US 20130267,429A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2013/0267429 A1 GARDNER et al. (43) Pub. Date: Oct. 10, 2013 (54) BIOLOGICAL SAMPLE TARGET (60) Provisional application No. 61/628.224, filed on Oct. CLASSIFICATION, DETECTION AND 26, 2011. SELECTION METHODS, AND RELATED ARRAYS AND OLGONUCLEOTIDE PROBES (71) Applicant: Lawrence Livermore National Publication Classification Security, LLC, Livermore, CA (US) (51) Int. Cl. (72) Inventors: Shea GARDNER, Oakland, CA (US); G06F 9/20 (2006.01) CrystalKevin MCLOUGHILIN, J. JAING, Livermore, Oakland, CA CA(US); (52) s g4. (2006.01) US):A ity's Th SLEZAK. issurancisco, San Franci CPCAV e. we.............. G06F 19/20 (2013.01): CI2O 1/6876 Alameda, CA (US); Marisa Wailam (2013.01) TORRES, Pleasanton, CA (US) USPC ................................................. 506/8:506/16 (21) Appl. No.: 13/886,172 (22) Filed: May 2, 2013 (57) ABSTRACT Related U.S. Application Data (63) Continuation-in-part of application No. 13/304.276, Biological sample target classification, detection and selec filed on Nov. 23, 2011, which is a continuation-in-part tion methods are described, together with related arrays and of application No. 12/643,903, filed on Dec. 21, 2009. oligonucleotide probes. Patent Application Publication Oct. 10, 2013 Sheet 1 of 19 US 2013/0267429 A1 All Filter With genomes Vmatch to in family, reOWe as of nonspecific Family specific April 2007 regions & 17 nt regions only >g1 . > 25 nt (bacterial AATCCTGACAGGGACAG and human) >g 1 >g2 AATCCTGACAGGGACAGTTT, ........... G AGCAAAAACAAGCAGTT >g 2 >g3 AGCAA, , , ..., , , , , , , , , , ... AGTGACAGTCAT. GGGGTCAAACGGGAG >g3 A. GGGGCAATACTGGGA., , , , , , , , ACCCTA >g4 -as-a-do A. TTGTccTAATTFCAA. Database of g4. A i"GCCAATTCAAACAGGCTAAAA human r +non-target Viral and bacterial families Probe candidates, favoring those with good length, entropy, Tm, and hairpin and homodimer avoidance Primer 3 and >g X Unafold ESAS333-sto AGCAA...... AGGACAGCAG 3i:iiisi-GGA.AccCTAGA>g TTTTGTCCTAAT iSEESSTAAAA GCTCTGATGTG...... GAffix:bAAGA Patent Application Publication Oct. 10, 2013 Sheet 2 of 19 US 2013/0267429 A1 Probe clusters ranked by conservation Cluster Down based on Select from shared Candidate probes probes -----------as Greedy algorithm Blast probe candidates favoring conserved against genomes and predict array annealing, probes picks until allowing mismatches all genomes based on experi represented by mentally determined >50 (viral) or properties > 15 (bacterial) - probes - Final Array Design, V2 170,000 viral 8,000 bacterial 1,200 human viral F.G. 1B response gene 20,00 Virochip (DeRise&Wang USCF) 2,600 random control Patent Application Publication Oct. 10, 2013 Sheet 3 of 19 US 2013/0267429 A1 Probe Counts Log-Odds 438 expe iral diarrhea virus 1BV133738 223 BOW ine viral diarrhea virus Complete RNA 430 expected sis Bovine viral diarrhea virus 1strain Singer Arg 438 expe BOwine viral diarrhea viruS 1 SD1 222 polyprotein gene 436 expected Bovine viral diarrhea viruS 1 223 detected 439 expec BOwine wira diarrhea virus 1 BOwine viral 221 detected diarrhea virus strain Oregon C24V 434 6.E. e Bovine viral diarrhea virus 1 Pestivirus type 1 42135, Bovine viral diarrhea virus Pestivirus 215 detected type 1 noncytopathic genomic RNA 407 expected BOwine via diarrhea virus Pestivirus 211 detected type 1 cytopathic genomic RNA 487 expect: 38 220E is Bovine viral diarrhea virus 1 strain KE9 434 expec 3.9 BOvine viral diarrhea virus Strain ZM, 95 27 437 expected BOwine viral diarrhea ViruS 1 BOwine viral is diarrhea virus WEDEVAC ORF1 for 35 expec Bovine viral diarrhea virus 1 Bovine viral 218 dest diarrhea virus 412 expected 9035 Bovine viral diarrhea virus 2 Bovine viral 2O2 detected diarrhea virus genotype 2 426 expecte 203 de BOwine viral diarrhea virus 2 New York 93 416 &E BOwine viral diarrhea virus 2 BOwine viral diarrhea virus genotype 2 strain p11C BOwine viral diarrhea virus 2 BOvine viral 4226 fee diarrhea virus genotype 2 strain p24515 856 expecte d 99 detected Clostridium leptum GF:643631 ... (Clostridium leptum DSM753 916 expecte #3 detected Anaerotruncus ColihominisGF:651056 (Anaerotruncus calihominis DSM 1019 ex ected" detected COStridium Scindens GF:651069 68 detected (Clostridium scindens ATCC 35704 856 expected Clostridium leptum|GF:636890 43 detected (Clostridium leptum DSM753 FIG. 2 Patent Application Publication Oct. 10, 2013 Sheet 4 of 19 US 2013/0267429 A1 Patent Application Publication Oct. 10, 2013 Sheet 5 of 19 US 2013/0267429 A1 sppo-6oT Patent Application Publication Oct. 10, 2013 Sheet 7 of 19 US 2013/0267429 A1 Patent Application Publication Oct. 10, 2013 Sheet 8 of 19 US 2013/0267429 A1 Probe Counts Log-Odds 790 expected 4777 & detected&B is Escherichia COi CFTO73 Escherichia COE24377A 5 g Shigella dysenteriae Sd197 1466.4 Shigellaflexneri5 str. 8401 0.8 Escherichia Coli 042 from Sander on S Aug 24 2005 2.52PM a 6 Escherichia Coli HS 825 expected 3884 Escherichia ColiGE630814 t s d (Escherichia coli B71 Escherichia 1831 expeiei" ce 1350.5 Escherichia Coli U 89 & Sid 401 expected Norwalk virus NorOvirus 77 deed Hu/NLVIGH/Neustrelitz260/2000/DE from Germany 409 expected Norwalk virus Norwalk-like virus genomic 77 ed RNA, isolate: Saitana U18 412 expected Norwalk virus Norwalk-like virus genomic 76 died RNA, isolate Saitana U201 425 expected7ged Norwalk virus Human Calcivinus strain Mc37 415 expected 63 detecteds Dehalococcoides sp. CBDB1 858 expected Mariprofundus ferroCXydanslCF:636226 eleted (Mariprofundus ferroCXydans PV-1 858 expected Mariprofundus ferroCXydanslgF.632951 ori (Mariprofundus ferroCXydans PV-1 84 detected marine gamma proteobacterium 889 *Pled HTCC20801GF:630922 (marine 952 expected97 detected gammaproteobacterium HTCC22O7IGF63298 B (marine gamma proteobacterium HTCC2207 89 detected gammaproteobacterium MTCC22O7IGF:636223 952 expected (gamma proteobacterium HTCC2207 marine etected Endori?tiapersephonelGF:637262 1129 expected (Endoriftia persephone 11 detected marine gamma proteobacterium 1011 expected TO detected HTCC21431GF-630924 (marine 1145 expected Reinekea sp. MED297IGF-630968 (Reinekea etected sp. MED297 Reinekea sp. MED297, unfinished FIG. 7 Patent Application Publication Oct. 10, 2013 Sheet 9 of 19 US 2013/0267429 A1 Probe Counts Log-Odds 61 expeted 862.8 51 detected is Chicken anemia virus isolate 3-1 from Malaysia 61 expeged Chicken anemia virus isolate AH6 from China 51 detecte 61 S. Chicken anemia virus from China 8. detected 860 s Sexpeted Chicken anemia Virus isolate C14- S S. expegledSE 4. Chicken anemia virus isolate SMSC-P9WT 5 51 detecte E. Chicken anemia viruS eleCE "eel ed E Serratia protearnaculans 568 eteCte Providencia StuartiCF6499.08 (Providencia stuartii ATCC 25827 Sodalis glossinidius Str, "morsitans' : Pectobacterium atroSepticum Erwina & carotovora subsp. atroseptica SCR 1043 it. Erwinia chrysanthem GF:188098 (Erwinia i s Chrysanthemi NO STRAN sequence from 9 1678 expected Serratia proteamaculans|GF:630880 2 & s (Serratia proteamaculans 568 Serratia L 95 expected Candidate division TM7 isolate 14 detected TM7biGF:636167 (candidate division 858 expected Mariprofundus ferrOOxydans GF:636228 (Mariprofundus ferrooxydans PV-1 29 Ef ected Endoritia persephonetGF:637262 68 detected (Endoriftia persephone marine gammaproteobacterium 1011 expected HTCC2143IGF-630924 (marine elected gammaproteobacterium HTCC22O7IGF-632981 952 expected- (marine gamma proteobacterium HTCC2207 952 t 54 detected gamma proteobacterium HTCC22O7IGF:636223 expec eader (gamma proteobacterium HTCC2207 marine 889 expected etected marine gamma proteobacterium 7 delee d HTCC208OIGF-630923 (marine Patent Application Publication Oct. 10, 2013 Sheet 10 of 19 US 2013/0267429 A1 Probe Counts Log-Odds etected StaphyloCOccuSaureus Subsp. aureuS MuSO 43 expected 900.5 StaphyloCOCCUS aureus Subsp. aurOUS 19 detected USA300 TCH959 plasmidpUSA300HOUMS StaphyloCOCCuSaureuS Subsp. aureuS Mu3 StaphyloCOCCuSaureus Subsp. aureus St. Newman 235 detected Shigella dysenteriae Sd197 Y 107 expected 55 detected Escherichia ColplasmidpAPEC-02-CoIV 33 expected y 16 detected Shigella Sonnel Ss046 plasmidpSSO46 SpE Escherichia CO, CFO73 147 expected Shigella dysenteriaelGF:447836 (Shigella O36 expeii detected dysenteriae M131649 from Sanger on Aug s f. StreptoCOCCussanguins SK36 51 expected LactoCOCCUS actis plasmid pGdh442 29 detected LactoCOCCUS lactis subsp. lactis plasmid pC305 14 expected 11 detected LactoCOCCUS lactisplasmidpSRQ800 16 expected 977.6 StreptoCOCCusthermophilus LMG 18311 972 expects elected 1252.7 is Streptococcus thermophilus CNRZ1066 997 exp StreptoCOCCUs thermophilus LMD-9 101 expecies StreptoCOCCusaureuS temperate 55 detected 12326 phage phlSLTIStaphyloCOCCUS phage phlSLT 160115 detectedC StaphyloCOCCuSaureuS bacteriophage 145 expected PVLIStaphyloCOCCUS prophage PWL. 96 deteed 177 expected 1244.5 StaphyloCOCCUS aureuSphage 114 deted philNMStaphyloCOCCUSphage phi\M 28 expected 12 detected EnterOCOCCuS faecalis V583 plasmidpTEF3 1092 1450 expected EnterOCOCCUS faecalis W583 etected F.G. 9 Patent Application Publication Oct. 10, 2013 Sheet 11 of 19 US 2013/0267429 A1 Alsued Patent Application Publication Oct. 10, 2013 Sheet 12 of 19 US 2013/0267429 A1 AISued Patent Application Publication Oct. 10, 2013 Sheet 13 of 19 US 2013/0267429 A1 Target specific - - - Non specific oro an as acao. -a- - Control o O. 2. OO. 4.6 O. O O. O Cyg a SAS ANY intensity distributions for an MDA v.2 array hybridized to a spiked mixture of vaccinia virus and HHV6B, for probes with and without target-specific