DOCSLIB.ORG

EMERGING INFECTIOUS DISEASES Volume 5 • Number 1 January–February 1999

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
EMERGING INFECTIOUS DISEASES Volume 5 • Number 1 January–February 1999 Contents EMERGING INFECTIOUS DISEASES Volume 5 Number 1 JanuaryFebruary 1999 International Update Hantavirus Emerging Viral Diseases: An Australian Perspective* 1 Long-Term Studies of Hantavirus 95 J. S. Mackenzie Reservoir Populations in the Southwestern United States: Rationale, Perspectives Potential, and Methods The Economic Impact of Staphylococcus 9 J.N. Mills,T.L. Yates, T.G. Ksiazek, aureus Infection in New York City Hospitals C.J. Peters, and J.E. Childs R.J. Rubin, C.A. Harrington, A. Poon, Long-Term Hantavirus Persistence 102 K. Dietrich, J.A. Greene, and A. Moiduddin in Rodent Populations in Central Arizona Socioeconomic and Behavioral Factors 18 K.D. Abbott, T.G. Ksiazek, and J.N. Mills Leading to Acquired Bacterial Resistance A Longitudinal Study of Sin Nombre 113 to Antibiotics in Developing Countries Virus Prevalence in Rodents, I.N. Okeke, A.Lamikanra, and R. Edelman Southeastern Arizona Campylobacter jejuniAn Emerging 28 A.J. Kuenzi, M.L. Morrison, D.E. Foodborne Pathogen Swann, P.C. Hardy, and G.T. Downard S.F. Altekruse, N.J. Stern, Statistical Sensitivity for Detection of 118 P.I. Fields, and D.L. Swerdlow Spatial and Temporal Patterns in Rodent Population Densities Synopses C.A. Parmenter, T.L. Yates, R.R. Comparative Genomics and Host 36 Parmenter, and J.L. Dunnum Resistance against Infectious Diseases Natural History of Sin Nombre 126 S. T. Qureshi, E. Skamene, and D. Malo Virus in Western Colorado Cyclospora: An Enigma Worth Unraveling 48 C.H. Calisher, W. Sweeney, J.N. Mills, and B.J. Beaty C.R. Sterling and Y.R. Ortega Using Monoclonal Antibodies to 54 Long-Term Studies of Hantavirus 135 Prevent Mucosal Transmission Reservoir Populations in the of Epidemic Infectious Diseases Southwestern United States: A Synthesis J.N. Mills, T.G. Ksiazek, C.J. Peters, L. Zeitlin, R.A. Cone, and K.J. Whaley and J.E. Childs Research Studies Dual and Recombinant Infections: 65 An Integral Part of the HIV Epidemic in Brazil A. Ramos, A. Tanuri, M. Schechter, Bank vole M.A. Rayfield, D.J. Hu, M.C. Cabral, C.I. (Clethrionomys Bandea, J. Baggs, and D. Pieniazek glareolus), Genetic Diversity and Distribution of 75 reservoir for Peromyscus-Borne Hantaviruses Puumala in North America virus. Photo by M. M.C. Monroe, S.P. Morzunov, A.M. Andera, Johnson, M.D. Bowen, H. Artsob, Mammal Image T. Yates, C.J. Peters, P.E. Rollin, Library of the T.G. Ksiazek, and S.T. Nichol American Climatic and Environmental Patterns 87 Society of Associated with Hantavirus Pulmonary Mammalogists. Syndrome, Four Corners Region, United States D.M. Engelthaler, D.G. Mosley, J.E. Cheek, C.E. Levy, K.K. Komatsu, P. Ettestad, T. Davis, D.T. Tanda, L. Miller, J. W. Frampton, R. Porter, and R.T. Bryan *Cover: Michael Eather (b. 1963) and Friends, Queensland, Australia. Two Worlds; synthethic polymer paint, natural pigments, shellac, and photocopied images on 75 boards; celebrating the Queensland Art Gallerys Centenary 1895-1995. Contents EMERGING INFECTIOUS DISEASES Volume 5 Number 1 JanuaryFebruary 1999 Dispatches Letters Proficiency of Clinical Laboratories 143 Navigational Instinct: A Reason Not 175 in and near Monterrey, Mexico, to to Live Trap Deer Mice in Residences Detect Vancomycin-Resistant Enterococci C.H. Calisher, W.P. Sweeney, L.C. McDonald, L.R. Garza, and J.J. Root, and B.J. Beaty W.R. Jarvis Bartonella quintana in Body Lice 176 Staphylococcus aureus with Reduced 147 Collected from Homeless Susceptibility to Vancomycin Isolated Persons in Russia from a Patient with Fatal Bacteremia E.B. Rydkina, V. Roux, E.M. Gagua, S.S. Rotun, V. McMath, D.J. Schoonmaker, A.B. Predtechenski, I.V. Tarasevich, and D. Raoult P.S. Maupin, F.C.Tenover, B.C. Hill, Tick-Transmitted Infections in 178 and D.A. Ackman Transvaal: Consider Rickettsia africae Candida dubliniensis Candidemia in 150 P. Fournier, J. Beytout, and D. Raoult Patients with Chemotherapy-Induced Extended-Spectrum Beta-Lactamase- 181 Neutropenia and Bone Marrow Producing Salmonella Enteritidis Transplantation in Trinidad and Tobago J.F.G.M. Meis, M. Ruhnke, B.P. Cherian, N. Singh, W.Charles, and P. Prabhakar B.E. De Pauw, F.C. Odds, New emm (M Protein Gene) Sequences 182 W. Siegert, and P.E. Verweij of Group A Streptococci Isolated Household Transmission of 154 from Malaysian Patients Streptococcus pneumoniae, F. Jamal, S. Pit, R. Facklam, and B. Beall Alberta, Canada Mutant Chemokine Receptor (CCR-5) 183 J.D. Kellner, A.P. Gibb, and Its Relevance to HIV Infection in Arabs J. Zhang, and H.R. Rabin Preventing Zoonotic Diseases in 159 I.H. Al-Sheikh, A. Rahi, and M. Al-Khalifa Immunocompromised Persons: The Role of Physicians and Veterinarians S. Grant and C.W. Olsen News and Notes Mycoplasma penetrans Bacteremia 164 Workshop on the Potential Role of 186 and Primary Antiphospholipid Syndrome Infectious Agents in Cardiovascular A. Yáñez, L. Cedillo, O. Neyrolles, Disease and Atherosclerosis E. Alonso, M. Prévost, Workshop on Risks Associated with 187 J. Rojas, H.L. Watson, Transmissible Spongiform A. Blanchard, and G.H. Cassell Encephalopathies (TSEs) Infectious Diarrhea in Tourists Staying in 168 USDA Report on Potential for 187 a Resort Hotel International Travelers to Transmit R.M. Hardie, P.G. Wall, Foreign Animal Diseases to U.S. P. Gott, M. Bardhan, and Livestock or Poultry C.L.R. Bartlett Second Annual Conference on 188 Vaccine Research, March 1999 International Scientific Forum on 188 Home Hygiene Commentary A Midcourse Assessment of 172 Hantavirus Pulmonary Syndrome Robert E. Shope Update International Editors update Emerging Viral Diseases: An Australian Perspective John S. Mackenzie The University of Queensland, Brisbane, Australia Dr. Mackenzie is professor because the inhabitants of Sydney were advised and head of the Department to boil the water before drinking it (25). of Microbiology and Parasi- The distribution and incidence of most of the tology, University of Queensland, Brisbane, Aus- recently described viral diseases (e.g., human tralia. His research interests herpesviruses 68 and hepatitis C and E viruses) include the epidemiology, in Australia are similar to those reported in other ecology, and molecular biol- industrialized nations (3). Recent data for ogy of mosquito-borne and emerging zoonotic viruses. hepatitis G in selected Australian populations also support this contention (26). With a few exceptions, emerging diseases in Vector-Borne Viral Diseases Australia are similar to those in other Australia has more than 70 arboviruses, but industrialized countries (1-8). Most exceptions relatively few cause human disease (27,28). The are either vector-borne or zoonotic viral diseases, most common arbovirus causing human disease the major focus of this update. The continuing is Ross River virus, an alphavirus, which causes emergence of antibiotic resistance is a worldwide an epidemic polyarthritis. Although Ross River problem. In Australia, antibiotic resistance is virus incidence has increased over the past being reported from a growing number of decade, the virus is not emerging; its increased organisms (9-15), often necessitating new case incidence is probably due to increased awareness management practices and guidelines (16,17). and recognition by general practitioners, Also, like other countries, Australia has had a improved diagnostic reagents, and increasing number of foodborne (18-22) and waterborne (23- encroachment of human habitation into or near 25) epidemics in the past few years; the major wetlands and other areas conducive to mosquito difference is that the higher incidence of breeding. The only indigenous virus that can be enterohemorrhagic Escherichia coli linked to called emerging is Barmah Forest virus, also outbreaks of hemolytic uremic syndrome is an alphavirus and also the cause of an epidemic associated with serotype O111:H- rather than polyarthritis-like disease. Associated with hu- serotype O157:H-, which is more common in man disease only since 1988 and increasing in other countries. Major waterborne epidemics or incidence as diagnostic reagents have become contamination of reservoirs due to Cryptosporidium available and clinicians have become aware of it, parvum have occurred over the past 3 years in the the virus has spread into new geographic areas, Eastern States of Australia (23-25), with the such as Western Australia (29,30). The two largest and most recent being a problem of mosquito-borne diseases of particular concern, contamination (in association with Giardia however, are importsJapanese encephalitis lamblia) in the Sydney water supply between (JE) and dengue viruses. July and September, 1998. However, despite this contamination, no increases in the number of Japanese Encephalitis Virus cases of diarrheal disease were reported, perhaps The first outbreak of JE in the Australian region occurred in Torres Strait, northern Address for correspondence: John S. Mackenzie, Depart- Australia, in 1995 (31). Three cases (two of which ment of Microbiology, The University of Queensland, were fatal) were reported from Badu Island in Brisbane, Qld 4072, Australia; fax: 61-7-3365-4620; e-mail: [email protected]. central Torres Strait, 2,000 km from the nearest Vol. 5, No. 1, JanuaryFebruary 19991 Emerging Infectious Diseases Update focus of JE virus activity in Bali. identical to the 1995 Torres Strait isolates, Seroepidemiologic studies showed that the virus including the acquisition of the 11 nucleotide was relatively widespread in the central and deletion (C.A. Johansen, R. Paru, S.A. Ritchie, A. northern islands with subclinical human
Load more

Recommended publications
  • Hantavirus Disease Were HPS Is More Common in Late Spring and Early Summer in Seropositive in One Study in the U.K
    Hantavirus Importance Hantaviruses are a large group of viruses that circulate asymptomatically in Disease rodents, insectivores and bats, but sometimes cause illnesses in humans. Some of these agents can occur in laboratory rodents or pet rats. Clinical cases in humans vary in Hantavirus Fever, severity: some hantaviruses tend to cause mild disease, typically with complete recovery; others frequently cause serious illnesses with case fatality rates of 30% or Hemorrhagic Fever with Renal higher. Hantavirus infections in people are fairly common in parts of Asia, Europe and Syndrome (HFRS), Nephropathia South America, but they seem to be less frequent in North America. Hantaviruses may Epidemica (NE), Hantavirus occasionally infect animals other than their usual hosts; however, there is currently no Pulmonary Syndrome (HPS), evidence that they cause any illnesses in these animals, with the possible exception of Hantavirus Cardiopulmonary nonhuman primates. Syndrome, Hemorrhagic Nephrosonephritis, Epidemic Etiology Hemorrhagic Fever, Korean Hantaviruses are members of the genus Orthohantavirus in the family Hantaviridae Hemorrhagic Fever and order Bunyavirales. As of 2017, 41 species of hantaviruses had officially accepted names, but there is ongoing debate about which viruses should be considered discrete species, and additional viruses have been discovered but not yet classified. Different Last Updated: September 2018 viruses tend to be associated with the two major clinical syndromes in humans, hemorrhagic fever with renal syndrome (HFRS) and hantavirus pulmonary (or cardiopulmonary) syndrome (HPS). However, this distinction is not absolute: viruses that are usually associated with HFRS have been infrequently linked to HPS and vice versa. A mild form of HFRS in Europe is commonly called nephropathia epidemica.
    [Show full text]
  • Hantavirus Infection: a Global Zoonotic Challenge
    VIROLOGICA SINICA DOI: 10.1007/s12250-016-3899-x REVIEW Hantavirus infection: a global zoonotic challenge Hong Jiang1#, Xuyang Zheng1#, Limei Wang2, Hong Du1, Pingzhong Wang1*, Xuefan Bai1* 1. Center for Infectious Diseases, Tangdu Hospital, Fourth Military Medical University, Xi’an 710032, China 2. Department of Microbiology, School of Basic Medicine, Fourth Military Medical University, Xi’an 710032, China Hantaviruses are comprised of tri-segmented negative sense single-stranded RNA, and are members of the Bunyaviridae family. Hantaviruses are distributed worldwide and are important zoonotic pathogens that can have severe adverse effects in humans. They are naturally maintained in specific reservoir hosts without inducing symptomatic infection. In humans, however, hantaviruses often cause two acute febrile diseases, hemorrhagic fever with renal syndrome (HFRS) and hantavirus cardiopulmonary syndrome (HCPS). In this paper, we review the epidemiology and epizootiology of hantavirus infections worldwide. KEYWORDS hantavirus; Bunyaviridae, zoonosis; hemorrhagic fever with renal syndrome; hantavirus cardiopulmonary syndrome INTRODUCTION syndrome (HFRS) and HCPS (Wang et al., 2012). Ac- cording to the latest data, it is estimated that more than Hantaviruses are members of the Bunyaviridae family 20,000 cases of hantavirus disease occur every year that are distributed worldwide. Hantaviruses are main- globally, with the majority occurring in Asia. Neverthe- tained in the environment via persistent infection in their less, the number of cases in the Americas and Europe is hosts. Humans can become infected with hantaviruses steadily increasing. In addition to the pathogenic hanta- through the inhalation of aerosols contaminated with the viruses, several other members of the genus have not virus concealed in the excreta, saliva, and urine of infec- been associated with human illness.
    [Show full text]
  • The Ecology of New World Rodent Borne Hemorrhagic Fevers
    THE ECOLOGY OF NEW WORLD RODENT BORNE HEMORRHAGIC FEVERS DARJN S. CARROLL , Centers for Disease Control and Prevention , National Centers for Infectious Diseases , Special Pathogens Branch , Atlanta , GA 30333 , USA EMILY JENTES , Centers for Disease Control and Prevention , National Centers for Infectious Diseases , Special Pathogens Branch , Atlanta , GA 30333, USA JAMES N. MILLS , Centers for Disease Control and Prevention , National Centers for Infectious Diseases, Special Pathogens Branch , Atlanta , GA 30333 , USA Abstract: Few, if any, human settlements are free of peridomestic rodent populations. The threat of rodent borne zoonotic diseases has been widely recognized since the bubonic plague outbreaks of the Middle Ages . In the last decades, outbreaks of human disease caused by the rodent borne hemorrhagic fever viruses , the arenaviruses (family Arenaviridae), and the hantaviruses (family Bunyaviridae, genus Hantaviru s) have again generated interest in the general public and scientific community regarding the biology of these types of diseases. Recent studie s have identified more than 30 new members of these two groups of viruses. Most are associated with rodents in the family Muridae and many are known to be pathogenic. Ongoing studies are investigating aspects of the ecology and systematics of these viruses and their reservoirs . Ecological studies are currently examining modes of transmission between members of the host species , and environmental factors associated with increased frequency of infection. Systematic research is identifying patterns of co-evolution between the viruses and their hosts. The overall goal of these research efforts is develop predictive models that will identify times and places of increased risk and. therefore provide an opportunity for risk reduction in these areas.
    [Show full text]
  • Mouse Anti-HFRS Virus, Hanta Strain Monoclonal Antibody
    SPECIFICATION SHEET Rev 110621MAB-S0006 Mouse Anti-HFRS Virus, Hanta strain Monoclonal Antibody Mouse, Monoclonal (HFRS Virus, Hanta strain) Cat. No. DMAB3487 Lot. No. (See product label) PRODUCT INFORMATION BACKGROUND Introduction: Hantaviruses (family Bunyaviridae, genus Han- Product Overview: Monoclonal Antibody to Hemorrhagic tavirus) are rodent-borne, zoonotic (acquired from animals), fever with renal syndrome (HFRS) Virus, Hanta Strain enveloped RNA viruses, and include the causative agents of Specificity: Specific for HFRS Virus. Strain: Hanta haemorrhagic fever with renal syndrome (HFRS). The viruses Immunogen: Inactivated virus particles that cause HFRS include Hanta, Dobrava, Seoul, and Puu- Clone: C963M mala. Dobrova and Hanta viruses cause a more severe HFRS Isotype: IgG1 with fever, haemorrhage, and renal failure, and a mortality rate Host animal: Mouse. Hybridization of Sp2/0 myeloma cells of up to 15%. The mildest form of HFRS is caused by Puu- with spleen cells from BALB/c mice. mala virus. Source: Ascites Keywords: Hemorrhagic fever with renal syndrome Virus; Format: Purified, Liquid HFRS virus, Hanta strain; HFRS virus; Hemorrhagic fever with Applications: Suitable for use in ELISA. Each laboratory renal syndrome Virus, Hanta strain; Hantaviruses; Bunyaviri- should determine an optimum working titer for use in its par- dae; Hantavirus; Hemorrhagic fever with renal syndrome Vi- ticular application. Other applications have not been tested rus; HFRS Virus Dobrava, Puumala, Hanta and Seoul Strains; but use in such assays
    [Show full text]
  • 7 X 11.5 Three Lines.P65
    Cambridge University Press 978-0-521-85447-4 - The Vector- and Rodent-Borne Diseases of Europe and North America: Their Distribution and Public Health Burden Norman G. Gratz Index More information Index Note: page numbers in italics refer to figures acrodermatitis chronica atrophicans 111, Afghanistan, malaria 44--5 122--3 African horse sickness 74 Aedes African tick bite fever 134 dengue virus 30--1, 32 agricultural practices, changes 160 dirofilariasis 212 aircraft Inkoo virus 27 disinfection 271--2 Jamestown Canyon virus 203--4 introduced vectors 271--2, 273 La Cross encephalitis 204--5 airport malaria 34--5, 49--51, 271--2, 273 Ockelbo virus 25 Albania snowshoe hare virus 205--6 Crimean--Congo Haemorrhagic fever 106 Tahyna virus 28 leishmaniasis 58--9 West Nile Virus 13--14, 19, 202 West Nile Virus 11--12 Aedes aegypti 8 alcoholic people, trench fever 85--6, 229--30 Americas 186, 195, 197 allergens/allergies importation 185, 276 chironomid haemoglobins 74 eradication 195 cockroaches 154--5, 267--8 Aedes albopictus midges 74 climate change impact 271 horses 216 control in Italy 180 mites 151--3, 262--6 introduction to Europe 156--7 tick 158 USA 197 Alphavirus 191--5 introduction 271--3, 276 Amblyomma americanum 245, 246, 248, 251 Aedes atropalpus 157 tick paralysis 257--8 Aedes bahamensis 273 tularaemia 257 Aedes japonicus 157 Amblyomma maculatum 257--8 introduction to US 272, 273 Americas Aedes taeniorhynchus 194 arboviruses 185--7 dirofilariasis 212 dengue 186 Aedes togoi 273 epidemic typhus 187 370 © Cambridge University Press www.cambridge.org Cambridge University Press 978-0-521-85447-4 - The Vector- and Rodent-Borne Diseases of Europe and North America: Their Distribution and Public Health Burden Norman G.
    [Show full text]
  • Ecology of Neglected Rodent-Borne American Orthohantaviruses
    pathogens Review Ecology of Neglected Rodent-Borne American Orthohantaviruses Nathaniel Mull 1,*, Reilly Jackson 1, Tarja Sironen 2,3 and Kristian M. Forbes 1 1 Department of Biological Sciences, University of Arkansas, Fayetteville, AR 72701, USA; [email protected] (R.J.); [email protected] (K.M.F.) 2 Department of Virology, University of Helsinki, 00290 Helsinki, Finland; Tarja.Sironen@helsinki.fi 3 Department of Veterinary Biosciences, University of Helsinki, 00790 Helsinki, Finland * Correspondence: [email protected] Received: 9 April 2020; Accepted: 24 April 2020; Published: 26 April 2020 Abstract: The number of documented American orthohantaviruses has increased significantly over recent decades, but most fundamental research has remained focused on just two of them: Andes virus (ANDV) and Sin Nombre virus (SNV). The majority of American orthohantaviruses are known to cause disease in humans, and most of these pathogenic strains were not described prior to human cases, indicating the importance of understanding all members of the virus clade. In this review, we summarize information on the ecology of under-studied rodent-borne American orthohantaviruses to form general conclusions and highlight important gaps in knowledge. Information regarding the presence and genetic diversity of many orthohantaviruses throughout the distributional range of their hosts is minimal and would significantly benefit from virus isolations to indicate a reservoir role. Additionally, few studies have investigated the mechanisms underlying transmission routes and factors affecting the environmental persistence of orthohantaviruses, limiting our understanding of factors driving prevalence fluctuations. As landscapes continue to change, host ranges and human exposure to orthohantaviruses likely will as well. Research on the ecology of neglected orthohantaviruses is necessary for understanding both current and future threats to human health.
    [Show full text]
  • (12) Patent Application Publication (10) Pub. No.: US 2013/0267429 A1 GARDNER Et Al
    US 20130267,429A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2013/0267429 A1 GARDNER et al. (43) Pub. Date: Oct. 10, 2013 (54) BIOLOGICAL SAMPLE TARGET (60) Provisional application No. 61/628.224, filed on Oct. CLASSIFICATION, DETECTION AND 26, 2011. SELECTION METHODS, AND RELATED ARRAYS AND OLGONUCLEOTIDE PROBES (71) Applicant: Lawrence Livermore National Publication Classification Security, LLC, Livermore, CA (US) (51) Int. Cl. (72) Inventors: Shea GARDNER, Oakland, CA (US); G06F 9/20 (2006.01) CrystalKevin MCLOUGHILIN, J. JAING, Livermore, Oakland, CA CA(US); (52) s g4. (2006.01) US):A ity's Th SLEZAK. issurancisco, San Franci CPCAV e. we.............. G06F 19/20 (2013.01): CI2O 1/6876 Alameda, CA (US); Marisa Wailam (2013.01) TORRES, Pleasanton, CA (US) USPC ................................................. 506/8:506/16 (21) Appl. No.: 13/886,172 (22) Filed: May 2, 2013 (57) ABSTRACT Related U.S. Application Data (63) Continuation-in-part of application No. 13/304.276, Biological sample target classification, detection and selec filed on Nov. 23, 2011, which is a continuation-in-part tion methods are described, together with related arrays and of application No. 12/643,903, filed on Dec. 21, 2009. oligonucleotide probes. Patent Application Publication Oct. 10, 2013 Sheet 1 of 19 US 2013/0267429 A1 All Filter With genomes Vmatch to in family, reOWe as of nonspecific Family specific April 2007 regions & 17 nt regions only >g1 . > 25 nt (bacterial AATCCTGACAGGGACAG and human) >g 1 >g2 AATCCTGACAGGGACAGTTT, ........... G AGCAAAAACAAGCAGTT >g 2 >g3 AGCAA, , , ..., , , , , , , , , , ... AGTGACAGTCAT. GGGGTCAAACGGGAG >g3 A. GGGGCAATACTGGGA., , , , , , , , ACCCTA >g4 -as-a-do A.
    [Show full text]
  • EMERGING INFECTIOUS DISEASES Volume 5 • Number 1 January–February 1999
    Contents EMERGING INFECTIOUS DISEASES Volume 5 Number 1 JanuaryFebruary 1999 International Update Hantavirus Emerging Viral Diseases: An Australian Perspective* 1 Long-Term Studies of Hantavirus 95 J. S. Mackenzie Reservoir Populations in the Southwestern United States: Rationale, Perspectives Potential, and Methods The Economic Impact of Staphylococcus 9 J.N. Mills,T.L. Yates, T.G. Ksiazek, aureus Infection in New York City Hospitals C.J. Peters, and J.E. Childs R.J. Rubin, C.A. Harrington, A. Poon, Long-Term Hantavirus Persistence 102 K. Dietrich, J.A. Greene, and A. Moiduddin in Rodent Populations in Central Arizona Socioeconomic and Behavioral Factors 18 K.D. Abbott, T.G. Ksiazek, and J.N. Mills Leading to Acquired Bacterial Resistance A Longitudinal Study of Sin Nombre 113 to Antibiotics in Developing Countries Virus Prevalence in Rodents, I.N. Okeke, A.Lamikanra, and R. Edelman Southeastern Arizona Campylobacter jejuniAn Emerging 28 A.J. Kuenzi, M.L. Morrison, D.E. Foodborne Pathogen Swann, P.C. Hardy, and G.T. Downard S.F. Altekruse, N.J. Stern, Statistical Sensitivity for Detection of 118 P.I. Fields, and D.L. Swerdlow Spatial and Temporal Patterns in Rodent Population Densities Synopses C.A. Parmenter, T.L. Yates, R.R. Comparative Genomics and Host 36 Parmenter, and J.L. Dunnum Resistance against Infectious Diseases Natural History of Sin Nombre 126 S. T. Qureshi, E. Skamene, and D. Malo Virus in Western Colorado Cyclospora: An Enigma Worth Unraveling 48 C.H. Calisher, W. Sweeney, J.N. Mills, and B.J. Beaty C.R. Sterling and Y.R. Ortega Using Monoclonal Antibodies to 54 Long-Term Studies of Hantavirus 135 Prevent Mucosal Transmission Reservoir Populations in the of Epidemic Infectious Diseases Southwestern United States: A Synthesis J.N.
    [Show full text]
  • Hantaviridae: Current Classification and Future Perspectives
    viruses Article Hantaviridae: Current Classification and Future Perspectives Lies Laenen 1,2 , Valentijn Vergote 1, Charles H. Calisher 3, Boris Klempa 4, Jonas Klingström 5 , Jens H. Kuhn 6 and Piet Maes 1,* 1 KU Leuven, Department of Microbiology and Immunology, Rega Institute for Medical Research, Zoonotic Infectious Diseases Unit, 3000 Leuven, Belgium 2 Department of Laboratory Medicine, University Hospitals Leuven, 3000 Leuven, Belgium 3 Colorado State University, Fort Collins, CO 80523, USA 4 Biomedical Research Center, Slovak Academy of Sciences, 845 05 Bratislava, Slovakia 5 Center for Infectious Medicine, Department of Medicine Huddinge, Karolinska Institutet, Karolinska University Hospital, SE-141 86 Stockholm, Sweden 6 Integrated Research Facility at Fort Detrick, National Institute of Allergy and Infectious Diseases, National Institutes of Health, B-8200 Research Plaza, Frederick, MD 21702, USA * Correspondence: [email protected]; Tel.: +32-16-321309 Received: 10 August 2019; Accepted: 23 August 2019; Published: 27 August 2019 Abstract: In recent years, negative-sense RNA virus classification and taxon nomenclature have undergone considerable transformation. In 2016, the new order Bunyavirales was established, elevating the previous genus Hantavirus to family rank, thereby creating Hantaviridae. Here we summarize affirmed taxonomic modifications of this family from 2016 to 2019. Changes involve the admission of >30 new hantavirid species and the establishment of subfamilies and novel genera based on DivErsity pArtitioning by hieRarchical Clustering (DEmARC) analysis of genomic sequencing data. We outline an objective framework that can be used in future classification schemes when more hantavirids sequences will be available. Finally, we summarize current taxonomic proposals and problems in hantavirid taxonomy that will have to be addressed shortly.
    [Show full text]
  • Qualitative and Quantitative Assessment of the “Dangerous
    Center for International and Security Studies at Maryland1 Qualitative and Quantitative Assessment of the “Dangerous Activities” Categories Jens H. Kuhn July 2005 CISSM School of Public Policy This paper was prepared as part of the Advanced Methods of Cooperative Security Program at the Center 4113 Van Munching Hall for International and Security Studies at Maryland, with generous support from the MacArthur Foundation University of Maryland and the Sloan Foundation. College Park, MD 20742 Tel: (301) 405-7601 [email protected] 2 QUALITATIVE AND QUANTITATIVE ASSESSMENT OF THE “DANGEROUS ACTIVITIES” CATEGORIES DEFINED BY THE CISSM CONTROLLING DANGEROUS PATHOGENS PROJECT WORKING PAPER (July 31, 2005) Jens H. Kuhn, MD, ScD (Med. Sci.), MS (Biochem.) Contact Address: New England Primate Research Center Department of Microbiology and Molecular Genetics Harvard Medical School 1 Pine Hill Drive Southborough, MA 01772-9102, USA Phone: (508) 786-3326 Fax: (508) 786-3317 Email: [email protected] 3 OBJECTIVE The Controlling Dangerous Pathogens Project of the Center for International Security Studies at Maryland (CISSM) outlines a prototype oversight system for ongoing microbiological research to control its possible misapplication. This so-called Biological Research Security System (BRSS) foresees the creation of regional, national, and international oversight bodies that review, approve, or reject those proposed microbiological research projects that would fit three BRSS-defined categories: Potentially Dangerous Activities (PDA), Moderately Dangerous Activities (MDA), and Extremely Dangerous Activities (EDA). It is the objective of this working paper to assess these categories qualitatively and quantitatively. To do so, published US research of the years 2000-present (early- to mid-2005) will be screened for science reports that would have fallen under the proposed oversight system had it existed already.
    [Show full text]
  • Qualitative and Quantitative Assessment of the "Dangerous
    Center for International and Security Studies at Maryland1 Qualitative and Quantitative Assessment of the “Dangerous Activities” Categories Jens H. Kuhn July 2005 CISSM School of Public Policy This paper was prepared as part of the Advanced Methods of Cooperative Security Program at the Center 4113 Van Munching Hall for International and Security Studies at Maryland, with generous support from the MacArthur Foundation University of Maryland and the Sloan Foundation. College Park, MD 20742 Tel: (301) 405-7601 [email protected] 2 QUALITATIVE AND QUANTITATIVE ASSESSMENT OF THE “DANGEROUS ACTIVITIES” CATEGORIES DEFINED BY THE CISSM CONTROLLING DANGEROUS PATHOGENS PROJECT WORKING PAPER (July 31, 2005) Jens H. Kuhn, MD, ScD (Med. Sci.), MS (Biochem.) Contact Address: New England Primate Research Center Department of Microbiology and Molecular Genetics Harvard Medical School 1 Pine Hill Drive Southborough, MA 01772-9102, USA Phone: (508) 786-3326 Fax: (508) 786-3317 Email: [email protected] 3 OBJECTIVE The Controlling Dangerous Pathogens Project of the Center for International Security Studies at Maryland (CISSM) outlines a prototype oversight system for ongoing microbiological research to control its possible misapplication. This so-called Biological Research Security System (BRSS) foresees the creation of regional, national, and international oversight bodies that review, approve, or reject those proposed microbiological research projects that would fit three BRSS-defined categories: Potentially Dangerous Activities (PDA), Moderately Dangerous Activities (MDA), and Extremely Dangerous Activities (EDA). It is the objective of this working paper to assess these categories qualitatively and quantitatively. To do so, published US research of the years 2000-present (early- to mid-2005) will be screened for science reports that would have fallen under the proposed oversight system had it existed already.
    [Show full text]
  • Hantavirus Reservoirs: Current Status with an Emphasis on Data from Brazil
    Viruses 2014, 6, 1929-1973; doi:10.3390/v6051929 OPEN ACCESS viruses ISSN 1999-4915 www.mdpi.com/journal/viruses Review Hantavirus Reservoirs: Current Status with an Emphasis on Data from Brazil Renata Carvalho de Oliveira 1,*, Alexandro Guterres 1, Jorlan Fernandes 1, Paulo Sérgio D’Andrea 2, Cibele Rodrigues Bonvicino 2,3 and Elba Regina Sampaio de Lemos 1 1 Laboratório de Hantaviroses e Rickettsioses, Instituto Oswaldo Cruz, Fundação Oswaldo Cruz, Rio de Janeiro, 21040-360, RJ, Brazil; E-Mails: [email protected] (A.G.); [email protected] (J.F.); [email protected] (E.R.S.L.) 2 Laboratório de Biologia e Parasitologia de Mamíferos Silvestres Reservatórios, Instituto Oswaldo Cruz, Fundação Oswaldo Cruz, Rio de Janeiro, 21040-360, RJ, Brazil; E-Mails: [email protected] (P.S.D.); [email protected] (C.R.B.) 3 Programa de Genética, Instituto Nacional de Câncer, Ministério da Saúde, Rio de Janeiro, 20231-050, RJ, Brazil * Author to whom correspondence should be addressed; E-Mail: [email protected]; Tel./Fax: +55-21-2562-1727. Received: 25 November 2013; in revised form: 3 February 2014 / Accepted: 7 February 2014 / Published: 29 April 2014 Abstract: Since the recognition of hantavirus as the agent responsible for haemorrhagic fever in Eurasia in the 1970s and, 20 years later, the descovery of hantavirus pulmonary syndrome in the Americas, the genus Hantavirus has been continually described throughout the World in a variety of wild animals. The diversity of wild animals infected with hantaviruses has only recently come into focus as a result of expanded wildlife studies.
    [Show full text]