHC)

Immunohistochemistry was performed as previously described (24). Primary antibody specific for CNTN1 (1:10, Sigma) and prostatic acid phosphatase (PAP, 1:300, Abcam) was incubated with the sections overnight at 4°C. Images were taken with a light microscope

(Olympus)

Tissue Microarray (TMA) analysis

TMA2 and TMA5 were obtained from the Cooperative Prostate Cancer Tissue Resource

(CPCTR). TMA2 was organized according to Gleason score and consisted of 1,128 prostate tissue cores derived from 250 PC tumors, 32 non-tumor and 58 HGPIN cases (Supplementary

Table S1). TMA5 was organized according to the BCR that was defined by CPCTR as an increase in serum PSA levels >0.6ng/ml (single value) or consecutive rise in serum PSA levels between 0.4-0.6ng/ml after radical prostatectomy (25). TMA5 contained 1,616 PC tissue cores derived from 404 patients based on their BCR (Supplementary Table S1). IHC was performed as follows. Primary antibody specific for CNTN1 (1:3000, Sigma) was incubated with the sections overnight at 4°C, followed by the use of a TSA™ Plus Biotin kit (Perkin Elmer) according to the manufacturer's protocol. TMA slides were scanned using a ScanScope and analyzed using the

ImageScope software (Aperio). All spots were also manually examined and scored. The scores obtained using the ImageScope software were representative of the scores obtained manually.

The former scores were converted to H-Scores using the formula [(H-Score=% positive X

(intensity+1)] (26). Corrected H-Scores were achieved by subtracting the H-Scores obtained from the stroma regions with H-Scores obtained from the prostate glands for each core. Scores were assigned to a scale of 0-3 (0-negative, 1-weak, 2-moderate, and 3-strong staining). Positive staining for CNTN1 was classified as moderate to strong staining with an H-score ≥10.

Immunofluorescence staining

Staining was performed as previously described using a goat anti-CNTN1antibody (1:50,

R&D systems) (24).

Real time PCR analysis

Reverse transcription was performed using superscript III (Life Technologies). PCR primers used are: CNTN1 (forward) 5' CAATAGTGCAGGGTGTGGAC 3' and (reverse) 5'

TGGCTAGGAGGTGCTTTCTT 3'. Actin (forward) 5' ACCGAGCGCGGCTACAG 3' and

(reverse) 5' CTTAATGTCACGCACGATTTCC 3'. Real-time PCR was performed using the

ABI 7500 Fast Real-Time PCR System (Applied Biosystems) in the presence of SYBR-green according to the manufacturer's instructions. All samples were run in triplicate.

Cell proliferation assay

DU145 EV and CNTN1 (1000/well) cells were seeded into a 96 well plate. Proliferation was daily measured using the WST-1 cell proliferation assay kit (Millipore) according to the manufacturer's instructions. Absorbance readings were measured with a plate reader at 420nm.

Colony Formation

Cells were seeded at the indicated number in triplicates and cultured for one week. Cells were stained with crystal violet (0.5%). Quantification was carried out by taking images of four quadrants per well and pixel count for crystal violet staining was determined using ImageScope.

Invasion Assay

Modified Boyden chambers consisted of inserts with an 8µm pore membrane coated with

Matrigel (BD Biosciences) placed in a 24-well plate. Assays were performed as previously described (24).

Formation of xenografts and lung metastasis

106 DU145 EV (n=4) and CNTN1 (n=5) as well as 104 DU145 shCTRL (n=4) and shCNTN1

(n=6) sphere cells were resuspended in media/matrigel mixture (1:1 volume, 0.1ml), followed by subcutaneous implantation in flanks of 8-week-old male NOD/SCID mice (The Jackson

Laboratory). Tumor volumes were determined using a caliper according to the standard formula:

L×W2×0.52, where L and W are the longest and shortest diameters, respectively. For the generation of lung metastasis, 106 DU145 EV (n=4) and CNTN1 (n=5) cells were resuspended into 0.3mL of PBS and injected through the tail vein of NOD/SCID mice. Lungs were harvested at 16 weeks post injection. Tumor volumes were photographed and measured using ImageJ. All animal work was carried out according to experimental protocols approved by the McMaster

University Animal Research Ethics Board.

Statistical analysis

Statistical analysis was performed using the Student t-test unless otherwise specified. Two- way ANOVA was used to determine significance for tumor growth. For comparison between H- score intensity and PC Gleason scores, a one-way ANOVA was performed. For comparison between CNTN1 staining for non-cancer versus cancer and between PC Gleason a chi-square test was performed. A log-rank test was performed to assess statistical significance between survival curves. All tests were two tailed. A p-value <0.05 was considered statistically significant.

Results

CNTN1 promotes PC cell invasion but not proliferation

To examine whether DU145 sphere cells (PCSCs) were associated with unique PC- promoting factors, we profiled the gene expression in DU145 monolayer (non-stem cells) and

PCSCs. Among the set of genes with differential expression CNTN1 was prominent. Its expression was increased approximately 10 folds in sphere cells compared to monolayer cells

(Fig 1A). The upregulation was confirmed by both real-time PCR (Fig 1B) and western blot (Fig

1C). Consistent with CNTN1 as a cell surface adhesion protein in neural cells, the surface presence of CNTN1 in DU145 sphere cells was apparent under both immunofluorescence (Fig

1D) and immunohistochemistry (data not shown) staining. To further confirm the CNTN1 upregulation is unique to PCSCs, we were able to show that both LNCaP and PC3 cells did not express CNTN1 when cultured in the presence of 10%FBS (Fig 1C). In contrast, a significant increase in CNTN1 mRNA was detected in PC3 cells cultured under serum free (PC3-SF)

PCSC-culturing conditions (Fig 1E). PC3-SF cells do not proliferate at a slower rate than PC3 cells cultured in a FBS-containing medium (data not shown). In addition, PC3-SF cells adopted a

different morphology appearing more rounded and less elongated, compared to PC3 cells cultured in FBS-containing medium (Supplementary Fig S1A). PC3-SF cells formed significantly larger colonies (Supplementary Fig S1B,C), suggesting that PC3-SF cells have acquired PCSC characteristics. Under SF-PCSC culture conditions, LNCaP cells did not survive

(data not shown). Collectively, the above observations reveal upregulation of CNTN1 in PCSCs.

The cell surface localization of CNTN1 in DU145 spheres suggests CNTN1 being functional.

To address this, ectopic CNTN1 was expressed in DU145 monolayer cells (Fig 1F). In comparison to DU145 empty vector (EV) cells, ectopic CNTN1 did not alter cell proliferation

(Supplementary Fig S2A), but significantly enhanced DU145 cell invasion (Fig 1G). To further support these observations, a CNTN1 expressing stable line was also constructed in LNCaP C4-2 cells (Supplementary Fig S2B). Compared to the EV cells, ectopic CNTN1 did not affect the cell’s ability to form colonies (Supplementary Fig S2C), but promoted LNCaP C4-2 cell’s invasion ability (Supplementary Fig S2D). Collectively, we provide evidence that CNTN1 promotes PC cell invasion.

CNTN1 enhances AKT activation and reduces E-cadherin expression in PC cells

One of the major pathways affecting cell invasion is the PI3K/AKT pathway (27). To examine the impact of CNTN1 on AKT activation, we demonstrated an enhancement of AKT activation in DU145 CNTN1 and LNCaP C4-2 CNTN1 cells in comparison to their respective

EV cells in response to serum stimulation (Fig 2A, Supplementary Fig S2F), despite ectopic

CNTN1 not affecting the basal levels of AKT activation in both lines (Supplementary Fig S2E).

Conversely, knockdown of CNTN1 in DU145 PCSCs reduced AKT activation (Fig 2B). To further determine the relevance of CNTN1-affected AKT activation during prostate tumorigenesis, we examined the status of AKT activation in xenograft tumors produced by

DU145 cells in which CNTN1 expression was modulated (see next section for details regarding xenograft tumor formation). In comparison to DU145 EV cell-derived xenograft tumors, an elevation of AKT activation was detected in DU145 CNTN1 monolayer cell-produced xenograft tumors (Fig 2C, top panels), although the differences were not significant, which could have been the result of multiple factors (see discussion for details). However, a significant reduction of AKT activation in xenograft tumors produced by CNTN1-knockdown DU145 sphere cells was observed (Fig 2C, bottom panels). In summary, these observations support the concept that

CNTN1 plays a role in AKT activation in PC cells.

Another key event leading to increase invasive ability of epithelial cell-originating tumors is the loss or reduction of E-cadherin expression (3, 4). CNTN1 may reduce E-cadherin levels, as

CNTN1 activates AKT which has been shown to play a role in E-cadherin downregulation (28).

In support of this hypothesis, overexpression of CNTN1 reduces E-cadherin levels in comparison to DU145 EV cells (Fig 2D); conversely, knockdown of CNTN1 in DU145 sphere cells leads to

E-cadherin upregulation (Fig 2E). Furthermore, xenograft tumors derived from DU145 CNTN1 cells express lower levels of E-cadherin than xenograft tumors produced by EV cells (Fig 2F), whereas DU145 shCNTN1 cells produce xenograft tumors with elevated levels of E-cadherin

(Fig 2F). Taken together, we demonstrate that CNTN1 reduces E-cadherin expression concurrently with the upregulation of AKT activation.

CNTN1 plays a role in PC initiation

CSCs are defined by their ability to initiate tumors in immunocompromised mice. The specific expression of CNTN1 in DU145-derived PCSCs and its role in promoting PC cell invasion and AKT activation as observed above collectively suggest a role of CNTN1 in DU145

PCSCs-associated tumor initiation. To examine this hypothesis, we knocked down CNTN1 in

DU145 sphere cells (Fig 2B). CNTN1 downregulation did not have an apparent effect on the

cell's ability to form spheres (data not shown). However, in comparison to DU145 Ctrl shRNA

sphere cells, knockdown of CNTN1 significantly reduced the cell's ability for tumor formation

(Fig 3A, top panel). CNTN1 expression was significantly lower in xenograft tumors produced by

CNTN1 knockdown sphere cells (Fig 3A, bottom panel). Additionally, overexpression of

CNTN1 in DU145 monolayer cells enhanced xenograft tumor formation (Fig 3B, top panel).

CNTN1 levels remained higher in DU145 CNTN1 cell-produced xenograft tumors than DU145

EV cell-derived tumors (Fig 3B, bottom panel). CNTN1 was clearly detected at the cell surface in DU145 CNTN1 and DU145 shCTRL produced xenograft tumors (Fig 3A,B, bottom panels).

Interestingly, despite DU145 EV cells expressing no detectable levels of CNTN1 in vitro, clusters of CNTN1-positive cells with membrane localization were clearly detected (Fig 3B, bottom panel). On the other hand, CNTN1-negative clusters of cells were also present in DU145

CNTN1 monolayer and DU145 Ctrl shRNA sphere cell-produced xenograft tumors (Fig 3B, A, bottom panels) (see discussion for details). Collectively, the above results demonstrate that despite the heterogeneity in CNTN1 expression in xenografts, CNTN1 has an important role in tumor formation.

CNTN1 enhances PC metastasis

The observation that CNTN1 promotes DU145 cell invasion (Fig 1G) indicates a role of

CNTN1 in PC metastasis. To examine this hypothesis, DU145 EV and CNTN1 cells were administrated into NOD/SCID mice via the tail vein. While DU145 EV cells formed lung metastases, DU145 CNTN1 produced more and larger lung nodules (Fig 4A, Supplementary Fig

S3A). On average, the number of lung nodules generated from the EV cells and CNTN1 cells was 3 and 11 per mouse, respectively. For one mouse injected with EV cells, lung metastasis could not be clearly detected (Supplementary Fig S3A, see the image without arrows). We thus obtained an average of 3 nodules/mouse for 3 mice with a total of 10 lung nodules for the EV group and 11 nodules/mouse for 5 mice for a total of 54 lung metastases for the CNTN1 group

(Fig 4B). Since the nodule volumes are spread out in a large range, to better capture the dynamics of lung metastases produced by both cell types, metastatic tumors were divided into two groups (0-15mm3 and 16mm3+) based on the median tumor volume of the EV group, so that each group contained five tumors (Fig 4B). Not only did CNTN1 cells generate more tumors

(Fig 4B), they produced larger lung nodules especially in the ≥16mm3 tumor group (Fig 4C). As expected, CNTN1-positive cell clusters were detected in both EV and CNTN1-produced lung metastases, but the latter contained more CNTN1-positive cells with higher levels of CNTN1 expression (Fig 4A, bottom panels).

CNTN1 associates with PC progression

To further characterize the role of CNTN1 in promoting PC tumorigenesis, we examined its expression in primary PC tissues. An anti-CNTN1 antibody specifically recognized tumor- associated CNTN1 in IHC staining, evidenced by no detectable staining with control IgG (data not shown) and the positive signals could be competed out with a CNTN1 peptide

(Supplementary Fig S3B). In a limited number of patients from our cohort consisting of three samples with Gleason Score (GS) 6-7, six GS 8-10, 3 pairs of local and lymph node metastases, and 9 bone metastases; CNTN1 intensity was noticed as either negative or at very low levels in normal prostate glands and high (positive) in advanced (GS8-10) prostate carcinomas

(Supplementary Fig S3C). The cell surface presence of CNTN1 was clearly observed in both the

primary tumor and the matched lymph node (Fig 5A, Supplementary Fig S3D) and bone (Fig

5A, Supplementary Fig S4) metastases. The bone metastases were confirmed as originating from

PC, as evidenced by the positive staining for PAP (Fig 5A, Supplementary Fig S4).

Subsequently, we examined CNTN1 expression using two TMAs. Typical staining for non- tumor tissue, HGPIN, GS6 and GS9 carcinomas showed a trend for increased CNTN1 expression with PC progression (Fig 5B). Quantification of CNTN1 staining was then measured in 637 patients using H-scores. The results revealed increased levels of CNTN1 expression with

PC progression from GS5/6 to GS7, and to GS8/9 carcinomas (Fig 5C). The number of CNTN1- positive cases was also increased following the progression from non-tumor prostate tissues to

HGPINs and to carcinomas (Table 1). Among carcinomas of different Gleason scores, the percentage of CNTN1 positive tumors increased from GS5 to GS9 carcinomas (Table 1).

Furthermore, Kaplan-Meier survival analysis revealed that patients with CNTN1-positive PC, which is classified as moderate to strong staining with an H-Score of >10 were associated with decreased BCR-free survival (Fig 5D) (P<0.05). Collectively, we suggest that CNTN1 expression associates with clinical PC progression and reduction of BCR-free survival.

CNTN1 affects pathways that are important for tumorigenesis

PC progression and metastasis is a complex process involving numerous factors. Our

observations that CNTN1 enhanced tumor initiation and metastasis and associated with PC

progression and BCR suggest that CNTN1 affects the expression of tumorigenesis-relevant

genes. In line with this possibility, analysis of gene expression using the Affymetrix platform

revealed the alterations of numerous gene expression by ≥1.5 fold following overexpression of

CNTN1 in DU145 cells and knockdown of CNTN1 in DU145 spheres (Fig 6A,B;

Supplementary Table S2). The expected changes of CNTN1 in the overexpression and knockdown cells were confirmed (Fig 6A, B; Supplementary Table S2). Knockdown of CNTN1 in spheres predominantly affected genes functioning in tumorigenesis, while overexpression of

CNTN1 in DU145 cells altered genes involved in cancer, immunological disorders, and inflammation (Fig 6C, top panels); the latter two processes are well known to impact tumorigenesis (29, 30). The main physiological processes affected by these candidate genes are organism and organ development (Fig 6C, middle panels). Consistent with CNTN1 as a neural cell adhesion protein, these genes contribute to neurological disorders (Fig 6C, top right panel) and nervous system development (Fig 6C, middle left panel). Knockdown of CNTN1 in DU145 spheres affected the expression of genes functioning in cell-cell communications and cellular function maintenance, which is consistent with CNTN1 being a cell surface protein and in agreement with PCSCs’ role in maintaining a tumor mass (Fig 6C, bottom left panel). The overexpression of CNTN1 in DU145 monolayer cells changed the expression of genes functioning in cell movement (Fig 6C, bottom right panel) supports its role in promoting DU145 cell’s invasion (Fig 1G). In summary, knockdown of CNTN1 in DU145 spheres (PCSCs) affected genes largely functioning in tumorigenesis, while overexpression of CNTN1 in DU145 monolayer cells altered genes involved in multiple processes, including tumor cell invasion

(Supplementary Fig S5). Collectively, these observations support a general role of CNTN1 in promoting PC progression.

Discussion

Accumulating evidence reveals a critical role of cancer stem cells (CSCs) in cancer

progression and metastasis. Tumors consist of heterogeneous cell populations (31, 32), in which

CSCs are prone to survival resulting from selection pressure (33, 34). Prostate stem cells (PSCs)

have been identified in both humans and mice (35, 36). While PSCs regenerate the prostate,

PCSCs produce recurrent castration resistant PC (CRPC) (37). Additionally, the signatures of

PCSCs are associated with PC bone metastasis and poor prognosis (38, 39).

Despite this knowledge, the mechanisms governing PCSCs-mediated metastasis remains poorly understood. In a genome-wide analysis of 94 metastatic PCs derived from 30 patients for copy number changes, the gene copy alterations in metastases at different sites were clustered at the level of individual patients rather than metastatic site-specific, i.e. no recurrent metastatic copy number alterations were identified, supporting a major role of epigenetic alterations in

driving PC metastasis (40). This theme is also seen in other cancer types (41). Accordingly,

unique epigenetic alterations are likely contributing to the acquisition of neural cell adhesion

proteins CNTN1 and L1CAM in a variety of cancer types (11, 12, 42).

In accordance with PCSCs being critical in PC progression and metastasis, it is thus possible

that epigenetic alterations can cause CNTN1 induction in DU145 PCSCs following the culture of non-stem DU145 cells under SF-PCSC conditions. This possibility is supported by the reduction of CNTN1 following culturing PCSCs under 10%FBS (data not shown), but more importantly by the respective production of CNTN1-positive and -negative cells in CNTN1-negative DU145 EV cell and CNTN1-positive sphere cell-derived xenograft tumors (Fig 3), and by the acquisition of

CNTN1 in PC3 cells when cultured under SF PCSC conditions (Fig 1C). It is possible that other mechanisms are also in action to regulate CNTN1 expression, such as transcription factors and miRNAs. Additionally, for the PC3 cells, despite the SF PCSC conditions robustly elevating

CNTN1 mRNA, the CNTN1 protein was rather low compared to DU145 sphere cells (data not

shown), suggesting that CNTN1 expression is also regulated at the post-mRNA level. As PC3

and DU145 cells were derived from bone and brain metastasis, respectively, the induction of

CNTN1 in DU145 cell-derived PCSCs may also suggest a specific role in brain metastasis, as a

similar role has been reported for L1CAM in breast cancer brain metastasis (10). However, this

does not exclude the possibility that CNTN1 exhibits a general role in promoting PC progression and metastasis, evidenced by CNTN1's contribution to DU145 PCSC-associated tumor initiation, and its association with PC progression and BCR (Fig 3 and Fig 5). This possibility is also supported by the emerging concept that the "driver" mutants promote cancer progression and metastasis, by the common induction of L1CAM in multiple cancer types (42), and by the

L1CAM-mediated lung cancer metastasis to bone and kidney in mice (9). Additionally, modulations of CNTN1 positively affected AKT activation, a major pathway stimulating cell invasion. This conclusion was based on the observed significant decrease in AKT activation in vitro (Fig 2B) and in vivo (Fig 2C) following CNTN1 knockdown in DU145 PCSCs as well as the trend of increasing AKT activation in vitro and in vivo in response to CNTN1 overexpression

(Fig 2A,C). Several factors can contribute to the elevation of AKT activation not being

significant in vivo (xenograft tumors) (Fig 2C) following CNTN1 expression. 1) There may be a

maximal level of AKT activation that can be achieved in xenograft tumors; 2) the method used to

quantify the differences might not be sufficiently sensitive to capture the small differences; and

3) the level of CNTN1 was overexpressed to 3.5 fold in DU145 cells in comparison to EV cells

based on microarrray analysis, while the endogenous CNTN1 was knocked down by 9 fold in

DU145 cell-derived PCSCs compared to shCTRL PCSCs.

A critical role of CNTN1 in contributing to PCSC-derived tumor initiation is intriguingly supported by the predominant effects of CNTN1 knockdown on genes that function in tumorigenesis (Fig 6C, Supplementary Fig S5). On the other hand, overexpression of CNTN1 in

DU145 non-stem (monolayer) cells altered genes that function in an array of physiological and cellular processes which affect tumorigenesis (Fig 6C, Supplementary Fig S5). These observations are in line with our understanding of PCSCs in cancer progression and metastasis, but also suggest a role of non-stem cancer cells in supporting tumorigenesis via the integration of a series of complex signaling networks. While our attention is focused on PCSCs in general, we cannot neglect the importance of the bulk non-stem cancerous cells. The physiological relevance of these cells in tumorigenesis was clearly reflected by the emergence of CNTN1-null cells following the process of tumorigenesis in mice by CNTN1-positive DU145 PCSCs (Fig 3 and

Fig 4). A similar role of non-stem cells in tumorigenesis in other cancer types should also be considered.

CNTN1's role in PC progression was supported by the observations that CNTN1 knockdown in DU145 PCSCs and its ectopic expression in DU145 monolayer cells affected lipid metabolism

(Fig 6C, the bottom panels). PC tumorigenesis is intimately connected with lipid metabolism.

Androgen regulates lipid metabolism and cholesterol is the precursor of androgen biosynthesis

(43). It is thus tempting to speculate a role of CNTN1 in CRPC development.

Although it remains essentially unknown regarding what cellular mechanisms lead to

CNTN1 expression in PCSCs, it is certain that these alterations also affect the expression of other important tumorigenic genes. It is likely that similar changes might also be in place to cause the expression of other neural cell adhesion molecules in other cancer types. Research into

this mechanism will not only advance our understanding of tumorigenesis, but also enables

developing better means in cancer diagnosis and therapy.

Conclusion

We report the expression of CNTN1 in DU145 cell-derived PCSCs and in PC3 cells cultured

under PCSC conditions. CNTN1 enhances cell invasion and AKT activation, and reduces E-

cadherin expression. Additionally, CNTN1 promotes xenograft tumor formation and lung

metastasis concurrently with the upregulation of AKT activation and the downregulation of E-

cadherin. In PC specimens, CNTN1 is detected in high-risk primary disease as well as in lymph

node and bone metastases, and is associated with PC progression and a reduction in BCR-free

survival. Thus, our research provides the first evidence of the neural cell adhesion molecule,

CNTN1 in promoting PC tumorigenesis and metastasis.

Author's contributions

J.Y. demonstrated CNTN-1 upregulation in PCSCs, and examined the mechanisms

governing CNTN1-mediated PC tumorigenesis, and CNTN-1 association with PC tumorigenesis.

D.O. determined CNTN-1 expression in PC3 cells, CNTN-1-enhanced LNCaP C4-2 cell

invasion, and CNTN-1-promoted AKT activation. A.K., T.B., J.C., P.M., and J.H.P. determined

PC pathology. X.L. established CNTN-1 stable lines. T.A. supervised IHC staining. N.W.,

J.D.M and F.W. contributed to CNTN-1-mediated tumorigenesis in vivo. G.W. and H.P. examined PC tumorigenesis in animal models. D.T. supervised the project. D.T., J.Y., A.K.,

J.H.P., T.B., and P.M. prepared the manuscript.

Acknowledgements

The authors are grateful to Drs. Ying Xia and Alison Allan at The University of Western

Ontario for examining CNTN1-positive circulating PC cells.

Grant Support

This work is supported in part by funds from Prostate Cancer Canada, CIHR (RMS79-71,

MOP-843861), and McMaster University and St. Joseph’s Hospital (GAP funding) to D.T.

References

1. Ferlay J, Soerjomataram I, Dikshit R, Eser S, Mathers C, Rebelo M, et al. Cancer incidence and mortality worldwide: sources, methods and major patterns in GLOBOCAN 2012. Int J Cancer. 2015;136:E359-86. 2. Heidenreich A, Bastian PJ, Bellmunt J, Bolla M, Joniau S, van der Kwast T, et al. EAU guidelines on prostate cancer. Part II: Treatment of advanced, relapsing, and castration-resistant prostate cancer. Eur Urol. 2014;65:467-79. 3. Gravdal K, Halvorsen OJ, Haukaas Sa, Akslen La. A switch from E-cadherin to N- cadherin expression indicates epithelial to mesenchymal transition and is of strong and independent importance for the progress of prostate cancer. Clinical cancer research : an official journal of the American Association for Cancer Research. 2007;13:7003-11. 4. Seidel B, Braeg S, Adler G, Wedlich D, Menke A. E- and N-cadherin differ with respect to their associated p120ctn isoforms and their ability to suppress invasive growth in pancreatic cancer cells. Oncogene. 2004;23:5532-42. 5. Falk J, Bonnon C, Girault J-A, Faivre-Sarrailh C. F3/contactin, a neuronal cell adhesion molecule implicated in axogenesis and myelination. Biology of the cell / under the auspices of the European Cell Biology Organization. 2002;94:327-34. 6. Wei CH, Ryu SE. Homophilic interaction of the L1 family of cell adhesion molecules. Exp Mol Med. 2012;44:413-23. 7. Fogel M, Gutwein P, Mechtersheimer S, Riedle S, Stoeck A, Smirnov A, et al. Mechanisms of disease L1 expression as a predictor of progression and survival in patients with uterine and ovarian carcinomas. The Lancet. 2003;362:869-75. 8. Gavert N, Conacci-Sorrell M, Gast D, Schneider A, Altevogt P, Brabletz T, et al. L1, a novel target of beta-catenin signaling, transforms cells and is expressed at the invasive front of colon cancers. J Cell Biol. 2005;168:633-42. 9. Hai J, Zhu CQ, Bandarchi B, Wang YH, Navab R, Shepherd FA, et al. L1 cell adhesion molecule promotes tumorigenicity and metastatic potential in non-small cell lung cancer. Clin Cancer Res. 2012;18:1914-24. 10. Valiente M, Obenauf AC, Jin X, Chen Q, Zhang XH, Lee DJ, et al. Serpins promote cancer cell survival and vascular co-option in brain metastasis. Cell. 2014;156:1002-16. 11. Su J-L, Yang C-Y, Shih J-Y, Wei L-H, Hsieh C-Y, Jeng Y-M, et al. Knockdown of contactin-1 expression suppresses invasion and metastasis of lung adenocarcinoma. Cancer Res. 2006;66:2553-61. 12. Su J-L, Yang P-C, Shih J-Y, Yang C-Y, Wei L-H, Hsieh C-Y, et al. The VEGF-C/Flt-4 axis promotes invasion and metastasis of cancer cells. Cancer cell. 2006;9:209-23. 13. Liu P, Chen S, Wu W, Liu B, Shen W, Wang F, et al. Contactin-1 (CNTN-1) Overexpression is Correlated with Advanced Clinical Stage and Lymph Node Metastasis in Oesophageal Squamous Cell Carcinomas. Jpn J Clin Oncol. 2012;42:612-8. 14. Wu H-M, Cao W, Ye D, Ren G-X, Wu Y-N, Guo W. Contactin 1 (CNTN1) expression associates with regional lymph node metastasis and is a novel predictor of prognosis in patients with oral squamous cell carcinoma. Molecular medicine reports. 2012;6:265-70. 15. Bizzoca A, Corsi P, Gennarini G. The mouse F3/contactin glycoprotein: Structural features, functional properties and developmental significance of its regulated expression. Cell adhesion & migration. 2009;3:53-63.

16. Bizzoca A, Virgintino D, Lorusso L, Buttiglione M, Yoshida L, Polizzi A, et al. Transgenic mice expressing F3/contactin from the TAG-1 promoter exhibit developmentally regulated changes in the differentiation of cerebellar neurons. Development. 2003;130:29-43. 17. Bizzoca A, Corsi P, Polizzi A, Pinto MF, Xenaki D, Furley AJ, et al. F3/Contactin acts as a modulator of neurogenesis during cerebral cortex development. Dev Biol. 2012;365:133-51. 18. Boyle ME, Berglund EO, Murai KK, Weber L, Peles E, Ranscht B. Contactin orchestrates assembly of the septate-like junctions at the paranode in myelinated peripheral nerve. Neuron. 2001;30:385-97. 19. Compton AG, Albrecht DE, Seto JT, Cooper ST, Ilkovski B, Jones KJ, et al. Mutations in contactin-1, a neural adhesion and neuromuscular junction protein, cause a familial form of lethal congenital myopathy. Am J Hum Genet. 2008;83:714-24. 20. Adorno-Cruz V, Kibria G, Liu X, Doherty M, Junk D, Guan D, et al. Cancer stem cells: targeting the roots of cancer, seeds of metastasis, and sources of therapy resistance. Cancer Res. 2015;75:924-9. 21. Baccelli I, Trumpp A. The evolving concept of cancer and metastasis stem cells. J Cell Biol. 2012;198:281-93. 22. Rybak AP, He L, Kapoor A, Cutz JC, Tang D. Characterization of sphere-propagating cells with stem-like properties from DU145 prostate cancer cells. Biochim Biophys Acta. 2011;1813:683-94. 23. Thomas C, Zoubeidi A, Kuruma H, Fazli L, Lamoureux F, Beraldi E, et al. Transcription factor Stat5 knockdown enhances androgen receptor degradation and delays castration-resistant prostate cancer progression in vivo. Mol Cancer Ther. 2011;10:347-59. 24. Yan J, Wong N, Hung C, Chen WX, Tang D. Contactin-1 reduces E-cadherin expression via activating AKT in lung cancer. PLoS One. 2013;8:e65463. 25. Veltri RW, Miller MC, Isharwal S, Marlow C, Makarov DV, Partin AW. Prediction of prostate-specific antigen recurrence in men with long-term follow-up postprostatectomy using quantitative nuclear morphometry. Cancer Epidemiol Biomarkers Prev. 2008;17:102-10. 26. Mehta R, Kyshtoobayeva A, Kurosaki T. Independent association of angiogenesis index with outcome in prostate cancer. Clin Cancer Res. 2001;7:81-8. 27. Sheng S, Qiao M, Pardee AB. Metastasis and AKT activation. J Cell Physiol. 2009;218:451-4. 28. Saegusa M, Hashimura M, Kuwata T, Okayasu I. Requirement of the Akt/beta-catenin pathway for uterine carcinosarcoma genesis, modulating E-cadherin expression through the transactivation of slug. The American journal of pathology. 2009;174:2107-15. 29. Balkwill F, Mantovani A. Inflammation and cancer: back to Virchow? Lancet. 2001;357:539-45. 30. Grivennikov SI, Greten FR, Karin M. Immunity, inflammation, and cancer. Cell. 2010;140:883-99. 31. De Sousa E, Melo F, Vermeulen L, Fessler E, Medema J. Cancer heterogeneity-a multifaceted view. EMBO Rep. 2013;14:686-95. 32. Gerashchenko T, Denisov E, Litviakov N, Zavyalova M, Vtorushin S, Tsyganov M, et al. Intratumor Heterogeneity: Nature and biological significance. Biochemistry Mosc. 2013;78. 33. Greaves M. Cancer stem cells as 'units of selection'. Evol Appl. 2013;6:102-8. 34. Visvader JE, Lindeman GJ. Cancer stem cells in solid tumours: accumulating evidence and unresolved questions. Nat Rev Cancer. 2008;8:755-68.

35. Goldstein AS, Huang J, Guo C, Garraway IP, Witte ON. Identification of a cell of origin for human prostate cancer. Science. 2010;329:568-71. 36. Leong KG, Wang B-E, Johnson L, Gao W-Q. Generation of a prostate from a single adult stem cell. Nature. 2008;456:804-8. 37. Qin J, Liu X, Laffin B, Chen X, Choy G, Jeter CR, et al. The PSA(-/lo) prostate cancer cell population harbors self-renewing long-term tumor-propagating cells that resist castration. Cell stem cell. 2012;10:556-69. 38. Colombel M, Eaton CL, Hamdy F, Ricci E, van der Pluijm G, Cecchini M, et al. Increased expression of putative cancer stem cell markers in primary prostate cancer is associated with progression of bone metastases. Prostate. 2012;72:713-20. 39. Wang ZA, Mitrofanova A, Bergren SK, Abate-Shen C, Cardiff RD, Califano A, et al. Lineage analysis of basal epithelial cells reveals their unexpected plasticity and supports a cell- of-origin model for prostate cancer heterogeneity. Nat Cell Biol. 2013;15:274-83. 40. Liu W, Laitinen S, Khan S, Vihinen M, Kowalski J, Yu G, et al. Copy number analysis indicates monoclonal origin of lethal metastatic prostate cancer. Nat Med. 2009;15:559-65. 41. Vanharanta S, Massague J. Origins of metastatic traits. Cancer Cell. 2013;24:410-21. 42. Gavert N, Ben-Shmuel A, Raveh S, Ben-Ze'ev A. L1-CAM in cancerous tissues. Expert Opin Biol Ther. 2008;8:1749-57. 43. Krycer JR, Brown AJ. Cholesterol accumulation in prostate cancer: a classic observation from a modern perspective. Biochim Biophys Acta. 2013;1835:219-29.

Table 1. CNTN1 is associated with prostate cancer progression Positive (%)+ Negative (%)++ p-value* Non-Tumour 26 74 HGPIN 33 67 <0.05 Cancer (Gleason 5-9) 42 58 Gleason 5 50 50 Gleason 6 81 19 Gleason 7 95 5 <0.01 Gleason 8 89 11 Gleason 9 90 10 * chi-square test. Total number of patients: 637. +Positive expression classified as moderate to strong staining (H-Score ≥10) ++Negative expression classified as weak to no staining (H-Score <10)

Figure Legends

Figure 1.

CNTN1 expression promotes PC cell invasion. A, the average levels of CNTN1 mRNA in

DU145 and DU145 spheres determined by microarray analysis (3 repeats). *:p<0.05 by a 2-

tailed Student t-test. B, real-time PCR analysis for CNTN1 mRNA in the indicated DU145 cell

lines. β-actin was used as an internal control. Experiments were repeated three times. CNTN1

mRNA in DU145 PCSCs is shown as a fold change to DU145 cells (mean±SE). *:p<0.05 by a 2-

tailed Student t-test. C, western blot analysis of CNTN1. Experiments were repeated at least three times; representative image from a single repeat is shown. M: monolayer cells. D, DU145 spheres were prepared onto slides and stained by immunofluoresence for CNTN1. E, real-time

PCR analysis for CNTN1 mRNA in PC3 cells cultured in the presence of 10% FBS (PC3) and in serum free PCSC conditions (PC3 SF). Experiments were repeated three times. CNTN1 mRNA in PC3 SF is shown as a fold change to PC3 cells (mean±SE). *:p<0.05 by a 2-tailed Student t- test in comparison to PC3 cells. F, western blot analysis of CNTN1 in DU145 EV, CNTN1, parental (Par) cells, and sphere cells. G, invasion analysis for DU145 EV and DU145 CNTN1.

Experiments were repeated three times. Typical images from one experiment are shown (left panel). Cell invasion was quantified (right panel). *:p<0.05 by a 2-tailed Student t-test.

Figure 2.

CNTN1 affects AKT activation and E-cadherin expression. A, DU145 EV and CNTN1 cells were serum starved over night followed by stimulation with 10% FBS as indicated. AKT activation was examined by western blot for serine 473-phosphorylated AKT (pAKT).

Experiments were repeated twice; typical images from a single repeat are shown. B, DU145

sphere cells were transduced with shCTRL (control shRNA) and shCNTN1, followed by western blot examination for the indicated proteins (inset). Experiments were repeated three times; the levels of pAKT were standardized to total AKT and quantified (means ± SE). *:p<0.05 by a 2- tailed Student t-test. C, IHC staining for pAKT on xenograft tumors derived from DU145 EV,

DU145 CNTN1, spheres shCTRL and spheres shCNTN1 cells. Multiple xenograft tumors were examined; typical images with 3x magnification (inset) are included. H-Scores for xenograft tumors were quantified (means ± SE). *:p<0.05 by a 2-tailed Student t-test. D, E, typical images

(insets) and quantification of E-cadherin expression in DU145 EV and CNTN1 cells (D) and in

DU145 spheres shCTRL and shCNTN1 cells (E) are shown. Quantifications were derived from three independent repeats. *:p<0.05 by a 2-tailed Student t-test. F, IHC staining for E-cadherin on xenograft tumors derived from DU145 EV, DU145 CNTN1, spheres shCTRL and spheres shCNTN1. Multiple xenograft tumors were examined; typical images are included.

Figure 3.

CNTN1 promotes xenograft tumor formation. The indicated sphere (A) and monolayer cells (B) were subcutaneously implanted into NOD/SCID mice at 104 sphere cells or 106 monolayer cells per mouse. The number of mice used was four each for shCTRL and EV cells, five for CNTN1, and six for shCNTN1 cells. Tumor volumes were graphed (means ± SE). *: p < 0.05 by a 2-way

ANOVA. Typical images of IHC staining with 2x magnification (inset) for CNTN1 are presented.

Figure 4.

CNTN1 increases lung metastases. A, 106 DU145 EV and DU145 CNTN1 cells were injected

through the lateral tail vein of mice followed for 16 weeks. Individual lobes of the lungs were

dissected and digitally photographed. Typical lung nodes and CNTN1 expression status

determined by IHC staining with 2.5x magnification (inset) are included. IHC staining for

CNTN1 was quantified by H-Scores (right panel) (means ± SE). *:p<0.05 by a 2-tailed Student t-

test. Four mice were used for DU145 EV cells and five mice were used for DU145 CNTN1 cells

(see Supplementary Fig S3A for additional images). B, dot plot distribution of tumor volumes for

DU145 EV (n=4) and DU145 CNTN1 (n=5) for volumes of 0-15 mm3 and 16+ mm3. Mean is represented by the horizontal line. *: p < 0.05 by a 2-tailed Student t-test. C, tumor volumes were measured using ImageJ and graphed (means ± SE). *: p < 0.05 by 2-tailed Student t-test.

Figure 5.

CNTN1 associates with PC progression and biochemical recurrence. A, IHC staining for CNTN1 expression in 3 patients with lymph node metastases and 9 patients with bone metastases.

Typical images from two lymph node patients with 2.5x magnification (inset) and one bone metastasis patient with 9x magnification (inset) are presented (see Supplementary Figs S3B-D and 4 for more images). PC in bone was confirmed by PAP staining. B, non-cancer (n=30),

HGPIN (n=61) and PC (n=637) obtained from TMA2 and TMA5 was stained for CNTN1 expression. Typical images with H-Score in brackets are included with 2.5x magnification

(inset). C, the H-Score was calculated for each sample and grouped into Gleason stages.

Staining intensity was graphed (mean±SE). *: p < 0.05, **: p< 0.01 by two-tailed Student t-test.

D, Kaplan-Meier analysis of biochemical recurrence-free survival in CNTN1-positive (n=385) versus CNTN1-negative (n=91) patients (p<0.05 by a log-rank test).

Figure 6.

CNTN1 affects gene expressions. Heatmap of microarray data for CNTN1 overexpressing

DU145 cells (A) and CNTN1 knockdown in DU145 PCSCs (B). C, Top diseases and biological functions for differentially expressed genes for DU145 PCSCs shCTRL and shCNTN1 and

DU145 EV and CNTN1.

Neural cell adhesion protein CNTN1 promotes the metastatic progression of prostate cancer

Judy Yan, Diane Ojo, Anil Kapoor, et al.

Cancer Res Published OnlineFirst January 21, 2016.

Updated version Access the most recent version of this article at: doi:10.1158/0008-5472.CAN-15-1898

Supplementary Access the most recent supplemental material at: Material http://cancerres.aacrjournals.org/content/suppl/2016/01/21/0008-5472.CAN-15-1898.DC1

Author Author manuscripts have been peer reviewed and accepted for publication but have not yet been Manuscript edited.

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/early/2016/01/21/0008-5472.CAN-15-1898. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.