DOCSLIB.ORG

Diseases of Sugar Beet

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Diseases of Sugar Beet Molecular Characterization of Beet Necrotic Yellow Vein Virus in Greece and Transgenic Approaches towards Enhancing Rhizomania Disease Resistance Ourania I. Pavli Thesis committee Thesis supervisor Prof.dr. J.M. Vlak Personal Chair at the Laboratory of Virology Wageningen University Prof.dr. G.N. Skaracis Head of Plant Breeding and Biometry Department of Crop Science Agricultural University of Athens, Greece Thesis co-supervisors Dr.ir. M. Prins Program Scientist KeyGene, Wageningen Prof.dr. N.J. Panopoulos Professor of Biotechnology and Applied Biology Department of Biology University of Crete, Greece Other members Prof.dr. R.G.F. Visser, Wageningen University Prof.dr.ir. L.C. van Loon, Utrecht University Dr.ir. R.A.A. van der Vlugt, Plant Research International, Wageningen Prof.dr. M. Varrelmann, Göttingen University, Germany This research was conducted under the auspices of the Graduate School of Experimental Plant Sciences. 2 Molecular Characterization of Beet Necrotic Yellow Vein Virus in Greece and Transgenic Approaches towards Enhancing Rhizomania Disease Resistance Ourania I. Pavli Thesis submitted in partial fulfilment of the requirements for the degree of doctor at Wageningen University by the authority of the Rector Magnificus Prof.dr. M.J. Kropff in the presence of the Thesis Committee appointed by the Doctorate Board to be defended in public on Monday 11 January 2010 at 1.30 PM in the Aula 3 Pavli, O.I. Molecular characterization of beet necrotic yellow vein virus in Greece and transgenic approaches towards enhancing rhizomania disease resistance 166 pages Thesis, Wageningen University, Wageningen, NL (2010) With references, with summaries in Dutch, English and Greek ISBN 978-90-8585-547-7 4 Contents Abstract 7 Chapter 1 General Introduction 9 Chapter 2 Performance of Rz1-based Resistance against 39 Sugar Beet Rhizomania Disease in Greece Chapter 3 Molecular Characterization of Beet Necrotic 49 Yellow Vein Virus in Rhizomania Diseased Sugar Beet throughout Greece Chapter 4 Survey for the Detection of Rhizomania 63 Related Soil-borne Viruses in Sugar Beet Cultivation Zones in Greece Chapter 5 A High Frequency Agrobacterium rhizogenes - 73 Mediated Sugar Beet Transformation Protocol Chapter 6 BNYVV Replicase-Derived dsRNA Confers 83 Resistance to Rhizomania Disease of Sugar Beet as Evidenced by a Novel Transgenic Hairy Root Approach Chapter 7 Expression of HrpZPsph in Transgenic Nicotiana 97 benthamiana Results in BNYVV - Induced Tissue Necrosis and Enhanced Rhizomania Resistance Chapter 8 General Discussion 115 Summary 131 Samenvatting 135 Περίληψη 141 Appendix 147 Acknowledgements 161 5 ABBREVIATIONS aa amino acid BNYVV Beet necrotic yellow vein virus bp Base pair BSBMV Beet soilborne mosaic virus BSBV Beet soilborne virus BVQ Beet virus Q CP coat protein dpi days post inoculation dpt days post transformation ds double stranded ELISA sandwich enzyme-linked immunosorbent assay GM genetically modified/genetic modification HCD hypersensitive cell death HR hypersensitive response Hrp harpin Hyb hybrid IR inverted repeat kb kilo base kDa kilo dalton MP movement protein mRCP multiplex PCR nptII neomycin phosphotransferase II nt nucleotide OD optical density ORF open reading frame p protein PCR polymerase chain reaction PDR pathogen-derived resistance PTGS post-transcriptional gene silencing RB resistance breaking RC resistant commercial Ri root-inducing RdRp RNA-dependent RNA polymerase rep replicase RFLP restriction fragment length polymorphism RT-PCR reverse-transcription PCR SAR systemic acquired resistance SC susceptible commercial si small interfering SP signal peptide ss single stranded TGB triple gene block TILLING targeted induced local lesions in genomes TTSS type III Secretion System V valine vir virulence 6 ABSTRACT Rhizomania disease of sugar beet, caused by Beet necrotic yellow vein virus (BNYVV), is responsible for severe economic losses. Due to the widespread occurrence of BNYVV and the absence of other practical and efficient control measures, economic viability of the crop is to the largest extent dependent on the use of varieties genetically resistant to the disease. Recent reports on the emergence of virus strains capable of compromising the Rz1-based resistance as well as on the spread of highly pathogenic RNA 5-containing BNYVV isolates have necessitated a detailed investigation of the situation as it evolves in Greece. The study revealed the widespread occurrence of BNYVV throughout the country as well as the prevalence of pathotype A isolates in all sugar beet growing regions. Sequence determination of the p25 protein, responsible for symptom development, pointed to the amino acid motifs ACHG/VCHG in the hypervariable amino acid region 67-70. However, the presence of valine (V) in position 67 was not associated with increased pathogenicity and resistance breaking properties. Disease severity appeared mostly dependent on agroclimatic conditions influencing the progress of the disease. A survey for a possible occurrence of Beet Soilborne Virus (BSBV) and Beet Virus Q (BVQ) in rhizomania infested fields revealed the co-existence of both viruses, with BVQ being systematically found in co-infections with BNYVV, while BSBV was in all cases only found in triple infections. Towards the exploitation of the antiviral properties of RNA silencing, three intron hairpin constructs carrying parts of the BNYVV replicase gene, were evaluated for their potential to confer rhizomania resistance in Ri T-DNA-transformed sugar beet roots. The results show that transgenic hairy roots were effectively protected against the virus disease and further indicate that the developed methodology for Agrobacterium rhizogenes-mediated transformation can be employed as a suitable platform to study transgene expression in sugar beet and other transformation recalcitrant crop species. In parallel, the potential to exploit the HrpZPsph protein from Pseudomonas syringae pv. phaseolicola for engineering rhizomania resistance in sugar beet against BNYVV was demonstrated by the successful engineering and protection against BNYVV in the model plant Nicotiana benthamiana. 7 CHAPTER 1 8 GENERAL INTRODUCTION Sugar beet (Beta vulgaris L. ssp. vulgaris) is one of the most important industrial crop species, occupying globally a cultivated area of approximately 8.1 million hectares spread over 41 countries (Rush et al., 2006). From a historical view point, it represents a European bred crop with a short but outstanding evolution characterized by pronounced improvements in breeding and cultivation which along with advanced processing technologies, have placed sugar beet as world’s second to sugar cane in raw sugar production worldwide. Sugar beet, whose root sugar content potential has throughout the years reached 15-20%, today provides approximately 25% of world sugar consumption. In addition, considerable quantities of sugar beet-based ethanol are also being produced for years, mostly in France. The recent interest for bioethanol production, as a replacement of fossil fuels in the transportation sector, has triggered significant research efforts in exploiting the crop’s potential towards this biofuel and for the production of biogas as well. Relevant business endeavours are being seriously pursued in several European countries, including Greece. Worldwide, economic viability of sugar beet growing is to a large extent depended on the successful protection against pathogens, of which Rhizomania, a viral root disease caused by Beet necrotic yellow vein virus (BNYVV), exerts a very high impact. Although several agronomic practices may help to a small degree, the only practical means of confronting this most devastating disease is by employing genetically resistant varieties. Due to the limited availability of useful natural genetic sources of resistance against the prevailing virus strains (Grimmer et al., 2007) as well as the recent emergence of novel resistance breaking strains, all relevant breeding activities become of paramount importance. HISTORY OF THE SUGAR BEET CROP Sugar beet belongs to the genus Beta of the Chenopodiaceae family, a genus also including all wild beet relatives. Mainly based on the presence of the sea beet (Beta vulgaris L. ssp. maritima), considered as sugar beet’s most probable wild progenitor, the genus Beta has originated in a widespread area ranging from the British Isles and the North Atlantic coast across Europe and the Mediterranean and the Black Sea to the Persian Gulf and the mouth of the Indus River (Ulbrich, 1934; Biancardi, 2005). In prehistoric times, sea beet is believed to have been domesticated around the Persian Gulf as early as wheat and barley, about 12,000 years ago (Simmonds, 1976). Sugar beet cultivation is far more recent however, dating back in ancient times when the first cultivars resembling spinach beet and Swiss chard that were grown as garden vegetables during the Greek and the Roman era. The earliest references to the beet plant 9 were provided by Aristophanes (445-385 BC) and Euripides (480-406 BC) and throughout the years several names, all of Greek origin, have been used. Its first name was teutlon, a name still being used in modern Greek language. Theophrastos (372-287 BC) used the term sicula to describe beet from the old Greek colony of Sicily. Upon the end of the second century BC, it was mentioned as Beta by Roman writers as well as by the Roman military physician Dioscuridis, whose interest was in the medical value of the plant (Lippmann, 1929; Ford-Lloyd & Williams, 1975; Winner,
Load more

Recommended publications
  • Beet Necrotic Yellow Vein Virus (Benyvirus)
    EuropeanBlackwell Publishing Ltd and Mediterranean Plant Protection Organization PM 7/30 (2) Organisation Européenne et Méditerranéenne pour la Protection des Plantes Diagnostics1 Diagnostic Beet necrotic yellow vein virus (benyvirus) Specific scope Specific approval and amendment This standard describes a diagnostic protocol for Beet necrotic This Standard was developed under the EU DIAGPRO Project yellow vein virus (benyvirus). (SMT 4-CT98-2252) through a partnership of contractor laboratories and intercomparison laboratories in European countries. Approved as an EPPO Standard in 2003-09. Revision approved in 2006-09. Introduction Identity Rhizomania disease of sugar beet was first reported in Italy Name: Beet necrotic yellow vein virus (Canova, 1959) and has since been reported in more than Acronym: BNYVV 25 countries. The disease causes economic loss to sugar beet Taxonomic position: Viruses, Benyvirus (Beta vulgaris var. saccharifera) by reducing yield. Rhizomania EPPO computer code: BNYVV0 is caused by Beet necrotic yellow vein virus (BNYVV), which Phytosanitary categorization: EPPO A2 list no. 160; EU is transmitted by the soil protozoan, Polymyxa betae (family Annex designation I/B. Plasmodiophoraceae). The virus can survive in P. betae cystosori for more than 15 years. The symptoms of rhizomania, Detection also known as ‘root madness’, include root bearding, stunting, chlorosis of leaves, yellow veining and necrosis of leaf veins. The disease affects all subspecies of Beta vulgaris, including The virus is spread by movement of soil, primarily on machinery, sugar beet (Beta vulgaris subsp. maritime), fodder beet (Beta sugar beet roots, stecklings, other root crops, such as potato, vulgaris subsp. vulgaris), red beet (Beta vulgaris subsp. cicla), and in composts and soil.
    [Show full text]
  • In Plant Physiology
    IN PLANT PHYSIOLOGY Did Silencing Suppression Counter-Defensive Strategy Contribute To Origin And Evolution Of The Triple Gene Block Coding For Plant Virus Movement Proteins? Sergey Y. Morozov and Andrey G. Solovyev Journal Name: Frontiers in Plant Science ISSN: 1664-462X Article type: Opinion Article Received on: 30 May 2012 Accepted on: 05 Jun 2012 Provisional PDF published on: 05 Jun 2012 Frontiers website link: www.frontiersin.org Citation: Morozov SY and Solovyev AG(2012) Did Silencing Suppression Counter-Defensive Strategy Contribute To Origin And Evolution Of The Triple Gene Block Coding For Plant Virus Movement Proteins?. Front. Physio. 3:136. doi:10.3389/fpls.2012.00136 Article URL: http://www.frontiersin.org/Journal/FullText.aspx?s=907& name=plant%20physiology&ART_DOI=10.3389/fpls.2012.00136 (If clicking on the link doesn't work, try copying and pasting it into your browser.) Copyright statement: © 2012 Morozov and Solovyev. This is an open‐access article distributed under the terms of the Creative Commons Attribution Non Commercial License, which permits non-commercial use, distribution, and reproduction in other forums, provided the original authors and source are credited. This Provisional PDF corresponds to the article as it appeared upon acceptance, after rigorous peer-review. Fully formatted PDF and full text (HTML) versions will be made available soon. 1 OPINION ARTICLE 2 3 Did Silencing Suppression Counter-Defensive Strategy 4 Contribute To Origin And Evolution Of The Triple Gene Block 5 Coding For Plant Virus Movement Proteins? 6 7 Sergey Y. Morozov*, Andrey G. Solovyev 8 9 Belozersky Institute of Physico-Chemical Biology, Moscow State University, Moscow, 10 Russia 11 12 Correspondence: 13 Sergey Y.
    [Show full text]
  • Viruses Affecting Tropical and Subtropical Crops: Biology, 1 Diversity, Management
    Viruses Affecting Tropical and Subtropical Crops: Biology, 1 Diversity, Management Gustavo Fermin,1* Jeanmarie Verchot,2 Abdolbaset Azizi3 and Paula Tennant4 1Instituto Jardín Botánico de Mérida, Faculty of Sciences, Universidad de Los Andes, Mérida, Venezuela; 2Department of Entomology and Plant Pathology, Oklahoma State University, Stillwater, Oklahoma, USA; 3Department of Plant Pathology, Faculty of Agriculture, Tarbiat Modares University, Tehran, Iran; 4Department of Life Sciences, The University of the West Indies, Mona Campus, Jamaica 1.1 Introduction of various basic concepts and phenomena in biology (Pumplin and Voinnet, 2013; Scholthof, Viruses are the most abundant biological en- 2014). However, they have also long been tities throughout marine and terrestrial eco- considered as disease-causing entities and systems. They interact with all life forms, are regarded as major causes of considerable including archaea, bacteria and eukaryotic losses in food crop production. Pathogenic organisms and are present in natural or agri- viruses imperil food security by decimating cultural ecosystems, essentially wherever life crop harvests as well as reducing the quality forms can be found (Roossinck, 2010). The of produce, thereby lowering profitability. concept of a virus challenges the way we de- This is particularly so in the tropics and fine life, especially since the recent discover- subtropics where there are ideal conditions ies of viruses that possess ribosomal genes. throughout the year for the perpetuation of These discoveries include the surprisingly the pathogens along with their vectors. Vir- large viruses of the Mimiviridae (Claverie and uses account for almost half of the emerging Abergel, 2012; Yutin et al., 2013), the Pan- infectious plant diseases (Anderson et al., doraviruses that lack phylogenetic affinity 2004).
    [Show full text]
  • ICTV Code Assigned: 2011.001Ag Officers)
    This form should be used for all taxonomic proposals. Please complete all those modules that are applicable (and then delete the unwanted sections). For guidance, see the notes written in blue and the separate document “Help with completing a taxonomic proposal” Please try to keep related proposals within a single document; you can copy the modules to create more than one genus within a new family, for example. MODULE 1: TITLE, AUTHORS, etc (to be completed by ICTV Code assigned: 2011.001aG officers) Short title: Change existing virus species names to non-Latinized binomials (e.g. 6 new species in the genus Zetavirus) Modules attached 1 2 3 4 5 (modules 1 and 9 are required) 6 7 8 9 Author(s) with e-mail address(es) of the proposer: Van Regenmortel Marc, [email protected] Burke Donald, [email protected] Calisher Charles, [email protected] Dietzgen Ralf, [email protected] Fauquet Claude, [email protected] Ghabrial Said, [email protected] Jahrling Peter, [email protected] Johnson Karl, [email protected] Holbrook Michael, [email protected] Horzinek Marian, [email protected] Keil Guenther, [email protected] Kuhn Jens, [email protected] Mahy Brian, [email protected] Martelli Giovanni, [email protected] Pringle Craig, [email protected] Rybicki Ed, [email protected] Skern Tim, [email protected] Tesh Robert, [email protected] Wahl-Jensen Victoria, [email protected] Walker Peter, [email protected] Weaver Scott, [email protected] List the ICTV study group(s) that have seen this proposal: A list of study groups and contacts is provided at http://www.ictvonline.org/subcommittees.asp .
    [Show full text]
  • Plant-Based Vaccines: the Way Ahead?
    viruses Review Plant-Based Vaccines: The Way Ahead? Zacharie LeBlanc 1,*, Peter Waterhouse 1,2 and Julia Bally 1,* 1 Centre for Agriculture and the Bioeconomy, Queensland University of Technology (QUT), Brisbane, QLD 4000, Australia; [email protected] 2 ARC Centre of Excellence for Plant Success in Nature and Agriculture, Queensland University of Technology (QUT), Brisbane, QLD 4000, Australia * Correspondence: [email protected] (Z.L.); [email protected] (J.B.) Abstract: Severe virus outbreaks are occurring more often and spreading faster and further than ever. Preparedness plans based on lessons learned from past epidemics can guide behavioral and pharmacological interventions to contain and treat emergent diseases. Although conventional bi- ologics production systems can meet the pharmaceutical needs of a community at homeostasis, the COVID-19 pandemic has created an abrupt rise in demand for vaccines and therapeutics that highlight the gaps in this supply chain’s ability to quickly develop and produce biologics in emer- gency situations given a short lead time. Considering the projected requirements for COVID-19 vaccines and the necessity for expedited large scale manufacture the capabilities of current biologics production systems should be surveyed to determine their applicability to pandemic preparedness. Plant-based biologics production systems have progressed to a state of commercial viability in the past 30 years with the capacity for production of complex, glycosylated, “mammalian compatible” molecules in a system with comparatively low production costs, high scalability, and production flexibility. Continued research drives the expansion of plant virus-based tools for harnessing the full production capacity from the plant biomass in transient systems.
    [Show full text]
  • Evidence to Support Safe Return to Clinical Practice by Oral Health Professionals in Canada During the COVID-19 Pandemic: a Repo
    Evidence to support safe return to clinical practice by oral health professionals in Canada during the COVID-19 pandemic: A report prepared for the Office of the Chief Dental Officer of Canada. November 2020 update This evidence synthesis was prepared for the Office of the Chief Dental Officer, based on a comprehensive review under contract by the following: Paul Allison, Faculty of Dentistry, McGill University Raphael Freitas de Souza, Faculty of Dentistry, McGill University Lilian Aboud, Faculty of Dentistry, McGill University Martin Morris, Library, McGill University November 30th, 2020 1 Contents Page Introduction 3 Project goal and specific objectives 3 Methods used to identify and include relevant literature 4 Report structure 5 Summary of update report 5 Report results a) Which patients are at greater risk of the consequences of COVID-19 and so 7 consideration should be given to delaying elective in-person oral health care? b) What are the signs and symptoms of COVID-19 that oral health professionals 9 should screen for prior to providing in-person health care? c) What evidence exists to support patient scheduling, waiting and other non- treatment management measures for in-person oral health care? 10 d) What evidence exists to support the use of various forms of personal protective equipment (PPE) while providing in-person oral health care? 13 e) What evidence exists to support the decontamination and re-use of PPE? 15 f) What evidence exists concerning the provision of aerosol-generating 16 procedures (AGP) as part of in-person
    [Show full text]
  • Genetic Diversity of Rice Stripe Necrosis Virus and New Insights Into Evolution of the Genus Benyvirus
    viruses Article Genetic Diversity of Rice stripe necrosis virus and New Insights into Evolution of the Genus Benyvirus Issiaka Bagayoko 1,†, Marcos Giovanni Celli 2,3,†, Gustavo Romay 1, Nils Poulicard 4 , Agnès Pinel-Galzi 4, Charlotte Julian 4,5, Denis Filloux 4,5, Philippe Roumagnac 4,5 , Drissa Sérémé 6 , Claude Bragard 1 and Eugénie Hébrard 4,* 1 Earth and Life Institute, Applied Microbiology-Phytopathology, Université Catholique de Louvain (UCLouvain), Croix du Sud 2 Bte L07.05.03, 1348 Louvain-la-Neuve, Belgium; [email protected] (I.B.); [email protected] (G.R.); [email protected] (C.B.) 2 Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET), Buenos Aires 1425, Argentina; [email protected] 3 Instituto de Patología Vegetal (IPAVE, CIAP, INTA), Camino 60 cuadras Km 5, Cordoba 5119, Argentina 4 PHIM, Plant Health Institute, Université de Montpellier, IRD, INRAE, CIRAD, SupAgro, 911 Avenue Agropolis, 34394 Montpellier, France; [email protected] (N.P.); [email protected] (A.P.-G.); [email protected] (C.J.); denis.fi[email protected] (D.F.); [email protected] (P.R.) 5 CIRAD, UMR PHIM, Campus International de Montferrier-Baillarguet, 34398 Montpellier, France 6 Laboratoire de Laboratoire de Virologie et de Biotechnologies Végétales, INERA—Institut de l’Environnement et de Recherches Agricoles, LMI Patho-Bios, Ouagadougou 01 BP 476, Burkina Faso; [email protected] * Correspondence: [email protected] † These authors contributed equally to this work. Abstract: The rice stripe necrosis virus (RSNV) has been reported to infect rice in several countries Citation: Bagayoko, I.; Celli, M.G.; in Africa and South America, but limited genomic data are currently publicly available.
    [Show full text]
  • (12) Patent Application Publication (10) Pub. No.: US 2013/0267429 A1 GARDNER Et Al
    US 20130267,429A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2013/0267429 A1 GARDNER et al. (43) Pub. Date: Oct. 10, 2013 (54) BIOLOGICAL SAMPLE TARGET (60) Provisional application No. 61/628.224, filed on Oct. CLASSIFICATION, DETECTION AND 26, 2011. SELECTION METHODS, AND RELATED ARRAYS AND OLGONUCLEOTIDE PROBES (71) Applicant: Lawrence Livermore National Publication Classification Security, LLC, Livermore, CA (US) (51) Int. Cl. (72) Inventors: Shea GARDNER, Oakland, CA (US); G06F 9/20 (2006.01) CrystalKevin MCLOUGHILIN, J. JAING, Livermore, Oakland, CA CA(US); (52) s g4. (2006.01) US):A ity's Th SLEZAK. issurancisco, San Franci CPCAV e. we.............. G06F 19/20 (2013.01): CI2O 1/6876 Alameda, CA (US); Marisa Wailam (2013.01) TORRES, Pleasanton, CA (US) USPC ................................................. 506/8:506/16 (21) Appl. No.: 13/886,172 (22) Filed: May 2, 2013 (57) ABSTRACT Related U.S. Application Data (63) Continuation-in-part of application No. 13/304.276, Biological sample target classification, detection and selec filed on Nov. 23, 2011, which is a continuation-in-part tion methods are described, together with related arrays and of application No. 12/643,903, filed on Dec. 21, 2009. oligonucleotide probes. Patent Application Publication Oct. 10, 2013 Sheet 1 of 19 US 2013/0267429 A1 All Filter With genomes Vmatch to in family, reOWe as of nonspecific Family specific April 2007 regions & 17 nt regions only >g1 . > 25 nt (bacterial AATCCTGACAGGGACAG and human) >g 1 >g2 AATCCTGACAGGGACAGTTT, ........... G AGCAAAAACAAGCAGTT >g 2 >g3 AGCAA, , , ..., , , , , , , , , , ... AGTGACAGTCAT. GGGGTCAAACGGGAG >g3 A. GGGGCAATACTGGGA., , , , , , , , ACCCTA >g4 -as-a-do A.
    [Show full text]
  • Hepatitis E Virus Genome Structure and Replication Strategy
    Hepatitis E Virus Genome Structure and Replication Strategy Scott P. Kenney1 and Xiang-Jin Meng2 1Food Animal Health Research Program, The Ohio State University, Wooster, Ohio 44691 2Department of Biomedical Sciences and Pathobiology, Virginia Polytechnic Institute and State University, Blacksburg, Virginia 24061 Correspondence: [email protected]; [email protected] Hepatitis E virus (HEV) possesses many of the features of other positive-stranded RNA viruses but also adds HEV-specific nuances, making its virus–host interactions unique. Slow virus replication kinetics and fastidious growth conditions, coupled with the historical lack of an efficient cell culture system to propagate the virus, have left many gaps in our understanding of its structure and replication cycle. Recent advances in culturing selected strains of HEV and resolving the 3D structure of the viral capsid are filling in knowledge gaps, but HEV remains an extremely understudied pathogen. Many steps in the HEV life cycle and many aspects of HEV pathogenesis remain unknown, such as the host and viral factors that determine cross- species infection, the HEV-specific receptor(s) on host cells, what determines HEV chronicity and the ability to replicate in extrahepatic sites, and what regulates processing of the open reading frame 1 (ORF1) nonstructural polyprotein. epatitis E virus (HEV) is one of the leading incidence of HEV infection within the United Hcauses of acute viral hepatitis worldwide. In States is unknown owing to the lack of Food and developing countries with poor sanitation con- Drug Administration (FDA)–approved diag- ditions, an estimated 20 million infections occur nostics for testing patients. Further complicat- annually with approximately 3.3 million acute ing diagnosis, the incubation period of hepatitis HEV cases, resulting in about 56,600 deaths per E following exposure to the virus ranges from 2 year (Lozano et al.
    [Show full text]
  • The Widespread Occurrence and Potential Biological Roles of Endogenous Viral Elements in Insect Genomes
    The Widespread Occurrence and Potential Biological Roles of Endogenous Viral Elements in Insect Genomes Carol D. Blair1, Ken E. Olson1 and Mariangela Bonizzoni2* 1Arthropod-borne and Infectious Diseases Laboratory, Department of Microbiology, Immunology and Pathology, Colorado State University, Fort Collins, CO, USA. 2Department of Biology and Biotechnology, University of Pavia, Pavia, Italy. *Correspondence: [email protected] htps://doi.org/10.21775/cimb.034.013 Abstract insect biology, particularly antiviral immunity, and Modern genomic sequencing and bioinformatics suggest directions for future research. approaches have detected numerous examples of DNA sequences derived from DNA and RNA virus genomes integrated into both vertebrate and insect Introduction: defnition of genomes. Retroviruses encode RNA-dependent endogenous viral elements DNA polymerases (reverse transcriptases) and and the surprising discovery of integrases that convert their RNA viral genomes those from non-retroviral RNA into DNA proviruses and facilitate proviral DNA viruses integration into the host genome. Surprisingly, Interactions between viruses and their hosts occur DNA sequences derived from RNA viruses that at many levels. Viruses evolve rapidly through do not encode these enzymes also occur in host genetic drif and/or natural selection and can genomes. Non-retroviral integrated RNA virus infuence the genetic structures of host popula- sequences (NIRVS) occur at relatively high fre- tions, especially if viral infection results in disease quency in the genomes of the arboviral vectors and mortality. A classic example of virus and host Aedes aegypti and Aedes albopictus, are not distrib- co-evolution is the natural experiment initiated uted randomly and possibly contribute to mosquito by the release of highly pathogenic myxoma virus antiviral immunity, suggesting these mosquitoes into the naive Australian wild rabbit population could serve as a model system for unravelling the in 1950, followed by rapid development of resist- function of NIRVS.
    [Show full text]
  • Ribes Americanum) with Distinct Genome Features Reshapes Classification in the Tymovirales
    viruses Article A Virus in American Blackcurrant (Ribes americanum) with Distinct Genome Features Reshapes Classification in the Tymovirales Thanuja Thekke-Veetil 1, Thien Ho 1, Joseph D. Postman 2, Robert R. Martin 3 ID and Ioannis E. Tzanetakis 1,* ID 1 Department of Plant Pathology, Division of Agriculture, University of Arkansas System, Fayetteville, AR 72701, USA; [email protected] (T.T.-V.); [email protected] (T.H.) 2 National Clonal Germplasm Repository, United States Department of Agriculture, Corvallis, OR 97333, USA; [email protected] 3 Horticultural Crops Research Unit, United States Department of Agriculture, Corvallis, OR 97331, USA; [email protected] * Correspondence: [email protected]; Tel.: +1-479-575-3180; Fax: +1-479-575-7601 Received: 21 April 2018; Accepted: 26 July 2018; Published: 3 August 2018 Abstract: A novel virus with distinct genome features was discovered by high throughput sequencing in a symptomatic blackcurrant plant. The virus, tentatively named Ribes americanum virus A (RAVA), has distinct genome organization and molecular features bridging genera in the order Tymovirales. The genome consists of 7106 nucleotides excluding the poly(A) tail. Five open reading frames were identified, with the first encoding a putative viral replicase with methyl transferase (MTR), AlkB, helicase, and RNA dependent RNA polymerase (RdRp) domains. The genome organization downstream of the replicase resembles that of members of the order Tymovirales with an unconventional triple gene block (TGB) movement protein arrangement with none of the other four putative proteins exhibiting significant homology to viral proteins. Phylogenetic analysis using replicase conserved motifs loosely placed RAVA within the Betaflexiviridae.
    [Show full text]
  • Plant Virus RNA Replication
    eLS Plant Virus RNA Replication Alberto Carbonell*, Juan Antonio García, Carmen Simón-Mateo and Carmen Hernández *Corresponding author: Alberto Carbonell ([email protected]) A22338 Author Names and Affiliations Alberto Carbonell, Instituto de Biología Molecular y Celular de Plantas (CSIC-UPV), Campus UPV, Valencia, Spain Juan Antonio García, Centro Nacional de Biotecnología (CSIC), Madrid, Spain Carmen Simón-Mateo, Centro Nacional de Biotecnología (CSIC), Madrid, Spain Carmen Hernández, Instituto de Biología Molecular y Celular de Plantas (CSIC-UPV), Campus UPV, Valencia, Spain *Advanced article Article Contents • Introduction • Replication cycles and sites of replication of plant RNA viruses • Structure and dynamics of viral replication complexes • Viral proteins involved in plant virus RNA replication • Host proteins involved in plant virus RNA replication • Functions of viral RNA in genome replication • Concluding remarks Abstract Plant RNA viruses are obligate intracellular parasites with single-stranded (ss) or double- stranded RNA genome(s) generally encapsidated but rarely enveloped. For viruses with ssRNA genomes, the polarity of the infectious RNA (positive or negative) and the presence of one or more genomic RNA segments are the features that mostly determine the molecular mechanisms governing the replication process. RNA viruses cannot penetrate plant cell walls unaided, and must enter the cellular cytoplasm through mechanically-induced wounds or assisted by a 1 biological vector. After desencapsidation, their genome remains in the cytoplasm where it is translated, replicated, and encapsidated in a coupled manner. Replication occurs in large viral replication complexes (VRCs), tethered to modified membranes of cellular organelles and composed by the viral RNA templates and by viral and host proteins.
    [Show full text]