DOCSLIB.ORG

1 Neural Cell Adhesion Protein CNTN1 Promotes the Metastatic

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
1 Neural Cell Adhesion Protein CNTN1 Promotes the Metastatic Author Manuscript Published OnlineFirst on January 21, 2016; DOI: 10.1158/0008-5472.CAN-15-1898 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Neural cell adhesion protein CNTN1 promotes the metastatic progression of prostate cancer Judy Yan,1 Diane Ojo,1 Anil Kapoor,2 Xiaozeng Lin,1 Jehonathan H. Pinthus,2 Tariq Aziz,3 Tarek A. Bismar,4 Fengxiang Wei,1,5 Nicholas Wong,1 Jason De Melo,1 Jean-Claude Cutz,3 Pierre Major,6 Geoffrey Wood,7 Hao Peng,8 and Damu Tang 1 * 1Division of Nephrology, Department of Medicine, 2Department of Surgery, 3Department of Pathology and Molecular Medicine, McMaster University, Hamilton, Canada; 4Department of Pathology and Laboratory Medicine, University of Calgary, Calgary, Canada; 5The Genetics Laboratory, Institute of Women and Children’s Health, Longgang District, Shenzhen, China; 6Department of Oncology, McMaster University, Hamilton, Canada; 7Department of Veterinary Pathology, University of Guelph, Guelph, Canada; 8Department of Medical Physics & Applied Radiation Sciences, McMaster University, Hamilton, Canada Correspondence: Damu Tang 50 Charlton Ave East Hamilton Canada L8N 4A6 Tel: (905) 522-1155, x35168 Fax: (9050 540-6549; (905) 521-6181 Email: [email protected] Running title: CNTN1 promotes prostate cancer progression Keywords: Contactin 1, prostate cancer, xenograft tumor, prostate cancer progression, and prostate cancer metastasis Conflicts of interest: A US provisional patent has been filed. J.Y., D.O., and D.T. hold the ownership 1 Downloaded from cancerres.aacrjournals.org on September 27, 2021. © 2016 American Association for Cancer Research. Author Manuscript Published OnlineFirst on January 21, 2016; DOI: 10.1158/0008-5472.CAN-15-1898 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Abstract Prostate cancer (PC) metastasis is the main cause of disease-related mortality. Elucidating the mechanisms underlying PC metastasis is critical for effective therapeutic intervention. In this study, we performed gene expression profiling of PC stem-like cells (PCSCs) derived from DU145 human PC cells to identify factors involved in metastatic progression. Our studies revealed contactin 1 (CNTN1), a neural cell adhesion protein, to be a PC-promoting factor. CNTN1 knockdown reduced PCSC-mediated tumor initiation, whereas CNTN1 overexpression enhanced PC cell invasion in vitro and promoted xenograft tumor formation and lung metastasis in vivo. Additionally, CNTN1 overexpression in DU145 cells and corresponding xenograft tumors resulted in elevated AKT activation and reduced E-cadherin (CDH1) expression. CNTN1 expression was not readily detected in normal prostate glands, but was clearly evident on PC cells in primary tumors and lymph node and bone metastases. Tumors from 637 patients expressing CNTN1 were associated with PC progression and worse biochemical recurrence-free survival following radical prostatectomy (p<0.05). Collectively, our findings demonstrate that CNTN1 promotes PC progression and metastasis, prompting further investigation into the mechanisms that enable neural proteins to become aberrantly expressed in non-neural malignancies. 2 Downloaded from cancerres.aacrjournals.org on September 27, 2021. © 2016 American Association for Cancer Research. Author Manuscript Published OnlineFirst on January 21, 2016; DOI: 10.1158/0008-5472.CAN-15-1898 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Introduction Prostate cancer (PC) is the most frequently diagnosed malignancy and the second/third leading cause of cancer-associated deaths for men in the developed world (1). The disease progresses from high grade prostatic intra-epithelial neoplasia (HGPIN), to locally invasive carcinoma and finally to metastatic cancer. PC predominantly metastasizes to the bone (2). While local tumors can be well controlled through watchful waiting, surgery and radiation; metastatic PC remains incurable. Therefore, identification of key molecules involved in PC metastasis is of an utmost importance for prognostic and therapeutic purposes. The capacity of primary tumor cells to metastasize relies on the integration of a complex network of signals, including those of the environment. As a result of signal integrations, cellular alterations occur that promote PC progression and metastasis. The typical changes for epithelium-originated tumors include the downregulation of E-cadherin leading to a reduction of cell-cell adhesion, a characteristic event of epithelial-mesenchymal transition (3, 4). In addition to the reduction of E-cadherin, elevation of cell adhesion molecules (CAMs), especially Ig-like neural cell adhesion molecules play an important role in cancer progression and metastasis. The Ig-like CAMs include contactins, the neural cell adhesion molecule (NCAM), and L1CAMs comprising of cell adhesion molecule L1-like (CHL1), neuronal cell adhesion molecule (NrCAM) and neurofascin (5, 6). Increases in L1CAM are associated with poor prognosis in patients with ovarian, uterine, colon, breast, and lung cancers (7-10). Interestingly, in addition to L1CAM, increased expression of contactin 1 (CNTN1, F3/contactin) was detected in lung carcinoma. CNTN1 promoted lung cancer metastasis (11, 12) and its expression associated with poor prognosis for patients with lung carcinoma, esophageal and oral squamous cell carcinomas (11, 13, 14). Nevertheless, to the best of our knowledge the role of 3 Downloaded from cancerres.aacrjournals.org on September 27, 2021. © 2016 American Association for Cancer Research. Author Manuscript Published OnlineFirst on January 21, 2016; DOI: 10.1158/0008-5472.CAN-15-1898 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. CNTN1 in PC progression and metastasis is unknown. CNTN1 is a neural cell adhesion protein consisting of 6 N-terminal Ig domains followed by 4 fibronectin (FN) like repeats (15) and plays important roles in the development of the central nervous system, including lineage commitment and precursor proliferation (16, 17). CNTN1 also promotes axon elongation in the cerebellum, the formation of the septate-like junctions between axons and myelinating glial cells and the formation of the neuromuscular junction (5, 18, 19). Collectively, it appears that the physiological functions of the Ig-like CAMs in neuron guidance and migration are commonly hijacked by tumors for metastasis. The above observations would suggest contributions of an Ig-like CAM to PC metastasis. To pursue this possibility, we have taken advantage of our recently established conditions to isolate PCSCs, a cell population that plays a major role in cancer metastasis (20, 21). Specifically, we were able to culture PCSCs as suspension spheres from DU145 cells. These sphere cells are likely PCSCs because of their elevated (100 fold) ability to initiate tumors in NOD/SCID mice (22). With the availability of PCSCs and their isogenic non-PCSCs, we have profiled the respective gene expression, and intriguingly, CNTN1 was specifically identified in DU145 cell- derived PCSCs and in PC3 cells cultured under PCSC conditions. Based on the reported role of CNTN1 in promoting lung cancer metastasis (11, 12), we proceeded to determine CNTN1's ability to stimulate PC invasion and metastasis. Lastly, we examined the association of CNTN1 expression with PC progression and BCR-free survival using clinical specimens. Materials and Methods Cell lines and plasmids 4 Downloaded from cancerres.aacrjournals.org on September 27, 2021. © 2016 American Association for Cancer Research. Author Manuscript Published OnlineFirst on January 21, 2016; DOI: 10.1158/0008-5472.CAN-15-1898 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. DU145, PC3 and LNCaP cells were from American Type Culture Collection and cultured accordingly in Minimum Essential Medium, F12 Medium and RPMI-1640 Medium supplemented with 10% fetal bovine serum (FBS, Sigma) and 1% Penicillin-Streptomycin (Life Technologies). The androgen-independent LNCaP derivative C4-2 cell line was kindly provided by Dr. Martin Gleave at The University of British Columbia, Canada (23). All cell lines were thawed fresh every two months; no further authentication was performed. CNTN1 shRNA and control shRNA were from Santa Cruz Biotechnology. CNTN1 shRNA is a pool of 3 different plasmids with the following short hairpin sequences (5'-3'): (A) GATCCGGGTGATAATTGAATGCAATTCAAGAGATTGCATTCAATTATCACCCTTTTT (B) GATCCCAAGAGCAGTGGACTTAATTTCAAGAGAATTAAGTCCACTGCTCTTGTTT TT (C)GATCCGCATCCTTGTCTACTTGGATTCAAGAGATCCAAGTAGACAAGGATGCT TTTT. The sequence for the scrambled control shRNA is proprietary and could not be provided by the company. CNTN1 isoform 3 cDNA was from Open Biosystems (GE Healthcare). Generation of DU145 spheres DU145 spheres were isolated as described (22). DU145 monolayer cells were individualized and resuspended at a density of 5,000 cells/mL in serum-free (SF) media supplemented with 0.4% bovine serum albumin (Bioshop Canada Inc) and 0.2× B27 minus Vitamin A (4mL/L, Life Technologies). Knockdown of CNTN1 in spheres Hairpin shRNAs were expressed by a retroviral-based shRNA vector as described (24). Briefly, a gag-pol, a rev and an envelope expressing vector (Stratagene) were transiently co- 5 Downloaded from cancerres.aacrjournals.org on September 27, 2021. © 2016 American Association for Cancer Research. Author Manuscript
Load more

Recommended publications
  • Growth and Molecular Profile of Lung Cancer Cells Expressing Ectopic LKB1: Down-Regulation of the Phosphatidylinositol 3؅-Phosphate Kinase/PTEN Pathway1
    [CANCER RESEARCH 63, 1382–1388, March 15, 2003] Growth and Molecular Profile of Lung Cancer Cells Expressing Ectopic LKB1: Down-Regulation of the Phosphatidylinositol 3؅-Phosphate Kinase/PTEN Pathway1 Ana I. Jimenez, Paloma Fernandez, Orlando Dominguez, Ana Dopazo, and Montserrat Sanchez-Cespedes2 Molecular Pathology Program [A. I. J., P. F., M. S-C.], Genomics Unit [O. D.], and Microarray Analysis Unit [A. D.], Spanish National Cancer Center, 28029 Madrid, Spain ABSTRACT the cell cycle in G1 (8, 9). However, the intrinsic mechanism by which LKB1 activity is regulated in cells and how it leads to the suppression Germ-line mutations in LKB1 gene cause the Peutz-Jeghers syndrome of cell growth is still unknown. It has been proposed that growth (PJS), a genetic disease with increased risk of malignancies. Recently, suppression by LKB1 is mediated through p21 in a p53-dependent LKB1-inactivating mutations have been identified in one-third of sporadic lung adenocarcinomas, indicating that LKB1 gene inactivation is critical in mechanism (7). In addition, it has been observed that LKB1 binds to tumors other than those of the PJS syndrome. However, the in vivo brahma-related gene 1 protein (BRG1) and this interaction is required substrates of LKB1 and its role in cancer development have not been for BRG1-induced growth arrest (10). Similar to what happens in the completely elucidated. Here we show that overexpression of wild-type PJS, Lkb1 heterozygous knockout mice show gastrointestinal hamar- LKB1 protein in A549 lung adenocarcinomas cells leads to cell-growth tomatous polyposis and frequent hepatocellular carcinomas (11, 12). suppression. To examine changes in gene expression profiles subsequent to Interestingly, the hamartomas, but not the malignant tumors, arising in exogenous wild-type LKB1 in A549 cells, we used cDNA microarrays.
    [Show full text]
  • A Spontaneous Mutation in Contactin 1 in the Mouse
    A Spontaneous Mutation in Contactin 1 in the Mouse Muriel T. Davisson1*, Roderick T. Bronson1, Abigail L. D. Tadenev1, William W. Motley1, Arjun Krishnaswamy2, Kevin L. Seburn1, Robert W. Burgess1 1 The Jackson Laboratory, Bar Harbor, Maine, United States of America, 2 Department of Molecular and Cellular Biology, Harvard University, Cambridge, Massachusetts, United States of America Abstract Mutations in the gene encoding the immunoglobulin-superfamily member cell adhesion molecule contactin1 (CNTN1) cause lethal congenital myopathy in human patients and neurodevelopmental phenotypes in knockout mice. Whether the mutant mice provide an accurate model of the human disease is unclear; resolving this will require additional functional tests of the neuromuscular system and examination of Cntn1 mutations on different genetic backgrounds that may influence the phenotype. Toward these ends, we have analyzed a new, spontaneous mutation in the mouse Cntn1 gene that arose in a BALB/c genetic background. The overt phenotype is very similar to the knockout of Cntn1, with affected animals having reduced body weight, a failure to thrive, locomotor abnormalities, and a lifespan of 2–3 weeks. Mice homozygous for the new allele have CNTN1 protein undetectable by western blotting, suggesting that it is a null or very severe hypomorph. In an analysis of neuromuscular function, neuromuscular junctions had normal morphology, consistent with previous studies in knockout mice, and the muscles were able to generate appropriate force when normalized for their reduced size in late stage animals. Therefore, the Cntn1 mutant mice do not show evidence for a myopathy, but instead the phenotype is likely to be caused by dysfunction in the nervous system.
    [Show full text]
  • Supplemental Information
    Supplemental information Dissection of the genomic structure of the miR-183/96/182 gene. Previously, we showed that the miR-183/96/182 cluster is an intergenic miRNA cluster, located in a ~60-kb interval between the genes encoding nuclear respiratory factor-1 (Nrf1) and ubiquitin-conjugating enzyme E2H (Ube2h) on mouse chr6qA3.3 (1). To start to uncover the genomic structure of the miR- 183/96/182 gene, we first studied genomic features around miR-183/96/182 in the UCSC genome browser (http://genome.UCSC.edu/), and identified two CpG islands 3.4-6.5 kb 5’ of pre-miR-183, the most 5’ miRNA of the cluster (Fig. 1A; Fig. S1 and Seq. S1). A cDNA clone, AK044220, located at 3.2-4.6 kb 5’ to pre-miR-183, encompasses the second CpG island (Fig. 1A; Fig. S1). We hypothesized that this cDNA clone was derived from 5’ exon(s) of the primary transcript of the miR-183/96/182 gene, as CpG islands are often associated with promoters (2). Supporting this hypothesis, multiple expressed sequences detected by gene-trap clones, including clone D016D06 (3, 4), were co-localized with the cDNA clone AK044220 (Fig. 1A; Fig. S1). Clone D016D06, deposited by the German GeneTrap Consortium (GGTC) (http://tikus.gsf.de) (3, 4), was derived from insertion of a retroviral construct, rFlpROSAβgeo in 129S2 ES cells (Fig. 1A and C). The rFlpROSAβgeo construct carries a promoterless reporter gene, the β−geo cassette - an in-frame fusion of the β-galactosidase and neomycin resistance (Neor) gene (5), with a splicing acceptor (SA) immediately upstream, and a polyA signal downstream of the β−geo cassette (Fig.
    [Show full text]
  • Curcumin Alters Gene Expression-Associated DNA Damage, Cell Cycle, Cell Survival and Cell Migration and Invasion in NCI-H460 Human Lung Cancer Cells in Vitro
    ONCOLOGY REPORTS 34: 1853-1874, 2015 Curcumin alters gene expression-associated DNA damage, cell cycle, cell survival and cell migration and invasion in NCI-H460 human lung cancer cells in vitro I-TSANG CHIANG1,2, WEI-SHU WANG3, HSIN-CHUNG LIU4, SU-TSO YANG5, NOU-YING TANG6 and JING-GUNG CHUNG4,7 1Department of Radiation Oncology, National Yang‑Ming University Hospital, Yilan 260; 2Department of Radiological Technology, Central Taiwan University of Science and Technology, Taichung 40601; 3Department of Internal Medicine, National Yang‑Ming University Hospital, Yilan 260; 4Department of Biological Science and Technology, China Medical University, Taichung 404; 5Department of Radiology, China Medical University Hospital, Taichung 404; 6Graduate Institute of Chinese Medicine, China Medical University, Taichung 404; 7Department of Biotechnology, Asia University, Taichung 404, Taiwan, R.O.C. Received March 31, 2015; Accepted June 26, 2015 DOI: 10.3892/or.2015.4159 Abstract. Lung cancer is the most common cause of cancer CARD6, ID1 and ID2 genes, associated with cell survival and mortality and new cases are on the increase worldwide. the BRMS1L, associated with cell migration and invasion. However, the treatment of lung cancer remains unsatisfactory. Additionally, 59 downregulated genes exhibited a >4-fold Curcumin has been shown to induce cell death in many human change, including the DDIT3 gene, associated with DNA cancer cells, including human lung cancer cells. However, the damage; while 97 genes had a >3- to 4-fold change including the effects of curcumin on genetic mechanisms associated with DDIT4 gene, associated with DNA damage; the CCPG1 gene, these actions remain unclear. Curcumin (2 µM) was added associated with cell cycle and 321 genes with a >2- to 3-fold to NCI-H460 human lung cancer cells and the cells were including the GADD45A and CGREF1 genes, associated with incubated for 24 h.
    [Show full text]
  • Human Fetal Gonad Transcriptomes
    IN PRESS, HUMAN REPRODUCTION 1 1 Dynamics of the transcriptional landscape during human fetal testis and ovary development 2 3 Running title: Human fetal gonad transcriptomes 4 5 Estelle Lecluze1, Antoine D. Rolland1, Panagiotis Filis2, Bertrand Evrard1, Sabrina Leverrier-Penna1,3, 6 Millissia Ben Maamar1, Isabelle Coiffec1, Vincent Lavoué4, Paul A. Fowler2, Séverine Mazaud- 7 Guittot1, Bernard Jégou1, Frédéric Chalmel1,* 8 9 1 Univ Rennes, Inserm, EHESP, Irset (Institut de recherche en santé, environnement et travail) - 10 UMR_S 1085, F-35000 Rennes, France. 11 2 Institute of Medical Sciences, School of Medicine, Medical Sciences & Nutrition, University of 12 Aberdeen, Foresterhill, Aberdeen, AB25 2ZD, UK. 13 3 Univ Poitiers, STIM, CNRS ERL7003, Poitiers Cedex 9, France. 14 4 CHU Rennes, Service Gynécologie et Obstétrique, F-35000 Rennes, France. 15 16 * To whom correspondence should be addressed 17 Correspondence: [email protected]. 18 2 19 Abstract 20 STUDY QUESTION: Which transcriptional program triggers sex differentiation in bipotential 21 gonads and downstream cellular events governing fetal testis and ovary development in humans? 22 SUMMARY ANSWER: The characterisation of a dynamically-regulated protein-coding and 23 noncoding transcriptional landscape in developing human gonads of both sexes highlights a large 24 number of potential key regulators that show an early sexually dimorphic expression pattern. 25 WHAT IS KNOWN ALREADY: Gonadal sex differentiation is orchestrated by a sexually dimorphic 26 gene expression program in XX and XY developing fetal gonads. A comprehensive characterisation 27 of its noncoding counterpart offers promising perspectives for deciphering the molecular events 28 underpinning gonad development and for a complete understanding of the aetiology of disorders of 29 sex development in humans.
    [Show full text]
  • Original Article Contactin 1 As a Potential Biomarker Promotes Cell Proliferation and Invasion in Thyroid Cancer
    Int J Clin Exp Pathol 2015;8(10):12473-12481 www.ijcep.com /ISSN:1936-2625/IJCEP0015044 Original Article Contactin 1 as a potential biomarker promotes cell proliferation and invasion in thyroid cancer Kaiyuan Shi1, Dong Xu1, Chen Yang1, Liping Wang1, Weiyun Pan1, Chuanming Zheng2, Linyin Fan3 1Department of Ultrasonography, Zhejiang Cancer Hospital, Hangzhou 310022, China; 2Oncological Surgery of Head and Neck, Zhejiang Cancer Hospital, Hangzhou 310022, China; 3Department of Radiology, Zhejiang Cancer Hospital, Hangzhou 310022, China Received August 25, 2015; Accepted September 25, 2015; Epub October 1, 2015; Published October 15, 2015 Abstract: Contactin 1 (CNTN1) as a member of the immunoglobulin superfamily plays important role in the develop- ment of nervous system. Recent studies find that elevated CNTN1 can promote the metastasis of cancer. However, the expression and function of CNTN1 in thyroid cancer are still unknown. Here, we firstly find CNTN1 is a new gene which can be regulated by RET/PTC3 (Ret proto-oncogene and Ret-activating protein ELE1) rearrangement gene and the protein level of CNTN1 is increasing in thyroid cancer. Besides this change is positively associated with the TNM stage and tumor size. Moreover, we confirm that knockdown of CNTN1 significantly inhibits the tumor proliferation, invasiveness and represses the expression of cyclin D1 (CCND1). In conclusion, CNTN1 will be a poteintial diagnosis biomarker and therapy target for thyroid cancer. Keywords: Thyroid cancer, RET, rearrangement, contactin 1, biomarker, metastasis Introduction E-cadherin expression [14]. Liu et al demon- strate overexpression of CNTN1 in oesophageal Thyroid cancer (TC) is the most prevalent endo- squamous cell carcinomas is correlated with crine cancer and one of the fastest growing advanced clinical stage and lymph node metas- diagnoses worldwide, however the cause and tasis [15].
    [Show full text]
  • Knockdown of Contactin-1 Expression Suppresses Invasion and Metastasis of Lung Adenocarcinoma
    Research Article Knockdown of Contactin-1 Expression Suppresses Invasion and Metastasis of Lung Adenocarcinoma Jen-Liang Su,1 Ching-Yao Yang,1,2,3 Jin-Yuan Shih,4 Lin-Hung Wei,5 Chang-Yao Hsieh,5,6 Yung-Ming Jeng,7 Ming-Yang Wang,3 Pan-Chyr Yang,4 and Min-Liang Kuo1 1Institute of Toxicology, College of Medicine, National Taiwan University and Departments of 2Traumatology, 3Surgery, 4Internal Medicine, 5Oncology, 6Obstetrics and Gynecology, and 7Pathology, National Taiwan University Hospital, Taipei, Taiwan Abstract for laminin (4) and vitronectin (5), matrix metalloproteinases/ MMPs (6, 7), and CD44 (8, 9)], whereas others inhibit these Numerous genetic changes are associated with cancer cell metastasis and invasion. In search for key regulators of processes [e.g., cadherin (10), tissue inhibitors of MMPs (11, 12), invasion and metastasis, a panel of lung cancer cell lines with nm23 (13), connective tissue growth factor/CTGF (14), and different invasive ability was screened. The gene for contactin- collapsing response mediator proteins/CRMP-1 (15)]. Understand- 1 was found to play an essential role in tumor invasion and ing of the regulation of gene expression in poorly metastatic metastasis. Suppression of contactin-1 expression abolished compared with highly metastatic cancer cells should facilitate the the ability of lung adenocarcinoma cells to invade Matrigel identification of genes associated with metastasis as well as the in vitro as well as the polymerization of filamentous-actin and development of novel therapeutic and diagnostic applications, the formation of focal adhesion structures. Furthermore, thereby improving clinical care of cancer patients. knockdown of contactin-1 resulted in extensive inhibition of Analysis of gene expression patterns has recently become possible through cDNA microarray techniques (16, 17).
    [Show full text]
  • Somamer Reagents Generated to Human Proteins Number Somamer Seqid Analyte Name Uniprot ID 1 5227-60
    SOMAmer Reagents Generated to Human Proteins The exact content of any pre-specified menu offered by SomaLogic may be altered on an ongoing basis, including the addition of SOMAmer reagents as they are created, and the removal of others if deemed necessary, as we continue to improve the performance of the SOMAscan assay. However, the client will know the exact content at the time of study contracting. SomaLogic reserves the right to alter the menu at any time in its sole discretion. Number SOMAmer SeqID Analyte Name UniProt ID 1 5227-60 [Pyruvate dehydrogenase (acetyl-transferring)] kinase isozyme 1, mitochondrial Q15118 2 14156-33 14-3-3 protein beta/alpha P31946 3 14157-21 14-3-3 protein epsilon P62258 P31946, P62258, P61981, Q04917, 4 4179-57 14-3-3 protein family P27348, P63104, P31947 5 4829-43 14-3-3 protein sigma P31947 6 7625-27 14-3-3 protein theta P27348 7 5858-6 14-3-3 protein zeta/delta P63104 8 4995-16 15-hydroxyprostaglandin dehydrogenase [NAD(+)] P15428 9 4563-61 1-phosphatidylinositol 4,5-bisphosphate phosphodiesterase gamma-1 P19174 10 10361-25 2'-5'-oligoadenylate synthase 1 P00973 11 3898-5 26S proteasome non-ATPase regulatory subunit 7 P51665 12 5230-99 3-hydroxy-3-methylglutaryl-coenzyme A reductase P04035 13 4217-49 3-hydroxyacyl-CoA dehydrogenase type-2 Q99714 14 5861-78 3-hydroxyanthranilate 3,4-dioxygenase P46952 15 4693-72 3-hydroxyisobutyrate dehydrogenase, mitochondrial P31937 16 4460-8 3-phosphoinositide-dependent protein kinase 1 O15530 17 5026-66 40S ribosomal protein S3 P23396 18 5484-63 40S ribosomal protein
    [Show full text]
  • The Long Non-Coding RNA GHSROS Reprograms Prostate Cancer Cell Lines Toward a More Aggressive Phenotype
    bioRxiv preprint doi: https://doi.org/10.1101/682203; this version posted June 26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 The long non-coding RNA GHSROS reprograms prostate cancer cell lines 2 toward a more aggressive phenotype 3 4 Patrick B. Thomas1,2,3, Penny L. Jeffery1,2,3, Manuel D. Gahete4,5,6,7,8, Eliza J. Whiteside9,10,†, 5 Carina Walpole1,3, Michelle L. Maugham1,2,3, Lidija Jovanovic3, Jennifer H. Gunter3, 6 Elizabeth D. Williams3, Colleen C. Nelson3, Adrian C. Herington1,3, Raúl M. Luque4,5,6,7,8, 7 Rakesh N. Veedu11, Lisa K. Chopin1,2,3,*, Inge Seim1,2,3,12,* 8 9 1 Ghrelin Research Group, Translational Research Institute- Institute of Health and 10 Biomedical Innovation, School of Biomedical Sciences, Queensland University of 11 Technology (QUT), Woolloongabba, Queensland 4102, Australia. 12 2 Comparative and Endocrine Biology Laboratory, Translational Research Institute-Institute 13 of Health and Biomedical Innovation, School of Biomedical Sciences, Queensland 14 University of Technology, Woolloongabba, Queensland 4102, Australia. 15 3 Australian Prostate Cancer Research Centre–Queensland, Institute of Health and 16 Biomedical Innovation, School of Biomedical Sciences, Queensland University of 17 Technology (QUT), Princess Alexandra Hospital, Translational Research Institute, 18 Woolloongabba, Queensland 4102, Australia. 19 4 Maimonides Institute of Biomedical Research of Cordoba (IMIBIC), Córdoba, 14004, 20 Spain. 21 5 Department of Cell Biology, Physiology and Immunology, University of Córdoba, Córdoba, 22 14004, Spain.
    [Show full text]
  • Next Generation Sequencing in a Large Cohort of Patients Presenting with Neuromuscular Disease Before Or at Birth Emily J
    Todd et al. Orphanet Journal of Rare Diseases (2015) 10:148 DOI 10.1186/s13023-015-0364-0 RESEARCH Open Access Next generation sequencing in a large cohort of patients presenting with neuromuscular disease before or at birth Emily J. Todd1, Kyle S. Yau1, Royston Ong1, Jennie Slee2, George McGillivray3, Christopher P. Barnett4, Goknur Haliloglu5, Beril Talim6, Zuhal Akcoren6, Ariana Kariminejad7, Anita Cairns8, Nigel F. Clarke9,10, Mary-Louise Freckmann11, Norma B. Romero12, Denise Williams13,14, Caroline A Sewry13,14, Alison Colley15, Monique M. Ryan16, Cathy Kiraly-Borri17, Padma Sivadorai18, Richard J.N. Allcock19, David Beeson20, Susan Maxwell20, Mark R. Davis18, Nigel G. Laing1,18 and Gianina Ravenscroft1* Abstract Background: Fetal akinesia/hypokinesia, arthrogryposis and severe congenital myopathies are heterogeneous conditions usually presenting before or at birth. Although numerous causative genes have been identified for each of these disease groups, in many cases a specific genetic diagnosis remains elusive. Due to the emergence of next generation sequencing, virtually the entire coding region of an individual’s DNA can now be analysed through “whole” exome sequencing, enabling almost all known and novel disease genes to be investigated for disorders such as these. Methods: Genomic DNA samples from 45 patients with fetal akinesia/hypokinesia, arthrogryposis or severe congenital myopathies from 38 unrelated families were subjected to next generation sequencing. Clinical features and diagnoses for each patient were supplied by referring clinicians. Genomic DNA was used for either whole exome sequencing or a custom-designed neuromuscular sub-exomic supercapture array containing 277 genes responsible for various neuromuscular diseases. Candidate disease-causing variants were investigated and confirmed using Sanger sequencing.
    [Show full text]
  • PLP1 and CNTN1 Gene Variation Modulates the Microstructure of Human White Matter in the Corpus Callosum
    Brain Structure and Function (2018) 223:3875–3887 https://doi.org/10.1007/s00429-018-1729-7 ORIGINAL ARTICLE PLP1 and CNTN1 gene variation modulates the microstructure of human white matter in the corpus callosum Catrona Anderson1,2 · Wanda M. Gerding3 · Christoph Fraenz2 · Caroline Schlüter2 · Patrick Friedrich2 · Maximilian Raane4 · Larissa Arning3 · Jörg T. Epplen3,4 · Onur Güntürkün2 · Christian Beste5,6 · Erhan Genç2 · Sebastian Ocklenburg2 Received: 4 December 2017 / Accepted: 3 August 2018 / Published online: 9 August 2018 © Springer-Verlag GmbH Germany, part of Springer Nature 2018 Abstract The corpus callosum is the brain’s largest commissural fiber tract and is crucial for interhemispheric integration of neural information. Despite the high relevance of the corpus callosum for several cognitive systems, the molecular determinants of callosal microstructure are largely unknown. Recently, it was shown that genetic variations in the myelin-related proteolipid 1 gene PLP1 and the axon guidance related contactin 1 gene CNTN1 were associated with differences in interhemispheric integration at the behavioral level. Here, we used an innovative new diffusion neuroimaging technique called neurite orienta- tion dispersion and density imaging (NODDI) to quantify axonal morphology in subsections of the corpus callosum and link them to genetic variation in PLP1 and CNTN1. In a cohort of 263 healthy human adults, we found that polymorphisms in both PLP1 and CNTN1 were significantly associated with callosal microstructure. Importantly, we found a double dissocia- tion between gene function and neuroimaging variables. Our results suggest that genetic variation in the myelin-related gene PLP1 impacts white matter microstructure in the corpus callosum, possibly by affecting myelin structure.
    [Show full text]
  • Supplementary Information
    Supplementary information The long non-coding RNA GHSROS reprograms prostate cancer cell lines toward a more aggressive phenotype Patrick B. Thomas1,2,3, Penny L. Jeffery1,2,3, Manuel D. Gahete4,5,6,7,8, Eliza J. Whiteside9,10,†, Carina Walpole1,3, Michelle L. Maugham1,2,3, Lidija Jovanovic3, Jennifer H. Gunter3, Elizabeth D. Williams3, Colleen C. Nelson3, Adrian C. Herington1,3, Raúl M. Luque4,5,6,7,8, Rakesh N. Veedu11, Lisa K. Chopin1,2,3,*, Inge Seim1,2,3,12,* 1 Ghrelin Research Group, Translational Research Institute- Institute of Health and Biomedical Innovation, School of Biomedical Sciences, Queensland University of Technology (QUT), Woolloongabba, Queensland 4102, Australia. 2 Comparative and Endocrine Biology Laboratory, Translational Research Institute-Institute of Health and Biomedical Innovation, School of Biomedical Sciences, Queensland University of Technology, Woolloongabba, Queensland 4102, Australia. 3 Australian Prostate Cancer Research Centre–Queensland, Institute of Health and Biomedical Innovation, School of Biomedical Sciences, Queensland University of Technology (QUT), Princess Alexandra Hospital, Translational Research Institute, Woolloongabba, Queensland 4102, Australia. 4 Maimonides Institute of Biomedical Research of Cordoba (IMIBIC), Córdoba, 14004, Spain. 5 Department of Cell Biology, Physiology and Immunology, University of Córdoba, Córdoba, 14004, Spain. 6 Hospital Universitario Reina Sofía (HURS), Córdoba, 14004, Spain. 7 CIBER de la Fisiopatología de la Obesidad y Nutrición (CIBERobn), Córdoba, 14004, Spain. 8 Campus de Excelencia Internacional Agroalimentario (ceiA3), Córdoba, 14004, Spain. 9 Centre for Health Research, University of Southern Queensland, Toowoomba, Queensland 4350, Australia. 10 Institute for Life Sciences and the Environment, University of Southern Queensland, Toowoomba, Queensland 4350, Australia. 11 Centre for Comparative Genomics, Murdoch University & Perron Institute for Neurological and Translational Science, Perth, Western Australia 6150, Australia.
    [Show full text]