DOCSLIB.ORG

7 X 11.5 Three Lines.P65

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
7 X 11.5 Three Lines.P65 Cambridge University Press 978-0-521-85447-4 - The Vector- and Rodent-Borne Diseases of Europe and North America: Their Distribution and Public Health Burden Norman G. Gratz Index More information Index Note: page numbers in italics refer to figures acrodermatitis chronica atrophicans 111, Afghanistan, malaria 44--5 122--3 African horse sickness 74 Aedes African tick bite fever 134 dengue virus 30--1, 32 agricultural practices, changes 160 dirofilariasis 212 aircraft Inkoo virus 27 disinfection 271--2 Jamestown Canyon virus 203--4 introduced vectors 271--2, 273 La Cross encephalitis 204--5 airport malaria 34--5, 49--51, 271--2, 273 Ockelbo virus 25 Albania snowshoe hare virus 205--6 Crimean--Congo Haemorrhagic fever 106 Tahyna virus 28 leishmaniasis 58--9 West Nile Virus 13--14, 19, 202 West Nile Virus 11--12 Aedes aegypti 8 alcoholic people, trench fever 85--6, 229--30 Americas 186, 195, 197 allergens/allergies importation 185, 276 chironomid haemoglobins 74 eradication 195 cockroaches 154--5, 267--8 Aedes albopictus midges 74 climate change impact 271 horses 216 control in Italy 180 mites 151--3, 262--6 introduction to Europe 156--7 tick 158 USA 197 Alphavirus 191--5 introduction 271--3, 276 Amblyomma americanum 245, 246, 248, 251 Aedes atropalpus 157 tick paralysis 257--8 Aedes bahamensis 273 tularaemia 257 Aedes japonicus 157 Amblyomma maculatum 257--8 introduction to US 272, 273 Americas Aedes taeniorhynchus 194 arboviruses 185--7 dirofilariasis 212 dengue 186 Aedes togoi 273 epidemic typhus 187 370 © Cambridge University Press www.cambridge.org Cambridge University Press 978-0-521-85447-4 - The Vector- and Rodent-Borne Diseases of Europe and North America: Their Distribution and Public Health Burden Norman G. Gratz Index More information Index 371 malaria 188--9 Argas cooleyi 236 plague 187 Argas reflexus 158 Rocky Mountain spotted fever 188 arthritis, Lyme 111, 116, 130--1, 240 yellow fever 185--6 Arvicola terrestris 174 see also Canada; United States asthma Ammospermophilus leucurus 223 chironomid haemoglobin allergens 74 Anaplasma 140--1 cockroach allergens 154, 267--8 Anaplasma phagocytophila 249, 251, 307--8 house dust mites 151, 263, 264--6 angiomatosis, bacillary 227 treatment 152--3 Anopheles Austria airport malaria 34--5 Lyme disease 114 dirofilariasis 212 malaria 38 introduction to North America 276 post-encephalitic syndrome 178 Jamestown Canyon virus 203--4 tick-borne encephalitis 92, 178 malaria in USA 207--8 Usutu virus 28--9, 307 West Nile Virus 16 West Nile Virus 12 Anopheles atroparvus 37, 44 Anopheles gambiae 271 Babesia 144--6, 253--5 Anopheles labranchiae 36, 37, 160 deer tick density 160 Anopheles maculipennis 45 public health importance 145--6, 255 Anopheles messae 45 reservoir hosts 254 Anopheles quadrimaculatus 212 tick vectors 145, 160, 255 Anopheles sacharovi 44 bacillary angiomatosis 227 Apodemus agrarius 164 bacterial infections Dobrava virus 167--8 rodent-borne 169--72 hantaviruses 284 tick-borne Saaremaa virus 168 Americas 239--52 Apodemus flavicollis 114 Europe 110 Dobrava virus 167--8 see also named diseases hantaviruses 164 baggage malaria 36 Lyme disease 119, 123, 128, Balkans, hantaviruses 167 132 Bartonella 81 Apodemus sylvaticus 102, 109 Bartonella elizabethae 229--30 Dobrava virus 167--8 Bartonella henselae 81--2, 226--7, 229--30 Lyme disease 119 Bartonella quintana 84--5, 229--30 arboviruses burden of disease 308 Americas 185--7 Batai virus 24 Canada 190--206, 276 Bayou virus 283 climate change impact 271 bears, trichinosis 296 costs associated with 177--8, 298--302 Belarus Europe 7--8, 9 tick-borne encephalitis 92 mosquito-borne 190--206 West Nile Virus 12--13 USA 190--206, 276 Belgium arenaviruses 286--9 airport malaria 34 lymphocytic choriomeningitis virus 168 hantavirus 166 © Cambridge University Press www.cambridge.org Cambridge University Press 978-0-521-85447-4 - The Vector- and Rodent-Borne Diseases of Europe and North America: Their Distribution and Public Health Burden Norman G. Gratz Index More information 372 Index Belgium (cont.) Italy 126 Lyme disease 114--15 Poland 128 malaria 38--9 Slovenia 130 Bhanja virus 107--8 Spain 131 biological warfare 256 Sweden 132 Biorat 172, 293 UK 133 bioterrorism 275 Borrelia burgdorferi 111--33 plague 224 Babesia co-infection 253, 254 tularaemia 256, 257 control costs 303 birds genospecies 112 domestic 194 Belgium 115 Highlands J virus 194 Croatia 117 Lyme disease 123, 128, 130, 244 Czech Republic 117--18 migrating France 120--1 Lyme disease 244 Germany 124 Ockelbo virus 24--5 Italy 126 Sindbis virus 20--1 Poland 128 tick introductions 158, 275 Slovenia 130 Usutu virus 20--1 Spain 131 West Nile Virus 10, 15--16, 17, 19, 20--1 Sweden 132 European spread 22--3 UK 133 Ockelbo virus 26 incidence 307 St Louis encephalitis 198 North America 240--5 Sindbis virus 20--1 Borrelia burgdorferi s. l. 130, 131, 132, 133 Usutu virus 20--1, 28--30, 307 Borrelia burgdorferi s. str. 126, 128, 130, 132, West Nile Virus 16, 19, 20--2, 199, 200--1 133 Western equine encephalitis 191 Borrelia garinii Black Creek Canal virus 283, 285 Belgium 115 black death 5 Croatia 117 blackflies, simuliids 212 Czech Republic 117--18 Blatella germanica 154 France 120--1 Blatta latteralis 274 Germany 124 Blatta orientalis 154 Italy 126 blepharoconjunctivitis 88 Poland 128 Bloma tropicalis 262 Slovenia 130 bluetongue 74, 216 Spain 131 Bornholm island, tick-borne encephalitis 95 Sweden 132 Borrelia, tick-borne relapsing fever 110 UK 133 Borrelia afzelii Borrelia hermsii 239 Belgium 115 Borrelia lonestari 245, 246 Croatia 117 Borrelia lusitaniae 131 Czech Republic 117--18 Borrelia parkeri 239 France 120--1 Borrelia recurrentis 86 Germany 124 Borrelia turicatae 239 © Cambridge University Press www.cambridge.org Cambridge University Press 978-0-521-85447-4 - The Vector- and Rodent-Borne Diseases of Europe and North America: Their Distribution and Public Health Burden Norman G. Gratz Index More information Index 373 Borrelia valaisiana 124, 126, 131, 132, 133 introduced vectors 271--8 boutonneuse fever 134--5 Jamestown Canyon virus 204 burden of disease 307--8 leptospirosis 290--1 public health importance 135 louse-borne diseases 303 Brazil Lyme disease 240--5, 270, 303--4 Anopheles gambiae introduction 271 malaria 188--9, 207--10, 276 dengue virus 31 imported cases 209, 302 Brill--Zinsser disease 84 mite allergies 262--3 bugs, hemipteran 233--5 mosquito control costs 304--5 Bulgaria mosquito-borne infections airport malaria 34--5 arboviruses 190--206 Crimean--Congo Haemorrhagic fever filarial 211--13 106--7 malaria 188--9, 207--9, 210, 276, 302 Lyme disease 115--16 myiasis 219 trichinosis 175 nematode infections 296 West Nile Virus 13 plague 220--4 Bunyaviridae 202--6 Powassan virus 238 public health importance Cache Valley virus 202--3 arboviruses 206 California encephalitis complex 27, 28 malaria 209--10 Calovo virus see Batai virus Qfever252 Canada 1, 269 rat-bite fever 291--2 arboviruses 190--206 Rift Valley fever introduction 276--8 costs associated with 298--302 Rocky Mountain spotted fever 248, 249 introduction 276 rodent-borne disease 279--97 arenaviruses 286--9 St Louis encephalitis 198 babesiosis 254 salmonellosis 292, 293 biting midge-borne diseases 216 sandfly-borne phleboviruses 214--15 cestodes 294--5 scabies 261, 303 climate change 270--1 snowshoe hare virus 205--6 cockroach allergies 267--8 tick paralysis 257--8 dengue 196, 301--2 tick-borne diseases introduction 276 bacterial 239--52 dirofilariasis 212 burden 307--8 disease burden 306--9 toxoplasmosis 293--4 ecological change 269--70 trench fever 230 economic impact of disease 298--305 tularaemia 256, 257 ehrlichiosis 250--1 West Nile virus 199--202, 275--6 filarial infections 211--13 burden of disease 306--7 flea-borne disease 220--7 economic costs 300--1 hantaviruses 279--86 Canis aureus 295 house dust mite 264 Canis lupus 295 allergies 266 Canis lupus dingo 295 hydatid disease 295--6 Canis lutrans 215, 295 © Cambridge University Press www.cambridge.org Cambridge University Press 978-0-521-85447-4 - The Vector- and Rodent-Borne Diseases of Europe and North America: Their Distribution and Public Health Burden Norman G. Gratz Index More information 374 Index Capreolus capreolus Lyme disease 241 Lyme disease 119, 127 plague 222--3 tick-borne encephalitis 94, 95 Powassan virus 238 cats Sin nombre virus 285 B. henselae prevalence 81--2 Chironomidae 74 dirofilariasis 211, 212 Chlamydia, pubic louse infestation 88, hydatid disease 295 231 leptospirosis hosts 290 Chrysomya megacephala 274 murine typhus 224--5 Chrysops discalis 255, 257 plague 223 tularaemia 147 toxoplasmosis 172, 293 Clethrionomys cat scratch disease 81--2, 226--7 echinococcosis 174 cattle hantaviruses 164, 165--6 bluetongue 216 Lyme disease 114, 119, 123, 128, Lyme disease 123 132 Qfever141 Puumala virus 164, 168 West Nile Virus 16 tick-borne encephalitis 91, central nervous system (CNS) disease see 102 encephalitis; meningitis; climate change 1, 270--1, 308--9 meningoencephalitis; leishmaniasis 72 tick-borne encephalitis (TBE) range 61 Ceratopogonidae 74, 216 Lyme disease 132 Cervus elaphus 119 tick-borne encephalitis 94, 105 cestodes, rodent-borne infections 173--5, vector-borne diseases in Europe 161--2 294--5 clinical symptoms/conditions 269 Chagas disease 233--5 Cochliomyia hominovorax 217 reservoir hosts 234--5 introduction to USA 271--2, 274 vectors 234 cockroaches 154--5, 267--8 children introduction abuse 88 to Europe 158 cockroach allergies 267 to USA 274 head lice 86--7 public health impact 268 leishmaniasis 60, 63, 64, 66, 67 co-infections 1
Load more

Recommended publications
  • Hantavirus Disease Were HPS Is More Common in Late Spring and Early Summer in Seropositive in One Study in the U.K
    Hantavirus Importance Hantaviruses are a large group of viruses that circulate asymptomatically in Disease rodents, insectivores and bats, but sometimes cause illnesses in humans. Some of these agents can occur in laboratory rodents or pet rats. Clinical cases in humans vary in Hantavirus Fever, severity: some hantaviruses tend to cause mild disease, typically with complete recovery; others frequently cause serious illnesses with case fatality rates of 30% or Hemorrhagic Fever with Renal higher. Hantavirus infections in people are fairly common in parts of Asia, Europe and Syndrome (HFRS), Nephropathia South America, but they seem to be less frequent in North America. Hantaviruses may Epidemica (NE), Hantavirus occasionally infect animals other than their usual hosts; however, there is currently no Pulmonary Syndrome (HPS), evidence that they cause any illnesses in these animals, with the possible exception of Hantavirus Cardiopulmonary nonhuman primates. Syndrome, Hemorrhagic Nephrosonephritis, Epidemic Etiology Hemorrhagic Fever, Korean Hantaviruses are members of the genus Orthohantavirus in the family Hantaviridae Hemorrhagic Fever and order Bunyavirales. As of 2017, 41 species of hantaviruses had officially accepted names, but there is ongoing debate about which viruses should be considered discrete species, and additional viruses have been discovered but not yet classified. Different Last Updated: September 2018 viruses tend to be associated with the two major clinical syndromes in humans, hemorrhagic fever with renal syndrome (HFRS) and hantavirus pulmonary (or cardiopulmonary) syndrome (HPS). However, this distinction is not absolute: viruses that are usually associated with HFRS have been infrequently linked to HPS and vice versa. A mild form of HFRS in Europe is commonly called nephropathia epidemica.
    [Show full text]
  • Hantavirus Infection: a Global Zoonotic Challenge
    VIROLOGICA SINICA DOI: 10.1007/s12250-016-3899-x REVIEW Hantavirus infection: a global zoonotic challenge Hong Jiang1#, Xuyang Zheng1#, Limei Wang2, Hong Du1, Pingzhong Wang1*, Xuefan Bai1* 1. Center for Infectious Diseases, Tangdu Hospital, Fourth Military Medical University, Xi’an 710032, China 2. Department of Microbiology, School of Basic Medicine, Fourth Military Medical University, Xi’an 710032, China Hantaviruses are comprised of tri-segmented negative sense single-stranded RNA, and are members of the Bunyaviridae family. Hantaviruses are distributed worldwide and are important zoonotic pathogens that can have severe adverse effects in humans. They are naturally maintained in specific reservoir hosts without inducing symptomatic infection. In humans, however, hantaviruses often cause two acute febrile diseases, hemorrhagic fever with renal syndrome (HFRS) and hantavirus cardiopulmonary syndrome (HCPS). In this paper, we review the epidemiology and epizootiology of hantavirus infections worldwide. KEYWORDS hantavirus; Bunyaviridae, zoonosis; hemorrhagic fever with renal syndrome; hantavirus cardiopulmonary syndrome INTRODUCTION syndrome (HFRS) and HCPS (Wang et al., 2012). Ac- cording to the latest data, it is estimated that more than Hantaviruses are members of the Bunyaviridae family 20,000 cases of hantavirus disease occur every year that are distributed worldwide. Hantaviruses are main- globally, with the majority occurring in Asia. Neverthe- tained in the environment via persistent infection in their less, the number of cases in the Americas and Europe is hosts. Humans can become infected with hantaviruses steadily increasing. In addition to the pathogenic hanta- through the inhalation of aerosols contaminated with the viruses, several other members of the genus have not virus concealed in the excreta, saliva, and urine of infec- been associated with human illness.
    [Show full text]
  • The Ecology of New World Rodent Borne Hemorrhagic Fevers
    THE ECOLOGY OF NEW WORLD RODENT BORNE HEMORRHAGIC FEVERS DARJN S. CARROLL , Centers for Disease Control and Prevention , National Centers for Infectious Diseases , Special Pathogens Branch , Atlanta , GA 30333 , USA EMILY JENTES , Centers for Disease Control and Prevention , National Centers for Infectious Diseases , Special Pathogens Branch , Atlanta , GA 30333, USA JAMES N. MILLS , Centers for Disease Control and Prevention , National Centers for Infectious Diseases, Special Pathogens Branch , Atlanta , GA 30333 , USA Abstract: Few, if any, human settlements are free of peridomestic rodent populations. The threat of rodent borne zoonotic diseases has been widely recognized since the bubonic plague outbreaks of the Middle Ages . In the last decades, outbreaks of human disease caused by the rodent borne hemorrhagic fever viruses , the arenaviruses (family Arenaviridae), and the hantaviruses (family Bunyaviridae, genus Hantaviru s) have again generated interest in the general public and scientific community regarding the biology of these types of diseases. Recent studie s have identified more than 30 new members of these two groups of viruses. Most are associated with rodents in the family Muridae and many are known to be pathogenic. Ongoing studies are investigating aspects of the ecology and systematics of these viruses and their reservoirs . Ecological studies are currently examining modes of transmission between members of the host species , and environmental factors associated with increased frequency of infection. Systematic research is identifying patterns of co-evolution between the viruses and their hosts. The overall goal of these research efforts is develop predictive models that will identify times and places of increased risk and. therefore provide an opportunity for risk reduction in these areas.
    [Show full text]
  • Mouse Anti-HFRS Virus, Hanta Strain Monoclonal Antibody
    SPECIFICATION SHEET Rev 110621MAB-S0006 Mouse Anti-HFRS Virus, Hanta strain Monoclonal Antibody Mouse, Monoclonal (HFRS Virus, Hanta strain) Cat. No. DMAB3487 Lot. No. (See product label) PRODUCT INFORMATION BACKGROUND Introduction: Hantaviruses (family Bunyaviridae, genus Han- Product Overview: Monoclonal Antibody to Hemorrhagic tavirus) are rodent-borne, zoonotic (acquired from animals), fever with renal syndrome (HFRS) Virus, Hanta Strain enveloped RNA viruses, and include the causative agents of Specificity: Specific for HFRS Virus. Strain: Hanta haemorrhagic fever with renal syndrome (HFRS). The viruses Immunogen: Inactivated virus particles that cause HFRS include Hanta, Dobrava, Seoul, and Puu- Clone: C963M mala. Dobrova and Hanta viruses cause a more severe HFRS Isotype: IgG1 with fever, haemorrhage, and renal failure, and a mortality rate Host animal: Mouse. Hybridization of Sp2/0 myeloma cells of up to 15%. The mildest form of HFRS is caused by Puu- with spleen cells from BALB/c mice. mala virus. Source: Ascites Keywords: Hemorrhagic fever with renal syndrome Virus; Format: Purified, Liquid HFRS virus, Hanta strain; HFRS virus; Hemorrhagic fever with Applications: Suitable for use in ELISA. Each laboratory renal syndrome Virus, Hanta strain; Hantaviruses; Bunyaviri- should determine an optimum working titer for use in its par- dae; Hantavirus; Hemorrhagic fever with renal syndrome Vi- ticular application. Other applications have not been tested rus; HFRS Virus Dobrava, Puumala, Hanta and Seoul Strains; but use in such assays
    [Show full text]
  • Ecology of Neglected Rodent-Borne American Orthohantaviruses
    pathogens Review Ecology of Neglected Rodent-Borne American Orthohantaviruses Nathaniel Mull 1,*, Reilly Jackson 1, Tarja Sironen 2,3 and Kristian M. Forbes 1 1 Department of Biological Sciences, University of Arkansas, Fayetteville, AR 72701, USA; [email protected] (R.J.); [email protected] (K.M.F.) 2 Department of Virology, University of Helsinki, 00290 Helsinki, Finland; Tarja.Sironen@helsinki.fi 3 Department of Veterinary Biosciences, University of Helsinki, 00790 Helsinki, Finland * Correspondence: [email protected] Received: 9 April 2020; Accepted: 24 April 2020; Published: 26 April 2020 Abstract: The number of documented American orthohantaviruses has increased significantly over recent decades, but most fundamental research has remained focused on just two of them: Andes virus (ANDV) and Sin Nombre virus (SNV). The majority of American orthohantaviruses are known to cause disease in humans, and most of these pathogenic strains were not described prior to human cases, indicating the importance of understanding all members of the virus clade. In this review, we summarize information on the ecology of under-studied rodent-borne American orthohantaviruses to form general conclusions and highlight important gaps in knowledge. Information regarding the presence and genetic diversity of many orthohantaviruses throughout the distributional range of their hosts is minimal and would significantly benefit from virus isolations to indicate a reservoir role. Additionally, few studies have investigated the mechanisms underlying transmission routes and factors affecting the environmental persistence of orthohantaviruses, limiting our understanding of factors driving prevalence fluctuations. As landscapes continue to change, host ranges and human exposure to orthohantaviruses likely will as well. Research on the ecology of neglected orthohantaviruses is necessary for understanding both current and future threats to human health.
    [Show full text]
  • (12) Patent Application Publication (10) Pub. No.: US 2013/0267429 A1 GARDNER Et Al
    US 20130267,429A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2013/0267429 A1 GARDNER et al. (43) Pub. Date: Oct. 10, 2013 (54) BIOLOGICAL SAMPLE TARGET (60) Provisional application No. 61/628.224, filed on Oct. CLASSIFICATION, DETECTION AND 26, 2011. SELECTION METHODS, AND RELATED ARRAYS AND OLGONUCLEOTIDE PROBES (71) Applicant: Lawrence Livermore National Publication Classification Security, LLC, Livermore, CA (US) (51) Int. Cl. (72) Inventors: Shea GARDNER, Oakland, CA (US); G06F 9/20 (2006.01) CrystalKevin MCLOUGHILIN, J. JAING, Livermore, Oakland, CA CA(US); (52) s g4. (2006.01) US):A ity's Th SLEZAK. issurancisco, San Franci CPCAV e. we.............. G06F 19/20 (2013.01): CI2O 1/6876 Alameda, CA (US); Marisa Wailam (2013.01) TORRES, Pleasanton, CA (US) USPC ................................................. 506/8:506/16 (21) Appl. No.: 13/886,172 (22) Filed: May 2, 2013 (57) ABSTRACT Related U.S. Application Data (63) Continuation-in-part of application No. 13/304.276, Biological sample target classification, detection and selec filed on Nov. 23, 2011, which is a continuation-in-part tion methods are described, together with related arrays and of application No. 12/643,903, filed on Dec. 21, 2009. oligonucleotide probes. Patent Application Publication Oct. 10, 2013 Sheet 1 of 19 US 2013/0267429 A1 All Filter With genomes Vmatch to in family, reOWe as of nonspecific Family specific April 2007 regions & 17 nt regions only >g1 . > 25 nt (bacterial AATCCTGACAGGGACAG and human) >g 1 >g2 AATCCTGACAGGGACAGTTT, ........... G AGCAAAAACAAGCAGTT >g 2 >g3 AGCAA, , , ..., , , , , , , , , , ... AGTGACAGTCAT. GGGGTCAAACGGGAG >g3 A. GGGGCAATACTGGGA., , , , , , , , ACCCTA >g4 -as-a-do A.
    [Show full text]
  • EMERGING INFECTIOUS DISEASES Volume 5 • Number 1 January–February 1999
    Contents EMERGING INFECTIOUS DISEASES Volume 5 Number 1 JanuaryFebruary 1999 International Update Hantavirus Emerging Viral Diseases: An Australian Perspective* 1 Long-Term Studies of Hantavirus 95 J. S. Mackenzie Reservoir Populations in the Southwestern United States: Rationale, Perspectives Potential, and Methods The Economic Impact of Staphylococcus 9 J.N. Mills,T.L. Yates, T.G. Ksiazek, aureus Infection in New York City Hospitals C.J. Peters, and J.E. Childs R.J. Rubin, C.A. Harrington, A. Poon, Long-Term Hantavirus Persistence 102 K. Dietrich, J.A. Greene, and A. Moiduddin in Rodent Populations in Central Arizona Socioeconomic and Behavioral Factors 18 K.D. Abbott, T.G. Ksiazek, and J.N. Mills Leading to Acquired Bacterial Resistance A Longitudinal Study of Sin Nombre 113 to Antibiotics in Developing Countries Virus Prevalence in Rodents, I.N. Okeke, A.Lamikanra, and R. Edelman Southeastern Arizona Campylobacter jejuniAn Emerging 28 A.J. Kuenzi, M.L. Morrison, D.E. Foodborne Pathogen Swann, P.C. Hardy, and G.T. Downard S.F. Altekruse, N.J. Stern, Statistical Sensitivity for Detection of 118 P.I. Fields, and D.L. Swerdlow Spatial and Temporal Patterns in Rodent Population Densities Synopses C.A. Parmenter, T.L. Yates, R.R. Comparative Genomics and Host 36 Parmenter, and J.L. Dunnum Resistance against Infectious Diseases Natural History of Sin Nombre 126 S. T. Qureshi, E. Skamene, and D. Malo Virus in Western Colorado Cyclospora: An Enigma Worth Unraveling 48 C.H. Calisher, W. Sweeney, J.N. Mills, and B.J. Beaty C.R. Sterling and Y.R. Ortega Using Monoclonal Antibodies to 54 Long-Term Studies of Hantavirus 135 Prevent Mucosal Transmission Reservoir Populations in the of Epidemic Infectious Diseases Southwestern United States: A Synthesis J.N.
    [Show full text]
  • Hantaviridae: Current Classification and Future Perspectives
    viruses Article Hantaviridae: Current Classification and Future Perspectives Lies Laenen 1,2 , Valentijn Vergote 1, Charles H. Calisher 3, Boris Klempa 4, Jonas Klingström 5 , Jens H. Kuhn 6 and Piet Maes 1,* 1 KU Leuven, Department of Microbiology and Immunology, Rega Institute for Medical Research, Zoonotic Infectious Diseases Unit, 3000 Leuven, Belgium 2 Department of Laboratory Medicine, University Hospitals Leuven, 3000 Leuven, Belgium 3 Colorado State University, Fort Collins, CO 80523, USA 4 Biomedical Research Center, Slovak Academy of Sciences, 845 05 Bratislava, Slovakia 5 Center for Infectious Medicine, Department of Medicine Huddinge, Karolinska Institutet, Karolinska University Hospital, SE-141 86 Stockholm, Sweden 6 Integrated Research Facility at Fort Detrick, National Institute of Allergy and Infectious Diseases, National Institutes of Health, B-8200 Research Plaza, Frederick, MD 21702, USA * Correspondence: [email protected]; Tel.: +32-16-321309 Received: 10 August 2019; Accepted: 23 August 2019; Published: 27 August 2019 Abstract: In recent years, negative-sense RNA virus classification and taxon nomenclature have undergone considerable transformation. In 2016, the new order Bunyavirales was established, elevating the previous genus Hantavirus to family rank, thereby creating Hantaviridae. Here we summarize affirmed taxonomic modifications of this family from 2016 to 2019. Changes involve the admission of >30 new hantavirid species and the establishment of subfamilies and novel genera based on DivErsity pArtitioning by hieRarchical Clustering (DEmARC) analysis of genomic sequencing data. We outline an objective framework that can be used in future classification schemes when more hantavirids sequences will be available. Finally, we summarize current taxonomic proposals and problems in hantavirid taxonomy that will have to be addressed shortly.
    [Show full text]
  • Qualitative and Quantitative Assessment of the “Dangerous
    Center for International and Security Studies at Maryland1 Qualitative and Quantitative Assessment of the “Dangerous Activities” Categories Jens H. Kuhn July 2005 CISSM School of Public Policy This paper was prepared as part of the Advanced Methods of Cooperative Security Program at the Center 4113 Van Munching Hall for International and Security Studies at Maryland, with generous support from the MacArthur Foundation University of Maryland and the Sloan Foundation. College Park, MD 20742 Tel: (301) 405-7601 [email protected] 2 QUALITATIVE AND QUANTITATIVE ASSESSMENT OF THE “DANGEROUS ACTIVITIES” CATEGORIES DEFINED BY THE CISSM CONTROLLING DANGEROUS PATHOGENS PROJECT WORKING PAPER (July 31, 2005) Jens H. Kuhn, MD, ScD (Med. Sci.), MS (Biochem.) Contact Address: New England Primate Research Center Department of Microbiology and Molecular Genetics Harvard Medical School 1 Pine Hill Drive Southborough, MA 01772-9102, USA Phone: (508) 786-3326 Fax: (508) 786-3317 Email: [email protected] 3 OBJECTIVE The Controlling Dangerous Pathogens Project of the Center for International Security Studies at Maryland (CISSM) outlines a prototype oversight system for ongoing microbiological research to control its possible misapplication. This so-called Biological Research Security System (BRSS) foresees the creation of regional, national, and international oversight bodies that review, approve, or reject those proposed microbiological research projects that would fit three BRSS-defined categories: Potentially Dangerous Activities (PDA), Moderately Dangerous Activities (MDA), and Extremely Dangerous Activities (EDA). It is the objective of this working paper to assess these categories qualitatively and quantitatively. To do so, published US research of the years 2000-present (early- to mid-2005) will be screened for science reports that would have fallen under the proposed oversight system had it existed already.
    [Show full text]
  • Qualitative and Quantitative Assessment of the "Dangerous
    Center for International and Security Studies at Maryland1 Qualitative and Quantitative Assessment of the “Dangerous Activities” Categories Jens H. Kuhn July 2005 CISSM School of Public Policy This paper was prepared as part of the Advanced Methods of Cooperative Security Program at the Center 4113 Van Munching Hall for International and Security Studies at Maryland, with generous support from the MacArthur Foundation University of Maryland and the Sloan Foundation. College Park, MD 20742 Tel: (301) 405-7601 [email protected] 2 QUALITATIVE AND QUANTITATIVE ASSESSMENT OF THE “DANGEROUS ACTIVITIES” CATEGORIES DEFINED BY THE CISSM CONTROLLING DANGEROUS PATHOGENS PROJECT WORKING PAPER (July 31, 2005) Jens H. Kuhn, MD, ScD (Med. Sci.), MS (Biochem.) Contact Address: New England Primate Research Center Department of Microbiology and Molecular Genetics Harvard Medical School 1 Pine Hill Drive Southborough, MA 01772-9102, USA Phone: (508) 786-3326 Fax: (508) 786-3317 Email: [email protected] 3 OBJECTIVE The Controlling Dangerous Pathogens Project of the Center for International Security Studies at Maryland (CISSM) outlines a prototype oversight system for ongoing microbiological research to control its possible misapplication. This so-called Biological Research Security System (BRSS) foresees the creation of regional, national, and international oversight bodies that review, approve, or reject those proposed microbiological research projects that would fit three BRSS-defined categories: Potentially Dangerous Activities (PDA), Moderately Dangerous Activities (MDA), and Extremely Dangerous Activities (EDA). It is the objective of this working paper to assess these categories qualitatively and quantitatively. To do so, published US research of the years 2000-present (early- to mid-2005) will be screened for science reports that would have fallen under the proposed oversight system had it existed already.
    [Show full text]
  • Hantavirus Reservoirs: Current Status with an Emphasis on Data from Brazil
    Viruses 2014, 6, 1929-1973; doi:10.3390/v6051929 OPEN ACCESS viruses ISSN 1999-4915 www.mdpi.com/journal/viruses Review Hantavirus Reservoirs: Current Status with an Emphasis on Data from Brazil Renata Carvalho de Oliveira 1,*, Alexandro Guterres 1, Jorlan Fernandes 1, Paulo Sérgio D’Andrea 2, Cibele Rodrigues Bonvicino 2,3 and Elba Regina Sampaio de Lemos 1 1 Laboratório de Hantaviroses e Rickettsioses, Instituto Oswaldo Cruz, Fundação Oswaldo Cruz, Rio de Janeiro, 21040-360, RJ, Brazil; E-Mails: [email protected] (A.G.); [email protected] (J.F.); [email protected] (E.R.S.L.) 2 Laboratório de Biologia e Parasitologia de Mamíferos Silvestres Reservatórios, Instituto Oswaldo Cruz, Fundação Oswaldo Cruz, Rio de Janeiro, 21040-360, RJ, Brazil; E-Mails: [email protected] (P.S.D.); [email protected] (C.R.B.) 3 Programa de Genética, Instituto Nacional de Câncer, Ministério da Saúde, Rio de Janeiro, 20231-050, RJ, Brazil * Author to whom correspondence should be addressed; E-Mail: [email protected]; Tel./Fax: +55-21-2562-1727. Received: 25 November 2013; in revised form: 3 February 2014 / Accepted: 7 February 2014 / Published: 29 April 2014 Abstract: Since the recognition of hantavirus as the agent responsible for haemorrhagic fever in Eurasia in the 1970s and, 20 years later, the descovery of hantavirus pulmonary syndrome in the Americas, the genus Hantavirus has been continually described throughout the World in a variety of wild animals. The diversity of wild animals infected with hantaviruses has only recently come into focus as a result of expanded wildlife studies.
    [Show full text]
  • DNA Viruses Herpesviridae  HSV, VZV RNA and DNA Viruses  CMV, HHV-6 a 7  EBV, HHV8 Adenoviridae Adenoviruses (Group A-F)
    říjen ’20 http://www.tulane.edu/ ~dmsander/garryfavwe b.html DNA viruses Herpesviridae HSV, VZV RNA and DNA viruses CMV, HHV-6 a 7 EBV, HHV8 Adenoviridae Adenoviruses (group A-F) Polyomaviridae BKV, JCV, WUV, KIV, SV40... ds DNA Papillomaviridae Papillomaviry Petr Hubáček Poxviridae Variolla virus, vaccinia, Dept. of Medical Microbiology and Paediatric Haematology and Oncology molluscum contagiosum … 2nd Medical Faculty of Charles University and Motol University Hospital Hepadna HBV Parvoviridae Parvovirus B19, lidský bocavirus (HBoV) ss DNA Anelloviridae TTV, TTMV, TTMDV RNA viruses Clinical consequences Ortomyxoviridae Influenza A-C http://mrstaberswiki.pbworks.com/f/1297256790/influenza.gif Paramyxoviridae Paramyxovirus PIV 1-4 Morbillivirus Pneumovirus RSV Flu-like sy. hMPV FUO, malaise, Encefalitis/ Coronaviridae HCoV myositis … (229E, NL63, OC43, HKU1, MERS, SARS…) Encefalopatia Picornaviridae Enteroviruses HRV ss RNA Rhinovirus Flaviviridae HCV, Yellow fever Virus, WNV, Denque v… Respiratory diseases Caliciviridae Human caliciviruses – Norovirus, Sapovirus Astroviridae Astrovirus Rhadboviridae Lyssa virus Reoviridae Rotavirus Hepatitis ds ds RNA Orbivirus Gastroenteritis Nephritis, cystitis, Myelosupression Methods of the viral detection Balance in the (immunocompromissed) patient Detection methods in virology • Microscopic Direct detection • Cultivation • Detection of the antigen • Detection of the nucleic acid • Detection of the antibodies • (Signs of disease) Immune system Pathogens (immunocompromissed Lymfocyte regulated
    [Show full text]