Author Manuscript Published OnlineFirst on January 21, 2016; DOI: 10.1158/0008-5472.CAN-15-1898 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Neural cell adhesion protein CNTN1 promotes the metastatic progression of prostate cancer Judy Yan,1 Diane Ojo,1 Anil Kapoor,2 Xiaozeng Lin,1 Jehonathan H. Pinthus,2 Tariq Aziz,3 Tarek A. Bismar,4 Fengxiang Wei,1,5 Nicholas Wong,1 Jason De Melo,1 Jean-Claude Cutz,3 Pierre Major,6 Geoffrey Wood,7 Hao Peng,8 and Damu Tang 1 * 1Division of Nephrology, Department of Medicine, 2Department of Surgery, 3Department of Pathology and Molecular Medicine, McMaster University, Hamilton, Canada; 4Department of Pathology and Laboratory Medicine, University of Calgary, Calgary, Canada; 5The Genetics Laboratory, Institute of Women and Children’s Health, Longgang District, Shenzhen, China; 6Department of Oncology, McMaster University, Hamilton, Canada; 7Department of Veterinary Pathology, University of Guelph, Guelph, Canada; 8Department of Medical Physics & Applied Radiation Sciences, McMaster University, Hamilton, Canada Correspondence: Damu Tang 50 Charlton Ave East Hamilton Canada L8N 4A6 Tel: (905) 522-1155, x35168 Fax: (9050 540-6549; (905) 521-6181 Email: [email protected] Running title: CNTN1 promotes prostate cancer progression Keywords: Contactin 1, prostate cancer, xenograft tumor, prostate cancer progression, and prostate cancer metastasis Conflicts of interest: A US provisional patent has been filed. J.Y., D.O., and D.T. hold the ownership 1 Downloaded from cancerres.aacrjournals.org on September 27, 2021. © 2016 American Association for Cancer Research. Author Manuscript Published OnlineFirst on January 21, 2016; DOI: 10.1158/0008-5472.CAN-15-1898 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Abstract Prostate cancer (PC) metastasis is the main cause of disease-related mortality. Elucidating the mechanisms underlying PC metastasis is critical for effective therapeutic intervention. In this study, we performed gene expression profiling of PC stem-like cells (PCSCs) derived from DU145 human PC cells to identify factors involved in metastatic progression. Our studies revealed contactin 1 (CNTN1), a neural cell adhesion protein, to be a PC-promoting factor. CNTN1 knockdown reduced PCSC-mediated tumor initiation, whereas CNTN1 overexpression enhanced PC cell invasion in vitro and promoted xenograft tumor formation and lung metastasis in vivo. Additionally, CNTN1 overexpression in DU145 cells and corresponding xenograft tumors resulted in elevated AKT activation and reduced E-cadherin (CDH1) expression. CNTN1 expression was not readily detected in normal prostate glands, but was clearly evident on PC cells in primary tumors and lymph node and bone metastases. Tumors from 637 patients expressing CNTN1 were associated with PC progression and worse biochemical recurrence-free survival following radical prostatectomy (p<0.05). Collectively, our findings demonstrate that CNTN1 promotes PC progression and metastasis, prompting further investigation into the mechanisms that enable neural proteins to become aberrantly expressed in non-neural malignancies. 2 Downloaded from cancerres.aacrjournals.org on September 27, 2021. © 2016 American Association for Cancer Research. Author Manuscript Published OnlineFirst on January 21, 2016; DOI: 10.1158/0008-5472.CAN-15-1898 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Introduction Prostate cancer (PC) is the most frequently diagnosed malignancy and the second/third leading cause of cancer-associated deaths for men in the developed world (1). The disease progresses from high grade prostatic intra-epithelial neoplasia (HGPIN), to locally invasive carcinoma and finally to metastatic cancer. PC predominantly metastasizes to the bone (2). While local tumors can be well controlled through watchful waiting, surgery and radiation; metastatic PC remains incurable. Therefore, identification of key molecules involved in PC metastasis is of an utmost importance for prognostic and therapeutic purposes. The capacity of primary tumor cells to metastasize relies on the integration of a complex network of signals, including those of the environment. As a result of signal integrations, cellular alterations occur that promote PC progression and metastasis. The typical changes for epithelium-originated tumors include the downregulation of E-cadherin leading to a reduction of cell-cell adhesion, a characteristic event of epithelial-mesenchymal transition (3, 4). In addition to the reduction of E-cadherin, elevation of cell adhesion molecules (CAMs), especially Ig-like neural cell adhesion molecules play an important role in cancer progression and metastasis. The Ig-like CAMs include contactins, the neural cell adhesion molecule (NCAM), and L1CAMs comprising of cell adhesion molecule L1-like (CHL1), neuronal cell adhesion molecule (NrCAM) and neurofascin (5, 6). Increases in L1CAM are associated with poor prognosis in patients with ovarian, uterine, colon, breast, and lung cancers (7-10). Interestingly, in addition to L1CAM, increased expression of contactin 1 (CNTN1, F3/contactin) was detected in lung carcinoma. CNTN1 promoted lung cancer metastasis (11, 12) and its expression associated with poor prognosis for patients with lung carcinoma, esophageal and oral squamous cell carcinomas (11, 13, 14). Nevertheless, to the best of our knowledge the role of 3 Downloaded from cancerres.aacrjournals.org on September 27, 2021. © 2016 American Association for Cancer Research. Author Manuscript Published OnlineFirst on January 21, 2016; DOI: 10.1158/0008-5472.CAN-15-1898 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. CNTN1 in PC progression and metastasis is unknown. CNTN1 is a neural cell adhesion protein consisting of 6 N-terminal Ig domains followed by 4 fibronectin (FN) like repeats (15) and plays important roles in the development of the central nervous system, including lineage commitment and precursor proliferation (16, 17). CNTN1 also promotes axon elongation in the cerebellum, the formation of the septate-like junctions between axons and myelinating glial cells and the formation of the neuromuscular junction (5, 18, 19). Collectively, it appears that the physiological functions of the Ig-like CAMs in neuron guidance and migration are commonly hijacked by tumors for metastasis. The above observations would suggest contributions of an Ig-like CAM to PC metastasis. To pursue this possibility, we have taken advantage of our recently established conditions to isolate PCSCs, a cell population that plays a major role in cancer metastasis (20, 21). Specifically, we were able to culture PCSCs as suspension spheres from DU145 cells. These sphere cells are likely PCSCs because of their elevated (100 fold) ability to initiate tumors in NOD/SCID mice (22). With the availability of PCSCs and their isogenic non-PCSCs, we have profiled the respective gene expression, and intriguingly, CNTN1 was specifically identified in DU145 cell- derived PCSCs and in PC3 cells cultured under PCSC conditions. Based on the reported role of CNTN1 in promoting lung cancer metastasis (11, 12), we proceeded to determine CNTN1's ability to stimulate PC invasion and metastasis. Lastly, we examined the association of CNTN1 expression with PC progression and BCR-free survival using clinical specimens. Materials and Methods Cell lines and plasmids 4 Downloaded from cancerres.aacrjournals.org on September 27, 2021. © 2016 American Association for Cancer Research. Author Manuscript Published OnlineFirst on January 21, 2016; DOI: 10.1158/0008-5472.CAN-15-1898 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. DU145, PC3 and LNCaP cells were from American Type Culture Collection and cultured accordingly in Minimum Essential Medium, F12 Medium and RPMI-1640 Medium supplemented with 10% fetal bovine serum (FBS, Sigma) and 1% Penicillin-Streptomycin (Life Technologies). The androgen-independent LNCaP derivative C4-2 cell line was kindly provided by Dr. Martin Gleave at The University of British Columbia, Canada (23). All cell lines were thawed fresh every two months; no further authentication was performed. CNTN1 shRNA and control shRNA were from Santa Cruz Biotechnology. CNTN1 shRNA is a pool of 3 different plasmids with the following short hairpin sequences (5'-3'): (A) GATCCGGGTGATAATTGAATGCAATTCAAGAGATTGCATTCAATTATCACCCTTTTT (B) GATCCCAAGAGCAGTGGACTTAATTTCAAGAGAATTAAGTCCACTGCTCTTGTTT TT (C)GATCCGCATCCTTGTCTACTTGGATTCAAGAGATCCAAGTAGACAAGGATGCT TTTT. The sequence for the scrambled control shRNA is proprietary and could not be provided by the company. CNTN1 isoform 3 cDNA was from Open Biosystems (GE Healthcare). Generation of DU145 spheres DU145 spheres were isolated as described (22). DU145 monolayer cells were individualized and resuspended at a density of 5,000 cells/mL in serum-free (SF) media supplemented with 0.4% bovine serum albumin (Bioshop Canada Inc) and 0.2× B27 minus Vitamin A (4mL/L, Life Technologies). Knockdown of CNTN1 in spheres Hairpin shRNAs were expressed by a retroviral-based shRNA vector as described (24). Briefly, a gag-pol, a rev and an envelope expressing vector (Stratagene) were transiently co- 5 Downloaded from cancerres.aacrjournals.org on September 27, 2021. © 2016 American Association for Cancer Research. Author Manuscript