Research Article

Knockdown of Contactin-1 Expression Suppresses Invasion and Metastasis of Lung Adenocarcinoma

Jen-Liang Su,1 Ching-Yao Yang,1,2,3 Jin-Yuan Shih,4 Lin-Hung Wei,5 Chang-Yao Hsieh,5,6 Yung-Ming Jeng,7 Ming-Yang Wang,3 Pan-Chyr Yang,4 and Min-Liang Kuo1

1Institute of Toxicology, College of Medicine, National Taiwan University and Departments of 2Traumatology, 3Surgery, 4Internal Medicine, 5Oncology, 6Obstetrics and Gynecology, and 7Pathology, National Taiwan University Hospital, Taipei, Taiwan

Abstract for laminin (4) and vitronectin (5), matrix metalloproteinases/ MMPs (6, 7), and CD44 (8, 9)], whereas others inhibit these Numerous genetic changes are associated with cancer cell metastasis and invasion. In search for key regulators of processes [e.g., cadherin (10), tissue inhibitors of MMPs (11, 12), invasion and metastasis, a panel of lung cancer cell lines with nm23 (13), connective tissue growth factor/CTGF (14), and different invasive ability was screened. The for contactin- collapsing response mediator /CRMP-1 (15)]. Understand- 1 was found to play an essential role in tumor invasion and ing of the regulation of in poorly metastatic metastasis. Suppression of contactin-1 expression abolished compared with highly metastatic cancer cells should facilitate the the ability of lung adenocarcinoma cells to invade Matrigel identification of associated with metastasis as well as the in vitro as well as the polymerization of filamentous-actin and development of novel therapeutic and diagnostic applications, the formation of focal adhesion structures. Furthermore, thereby improving clinical care of cancer patients. knockdown of contactin-1 resulted in extensive inhibition of Analysis of gene expression patterns has recently become possible through cDNA microarray techniques (16, 17). Microarray tumor metastasis and in increased survival in an animal model. RhoA but not Cdc42 or Rac1 was found to serve a technology also represents a powerful tool for identifying critical role in contactin-1–mediated invasion and metastasis. oncogenes or tumor suppressor genes potentially involved in Contactin-1–specific RNA interference resulted in loss of the etiology of lung cancer. In the present report, the cDNA metastatic and invasive capacity in both in vitro and in vivo microarray method, rather than the traditional paired comparison models. This loss was overturned by constitutive expression approach, was used to identify invasion-associated genes in a of the active form of RhoA. Contactin-1 was differentially series of lung adenocarcinoma cell lines. Several genes critical to expressed in tumor tissues, and its expression correlated with lung metastasis (14, 15) were identified using this approach. Here, tumor stage, lymph node metastasis, and patient survival. a differentially expressed gene, contactin-1 (CNTN-1), was Contactin-1 is proposed to function importantly in the associated with invasive ability and reversely correlated with the invasion and metastasis of lung adenocarcinoma cells via prognosis of lung adenocarcinoma patients. The activity of the small GTP-binding , RhoA, was found to be required for RhoA-mediated mechanisms. (Cancer Res 2006; 66(5): 2553-61) CNTN-1–mediated filamentous-actin (F-actin) polymerization and cell invasion. Introduction Lung cancer remains the leading cause of cancer death in industrialized countries. Metastasis, the major factor governing Materials and Methods cancer patient mortality, is a complicated process that is currently Cell culture, antibodies, and reagents. Lung adenocarcinoma cells uncontrolled (1). It is now widely accepted that malignant tumors were cultured as described previously (18). MAB904 mouse monoclonal contain heterogeneous populations of cells of varying metastatic anti-CNTN-1 and AF904 goat polyclonal anti-CNTN-1 antibodies were potential (2). Consequently, highly and weakly metastatic cells in purchased from R&D Systems (Minneapolis, MN). Rhodamine-conjugated a given tumor should differ from each other with respect to anti-phalloidin antibody was purchased from Molecular Probes (Eugene, biological properties, such as invasiveness, adhesiveness, motility, OR). Goat polyclonal anti-CNTN-1, rabbit polyclonal anti-paxillin, anti-Rac1, mouse monoclonal anti-vinculin, anti-RhoA, and anti-Cdc42 antibodies and proliferation capacity. were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Hoechst Understanding of the genetic alterations responsible for the 33258 was obtained from Sigma (St. Louis, MO). molecular biological changes associated with human lung cancer In vitro invasion assay and cell proliferation measurement. Modified pathogenesis has advanced during past decades. Considerable Boyden chambers with filter inserts (pore size of 8 Am) coated with Matrigel evidence exists to support the concept that each discrete step of (40 Ag; Collaborative Biomedical, Becton Dickinson Labware, Franklin metastasis is regulated by transient or permanent changes at the Lakes, NJ) in 24-well dishes (Nucleopore, Pleasanton, CA) were employed DNA, mRNA, and/or protein levels for different genes (3). Some of for invasion assays as described previously (14). Cell proliferation was 3 these molecules facilitate invasion and metastasis [e.g., receptors measured by incorporation of [ H]thymidine as described previously (19). Immunohistochemistry. Protein expression in cancer patients was detected by immunohistochemistry as described previously (18). A scoring system was devised to assign a staining intensity score for CNTN-1 Note: Supplementary data for this article are available at Cancer Research Online (http://cancerres.aacrjournals.org/). expression from 0 (no expression) to 3 (highest intensity staining). Requests for reprints: Min-Liang Kuo, Laboratory of Molecular and Cellular Immunostaining was classified in the following two groups according to Toxicology, Institute of Toxicology, College of Medicine, National Taiwan University, both intensity and extent: low expression, no staining was present (staining No. 1, Section 1, Jen-Ai Road, Taipei, Taiwan. Phone: 886-2-2312-3456 ext. 8607; Fax: intensity score = 0), or positive staining was detected in <10% of the cells 886-2-2341-0217; E-mail: [email protected]. I2006 American Association for Cancer Research. (staining intensity score = 1); high expression, positive immunostaining was doi:10.1158/0008-5472.CAN-05-2645 present in 10% to 25% (staining intensity score = 2) or >25% of the cells www.aacrjournals.org 2553 Cancer Res 2006; 66: (5). March 1, 2006 Cancer Research

Figure 1. CNTN-1 expression correlates with invasive ability in vitro and with patient stage, lymph node metastasis, and survival in lung cancer patients. A, correlation of CNTN-1 expression with the invasive ability of lung cancer cell lines. Top, expression of CNTN-1 mRNA and CNTN-1 protein in lung adenocarcinoma cell lines with different invasive abilities cultured under identical conditions. b-actin mRNA and h-actin protein are presented as controls for internal mRNA or protein loading, respectively. Bottom, relative in vitro invasion activity of the human lung adenocarcinoma cancer cell lines. To compare the relative invasiveness of five different cell lines, values were normalized to that of CL1.0 cells. Bars, upper 95% CI. Findings were reproduced on three separate occasions. Kaplan-Meier survival plots for patients with lung adenocarcinoma, grouped by the degree of expression of CNTN-1 protein. B, CNTN-1 expression and disease-free survival. C, CNTN-1 expression and overall survival. Solid line, patients with reduced or no expression (levels 1 and 0) of CNTN-1; dotted line, patients with high expression of CNTN-1 (levels 2 and 3). P was determined by a two-sided log-rank test. D, results of real-time RT-PCR quantification of CNTN-1 mRNA and TBP mRNA expression from 23 patients with metastatic lung adenocarcinoma and 19 patients without metastatic lung adenocarcinoma.

(staining intensity score = 3). All of the immunohistochemical staining Immunoprecipitation and Western blotting. The cellular lysates were results were reviewed independently by two pathologists. prepared as described previously (18). Equal amounts of protein were Real-time quantitative reverse transcription-PCR. The quality of RNA incubated with specific antibody immobilized onto protein A-Sepharose in samples was determined by electrophoresis through agarose gels and beads. Solubilized proteins were analyzed by Western blotting as describe staining with ethidium bromide. 18S and 28S RNA bands were visualized previously (18). Where indicated, the membranes were stripped and with UV illumination. The primers used, based on the cDNA sequence reprobed with another antibody. of CNTN-1 (69 bp), were as follows: 5V-CAATAGTGCAGGGTGTGGAC-3V RNA isolation and RT-PCR. The RNA was prepared as described (forward), 5V-TGGCTAGGAGGTGCTTTCTT-3V (reverse), and 5V-CCAAGT- previously (18). Amplification of growth factor cDNAs and h-actin cDNA as GACATGATTGAGGCTTTCACC-3V(probe). The probe was labeled at the 5V internal controls in each reaction was done by the PCR with the following end with carboxyfluorescein and at the 3Vend with N,N,NV,NV-tetramethyl-6- primer pairs: the primer sequences for CNTN-1 were 5V-TGTTCAGCAAATT- carboxyrhodamine. The primers and probe used for quantitative reverse CATCCCA-3V (forward) and 5V-TCTACCCACTCAGGGAATGC-3V (reverse) transcription-PCR (RT-PCR) of the TATA box–binding protein mRNA and for b-actin were 5V-GATGATGATATCGCCGCGCT-3V(forward) and 5V- (internal control, Genbank accession no. X54993) were as described TGGGTCATCTTCTCGCGGTT-3V(reverse). Denaturation was done at 95jC previously (15). The threshold cycle (CT) is the fractional cycle number at for 10 minutes. The PCR conditions were 30 cycles of 95jC for 1 minute, which the fluorescence generated by cleavage of the probe exceeds a fixed 55jC for 1 minute, and 72jC for 1 minute, then 72jC for 10 minutes. PCR level above baseline. For a chosen threshold, a smaller starting copy number products were visualized by ethidium bromide staining after separation by results in a higher CT value. agarose gel electrophoresis. Immunofluorescence staining and laser scan confocal microscopy. RNA interference and stably transfected clone selection. Three short Cells to be analyzed by immunofluorescent staining were fixed in 3% interfering RNA (siRNA)–coding oligos against human CNTN-1 were paraformaldehyde and then blocked by incubation in 2.5% bovine serum designed and verified to be specific for CNTN-1 by a Blast search done albumin in PBS. Primary antibodies as indicated were applied to the slides against the . The Contactin-1/siRNA-1–targeting sequence at a dilution of 1:50 and incubated at 4jC overnight. The samples were is CTACCTGTTTAGCAGAGTTTA; the Contactin-1/siRNA-2–targeting treated with FITC-conjugated or TRITC-conjugated secondary antibody sequence is ACAGAAAGATGCTGGAATATA; and the Contactin-1/siRNA- (Sigma). The FITC-labeled or TRITC-labeled cells were then analyzed by 3–targeting sequence is GTAGTTCAGTTCAAGGATGTA. The U6 promoter fluorescence microscopy. with Contactin-1/siRNA-1, Contactin-1/siRNA-2, or Contactin-1/siRNA-3 For laser scan microscopy, immunofluorescence-labeled cells were inserts was cloned into a commercially available vector (pRNAU6.1/Hygro) analyzed using an inverted laser scanning microscope (Zeiss LSM 410 according to the manufacturer’s instructions (GenScript, Piscataway, NJ). A invert, Carl Zeiss, Oberkochen, Germany), equipped with both argon ion siRNA oligo that did not match any known human coding cDNA was used (488 nm) and HeNe (543 nm) lasers. Colocalization of two labeled antigens as a control. The insert-containing vector or control vector was stably was detected as a single yellow image when the images from both channels transfected into A549 cells or CL1-5 cells using the transfection reagent were overlaid. For each image, the cells were optically sectioned from the FuGENE-6 (Roche Molecular Biochemicals, Indianapolis, IN) as described ventral to the dorsal surface at intervals of 1 Am. previously (18). After 48 hours of transfection, cells were treated with

Cancer Res 2006; 66: (5). March 1, 2006 2554 www.aacrjournals.org Knockdown of CNTN-1 Inhibits Metastasis

400 Ag/mL hygromycin B. Hygromycin-resistant clones were selected, and Statistical analysis. The data are presented as the mean F SD. The these clones were then expanded for further studies. Student’s t test was used to compare data between two groups. Statistical Separation of nuclear and cytosolic fractions. Cytosolic and nuclear analyses of clinicopathologic data were done as described previously (15). fractions were prepared as described previously (20). Survival curves were obtained using the Kaplan-Meier method. All Rho family pull-down assay. The Rho family pull-down assay was done statistical tests included two-way ANOVA. Ps < 0.05 were considered to as described previously (20). be statistically significant. Mice and measurement of s.c. tumor growth. Six-week-old severe combined immunodeficient (SCID) mice were inoculated s.c. with tumor cells (106 per animal). Tumor development was determined for individual Results animals (15 per group) by twice weekly sequential caliper measurements of CNTN-1 expression correlates with in vitro invasive ability length (L) and width (W). Tumor volume was calculated by the formula and stage, lymph node metastasis and survival in lung cancer LW 2/2. After 10 weeks, the mice were sacrificed, and the tumors and lungs patients. To identify genes associated with invasion, established were removed and weighed. Segments of tumor and lung were excised and fixed in 10% neutral buffered formalin. All animal work was done according human lung adenocarcinoma cell lines with different invasive to protocols approved by the Institutional Animal Care and Use Committee activities (22) were examined by cDNA microarray and a of the College of Medicine, National Taiwan University. colorimetric detection system (23). All experiments involving the Experimental metastasis assay. The experimental metastasis assay was cDNA microarrays were done in triplicate and under the high- done as described previously (14). stringency conditions reported previously (15). The expression of Patients and specimens. Sixty-five patients who underwent surgery for CNTN-1 mRNA was found to be positively associated with cell adenocarcinoma of the lung at the National Taiwan University Hospital invasiveness (data not shown). To confirm the results of cDNA were included in the study. None of the patients had received neoadjuvant array screening, expressions of CNTN-1 mRNA and CNTN-1 protein chemotherapy or radiation therapy before surgery. Paraffin-embedded, were measured by reverse transcription-PCR (RT-PCR) and formalin-fixed surgical specimens were collected for immunohistochemical Western blotting, respectively. Expression of CNTN-1 mRNA and staining. The histologic classification of adenocarcinoma lung cancer was determined as recommended by the WHO (21). Tumor size, local invasion, CNTN-1 protein was found to be elevated in highly invasive CL1-3 lymph node metastasis, and final disease stage were determined as and CL1-5 lung cancer cells but expression was barely detectable described previously (14). The follow-up period lasted up to 110 months. in the poorly invasive parental CL1-0 cells (Fig. 1A, left). CNTN-1 Patients who died of postoperative complications within 30 days following expression and invasive capacity were also examined in other lung their surgery were excluded from the survival analysis. adenocarcinoma cell lines. A549 cells, which have strong invasive

Figure 2. Suppression of CNTN-1 expression by stable siRNA decreases invasive ability and rearrangements of the actin cytoskeleton and focal adhesion structures in lung adenocarcinoma cells. A, top, expression of CNTN-1 in CL1-5 (left) and A549 (right) cells stably expressing control/siRNA– or CNTN-1–targeted siRNA as determined by immunoblotting. Bottom, relative invasive abilities of CL1-5 (left) and A549 (right) cells stably expressing control/siRNA– or CNTN-1–targeted siRNA. To determine relative invasiveness, values were normalized to that of CL1-5/control or A549/control cells. Columns, means of three independent experiments; bars, upper 95% CI. Contactin-1/siRNA–transfected cells had significantly lower invasive activities than control/siRNA–transfected cells. *, P < 0.05, two-tailed Student’s t test. B, presence of well-formed F-actin–containing microfilament bundles in A549/control cells (top) but not in A549/siRNA-2 cells (bottom). Cells were fixed and stained with Hoechst 33258 to visualize nuclei (blue) and with a rhodamine-conjugated anti-phalloidin antibody to detect F-actin (red). Stained preparations were then examined by laser scan confocal microscopy. Arrows, F-actin–containing microfilament bundles. C and D, presence of focal adhesion structures in cells. Cells were fixed, stained with Hoechst 33258, and labeled with either anti-paxillin (C) or anti-vinculin (D) antibodies. Preparations were incubated with TRITC-conjugated secondary antibody and then examined by laser scan confocal microscopy. Arrows, focal adhesions. Bar, 15 Am. www.aacrjournals.org 2555 Cancer Res 2006; 66: (5). March 1, 2006 Cancer Research

Figure 3. CNTN-1 is colocalized with RhoA and required for RhoA activation. A, expression of various Rho family GTPases in A549 cells and CL1-5 cells transfected with contactin-1/siRNA-2 or control-siRNA by Western blot assay and GST pull-down assay. Findings were repeated on three separate occasions, and representative findings are presented. B, membrane and cytosolic fractions were derived from lysates, and solubilized proteins from each fraction were subjected to SDS-PAGE and immunoblotting for RhoA and Rac-1. Findings were repeated on three separate occasions, and representative findings are shown. C, A549 cells were treated with the indicated concentrations of CNTN-1–neutralizing antibody for 24 or 48 hours. Activation of RhoA (top) and invasive ability (bottom) were measured. CNTN-1–neutralizing antibody-treated cells had significantly lower invasive activities than normal IgG-treated cells. *, P < 0.05, two-tailed Student’s t test. Columns, means of three independent experiments; bars, upper 95% CI. D, top, association of membrane-localized CNTN-1 with RhoA in lung cancer cells. Colocalization of two labeled antigens was detected as a single yellow image when the images from both channels were overlaid. Bottom, membrane fractions prepared from A549 and CL1-5 cells transfected with contactin-1/siRNA-2 or control/siRNA were incubated with anti-RhoA antibody. Immunoprecipitated proteins were collected and subjected to SDS-PAGE and immunoblotting with anti-CNTN-1 or anti-RhoA antibody. Representative of three independent experiments. activity (Fig. 1A, right), expressed CNTN-1 more abundantly The surgical-pathology stages of the 65 patients described above compared with H928 cells, which have low invasive activity were stage I for 26 patients, stage II for 10 patients, stage III for 24 (Fig. 1A, right). In addition, expression of CNTN-1 in normal lung patients, and stage IV for 5 patients. Tumor status was T1 for 18 epithelial cells was undetectable (data not shown). Expression of patients, T2 for 36 patients, T3 for 3 patients, and T4 for 8 patients. CNTN-1 was further determined in tumor samples from 65 lung Thirty patients had no lymph node metastasis (N0), and 35 patients adenocarcinoma patients by immunohistochemistry using an anti- had regional or mediastinal lymph node metastases (N1 in 13 CNTN-1–specific monoclonal antibody (MAB904) from R&D patients, N2 in 21 patients, and N3 in 1 patient). Immunohisto- Systems. A moderate/strong staining for plasmalemmal CNTN-1 chemical analysis of the 65 tumor specimens revealed high CNTN-1 was frequently observed in advanced stage lung adenocarcinoma expression for 58.5% (38 of 65) of the lung adenocarcinoma (Supplementary Fig. S1A); this positive staining was not obtained patients. CNTN-1 high-expression patients were more likely than with preimmune serum or with antigen-blocked antibody (data low-expression patients to have advanced disease (stage III or IV; not shown). In contrast, negative or very weak staining of CNTN-1 P < 0.001), advanced tumor status (T2,T3, and T4; P = 0.048), and by MAB904 was seen in early-stage lung adenocarcinoma lymph node metastasis (N1,N2, and N3; P < 0.001). The median (Supplementary Fig. S1B). More importantly, strong staining of duration to postoperative recurrence was also longer in CNTN-1 CNTN-1 was observed in metastatic tumor cells in lymph node low-expression patients (57.9 months) than in CNTN-1 high- sections (Supplementary Fig. S1C); this positive staining was not expression patients [9.0 F 4.4 months; 95% confidence interval observed with preimmune serum (Supplementary Fig. S1D). (95% CI), 0.4-17.7 months; log-rank test, P = .001; Fig. 1B]. For Similar positive findings were obtained with two other anti- CNTN-1 low-expression patients, the probability of survival CNTN-1–specific polyclonal antibodies (AF904 from R&D Systems reached a plateau value of 0.54. Their survival was increased in a and sc-20296 from Santa Cruz Biotechnology; data not shown). statistically significant manner when compared with CNTN-1 high- By real-time quantitative RT-PCR assay, we also found that the expression patients (median survival = 19.4 F 4.5 months; 95% CI, expression of CNTN-1 mRNA in specimens from patients with 10.7-28.2 months; log-rank test, P < 0.001; Fig. 1C). metastatic lung adenocarcinoma was significantly higher than CNTN-1 is essential for invasion and for rearrangements of specimens from lung adenocarcinoma patients without metastasis the actin cytoskeleton and focal adhesion structures in lung (Fig. 1D). adenocarcinoma cells. To ascertain whether CNTN-1 plays a

Cancer Res 2006; 66: (5). March 1, 2006 2556 www.aacrjournals.org Knockdown of CNTN-1 Inhibits Metastasis critical role in tumor metastasis, three human CNTN-1–targeted It was, therefore, of interest to explore the possibility that GTP- RNA interference expression vectors (siRNA) or a control vector binding proteins of the Rho family were involved in CNTN-1– was transfected into highly metastatic lung adenocarcinoma cells. mediated invasion of lung adenocarcinoma cells. As shown in As shown in Fig. 2A, expression of each of the three siRNAs, but not Fig. 3A, expression of contactin-1/siRNA-2 decreased the activity of of the control siRNA, dramatically reduced the expression of RhoA (relative amount of RhoA in the active form) but not of the CNTN-1 protein (Fig. 2A, top). The contactin-1/siRNA-2 proved two other Rho family small GTPases, Rac1 and Cdc42, in both A549 especially effective, suppressing the expression of CNTN-1 protein and CL1-5 cells. The activities of these GTPases were not altered in in both cell lines to degrees that were undetectable by cells transfected with control vector. The activity of RhoA was immunoblotting (Fig. 2A, top). The expression of contactin-1/ either very low or undetectable in the less invasive and low CNTN- siRNA-2 in CL1-5 cells and A549 cells also strongly impaired their 1–expressing CL1-0 and H928 cells (data not shown). In addition to invasive activities (Fig. 2A, bottom) but not proliferation rates (data the findings from glutathione S-transferase (GST) pull-down assays, not shown). These data rule out the possibility that the effects of expression of contactin-1/siRNA-2 was found to promote the CNTN-1 on in vitro cell invasiveness were attributable to the redistribution of RhoA but not of Rac1 from the membrane to the different proliferation rates. cytosol (Fig. 3B). The expression of active RhoA (RhoA/GTP) and in F-actin is continuously polymerized and depolymerized in subsequent invasive ability were concentration-dependently de- motile cells and is essential to cell motility (24). To further assess creased by CNTN-1 neutralizing antibody but not with control the role of CNTN-1 arrangements of the actin cytoskeleton and antibody (Fig. 3C). focal adhesion structures, A549/siRNA-2 and A549/control cells Members of several classes of adhesion molecules, including were, therefore, stained with rhodamine-conjugated anti-phalloidin integrins, cadherins and immunoglobulin superfamily members, antibody and characterized using multicolor immunofluorescence are reported to form complexes with Rho family proteins, thereby and confocal laser scanning microscopy. A549/control cells altering their activities (27). Multicolor immunofluorescence displayed well-formed F-actin–containing microfilament bundles staining and confocal laser scanning microscopy were, therefore, within the cytoplasm and below the plasma membrane (Fig. 2B, employed to ascertain whether membrane-specific RhoA associates top). However, cells expressing contactin-1/siRNA-2 contained few, with CNTN-1 in A549/control and A549/siRNA-2 cells. Plasmalem- if any, microfilament bundles (Fig. 2B, bottom). A549/control cells mal RhoA was expressed more abundantly in A549/control cells displayed a large number of prominent paxillin-containing (Fig. 2C, and was colocalized with CNTN-1 (Fig. 3D, top). In contrast, A549 top) and vinculin-containing (Fig. 2D, top) focal adhesions at the cells expressing contactin-1/siRNA-2 displayed decreased CNTN-1 cell periphery. Stable expression of contactin-1/siRNA-2 resulted in expression and a loss of associations between CNTN-1 and a decrease in focal adhesion formation as assessed by paxillin and membrane-localized RhoA (Fig. 3D, top). In a separate experiment, vinculin staining (Fig. 2C and D). These findings strongly support expression of contactin-1/siRNA-2 dramatically decreased the the hypothesis that CNTN-1 is intimately involved in regulation of association of RhoA with CNTN-1 in membrane fractions prepared the invasive activity of lung adenocarcinoma cells. from both A549 and CL1-5 cells (Fig. 3D, bottom). Transfection with RhoA is required for CNTN-1–mediated cell invasion. The the constitutively activated RhoA (V14RhoA) expression vector Rho family of small GTPases has recently been implicated in the resulted in increased expression of activated RhoA and slight invasive and metastatic capacities of various cancer cells (25, 26). enhancement of invasive ability in A549/control cells (Fig. 4A).

Figure 4. RhoA activity is required for CNTN-1–mediated lung adenocarcinoma cell invasion and F-actin polymerization. A, activation of RhoA and invasive activity of A549/control and A549/siRNA-2 cells as a function of stable transfection with the constitutively activated RhoA (pcDNA3.1-V14RhoA) expressing vector. Top, activation of RhoA was measured by the GTP pull-down assay. Bottom, invasive activity was measured by an in vitro invasion assay with values expressed as percentage of the untreated control. Bars, upper 95% CI. pcDNA3.1-transfected A549/siRNA-2 cells had significantly lower invasive activities than pcDNA3.1-transfected A549/control cells. *, P < 0.05, two-tailed Student’s t test. Transfection of A549/siRNA-2 cells with pcDNA3.1-V14RhoA restored invasive activity significantly compared with pcDNA3.1-transfected A549/siRNA-2 control cells. #, P < 0.05, two-tailed Student’s t test. B, formation of F-actin filaments in cells stably transfected with pcDNA3.1-V14RhoA or pcDNA3.1. Arrows, F-actin–containing microfilament bundles. C, expression of CNTN-1, total RhoA, and activated RhoA in tissue specimens from lung adenocarcinoma patients with (lanes 1-8) or without (lanes 9-16) lymph node metastasis by Western blotting and GST pull-down assay.

www.aacrjournals.org 2557 Cancer Res 2006; 66: (5). March 1, 2006 Cancer Research

Figure 5. Suppression of CNTN-1 expression impairs the ability of lung adenocarcinoma cells to metastasize to the lungs. A, growth patterns of subcutaneously xenografted tumors formed in mice by injection of A549 cells or CL1-5 cells expressing either control/siRNA or contactin-1/siRNA2. Tumor volumes were measured at 5-day intervals for 70 days. Point, mean of measurements for 15 primary tumors; bars, SD. B, survival curves of mice carrying s.c. xenografted tumors derived from A549 cells or CL1-5 cells expressing either control/siRNA or contactin-1/siRNA2. C, expression of CNTN-1 protein and RhoA activity in s.c. xenografted mouse tumors were determined by Western blotting and GST pull-down assay. D, numbers of metastatic nodules in the lungs of mice were determined by experimental metastasis assay. Columns, average number of metastatic nodules per lung for each group of mice; bars, SD.

Furthermore, the observed contactin-1/siRNA-2–dependent reduc- CNTN-1 is essential for tumor metastasis. To determine tions of RhoA activation and invasive ability described above whether CNTN-1 plays a causal role in tumor metastasis, A549/ were both significantly overturned by transfection with V14RhoA control, A549/siRNA-2, CL1-5/control, and CL1-5/siRNA-2 cells expression vector (Fig. 4A). In addition, the decrease in F-actin– were injected s.c. into the right flank of SCID mice followed by containing microfilament bundles resulting from expression of measurements of growth of the resulting primary tumors at five contactin-1/siRNA-2 was also reversed by transfection with the day intervals. A549 cells and CL1-5 cells carrying either contactin-1/ V14RhoA expression vector but not with a control vector (Fig. 4B). siRNA-2 or the control siRNA formed primary tumors at identical These findings are consistent with a critical role for activated RhoA rates (Fig. 5A), indicating that high expression of CNTN-1 is not in adenocarcinoma cell invasion and in CNTN-1–dependent F- required for primary tumor formation by these cells. To determine actin polymerization in these cells. whether loss of CNTN-1 expression affected the ability of A549 cells To explore the relationships among CNTN-1 expression, RhoA or CL1-5 cells to metastasize, the metastatic behaviors of the activity, and metastatic potential in lung adenocarcinoma tumors, A549 and CL1-5 tumor cells expressing either contactin-1/siRNA-2 measurements of CNTN-1 expression and RhoA activity were done or the control siRNA vector were compared. Although cells for specimens from lung adenocarcinoma patients with or without expressing control siRNA formed large numbers of macroscopi- metastasis. As shown in Fig. 4C, CNTN-1 protein was clearly cally visible metastases in lungs, cells that expressed contactin-1/ expressed in specimens from patients with metastatic lung siRNA-2 formed very few metastases (Supplementary Fig. S2). A adenocarcinoma but was only modestly expressed or undetectable mean of 44 metastatic lung nodules was obtained for mice in specimens from lung adenocarcinoma patients without injected with A549/control cells, whereas a mean of 5 metastatic metastasis. Furthermore, the activity of RhoA was significantly lung nodules was obtained for mice injected with A549/siRNA-2 higher in specimens from patients with metastasis (Fig. 4C). These cells (difference = 39 nodules; 95% CI, 28-49 nodules; P < 0.001). A correlative findings support relationships between RhoA activity mean value of 38 metastatic lung nodules was obtained for mice and CNTN-1 expression in human lung adenocarcinoma tumors. injected with CL1-5/control cells, whereas the mean value for

Cancer Res 2006; 66: (5). March 1, 2006 2558 www.aacrjournals.org Knockdown of CNTN-1 Inhibits Metastasis mice injected with CL1-5/siRNA-2 cells was 5 metastatic lung siRNA-2/V14RhoA cells; Fig. 5D). The average numbers of visible nodules (difference = 33 nodules, 95% CI = 26 to 41 nodules; P < metastatic nodules in mice injected with A549/control/vector and 0.001). Suppression of CNTN-1 expression in CL1-5 and A549 cells A549/control/V14RhoA cells were 85.38 F 31.42 and 99.88 F 22.86 was therefore concluded to decrease the ability of these cells to (mean F SD), respectively. As shown in Fig. 5D, the average form metastatic nodules in the lungs. The mean weight of lungs number of metastatic nodules in mice injected with A549/siRNA-2/ from mice injected with A549/siRNA-2 cells was 440 mg, whereas vector was dramatically reduced compared with A549/control/ that from mice injected with A549/control vector control cells vector cells (85.38 F 31.42 for A549/control/vector cells versus was 552 mg (difference = 112 mg; 95% CI of the difference, 77-147 10.75 F 10.59 for A549/siRNA-2/vector cells; P < 0.001). This mg; P < 0.001). The mean weight of lungs from mice injected with reduction in number of metastatic nodules could be diminished CL1-5/siRNA-2 cells was 440 mg, whereas that from mice injected significantly by transfection with the V14RhoA expression vector with CL1-5/control vector control cells was 502 mg (difference = (10.75 F 10.59 for A549/siRNA-2/vector cells versus 51.25 F 36.66 62 mg; 95% CI of the difference, 26-97 mg; P = 0.001). Mean lung for A549/siRNA-2/V14RhoA cells; P = 0.01). Taken together, the weight was, therefore, decreased by 20.3% in mice injected with above findings strongly support a requirement for RhoA in CNTN- A549/siRNA-2 cells and by 12.4% in mice injected with CL1-5/ 1–mediated metastasis of lung adenocarcinoma cells in vivo. siRNA-2 cells compared with lung weights in mice injected with vector control cells. Data from these two experiments are Discussion summarized in Table 1. By using genome-wide cDNA microarray screening for invasion- Metastasis is believed to represent the factor most critical to associated genes, two potent metastasis suppressors were identi- mortality of cancer patients (1). As shown in Fig. 5B, the survival fied previously in this laboratory (14, 15). The present study, which time of mice injected with A549/siRNA-2 cells was 59.27 F 14.17 also used the screening approach, provides evidence that CNTN-1 F (mean SD) days and was significantly longer than that of mice is essential for the invasion and metastasis of human lung F injected with A549/control cells (43.87 10.95 days; P < 0.001, log- adenocarcinoma. CNTN-1 expression was shown to be associated rank test). Consistent with these findings, the survival time of mice with clinical metastasis and patient survival, and reduced CNTN-1 F injected with CL1-5/siRNA-2 cells was 64.93 8.27 days and was expression was found to be associated with the suppression of significantly longer than that of mice injected with CL1-5/control human lung cancer cell metastasis in a mouse model. Furthermore, F cells (53.60 13.83 days; P < 0.05, log-rank test). Suppression of one of the Rho family GTPases, RhoA, was found to be required CNTN-1 was therefore concluded to decrease the metastatic ability for CNTN-1–mediated invasion and metastasis of human lung of lung adenocarcinoma cells in vivo and to promote the survival adenocarcinoma. These findings not only serve to delineate a of tumor-bearing mice. The primary tumors formed from A549/ function for CNTN-1 in lung adenocarcinoma but also provide new control, A549/siRNA-2, CL1-5/control, or CL1-5/siRNA-2 cells were information regarding the mechanisms through which this type of collected, subjected to homogenization, and analyzed for expres- cancer becomes metastatic. sion of CNTN-1 protein and for RhoA activity. The expression of Human CNTN-1 is a member of the contactin subgroup of the CNTN-1 and the activity of RhoA in primary tumors formed from immunoglobulin superfamily. Other members of this family include A549/siRNA-2 and CL1-5/siRNA-2 cells were significantly higher contactin-2 (TAG-1), contactin-5 (NB-2), and contactin-6 (NB-3). than tumors from A549/control or CL1-5/control cells (Fig. 5C). The best-characterized function of these proteins is the repulsive To ascertain whether RhoA is critical for CNTN-1–mediated guidance of nerve axons, the molecular mechanism of which metastatic colonization, A549/control cells and A549/siRNA-2 cells remains to be characterized (28). CNTN-1 is a glycosyl phospha- were each stably transfected with V14RhoA expression vector or tidylinositol anchor neural cell adhesion molecule (NCAM) control vector (A549/control/vector, A549/control/V14RhoA, A549/ differentially expressed in numerous neuronal tissues and thought siRNA-2/vector, or A549/siRNA-2/V14RhoA) and evaluated in to function in nervous system development (29). CNTN-1 has been an in vivo experimental metastasis assay. Mice injected with observed to associate with other cell surface proteins believed A549/siRNA-2/vector cells exhibited a lower occurrence of lung to participate in various signal transduction pathways and cell metastases than did those injected with A549/control/vector cells. functions. CNTN-1 interacts in trans with the h-isoform of receptor This decreased occurrence in vivo was overturned significantly by protein tyrosine phosphatase (RPTP) to promote neurite out- expression of V14RhoA in the A549/siRNA-2 cells (50% occurrence growth (30) and in cis with the a-isoform of RPTP (31) to transduce for A549/siRNA-2/vector cells versus 87.5% occurrence for A549/ extracellular signals to Fyn kinase (32), a member of the Src kinase

Table 1. Suppression of metastasis by RNA interference of CNTN-1 expression in lung adenocarcinoma cells

Cell lines Lung weight Lung metastasis

Mean F SD; (mg) P No. mice with lung metastasis/total no. mice Mean of lung nodules/mouse (range) P

A549/control 552 F 51 14/15 44 (0-66) A549/siCNTN-1 440 F 42 <0.001* 4/15 5 (0-28) <0.001* CL1-5/control 502 F 52 15/15 38 (21-57) CL1-5/siCNTN-1 440 F 41 0.001* 5/15 5 (0-24) <0.001*

*A549/control vs A549/siCNTN-1; CL1-5/control vs CL1-5/siCNTN-1 (Student’s t test).

www.aacrjournals.org 2559 Cancer Res 2006; 66: (5). March 1, 2006 Cancer Research family that regulates cell mobility (33). The CNTN-1–associated be required for CNTN-1–mediated F-actin bundle formation, cell protein RPTPh has been reported to bind to a variety of cell invasion, and in vivo metastasis of lung adenocarcinoma cells. adhesion molecules and components of the extracellular matrix, Other investigators reported recently (25–27) that Rho-related such as NCAM and pleiotrophin (34). Interestingly, both RPTPA and GTPases can also regulate gene expression, often through the RPTPh interact with and regulate the tyrosine phosphorylation of activation of kinase cascades leading to enhanced activity of stress- catenins, proteins that are critical to physiologic and pathologic activated protein kinases, such c-Jun NH2-terminal kinase and p38 processes, such as cell migration, adhesion, and transformation mitogen-activated protein kinase, to alter cell survival. In the (34). The present study shows, for the first time, that the small present study, however, CNTN-1–mediated RhoA activation was GTPase called RhoA is a novel CNTN-1–associated protein observed to be essential to cell invasion but not to cell proliferation essential to CNTN-1–mediated invasion and metastasis of lung in an animal model (Fig. 4A). adenocarcinoma cells (Figs. 3 and 4). Whether the CNTN-1/RhoA Vinculin plays a central role in the mechanical coupling of complex also associates with other cell mobility-related proteins, integrins to the cytoskeleton as well as in the control of such as members of the Src kinase family or isoforms of RPTP, cytoskeletal mechanics, cell shape, and motility (44, 45). Paxillin, requires further investigation. which can interact with a variety of signaling proteins, is presumed Tumor metastasis could result from decreased expression of to be involved in several signaling pathways as well as in anchoring tumor suppressor genes, such as NM23, CRMP-1, and CTGF (14, 15, of the actin cytoskeleton (46). In the present study, knockdown of 35), and/or increased expression of metastasis-promoting genes, CNTN-1 expression resulted in significant changes in the such as CNTN-1. To ascertain whether suppression of CNTN-1 distribution of vinculin and paxillin concurrent with suppression increases the expression of potent suppressors of metastasis, the of cell invasion (Fig. 2C and D). Additional studies to ascertain expression of NM23, CRMP-1, and CTGF proteins in contactin-1/ whether selected integrins or other signaling proteins are involved siRNA-2 stably transfected A549 and CL1-5 cells was measured. in CNTN-1–induced macroaggregation of vinculin and paxillin in Stable expression of contactin-1/siRNA-2 did not affect nm23, lung adenocarcinoma cells should prove helpful in characterizing CRMP-1 or CTGF protein expression in either A549 cells or CL1-5 further the mechanisms underlying invasion by these cells. cells.8 Two in vivo models were used in this study: one is s.c. In the studies described in the present report, suppression of transplanted cancer cells in mice, another is i.v. injection of cancer CNTN-1 was shown not only to suppress the ability of lung cells into lateral tail vein of mice. Our data indicated that CNTN-1 adenocarcinoma cells to invade Matrigel in vitro but also to inhibit plays a critical role in metastasis of lung adenocarcinoma cells tumor metastasis strongly in an animal model. Regarding the through RhoA-dependent pathway. Otherwise, the animal models mechanisms through which CNTN-1 affects tumor invasion, RhoA we used in this study are not physiologic metastatic model, was observed to interact with CNTN-1 at the cell membrane and to and this is a weakness in our study. The surgical orthotopic play a critical role in CNTN-1-mediated invasion and metastasis. implantation is the more clinic-like metastasis model and may CNTN-1 was differentially expressed in tumor tissues, and its provide additional insights (36). expression was directly correlated with tumor stage, lymph node Rho proteins, including Cdc42, Rac1, and RhoA, are best metastasis, and patient survival. These findings are fully consistent characterized for their effects on the cytoskeleton and cell with involvement of CNTN-1 in the invasion and metastasis of adhesion. Because cell mobility is likely to be influenced by these lung adenocarcinoma cells. Further investigations are nonetheless effects, invasion and metastasis are also likely to be affected (37). required to characterize in full the mechanism(s) through which During stimulated migration of NIH3T3 cells, Cdc42 is activated CNTN-1 modulates carcinoma cell invasion and metastasis. and induces formation of thin protrusions rich in actin and known as microspikes or filopodia (38). Activation of Rac1 promotes formation of sheath-like protrusions termed lamellipodia to Acknowledgments promote an increase in cell mobility (39–41). In addition to Received 7/27/2005; revised 11/11/2005; accepted 12/14/2005. regulation of protrusive events, Cdc42 and Rac1 both promote Grant support: National Science Council, Taiwan grants NSC93-2323-B-002-007, NSC93-2320-B-002-019, NSC94-2323-B-002-212, and NSC95-2314-B-002-041 and Na- formation of the smaller focal complexes (39). Activation of RhoA is tional Taiwan University Hospital grant NTUH-93A15-3. recognized to mediate formation of stress fibers and focal contacts The costs of publication of this article were defrayed in part by the payment of page that firmly anchor cells to their substrata, permitting retraction of charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. cellular rear ends (42, 43). In the present study, RhoA was found to We thank Dr. Zee-Fen Chang (Institute of Biochemistry and Molecular Biology, College of Medicine, National Taiwan University, Taipei, Taiwan) for providing the GST-rhotekin and GST-PAK and guidance for the RhoA family GST pull-down assay and Dr. Tzuu-Shuh Jou (Graduate Institute of Clinical Medicine, College of Medicine, National Taiwan University) for providing constitutive activated V14RhoA, V12Rac1, 8 Unpublished observations. and V12Cdc42 expression vector.

References 4. Wewer UM, Liotta LA, Jaye M, et al. Altered levels of their invasive potential in severe combined immunode- laminin receptor mRNA in various human carcinoma ficient mice. Cancer Res 1993;53:417–22. 1. Yoshida BA, Sokoloff MM, Welch DR, Rinker-Schaeffe cells that have different abilities to bind laminin. Proc 7. Sreenath T, Matrisian LM, Stetler-Stevenson W, CW. Metastasis-suppressor genes: a review and per- Natl Acad Sci U S A 1986;83:7137–41. Gattoni-Celli S, Pozzatti RO. Expression of matrix spective on an emerging field. J Natl Cancer Inst 2000;92: 5. Albelda SM, Mette SA, Elder DE, et al. Integrin metalloproteinase genes in transformed rat cell lines 1717–30. distribution in malignant melanoma: association of of high and low metastatic potential. Cancer Res 1992; 2. Bishop JM. The molecular genetics of cancer. Science the beta 3 subunit with tumor progression. Cancer Res 52:4942–7. 1987;235:305–11. 1990;50:6757–64. 8. Birch M, Mitchell S, Hart IR. Isolation and character- 3. Fidler IJ, Radinsky R. Genetic control of cancer 6. Powell WC, Knox JD, Navre M, et al. Expression of the ization of human melanoma cell variants expressing metastasis. J Natl Cancer Inst 1990;82:166–8. metalloproteinase matrilysin in DU-145 cells increases high and low levels of CD44. Cancer Res 1991;51:6660–7.

Cancer Res 2006; 66: (5). March 1, 2006 2560 www.aacrjournals.org Knockdown of CNTN-1 Inhibits Metastasis

9. Harn HJ, Ho LI, Shyu RY, et al. Soluble CD44 isoforms ASK1/JNK-dependent signaling pathway in human 34. Beltran PJ, Bixby JL. Receptor protein tyrosine in serum as potential markers of metastatic gastric leukemia HL-60 cells. Carcinogenesis 2005;26:1–10. phosphatases as mediators of cellular adhesion. Front carcinoma. J Clin Gastroenterol 1996;22:107–10. 21. TravisWD,ColbyTV,CorrinB,ShimosatoY, Biosci 2003;8:d87–99. 10. Vleminckx K, Vakaet L, Jr., Mareel M, Fiers W, van Brambilla E. Histological typing of lung and pleural 35. Steeg PS, Bevilacqua G, Kopper L, et al. Evidence for a Roy F. Genetic manipulation of E-cadherin expression tumors, 3rd ed. Berlin: Springer; 1999. novel gene associated with low tumor metastatic by epithelial tumor cells reveals an invasion suppressor 22. Chen JJ, Peck K, Hong TM, et al. Global analysis of potential. J Natl Cancer Inst 1988;80:200–4. role. Cell 1991;66:107–19. gene expression in invasion by a lung cancer model. 36. Hoffman RM. Orthotopic metastasis mouse models 11. Liotta LA, Steeg PS, Stetler-Stevenson WG. Cancer Cancer Res 2001;61:5223–30. for anticancer drug discovery and evaluation: a bridge to metastasis and angiogenesis: an imbalance of positive 23. Chen JJ, Wu R, Yang PC, et al. Profiling expression clinic. Invest New Drugs 1999;17:343–59. and negative regulation. Cell 1991;64:327–36. patterns and isolating differentially expressed genes by 37. Hall A. Rho GTPases and the actin cytoskeleton. 12. Goldberg GI, Marmer BL, Grant GA, Eisen AZ, cDNA microarray system with colorimetry detection. Science 1998;279:509–14. Wilhelm S, He CS. Human 72-kilodalton type IV Genomics 1998;51:313–24. 38. Kozma R, Ahmed S, Best A, Lim L. The Ras-related collagenase forms a complex with a tissue inhibitor of 24. Cooper JA. The role of actin polymerization in cell protein Cdc42Hs and bradykinin promote formation of metalloproteases designated TIMP-2. Proc Natl Acad Sci motility. Annu Rev Physiol 1991;53:585–605. peripheral actin microspikes and filopodia in Swiss 3T3 U S A 1989;86:8207–11. 25. Sahai E, Marshall CJ. RHO-GTPases and cancer. Nat fibroblasts. Mol Cell Biol 1995;15:1942–52. 13. Kodera Y, Isobe K, Yamauchi M, et al. Expression of Rev Cancer 2002;2:133–42. 39. Nobes CD, Hall A. Rho, rac, and cdc42 GTPases nm23 H-1 RNA levels in human gastric cancer tissues. A 26. Itoh K, Yoshioka K, Akedo H, Uehata M, Ishizaki T, regulate the assembly of multimolecular focal com- negative correlation with nodal metastasis. Cancer 1994; Narumiya S. An essential part for Rho-associated kinase plexes associated with actin stress fibers, lamellipodia, 73:259–65. in the transcellular invasion of tumor cells. Nat Med and filopodia. Cell 1995;81:53–62. 14. Chang CC, Shih JY, Jeng YM, et al. Connective tissue 1999;5:221–5. 40. Chen HY, Shen CH, Tsai YT, Lin FC, Huang YP, Chen growth factor and its role in lung adenocarcinoma 27. Burridge K, Wennerberg K. Rho and Rac take center RH. Brk activates rac1 and promotes cell migration and invasion and metastasis. J Natl Cancer Inst 2004;96: stage. Cell 2004;116:167–79. invasion by phosphorylating paxillin. Mol Cell Biol 2004; 364–75. 28. Reid RA, Bronson DD, Young KM, Hemperly JJ. 24:10558–72. 15. Shih JY, Yang SC, Hong TM, et al. Collapsin Identification and characterization of the human cell 41. Ridley AJ, Paterson HF, Johnston CL, Diekmann D, response mediator protein-1 and the invasion and adhesion molecule contactin. Brain Res Mol Brain Res Hall A. The small GTP-binding protein rac regulates metastasis of cancer cells. J Natl Cancer Inst 2001;93: 1994;21:1–8. growth factor-induced membrane ruffling. Cell 1992;70: 1392–400. 29. Revest JM, Faivre-Sarrailh C, Maeda N, Noda M, 401–10. 16. Garber ME, Troyanskaya OG, Schluens K, et al. Schachner M, Rougon G. The interaction between F3 42. Ridley AJ, Hall A. The small GTP-binding protein rho Diversity of gene expression in adenocarcinoma of the immunoglobulin domains and protein tyrosine phospha- regulates the assembly of focal adhesions and actin lung. Proc Natl Acad Sci U S A 2001;98:13784–9. tases zeta/beta triggers bidirectional signalling between stress fibers in response to growth factors. Cell 1992;70: 17. Bhattacharjee A, Richards WG, Staunton J, et al. neurons and glial cells. Eur J Neurosci 1999;11:1134–47. 389–99. Classification of human lung carcinomas by mRNA 30. Sakurai T, Lustig M, Nativ M, et al. Induction of 43. Hotchin NA, Hall A. The assembly of integrin expression profiling reveals distinct adenocarcinoma neurite outgrowth through contactin and Nr-CAM by adhesion complexes requires both extracellular matrix subclasses. Proc Natl Acad Sci U S A 2001;98:13790–5. extracellular regions of glial receptor tyrosine phospha- and intracellular rho/rac GTPases. J Cell Biol 1995;131: 18. Su JL, Shih JY, Yen ML, et al. Cyclooxygenase-2 tase beta. J Cell Biol 1997;136:907–18. 1857–65. induces EP1- and HER-2/Neu-dependent vascular en- 31. Zeng L, D’Alessandri L, Kalousek MB, Vaughan L, 44. Samuels M, Ezzell RM, Cardozo TJ, Critchley DR, Coll dothelial growth factor-C up-regulation: a novel mech- Pallen CJ. Protein tyrosine phosphatase alpha (PTPal- JL, Adamson ED. Expression of chicken vinculin anism of lymphangiogenesis in lung adenocarcinoma. pha) and contactin form a novel neuronal receptor complements the adhesion-defective phenotype of a Cancer Res 2004;64:554–64. complex linked to the intracellular tyrosine kinase fyn. mutant mouse F9 embryonal carcinoma cell. J Cell Biol 19. Lin MT, Yen ML, Lin CY, Kuo ML. Inhibition of J Cell Biol 1999;147:707–14. 1993;121:909–21. vascular endothelial growth factor-induced angiogenesis 32. Umemori H, Sato S, Yagi T, Aizawa S, Yamamoto T. 45. Coll JL, Ben-Ze’ev A, Ezzell RM, et al. Targeted by resveratrol through interruption of Src-dependent Initial events of myelination involve Fyn tyrosine kinase disruption of vinculin genes in F9 and embryonic stem vascular endothelial cadherin tyrosine phosphorylation. signalling. Nature 1994;367:572–6. cells changes cell morphology, adhesion, and locomo- Mol Pharmacol 2003;64:1029–36. 33. Huang J, Asawa T, Takato T, Sakai R. Cooperative tion. Proc Natl Acad Sci U S A 1995;92:9161–5. 20. Su JL, Lin MT, Hong CC, et al. Resveratrol induces roles of Fyn and cortactin in cell migration of metastatic 46. Schaller MD. Paxillin: a focal adhesion-associated FasL-related apoptosis through Cdc42 activation of murine melanoma. J Biol Chem 2003;278:48367–76. adaptor protein. Oncogene 2001;20:6459–72.

www.aacrjournals.org 2561 Cancer Res 2006; 66: (5). March 1, 2006