DOCSLIB.ORG

(12) Patent Application Publication (10) Pub. No.: US 2013/0267429 A1 GARDNER Et Al

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
(12) Patent Application Publication (10) Pub. No.: US 2013/0267429 A1 GARDNER Et Al US 20130267,429A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2013/0267429 A1 GARDNER et al. (43) Pub. Date: Oct. 10, 2013 (54) BIOLOGICAL SAMPLE TARGET (60) Provisional application No. 61/628.224, filed on Oct. CLASSIFICATION, DETECTION AND 26, 2011. SELECTION METHODS, AND RELATED ARRAYS AND OLGONUCLEOTIDE PROBES (71) Applicant: Lawrence Livermore National Publication Classification Security, LLC, Livermore, CA (US) (51) Int. Cl. (72) Inventors: Shea GARDNER, Oakland, CA (US); G06F 9/20 (2006.01) CrystalKevin MCLOUGHILIN, J. JAING, Livermore, Oakland, CA CA(US); (52) s g4. (2006.01) US):A ity's Th SLEZAK. issurancisco, San Franci CPCAV e. we.............. G06F 19/20 (2013.01): CI2O 1/6876 Alameda, CA (US); Marisa Wailam (2013.01) TORRES, Pleasanton, CA (US) USPC ................................................. 506/8:506/16 (21) Appl. No.: 13/886,172 (22) Filed: May 2, 2013 (57) ABSTRACT Related U.S. Application Data (63) Continuation-in-part of application No. 13/304.276, Biological sample target classification, detection and selec filed on Nov. 23, 2011, which is a continuation-in-part tion methods are described, together with related arrays and of application No. 12/643,903, filed on Dec. 21, 2009. oligonucleotide probes. Patent Application Publication Oct. 10, 2013 Sheet 1 of 19 US 2013/0267429 A1 All Filter With genomes Vmatch to in family, reOWe as of nonspecific Family specific April 2007 regions & 17 nt regions only >g1 . > 25 nt (bacterial AATCCTGACAGGGACAG and human) >g 1 >g2 AATCCTGACAGGGACAGTTT, ........... G AGCAAAAACAAGCAGTT >g 2 >g3 AGCAA, , , ..., , , , , , , , , , ... AGTGACAGTCAT. GGGGTCAAACGGGAG >g3 A. GGGGCAATACTGGGA., , , , , , , , ACCCTA >g4 -as-a-do A. TTGTccTAATTFCAA. Database of g4. A i"GCCAATTCAAACAGGCTAAAA human r +non-target Viral and bacterial families Probe candidates, favoring those with good length, entropy, Tm, and hairpin and homodimer avoidance Primer 3 and >g X Unafold ESAS333-sto AGCAA...... AGGACAGCAG 3i:iiisi-GGA.AccCTAGA>g TTTTGTCCTAAT iSEESSTAAAA GCTCTGATGTG...... GAffix:bAAGA Patent Application Publication Oct. 10, 2013 Sheet 2 of 19 US 2013/0267429 A1 Probe clusters ranked by conservation Cluster Down based on Select from shared Candidate probes probes -----------as Greedy algorithm Blast probe candidates favoring conserved against genomes and predict array annealing, probes picks until allowing mismatches all genomes based on experi represented by mentally determined >50 (viral) or properties > 15 (bacterial) - probes - Final Array Design, V2 170,000 viral 8,000 bacterial 1,200 human viral F.G. 1B response gene 20,00 Virochip (DeRise&Wang USCF) 2,600 random control Patent Application Publication Oct. 10, 2013 Sheet 3 of 19 US 2013/0267429 A1 Probe Counts Log-Odds 438 expe iral diarrhea virus 1BV133738 223 BOW ine viral diarrhea virus Complete RNA 430 expected sis Bovine viral diarrhea virus 1strain Singer Arg 438 expe BOwine viral diarrhea viruS 1 SD1 222 polyprotein gene 436 expected Bovine viral diarrhea viruS 1 223 detected 439 expec BOwine wira diarrhea virus 1 BOwine viral 221 detected diarrhea virus strain Oregon C24V 434 6.E. e Bovine viral diarrhea virus 1 Pestivirus type 1 42135, Bovine viral diarrhea virus Pestivirus 215 detected type 1 noncytopathic genomic RNA 407 expected BOwine via diarrhea virus Pestivirus 211 detected type 1 cytopathic genomic RNA 487 expect: 38 220E is Bovine viral diarrhea virus 1 strain KE9 434 expec 3.9 BOvine viral diarrhea virus Strain ZM, 95 27 437 expected BOwine viral diarrhea ViruS 1 BOwine viral is diarrhea virus WEDEVAC ORF1 for 35 expec Bovine viral diarrhea virus 1 Bovine viral 218 dest diarrhea virus 412 expected 9035 Bovine viral diarrhea virus 2 Bovine viral 2O2 detected diarrhea virus genotype 2 426 expecte 203 de BOwine viral diarrhea virus 2 New York 93 416 &E BOwine viral diarrhea virus 2 BOwine viral diarrhea virus genotype 2 strain p11C BOwine viral diarrhea virus 2 BOvine viral 4226 fee diarrhea virus genotype 2 strain p24515 856 expecte d 99 detected Clostridium leptum GF:643631 ... (Clostridium leptum DSM753 916 expecte #3 detected Anaerotruncus ColihominisGF:651056 (Anaerotruncus calihominis DSM 1019 ex ected" detected COStridium Scindens GF:651069 68 detected (Clostridium scindens ATCC 35704 856 expected Clostridium leptum|GF:636890 43 detected (Clostridium leptum DSM753 FIG. 2 Patent Application Publication Oct. 10, 2013 Sheet 4 of 19 US 2013/0267429 A1 Patent Application Publication Oct. 10, 2013 Sheet 5 of 19 US 2013/0267429 A1 sppo-6oT Patent Application Publication Oct. 10, 2013 Sheet 7 of 19 US 2013/0267429 A1 Patent Application Publication Oct. 10, 2013 Sheet 8 of 19 US 2013/0267429 A1 Probe Counts Log-Odds 790 expected 4777 & detected&B is Escherichia COi CFTO73 Escherichia COE24377A 5 g Shigella dysenteriae Sd197 1466.4 Shigellaflexneri5 str. 8401 0.8 Escherichia Coli 042 from Sander on S Aug 24 2005 2.52PM a 6 Escherichia Coli HS 825 expected 3884 Escherichia ColiGE630814 t s d (Escherichia coli B71 Escherichia 1831 expeiei" ce 1350.5 Escherichia Coli U 89 & Sid 401 expected Norwalk virus NorOvirus 77 deed Hu/NLVIGH/Neustrelitz260/2000/DE from Germany 409 expected Norwalk virus Norwalk-like virus genomic 77 ed RNA, isolate: Saitana U18 412 expected Norwalk virus Norwalk-like virus genomic 76 died RNA, isolate Saitana U201 425 expected7ged Norwalk virus Human Calcivinus strain Mc37 415 expected 63 detecteds Dehalococcoides sp. CBDB1 858 expected Mariprofundus ferroCXydanslCF:636226 eleted (Mariprofundus ferroCXydans PV-1 858 expected Mariprofundus ferroCXydanslgF.632951 ori (Mariprofundus ferroCXydans PV-1 84 detected marine gamma proteobacterium 889 *Pled HTCC20801GF:630922 (marine 952 expected97 detected gammaproteobacterium HTCC22O7IGF63298 B (marine gamma proteobacterium HTCC2207 89 detected gammaproteobacterium MTCC22O7IGF:636223 952 expected (gamma proteobacterium HTCC2207 marine etected Endori?tiapersephonelGF:637262 1129 expected (Endoriftia persephone 11 detected marine gamma proteobacterium 1011 expected TO detected HTCC21431GF-630924 (marine 1145 expected Reinekea sp. MED297IGF-630968 (Reinekea etected sp. MED297 Reinekea sp. MED297, unfinished FIG. 7 Patent Application Publication Oct. 10, 2013 Sheet 9 of 19 US 2013/0267429 A1 Probe Counts Log-Odds 61 expeted 862.8 51 detected is Chicken anemia virus isolate 3-1 from Malaysia 61 expeged Chicken anemia virus isolate AH6 from China 51 detecte 61 S. Chicken anemia virus from China 8. detected 860 s Sexpeted Chicken anemia Virus isolate C14- S S. expegledSE 4. Chicken anemia virus isolate SMSC-P9WT 5 51 detecte E. Chicken anemia viruS eleCE "eel ed E Serratia protearnaculans 568 eteCte Providencia StuartiCF6499.08 (Providencia stuartii ATCC 25827 Sodalis glossinidius Str, "morsitans' : Pectobacterium atroSepticum Erwina & carotovora subsp. atroseptica SCR 1043 it. Erwinia chrysanthem GF:188098 (Erwinia i s Chrysanthemi NO STRAN sequence from 9 1678 expected Serratia proteamaculans|GF:630880 2 & s (Serratia proteamaculans 568 Serratia L 95 expected Candidate division TM7 isolate 14 detected TM7biGF:636167 (candidate division 858 expected Mariprofundus ferrOOxydans GF:636228 (Mariprofundus ferrooxydans PV-1 29 Ef ected Endoritia persephonetGF:637262 68 detected (Endoriftia persephone marine gammaproteobacterium 1011 expected HTCC2143IGF-630924 (marine elected gammaproteobacterium HTCC22O7IGF-632981 952 expected- (marine gamma proteobacterium HTCC2207 952 t 54 detected gamma proteobacterium HTCC22O7IGF:636223 expec eader (gamma proteobacterium HTCC2207 marine 889 expected etected marine gamma proteobacterium 7 delee d HTCC208OIGF-630923 (marine Patent Application Publication Oct. 10, 2013 Sheet 10 of 19 US 2013/0267429 A1 Probe Counts Log-Odds etected StaphyloCOccuSaureus Subsp. aureuS MuSO 43 expected 900.5 StaphyloCOCCUS aureus Subsp. aurOUS 19 detected USA300 TCH959 plasmidpUSA300HOUMS StaphyloCOCCuSaureuS Subsp. aureuS Mu3 StaphyloCOCCuSaureus Subsp. aureus St. Newman 235 detected Shigella dysenteriae Sd197 Y 107 expected 55 detected Escherichia ColplasmidpAPEC-02-CoIV 33 expected y 16 detected Shigella Sonnel Ss046 plasmidpSSO46 SpE Escherichia CO, CFO73 147 expected Shigella dysenteriaelGF:447836 (Shigella O36 expeii detected dysenteriae M131649 from Sanger on Aug s f. StreptoCOCCussanguins SK36 51 expected LactoCOCCUS actis plasmid pGdh442 29 detected LactoCOCCUS lactis subsp. lactis plasmid pC305 14 expected 11 detected LactoCOCCUS lactisplasmidpSRQ800 16 expected 977.6 StreptoCOCCusthermophilus LMG 18311 972 expects elected 1252.7 is Streptococcus thermophilus CNRZ1066 997 exp StreptoCOCCUs thermophilus LMD-9 101 expecies StreptoCOCCusaureuS temperate 55 detected 12326 phage phlSLTIStaphyloCOCCUS phage phlSLT 160115 detectedC StaphyloCOCCuSaureuS bacteriophage 145 expected PVLIStaphyloCOCCUS prophage PWL. 96 deteed 177 expected 1244.5 StaphyloCOCCUS aureuSphage 114 deted philNMStaphyloCOCCUSphage phi\M 28 expected 12 detected EnterOCOCCuS faecalis V583 plasmidpTEF3 1092 1450 expected EnterOCOCCUS faecalis W583 etected F.G. 9 Patent Application Publication Oct. 10, 2013 Sheet 11 of 19 US 2013/0267429 A1 Alsued Patent Application Publication Oct. 10, 2013 Sheet 12 of 19 US 2013/0267429 A1 AISued Patent Application Publication Oct. 10, 2013 Sheet 13 of 19 US 2013/0267429 A1 Target specific - - - Non specific oro an as acao. -a- - Control o O. 2. OO. 4.6 O. O O. O Cyg a SAS ANY intensity distributions for an MDA v.2 array hybridized to a spiked mixture of vaccinia virus and HHV6B, for probes with and without target-specific
Load more

Recommended publications
  • Bacteriophage of Enterococcus Species for Microbial Source Tracking
    Bacteriophage of Enterococcus species for microbial source tracking Sarah Elizabeth Purnell A thesis submitted in partial fulfilment of the requirements of the University of Brighton for the degree of Doctor of Philosophy 2012 School of Environment and Technology University of Brighton United Kingdom Abstract Contamination of surface waters with faeces may lead to increased public risk of human exposure to pathogens through drinking water supply, aquaculture, and recreational activities. Determining the source(s) of contamination is important for assessing the degree of risk to public health, and for selecting appropriate mitigation measures. Phage-based microbial source tracking (MST) techniques have been promoted as effective, simple and low-cost. The intestinal enterococci are a faecal “indicator of choice” in many parts of the world for determining water quality, and recently, phages capable of infecting Enterococcus faecalis have been proposed as a potential alternative indicator of human faecal contamination. The primary aim of this study was to evaluate critically the suitability and efficacy of phages infecting host strains of Enterococcus species as a low-cost tool for MST. In total, 390 potential Enterococcus hosts were screened for their ability to detect phage in reference faecal samples. Development and implementation of a tiered screening approach allowed the initial large number of enterococcal hosts to be reduced rapidly to a smaller subgroup suitable for phage enumeration and MST. Twenty-nine hosts were further tested using additional faecal samples of human and non-human origin. Their specificity and sensitivity were found to vary, ranging from 44 to 100% and from 17 to 83%, respectively. Most notably, seven strains exhibited 100% specificity to cattle, human, or pig samples.
    [Show full text]
  • Grapevine Virus Diseases: Economic Impact and Current Advances in Viral Prospection and Management1
    1/22 ISSN 0100-2945 http://dx.doi.org/10.1590/0100-29452017411 GRAPEVINE VIRUS DISEASES: ECONOMIC IMPACT AND CURRENT ADVANCES IN VIRAL PROSPECTION AND MANAGEMENT1 MARCOS FERNANDO BASSO2, THOR VINÍCIUS MArtins FAJARDO3, PASQUALE SALDARELLI4 ABSTRACT-Grapevine (Vitis spp.) is a major vegetative propagated fruit crop with high socioeconomic importance worldwide. It is susceptible to several graft-transmitted agents that cause several diseases and substantial crop losses, reducing fruit quality and plant vigor, and shorten the longevity of vines. The vegetative propagation and frequent exchanges of propagative material among countries contribute to spread these pathogens, favoring the emergence of complex diseases. Its perennial life cycle further accelerates the mixing and introduction of several viral agents into a single plant. Currently, approximately 65 viruses belonging to different families have been reported infecting grapevines, but not all cause economically relevant diseases. The grapevine leafroll, rugose wood complex, leaf degeneration and fleck diseases are the four main disorders having worldwide economic importance. In addition, new viral species and strains have been identified and associated with economically important constraints to grape production. In Brazilian vineyards, eighteen viruses, three viroids and two virus-like diseases had already their occurrence reported and were molecularly characterized. Here, we review the current knowledge of these viruses, report advances in their diagnosis and prospection of new species, and give indications about the management of the associated grapevine diseases. Index terms: Vegetative propagation, plant viruses, crop losses, berry quality, next-generation sequencing. VIROSES EM VIDEIRAS: IMPACTO ECONÔMICO E RECENTES AVANÇOS NA PROSPECÇÃO DE VÍRUS E MANEJO DAS DOENÇAS DE ORIGEM VIRAL RESUMO-A videira (Vitis spp.) é propagada vegetativamente e considerada uma das principais culturas frutíferas por sua importância socioeconômica mundial.
    [Show full text]
  • Elisabeth Mendes Martins De Moura Diversidade De Vírus DNA
    Elisabeth Mendes Martins de Moura Diversidade de vírus DNA autóctones e alóctones de mananciais e de esgoto da região metropolitana de São Paulo Tese apresentada ao Programa de Pós- Graduação em Microbiologia do Instituto de Ciências Biomédicas da Universidade de São Paulo, para obtenção do Titulo de Doutor em Ciências. Área de concentração: Microbiologia Orienta: Prof (a). Dr (a). Dolores Ursula Mehnert versão original São Paulo 2017 RESUMO MOURA, E. M. M. Diversidade de vírus DNA autóctones e alóctones de mananciais e de esgoto da região metropolitana de São Paulo. 2017. 134f. Tese (Doutorado em Microbiologia) - Instituto de Ciências Biomédicas, Universidade de São Paulo, São Paulo, 2017. A água doce no Brasil, assim como o seu consumo é extremamente importante para as diversas atividades criadas pelo ser humano. Por esta razão o consumo deste bem é muito grande e consequentemente, provocando o seu impacto. Os mananciais são normalmente usados para abastecimento doméstico, comercial, industrial e outros fins. Os estudos na área de ecologia de micro-organismos nos ecossistemas aquáticos (mananciais) e em esgotos vêm sendo realizados com mais intensidade nos últimos anos. Nas últimas décadas foi introduzido o conceito de virioplâncton com base na abundância e diversidade de partículas virais presentes no ambiente aquático. O virioplâncton influencia muitos processos ecológicos e biogeoquímicos, como ciclagem de nutriente, taxa de sedimentação de partículas, diversidade e distribuição de espécies de algas e bactérias, controle de florações de fitoplâncton e transferência genética horizontal. Os estudos nesta área da virologia molecular ainda estão muito restritos no país, bem como muito pouco se conhece sobre a diversidade viral na água no Brasil.
    [Show full text]
  • Geographic Distribution of Hantaviruses Associated with Neotomine and Sigmodontine Rodents, Mexico Mary L
    Geographic Distribution of Hantaviruses Associated with Neotomine and Sigmodontine Rodents, Mexico Mary L. Milazzo,1 Maria N.B. Cajimat,1 Hannah E. Romo, Jose G. Estrada-Franco, L. Ignacio Iñiguez-Dávalos, Robert D. Bradley, and Charles F. Fulhorst To increase our knowledge of the geographic on the North American continent are Bayou virus, Black distribution of hantaviruses associated with neotomine or Creek Canal virus (BCCV), Choclo virus (CHOV), New sigmodontine rodents in Mexico, we tested 876 cricetid York virus, and Sin Nombre virus (SNV) (3–7). Other rodents captured in 18 Mexican states (representing at hantaviruses that are principally associated with neotomine least 44 species in the subfamily Neotominae and 10 or North American sigmodontine rodents include Carrizal species in the subfamily Sigmodontinae) for anti-hantavirus virus (CARV), Catacamas virus, El Moro Canyon virus IgG. We found antibodies against hantavirus in 35 (4.0%) rodents. Nucleotide sequence data from 5 antibody-positive (ELMCV), Huitzilac virus (HUIV), Limestone Canyon rodents indicated that Sin Nombre virus (the major cause of virus (LSCV), Montano virus (MTNV), Muleshoe virus hantavirus pulmonary syndrome [HPS] in the United States) (MULV), Playa de Oro virus, and Rio Segundo virus is enzootic in the Mexican states of Nuevo León, San Luis (RIOSV) (8–14). Potosí, Tamaulipas, and Veracruz. However, HPS has not Specifi c rodents (usually 1 or 2 closely related been reported from these states, which suggests that in species) are the principal hosts of the hantaviruses, northeastern Mexico, HPS has been confused with other for which natural host relationships have been well rapidly progressive, life-threatening respiratory diseases.
    [Show full text]
  • Identification of Capsid/Coat Related Protein Folds and Their Utility for Virus Classification
    ORIGINAL RESEARCH published: 10 March 2017 doi: 10.3389/fmicb.2017.00380 Identification of Capsid/Coat Related Protein Folds and Their Utility for Virus Classification Arshan Nasir 1, 2 and Gustavo Caetano-Anollés 1* 1 Department of Crop Sciences, Evolutionary Bioinformatics Laboratory, University of Illinois at Urbana-Champaign, Urbana, IL, USA, 2 Department of Biosciences, COMSATS Institute of Information Technology, Islamabad, Pakistan The viral supergroup includes the entire collection of known and unknown viruses that roam our planet and infect life forms. The supergroup is remarkably diverse both in its genetics and morphology and has historically remained difficult to study and classify. The accumulation of protein structure data in the past few years now provides an excellent opportunity to re-examine the classification and evolution of viruses. Here we scan completely sequenced viral proteomes from all genome types and identify protein folds involved in the formation of viral capsids and virion architectures. Viruses encoding similar capsid/coat related folds were pooled into lineages, after benchmarking against published literature. Remarkably, the in silico exercise reproduced all previously described members of known structure-based viral lineages, along with several proposals for new Edited by: additions, suggesting it could be a useful supplement to experimental approaches and Ricardo Flores, to aid qualitative assessment of viral diversity in metagenome samples. Polytechnic University of Valencia, Spain Keywords: capsid, virion, protein structure, virus taxonomy, SCOP, fold superfamily Reviewed by: Mario A. Fares, Consejo Superior de Investigaciones INTRODUCTION Científicas(CSIC), Spain Janne J. Ravantti, The last few years have dramatically increased our knowledge about viral systematics and University of Helsinki, Finland evolution.
    [Show full text]
  • ABSTRACT Vector-Borne Viral Infections in South-West
    저작자표시-비영리-변경금지 2.0 대한민국 이용자는 아래의 조건을 따르는 경우에 한하여 자유롭게 l 이 저작물을 복제, 배포, 전송, 전시, 공연 및 방송할 수 있습니다. 다음과 같은 조건을 따라야 합니다: 저작자표시. 귀하는 원저작자를 표시하여야 합니다. 비영리. 귀하는 이 저작물을 영리 목적으로 이용할 수 없습니다. 변경금지. 귀하는 이 저작물을 개작, 변형 또는 가공할 수 없습니다. l 귀하는, 이 저작물의 재이용이나 배포의 경우, 이 저작물에 적용된 이용허락조건 을 명확하게 나타내어야 합니다. l 저작권자로부터 별도의 허가를 받으면 이러한 조건들은 적용되지 않습니다. 저작권법에 따른 이용자의 권리는 위의 내용에 의하여 영향을 받지 않습니다. 이것은 이용허락규약(Legal Code)을 이해하기 쉽게 요약한 것입니다. Disclaimer August 2016 Master’s Degree Thesis Vector-Borne Viral Infections in South-West Region of Korea Graduate School of Chosun University Department of Biomedical Sciences Babita Jha August 2016 Master’s Degree Thesis Vector-Borne Viral Infections in South-West Region of Korea Graduate School of Chosun University Department of Biomedical Sciences Babita Jha Vector-Borne Viral Infections in South-West Region of Korea 한국의 남서부 지역에서 매개체 관련 바이러스 질환 August, 2016 Graduate School of Chosun University Department of Biomedical Sciences Babita Jha Vector-Borne Viral Infections in South-West Region of Korea Advisor: Prof. Dong-Min Kim, MD, PhD THESIS SUBMITTED TO THE DEPARTMENT OF BIOMEDICAL SCIENCES, CHOSUN UNIVERSITY IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF BIOMEDICAL SCIENCES April, 2016 Graduate School of Chosun University Department of Biomedical Sciences Submitted by Babita Jha August Master’s Vector-Borne Viral Infections in Babita Jha Degree 2016 Thesis South-West Region of Korea Table of Contents LIST OF TABLES……………………….................iv LIST OF FIGURES…………………………………v ABBREVIATIONS AND SYMBOLS…………….vi ABSTRACT…………………………………...…….ix 한 글 요 약……………………………………...…..xii I.
    [Show full text]
  • Nucleotide Amino Acid Size (Nt) #Orfs Marnavirus Heterosigma Akashiwo Heterosigma Akashiwo RNA Heterosigma Lang Et Al
    Supplementary Table 1: Summary of information for all viruses falling within the seven Marnaviridae genera in our analyses. Accession Genome Genus Species Virus name Strain Abbreviation Source Country Reference Nucleotide Amino acid Size (nt) #ORFs Marnavirus Heterosigma akashiwo Heterosigma akashiwo RNA Heterosigma Lang et al. , 2004; HaRNAV AY337486 AAP97137 8587 One Canada RNA virus 1 virus akashiwo Tai et al. , 2003 Marine single- ASG92540 Moniruzzaman et Classification pending Q sR OV 020 KY286100 9290 Two celled USA ASG92541 al ., 2017 eukaryotes Marine single- Moniruzzaman et Classification pending Q sR OV 041 KY286101 ASG92542 9328 One celled USA al ., 2017 eukaryotes APG78557 Classification pending Wenzhou picorna-like virus 13 WZSBei69459 KX884360 9458 One Bivalve China Shi et al ., 2016 APG78557 Classification pending Changjiang picorna-like virus 2 CJLX30436 KX884547 APG79001 7171 One Crayfish China Shi et al ., 2016 Beihai picorna-like virus 57 BHHQ57630 KX883356 APG76773 8518 One Tunicate China Shi et al ., 2016 Classification pending Beihai picorna-like virus 57 BHJP51916 KX883380 APG76812 8518 One Tunicate China Shi et al ., 2016 Marine single- ASG92530 Moniruzzaman et Classification pending N OV 137 KY130494 7746 Two celled USA ASG92531 al ., 2017 eukaryotes Hubei picorna-like virus 7 WHSF7327 KX884284 APG78434 9614 One Pill worm China Shi et al ., 2016 Classification pending Hubei picorna-like virus 7 WHCC111241 KX884268 APG78407 7945 One Insect China Shi et al ., 2016 Sanxia atyid shrimp virus 2 WHCCII13331 KX884278 APG78424 10445 One Insect China Shi et al ., 2016 Classification pending Freshwater atyid Sanxia atyid shrimp virus 2 SXXX37884 KX883708 APG77465 10400 One China Shi et al ., 2016 shrimp Labyrnavirus Aurantiochytrium single Aurantiochytrium single stranded BAE47143 Aurantiochytriu AuRNAV AB193726 9035 Three4 Japan Takao et al.
    [Show full text]
  • Beet Necrotic Yellow Vein Virus (Benyvirus)
    EuropeanBlackwell Publishing Ltd and Mediterranean Plant Protection Organization PM 7/30 (2) Organisation Européenne et Méditerranéenne pour la Protection des Plantes Diagnostics1 Diagnostic Beet necrotic yellow vein virus (benyvirus) Specific scope Specific approval and amendment This standard describes a diagnostic protocol for Beet necrotic This Standard was developed under the EU DIAGPRO Project yellow vein virus (benyvirus). (SMT 4-CT98-2252) through a partnership of contractor laboratories and intercomparison laboratories in European countries. Approved as an EPPO Standard in 2003-09. Revision approved in 2006-09. Introduction Identity Rhizomania disease of sugar beet was first reported in Italy Name: Beet necrotic yellow vein virus (Canova, 1959) and has since been reported in more than Acronym: BNYVV 25 countries. The disease causes economic loss to sugar beet Taxonomic position: Viruses, Benyvirus (Beta vulgaris var. saccharifera) by reducing yield. Rhizomania EPPO computer code: BNYVV0 is caused by Beet necrotic yellow vein virus (BNYVV), which Phytosanitary categorization: EPPO A2 list no. 160; EU is transmitted by the soil protozoan, Polymyxa betae (family Annex designation I/B. Plasmodiophoraceae). The virus can survive in P. betae cystosori for more than 15 years. The symptoms of rhizomania, Detection also known as ‘root madness’, include root bearding, stunting, chlorosis of leaves, yellow veining and necrosis of leaf veins. The disease affects all subspecies of Beta vulgaris, including The virus is spread by movement of soil, primarily on machinery, sugar beet (Beta vulgaris subsp. maritime), fodder beet (Beta sugar beet roots, stecklings, other root crops, such as potato, vulgaris subsp. vulgaris), red beet (Beta vulgaris subsp. cicla), and in composts and soil.
    [Show full text]
  • Diseases of Sugar Beet
    Molecular Characterization of Beet Necrotic Yellow Vein Virus in Greece and Transgenic Approaches towards Enhancing Rhizomania Disease Resistance Ourania I. Pavli Thesis committee Thesis supervisor Prof.dr. J.M. Vlak Personal Chair at the Laboratory of Virology Wageningen University Prof.dr. G.N. Skaracis Head of Plant Breeding and Biometry Department of Crop Science Agricultural University of Athens, Greece Thesis co-supervisors Dr.ir. M. Prins Program Scientist KeyGene, Wageningen Prof.dr. N.J. Panopoulos Professor of Biotechnology and Applied Biology Department of Biology University of Crete, Greece Other members Prof.dr. R.G.F. Visser, Wageningen University Prof.dr.ir. L.C. van Loon, Utrecht University Dr.ir. R.A.A. van der Vlugt, Plant Research International, Wageningen Prof.dr. M. Varrelmann, Göttingen University, Germany This research was conducted under the auspices of the Graduate School of Experimental Plant Sciences. 2 Molecular Characterization of Beet Necrotic Yellow Vein Virus in Greece and Transgenic Approaches towards Enhancing Rhizomania Disease Resistance Ourania I. Pavli Thesis submitted in partial fulfilment of the requirements for the degree of doctor at Wageningen University by the authority of the Rector Magnificus Prof.dr. M.J. Kropff in the presence of the Thesis Committee appointed by the Doctorate Board to be defended in public on Monday 11 January 2010 at 1.30 PM in the Aula 3 Pavli, O.I. Molecular characterization of beet necrotic yellow vein virus in Greece and transgenic approaches towards enhancing rhizomania
    [Show full text]
  • Hantavirus Disease Were HPS Is More Common in Late Spring and Early Summer in Seropositive in One Study in the U.K
    Hantavirus Importance Hantaviruses are a large group of viruses that circulate asymptomatically in Disease rodents, insectivores and bats, but sometimes cause illnesses in humans. Some of these agents can occur in laboratory rodents or pet rats. Clinical cases in humans vary in Hantavirus Fever, severity: some hantaviruses tend to cause mild disease, typically with complete recovery; others frequently cause serious illnesses with case fatality rates of 30% or Hemorrhagic Fever with Renal higher. Hantavirus infections in people are fairly common in parts of Asia, Europe and Syndrome (HFRS), Nephropathia South America, but they seem to be less frequent in North America. Hantaviruses may Epidemica (NE), Hantavirus occasionally infect animals other than their usual hosts; however, there is currently no Pulmonary Syndrome (HPS), evidence that they cause any illnesses in these animals, with the possible exception of Hantavirus Cardiopulmonary nonhuman primates. Syndrome, Hemorrhagic Nephrosonephritis, Epidemic Etiology Hemorrhagic Fever, Korean Hantaviruses are members of the genus Orthohantavirus in the family Hantaviridae Hemorrhagic Fever and order Bunyavirales. As of 2017, 41 species of hantaviruses had officially accepted names, but there is ongoing debate about which viruses should be considered discrete species, and additional viruses have been discovered but not yet classified. Different Last Updated: September 2018 viruses tend to be associated with the two major clinical syndromes in humans, hemorrhagic fever with renal syndrome (HFRS) and hantavirus pulmonary (or cardiopulmonary) syndrome (HPS). However, this distinction is not absolute: viruses that are usually associated with HFRS have been infrequently linked to HPS and vice versa. A mild form of HFRS in Europe is commonly called nephropathia epidemica.
    [Show full text]
  • Next-Generation Sequencing Reveals an Extraordinary Virus with Multiple Genomic Co
    Preprints (www.preprints.org) | NOT PEER-REVIEWED | Posted: 30 March 2018 doi:10.20944/preprints201803.0271.v1 Peer-reviewed version available at Viruses 2018, 10, 260; doi:10.3390/v10050260 1 Blackcurrant leaf chlorosis associated virus: next-generation sequencing 2 reveals an extraordinary virus with multiple genomic components including 3 evidence of circular RNA 4 5 Delano James*, James Phelan and Daniel Sanderson 6 Sidney Laboratory, Centre for Plant Health, Canadian Food Inspection Agency, 8801 East 7 Saanich Road, North Saanich, British Columbia, V8L 1H3, Canada; 8 [email protected] (J.P.); [email protected] (D.S.) 9 *Correspondence: [email protected]; Tel.: 1 250 363 6650; FAX: 1 250 363 6661 10 11 Abstract: Blackcurrant leaf chlorosis associated virus (BCLCaV) was detected recently by next- 12 generation sequencing (NGS) and proposed as a new and distinct species in the genus 13 Idaeovirus. Genomic components of BCLCaV that were detected and confirmed include: 1) 14 RNA-1 that is monocistronic and encodes the replicase complex; 2) a bicistronic RNA-2 that 15 encodes a movement protein (MP) and the coat protein (CP) of the virus, with open reading 16 frames (ORF) that overlap by a single adenine (A) nucleotide (nt) representing the third position 17 of an opal stop codon of the MP ORF2a and the first position of the start codon of the CP 18 ORF2b; 3) a subgenomic form of RNA-2 (RNA-3) that contains ORF2b; and 4) a concatenated 19 form of RNA-2 that consists of a complementary and inverted RNA-3 conjoined to the full- 20 length RNA-2.
    [Show full text]
  • The LUCA and Its Complex Virome in Another Recent Synthesis, We Examined the Origins of the Replication and Structural Mart Krupovic , Valerian V
    PERSPECTIVES archaea that form several distinct, seemingly unrelated groups16–18. The LUCA and its complex virome In another recent synthesis, we examined the origins of the replication and structural Mart Krupovic , Valerian V. Dolja and Eugene V. Koonin modules of viruses and posited a ‘chimeric’ scenario of virus evolution19. Under this Abstract | The last universal cellular ancestor (LUCA) is the most recent population model, the replication machineries of each of of organisms from which all cellular life on Earth descends. The reconstruction of the four realms derive from the primordial the genome and phenotype of the LUCA is a major challenge in evolutionary pool of genetic elements, whereas the major biology. Given that all life forms are associated with viruses and/or other mobile virion structural proteins were acquired genetic elements, there is no doubt that the LUCA was a host to viruses. Here, by from cellular hosts at different stages of evolution giving rise to bona fide viruses. projecting back in time using the extant distribution of viruses across the two In this Perspective article, we combine primary domains of life, bacteria and archaea, and tracing the evolutionary this recent work with observations on the histories of some key virus genes, we attempt a reconstruction of the LUCA virome. host ranges of viruses in each of the four Even a conservative version of this reconstruction suggests a remarkably complex realms, along with deeper reconstructions virome that already included the main groups of extant viruses of bacteria and of virus evolution, to tentatively infer archaea. We further present evidence of extensive virus evolution antedating the the composition of the virome of the last universal cellular ancestor (LUCA; also LUCA.
    [Show full text]