DOCSLIB.ORG

3364.Full.Pdf

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
3364.Full.Pdf [CANCER RESEARCH 63, 3364–3369, June 15, 2003] Testican 2 Abrogates Inhibition of Membrane-type Matrix Metalloproteinases by Other Testican Family Proteins1 Mitsutoshi Nakada,2 Hisashi Miyamori,2 Junkoh Yamashita, and Hiroshi Sato3 Department of Molecular Virology and Oncology [M. N., H. M., H. S.], Center for the Development of Molecular Target Drugs, Cancer Research Institute [H. S.], Department of Neurosurgery, Division of Neuroscience, Graduate School of Medical Science [M. N., J. Y.], Kanazawa University, Ishikawa 920-0934, Japan ABSTRACT activation of pro-MMP-2 is a common functional role proposed for all of the MT-MMPs (4–8), expression of MT1-MMP most closely Testican family proteins are putative extracellular heparan/chondroitin correlates with invasive phenotype of human tumors (9–13). sulfate proteoglycans of unknown function. We identified recently N-Tes, Testican was first defined as an unnamed chondroitin/heparan which is a product of testican 3 splicing variant gene, as an inhibitor of membrane-type matrix metalloproteinases (MT-MMPs). The inhibitory sulfate proteoglycan in seminal plasma (14). Corresponding cDNAs function is common among testican family members except for testican 2, were isolated from human testis libraries, and the deduced protein was which was shown to uniquely abolish inhibition of MT1-MMP- or MT3- named testican (15). To date 3 members of the testican family were MMP-mediated pro-MMP-2 activation by other testican family members. identified by cDNA cloning, with deduced amino acid homologies of Testican 2 inactivates N-Tes by binding to the COOH-terminal extracel- 42%, 51%, and 44% for testican 1/testican 2, testican 1/testican 3, and lular calcium-binding domain of N-Tes through its NH2-terminal unique testican 2/testican 3, respectively (15–17). Testican 1 and testican 2 domain as demonstrated by coimmunoprecipitation analysis, and, thus, are extracellular proteoglycans highly expressed in brain, and it was testican 2 was unable to inactivate a N-Tes deletion mutant lacking the expected that testicans might contribute to the proteoglycan-rich ECM ⌬ extracellular calcium-binding domain (N-Tes- 122). Migration of U251 of the brain and associate with neurogenesis (17–19). However, the cells on collagen, which was dependent on MT1-MMP activity under biological function of testicans has not been extensively explored. We serum-free condition, was inhibited by N-Tes or N-Tes-⌬122 deposited on collagen. Testican 2 was not incorporated into collagen by itself, and was identified recently a splicing variant of the testican 3 gene by the deposited only in the presence of N-Tes, suggesting that testican 2 binds to expression cloning method, the product of which inhibits pro-MMP-2 N-Tes deposited on collagen. Binding of testican 2 to N-Tes deposited on processing mediated by MT-MMPs (20). Furthermore, we revealed collagen allowed migration of cells expressing MT1-MMP. Unlike wild- that all members of testican except testican 2 interfered with pro- type N-Tes, N-Tes-⌬122 did not bind to testican 2, and, thus, expression of MMP-2 activation mediated by MT1-MMP or MT3-MMP (20). This testican 2 did not recover cell migration blocked by N-Tes-⌬122. In situ suggests that testicans may regulate ECM degradation by interacting hybridization showed that neurons are a major source of all of the testican with MT-MMPs. However, its biological role in controlling ECM family members in the normal brain. The quantitative reverse transcrip- turnover has not been explored thus far. In addition, the expression tion-PCR analysis demonstrated that all of the testican family members level and tissue localization of testican mRNA in tumor tissues have are expressed prominently in normal brain, and their expression levels not been studied. decrease as tumor grade increases. The expression level of testican 2 was the highest among testican family members regardless of histological In this study, we examined the interaction between testican 2 and grade of astrocytic tumors. These results suggest that abundant distribu- other testican family proteins, and demonstrated that testican 2 abol- tion of testican 2 may contribute to glioma invasion by inactivating other ishes inactivation of MT-MMPs by other testican family, and permits testican family members including N-Tes, which all inhibit MT-MMPs. migration of glioma cells expressing MT1-MMP in the presence of We propose that N-Tes-⌬122, which is resistant to testican 2, may have other testican family proteins. Furthermore, we showed that testican 2 therapeutic potential as a barrier against glioma invasion. was expressed more highly than other testican family members both in normal and malignant astrocytic tissues. These results suggest that in contrast to other testican family members, only testican 2 contributes INTRODUCTION to malignant behavior of astrocytic tumors. MMPs4 are a family of Zn2ϩ-dependent enzymes that are essential for ECM turnover in normal and pathological conditions (1–3). To MATERIALS AND METHODS date, 21 mammalian MMPs have been identified by cDNA cloning, and they can be subgrouped into 15 soluble-type and 6 MT-MMPs. Reagents. DMEM was from Nissui Pharmaceutical Co., Ltd. (Tokyo, MMPs are overexpressed in various human malignancies (2, 3). The Japan). Primers were synthesized by Genset (Kyoto, Japan). Anti-FLAG M2 first MT-MMP (MT1-MMP) was identified as an activator of pro- and anti-HA antibodies were purchased from Sigma and Santa Cruz Biotech MMP-2, which functions on the cell surface (4). Although the proteolytic (Santa Cruz, CA), respectively. Cell Culture. Human embryonic kidney 293T cells, and U251, U87, U373, and T98G glioma cells were obtained from Health Science Resources Bank Received 9/5/02; accepted 4/15/03. The costs of publication of this article were defrayed in part by the payment of page (Osaka, Japan) and cultured in DMEM supplemented with 10% fetal bovine charges. This article must therefore be hereby marked advertisement in accordance with serum. 18 U.S.C. Section 1734 solely to indicate this fact. Expression Plasmids. Expression plasmids for MT1-MMP, MT3-MMP, 1 Supported by grants-in-aid for young scientists (B-14770707 to M. N.) and for MMP-2, and TIMP-2 were as described previously (4, 21). Expression plas- scientific research (B2-13470290 to J. Y., and B2-14370053 and 11240203 to H. S., respectively) from the Ministry of Education, Science and Culture of Japan, and a grant mids for testican 1, testican 2, testican 3, N-Tes, and N-Tes/testican-2 chimeric from the Hokkoku Foundation for Cancer Research (to M. N.). proteins tagged with FLAG or HA epitope at the COOH terminus were 2 These authors have equally contributed to this work. constructed as described previously (20, 22). Expression plasmids for N-Tes- 3 To whom requests for reprints should be addressed, at Department of Molecular ⌬122, testican 2-⌬-133, and testican 2-⌬-89 tagged with FLAG or HA epitope Virology and Oncology, Cancer Research Institute, Kanazawa University, 13-1 Takara- machi, Kanazawa, Ishikawa 920-0934, Japan. Phone: 81-76-265-2750; Fax: 81-76-234- were constructed by inserting cDNA fragment into respective plasmids. N-Tes- 4504; E-mail: [email protected]. ⌬122 cDNA fragment was PCR-amplified with pEAK8 5Ј primer and N-Tes 4 The abbreviations used are: MMP, matrix metalloproteinase; ECM, extracellular reverse primer TCTAGATCCTGCTTCTTTCATCCTG that starts at nucleotide matrix; TIMP, tissue inhibitor of metalloproteinase; MT, membrane type; HA, influenza 2ϩ 473 (GenBank accession no. AB054866) with an extra Xba I site (italicized). virus hemagglutinin; EC, extracellular C -binding; RT-PCR, reverse transcription-PCR; ⌬ ⌬ GAPDH, glyceraldehydes-3-phosphate dehydrogenase; ISH, in situ hybridization; The cDNA fragments encoding testican 2- -133 and testican 2- -89 were N-, NH2-. amplified with testican 2 forward primer GAATTCCAGACCACGAT- 3364 Downloaded from cancerres.aacrjournals.org on September 28, 2021. © 2003 American Association for Cancer Research. INTERACTION AMONG TESTICAN FAMILY PROTEINS Table 1 Nucleotide sequence of primers and probesa Product size Target Sequence 5Ј-3Ј (bp) Testican 1 Forward primer ACACTAGCATCCTGCCCATCT (1147–1167) 86 Reverse primer AGGGTCAAGCAGGAGGTCATAG (1232–1211) Probe CTCCCTGGGCTGGATGTTCAACAA (1175–1198) Testican 2 Forward primer GCAATTTCATGGAGGACGAGC (393–413) 77 Reverse primer GAAGCGGTTCCAGTGCTTGAT (469–449) Probe ATGGCTGTCGTCCATCTCGCAGTACA (415–440) Testican 3 Forward primer GATAAGCCCACCAGTACAAGCA (683–704) 80 Reverse primer CGCAATCTGTTTGCCACTTC (762–743) Probe TAAGAGAGCATGCAGTGACCTGGAGTTCAG (712–741) N-Tes Forward primer CTAATAATGAGTGGTGCTACTGCTT (13–37) 82 Reverse primer ATGCAGGTCAACTATTTGCATC (94–73) Probe CAGAGACAGCAAGGTAAAAGATGAGACCC (39–67) a All of the TaqMan probes carried a 5Ј FAM (6-carboxy-fluorescein) reporter dye and a 3Ј TAMRA (6-carboxy-tetramethyl-rhodamine) quencher dye and contained a 3Ј phosphate group (p) to prevent extension during PCR. Nucleotide numbers for each primers are presented in parenthesis (GeneBank accession nos. CAA51999, CAA04774, NM_016950, and AB056866 for testican 1, testican 2, testican 3, and N-Tes, respectively). Table 2 Nucleotide sequences of oligo probes used for in situ hybridizationa RESULTS Probe Sequence 5Ј-3Ј Testican 2 Abolishes Inactivation of MT-MMPs by Other Tes- Testican 1 GGGGCCCGCGCCTCCGGCGAGCGCGTCCAG (504–533) Testican 2 GTGCGCGTGCCAGTCAGCTCCAGGCCCAGC (1366–1395) ticans. Testican family members, except for testican 2, inhibit pro- Testican 3 AATGTATACATCATGGTCATCACCACCATC
Load more

Recommended publications
  • Cleavage of Lumican by Membrane-Type Matrix Metalloproteinase-1 Abrogates This Proteoglycan-Mediated Suppression of Tumor Cell Colony Formation in Soft Agar
    [CANCER RESEARCH 64, 7058–7064, October 1, 2004] Cleavage of Lumican by Membrane-Type Matrix Metalloproteinase-1 Abrogates This Proteoglycan-Mediated Suppression of Tumor Cell Colony Formation in Soft Agar Yingyi Li,1 Takanori Aoki,1,3 Yuya Mori,1 Munirah Ahmad,1 Hisashi Miyamori,1 Takahisa Takino,1 and Hiroshi Sato1,2 1Department of Molecular Virology and Oncology and 2Center for the Development of Molecular Target Drugs, Cancer Research Institute, Kanazawa University, Kanazawa, Ishikawa, Japan; and 3Daiichi Fine Chemical Co. Ltd., Takaoka, Toyama, Japan ABSTRACT or tumorigenicity in nude mice of rat fibroblast F204 cells trans- formed by K-ras or v-src oncogene (12). The small leucine-rich proteoglycan lumican was identified from a Matrix metalloproteinases (MMPs) are a family of Zn2ϩ-dependent human placenta cDNA library by the expression cloning method as a gene product that interacts with membrane-type matrix metalloproteinase-1 enzymes that are known to cleave extracellular matrix proteins in (MT1-MMP). Coexpression of MT1-MMP with lumican in HEK293T cells normal and pathological conditions (13). Currently, 23 MMP genes reduced the concentration of lumican secreted into culture medium, and have been identified in humans, and they can be subgrouped into this reduction was abolished by addition of the MMP inhibitor BB94. soluble-type and membrane-type MMPs (MT-MMPs; refs. 13, 14). Lumican protein from bovine cornea and recombinant lumican core MMPs are overexpressed in various human malignancies and have protein fused to glutathione S-transferase was shown to be cleaved at been thought to contribute to tumor invasion and metastasis by de- multiple sites by recombinant MT1-MMP.
    [Show full text]
  • Curcumin Alters Gene Expression-Associated DNA Damage, Cell Cycle, Cell Survival and Cell Migration and Invasion in NCI-H460 Human Lung Cancer Cells in Vitro
    ONCOLOGY REPORTS 34: 1853-1874, 2015 Curcumin alters gene expression-associated DNA damage, cell cycle, cell survival and cell migration and invasion in NCI-H460 human lung cancer cells in vitro I-TSANG CHIANG1,2, WEI-SHU WANG3, HSIN-CHUNG LIU4, SU-TSO YANG5, NOU-YING TANG6 and JING-GUNG CHUNG4,7 1Department of Radiation Oncology, National Yang‑Ming University Hospital, Yilan 260; 2Department of Radiological Technology, Central Taiwan University of Science and Technology, Taichung 40601; 3Department of Internal Medicine, National Yang‑Ming University Hospital, Yilan 260; 4Department of Biological Science and Technology, China Medical University, Taichung 404; 5Department of Radiology, China Medical University Hospital, Taichung 404; 6Graduate Institute of Chinese Medicine, China Medical University, Taichung 404; 7Department of Biotechnology, Asia University, Taichung 404, Taiwan, R.O.C. Received March 31, 2015; Accepted June 26, 2015 DOI: 10.3892/or.2015.4159 Abstract. Lung cancer is the most common cause of cancer CARD6, ID1 and ID2 genes, associated with cell survival and mortality and new cases are on the increase worldwide. the BRMS1L, associated with cell migration and invasion. However, the treatment of lung cancer remains unsatisfactory. Additionally, 59 downregulated genes exhibited a >4-fold Curcumin has been shown to induce cell death in many human change, including the DDIT3 gene, associated with DNA cancer cells, including human lung cancer cells. However, the damage; while 97 genes had a >3- to 4-fold change including the effects of curcumin on genetic mechanisms associated with DDIT4 gene, associated with DNA damage; the CCPG1 gene, these actions remain unclear. Curcumin (2 µM) was added associated with cell cycle and 321 genes with a >2- to 3-fold to NCI-H460 human lung cancer cells and the cells were including the GADD45A and CGREF1 genes, associated with incubated for 24 h.
    [Show full text]
  • Appendix 2. Significantly Differentially Regulated Genes in Term Compared with Second Trimester Amniotic Fluid Supernatant
    Appendix 2. Significantly Differentially Regulated Genes in Term Compared With Second Trimester Amniotic Fluid Supernatant Fold Change in term vs second trimester Amniotic Affymetrix Duplicate Fluid Probe ID probes Symbol Entrez Gene Name 1019.9 217059_at D MUC7 mucin 7, secreted 424.5 211735_x_at D SFTPC surfactant protein C 416.2 206835_at STATH statherin 363.4 214387_x_at D SFTPC surfactant protein C 295.5 205982_x_at D SFTPC surfactant protein C 288.7 1553454_at RPTN repetin solute carrier family 34 (sodium 251.3 204124_at SLC34A2 phosphate), member 2 238.9 206786_at HTN3 histatin 3 161.5 220191_at GKN1 gastrokine 1 152.7 223678_s_at D SFTPA2 surfactant protein A2 130.9 207430_s_at D MSMB microseminoprotein, beta- 99.0 214199_at SFTPD surfactant protein D major histocompatibility complex, class II, 96.5 210982_s_at D HLA-DRA DR alpha 96.5 221133_s_at D CLDN18 claudin 18 94.4 238222_at GKN2 gastrokine 2 93.7 1557961_s_at D LOC100127983 uncharacterized LOC100127983 93.1 229584_at LRRK2 leucine-rich repeat kinase 2 HOXD cluster antisense RNA 1 (non- 88.6 242042_s_at D HOXD-AS1 protein coding) 86.0 205569_at LAMP3 lysosomal-associated membrane protein 3 85.4 232698_at BPIFB2 BPI fold containing family B, member 2 84.4 205979_at SCGB2A1 secretoglobin, family 2A, member 1 84.3 230469_at RTKN2 rhotekin 2 82.2 204130_at HSD11B2 hydroxysteroid (11-beta) dehydrogenase 2 81.9 222242_s_at KLK5 kallikrein-related peptidase 5 77.0 237281_at AKAP14 A kinase (PRKA) anchor protein 14 76.7 1553602_at MUCL1 mucin-like 1 76.3 216359_at D MUC7 mucin 7,
    [Show full text]
  • MALE Protein Name Accession Number Molecular Weight CP1 CP2 H1 H2 PDAC1 PDAC2 CP Mean H Mean PDAC Mean T-Test PDAC Vs. H T-Test
    MALE t-test t-test Accession Molecular H PDAC PDAC vs. PDAC vs. Protein Name Number Weight CP1 CP2 H1 H2 PDAC1 PDAC2 CP Mean Mean Mean H CP PDAC/H PDAC/CP - 22 kDa protein IPI00219910 22 kDa 7 5 4 8 1 0 6 6 1 0.1126 0.0456 0.1 0.1 - Cold agglutinin FS-1 L-chain (Fragment) IPI00827773 12 kDa 32 39 34 26 53 57 36 30 55 0.0309 0.0388 1.8 1.5 - HRV Fab 027-VL (Fragment) IPI00827643 12 kDa 4 6 0 0 0 0 5 0 0 - 0.0574 - 0.0 - REV25-2 (Fragment) IPI00816794 15 kDa 8 12 5 7 8 9 10 6 8 0.2225 0.3844 1.3 0.8 A1BG Alpha-1B-glycoprotein precursor IPI00022895 54 kDa 115 109 106 112 111 100 112 109 105 0.6497 0.4138 1.0 0.9 A2M Alpha-2-macroglobulin precursor IPI00478003 163 kDa 62 63 86 72 14 18 63 79 16 0.0120 0.0019 0.2 0.3 ABCB1 Multidrug resistance protein 1 IPI00027481 141 kDa 41 46 23 26 52 64 43 25 58 0.0355 0.1660 2.4 1.3 ABHD14B Isoform 1 of Abhydrolase domain-containing proteinIPI00063827 14B 22 kDa 19 15 19 17 15 9 17 18 12 0.2502 0.3306 0.7 0.7 ABP1 Isoform 1 of Amiloride-sensitive amine oxidase [copper-containing]IPI00020982 precursor85 kDa 1 5 8 8 0 0 3 8 0 0.0001 0.2445 0.0 0.0 ACAN aggrecan isoform 2 precursor IPI00027377 250 kDa 38 30 17 28 34 24 34 22 29 0.4877 0.5109 1.3 0.8 ACE Isoform Somatic-1 of Angiotensin-converting enzyme, somaticIPI00437751 isoform precursor150 kDa 48 34 67 56 28 38 41 61 33 0.0600 0.4301 0.5 0.8 ACE2 Isoform 1 of Angiotensin-converting enzyme 2 precursorIPI00465187 92 kDa 11 16 20 30 4 5 13 25 5 0.0557 0.0847 0.2 0.4 ACO1 Cytoplasmic aconitate hydratase IPI00008485 98 kDa 2 2 0 0 0 0 2 0 0 - 0.0081 - 0.0
    [Show full text]
  • Development and Validation of a Protein-Based Risk Score for Cardiovascular Outcomes Among Patients with Stable Coronary Heart Disease
    Supplementary Online Content Ganz P, Heidecker B, Hveem K, et al. Development and validation of a protein-based risk score for cardiovascular outcomes among patients with stable coronary heart disease. JAMA. doi: 10.1001/jama.2016.5951 eTable 1. List of 1130 Proteins Measured by Somalogic’s Modified Aptamer-Based Proteomic Assay eTable 2. Coefficients for Weibull Recalibration Model Applied to 9-Protein Model eFigure 1. Median Protein Levels in Derivation and Validation Cohort eTable 3. Coefficients for the Recalibration Model Applied to Refit Framingham eFigure 2. Calibration Plots for the Refit Framingham Model eTable 4. List of 200 Proteins Associated With the Risk of MI, Stroke, Heart Failure, and Death eFigure 3. Hazard Ratios of Lasso Selected Proteins for Primary End Point of MI, Stroke, Heart Failure, and Death eFigure 4. 9-Protein Prognostic Model Hazard Ratios Adjusted for Framingham Variables eFigure 5. 9-Protein Risk Scores by Event Type This supplementary material has been provided by the authors to give readers additional information about their work. Downloaded From: https://jamanetwork.com/ on 10/02/2021 Supplemental Material Table of Contents 1 Study Design and Data Processing ......................................................................................................... 3 2 Table of 1130 Proteins Measured .......................................................................................................... 4 3 Variable Selection and Statistical Modeling ........................................................................................
    [Show full text]
  • Human Induced Pluripotent Stem Cell–Derived Podocytes Mature Into Vascularized Glomeruli Upon Experimental Transplantation
    BASIC RESEARCH www.jasn.org Human Induced Pluripotent Stem Cell–Derived Podocytes Mature into Vascularized Glomeruli upon Experimental Transplantation † Sazia Sharmin,* Atsuhiro Taguchi,* Yusuke Kaku,* Yasuhiro Yoshimura,* Tomoko Ohmori,* ‡ † ‡ Tetsushi Sakuma, Masashi Mukoyama, Takashi Yamamoto, Hidetake Kurihara,§ and | Ryuichi Nishinakamura* *Department of Kidney Development, Institute of Molecular Embryology and Genetics, and †Department of Nephrology, Faculty of Life Sciences, Kumamoto University, Kumamoto, Japan; ‡Department of Mathematical and Life Sciences, Graduate School of Science, Hiroshima University, Hiroshima, Japan; §Division of Anatomy, Juntendo University School of Medicine, Tokyo, Japan; and |Japan Science and Technology Agency, CREST, Kumamoto, Japan ABSTRACT Glomerular podocytes express proteins, such as nephrin, that constitute the slit diaphragm, thereby contributing to the filtration process in the kidney. Glomerular development has been analyzed mainly in mice, whereas analysis of human kidney development has been minimal because of limited access to embryonic kidneys. We previously reported the induction of three-dimensional primordial glomeruli from human induced pluripotent stem (iPS) cells. Here, using transcription activator–like effector nuclease-mediated homologous recombination, we generated human iPS cell lines that express green fluorescent protein (GFP) in the NPHS1 locus, which encodes nephrin, and we show that GFP expression facilitated accurate visualization of nephrin-positive podocyte formation in
    [Show full text]
  • Electronic Supplementary Material (ESI) for Analyst. This Journal Is © the Royal Society of Chemistry 2020
    Electronic Supplementary Material (ESI) for Analyst. This journal is © The Royal Society of Chemistry 2020 Table S1.
    [Show full text]
  • Proteoglycan Form and Function: a Comprehensive Nomenclature of Proteoglycans
    HHS Public Access Author manuscript Author ManuscriptAuthor Manuscript Author Matrix Biol Manuscript Author . Author manuscript; Manuscript Author available in PMC 2016 May 06. Published in final edited form as: Matrix Biol. 2015 March ; 42: 11–55. doi:10.1016/j.matbio.2015.02.003. Proteoglycan form and function: A comprehensive nomenclature of proteoglycans Renato V. Iozzo1 and Liliana Schaefer2 1Department of Pathology, Anatomy and Cell Biology and the Cancer Cell Biology and Signaling Program, Kimmel Cancer Center, Sidney Kimmel Medical College at Thomas Jefferson University, Philadelphia, PA 19107, USA 2Pharmazentrum Frankfurt/ZAFES, Institut für Allgemeine Pharmakologie und Toxikologie, Klinikum der Goethe-Universität Frankfurt am Main, Frankfurt am Main, Germany Abstract We provide a comprehensive classification of the proteoglycan gene families and respective protein cores. This updated nomenclature is based on three criteria: Cellular and subcellular location, overall gene/protein homology, and the utilization of specific protein modules within their respective protein cores. These three signatures were utilized to design four major classes of proteoglycans with distinct forms and functions: the intracellular, cell-surface, pericellular and extracellular proteoglycans. The proposed nomenclature encompasses forty-three distinct proteoglycan-encoding genes and many alternatively-spliced variants. The biological functions of these four proteoglycan families are critically assessed in development, cancer and angiogenesis, and in various acquired and genetic diseases where their expression is aberrant. Keywords Proteoglycan; Glycosaminoglycan; Cancer growth; Angiogenesis; Growth factor modulation Introduction It has been nearly 20 years since the original publication of a comprehensive classification of proteoglycan gene families [1]. For the most part, these classes have been widely accepted. However, a broad and current taxonomy of the various proteoglycan gene families and their products is not available.
    [Show full text]
  • Fibroblasts from the Human Skin Dermo-Hypodermal Junction Are
    cells Article Fibroblasts from the Human Skin Dermo-Hypodermal Junction are Distinct from Dermal Papillary and Reticular Fibroblasts and from Mesenchymal Stem Cells and Exhibit a Specific Molecular Profile Related to Extracellular Matrix Organization and Modeling Valérie Haydont 1,*, Véronique Neiveyans 1, Philippe Perez 1, Élodie Busson 2, 2 1, 3,4,5,6, , Jean-Jacques Lataillade , Daniel Asselineau y and Nicolas O. Fortunel y * 1 Advanced Research, L’Oréal Research and Innovation, 93600 Aulnay-sous-Bois, France; [email protected] (V.N.); [email protected] (P.P.); [email protected] (D.A.) 2 Department of Medical and Surgical Assistance to the Armed Forces, French Forces Biomedical Research Institute (IRBA), 91223 CEDEX Brétigny sur Orge, France; [email protected] (É.B.); [email protected] (J.-J.L.) 3 Laboratoire de Génomique et Radiobiologie de la Kératinopoïèse, Institut de Biologie François Jacob, CEA/DRF/IRCM, 91000 Evry, France 4 INSERM U967, 92260 Fontenay-aux-Roses, France 5 Université Paris-Diderot, 75013 Paris 7, France 6 Université Paris-Saclay, 78140 Paris 11, France * Correspondence: [email protected] (V.H.); [email protected] (N.O.F.); Tel.: +33-1-48-68-96-00 (V.H.); +33-1-60-87-34-92 or +33-1-60-87-34-98 (N.O.F.) These authors contributed equally to the work. y Received: 15 December 2019; Accepted: 24 January 2020; Published: 5 February 2020 Abstract: Human skin dermis contains fibroblast subpopulations in which characterization is crucial due to their roles in extracellular matrix (ECM) biology.
    [Show full text]
  • Gene Expression Alterations in Salivary Gland Epithelia of Sjögren's
    www.nature.com/scientificreports OPEN Gene expression alterations in salivary gland epithelia of Sjögren’s syndrome patients are associated with clinical and histopathological manifestations Ariana Dela Cruz1,7, Vinay Kartha2,7, Andrew Tilston‑Lunel3,7, Rongjuan Mi1,3, Taylor L. Reynolds4, Michael Mingueneau4, Stefano Monti2, Janicke L. Jensen5, Kathrine Skarstein6, Xaralabos Varelas3* & Maria A. Kukuruzinska1* Sjögren’s syndrome (SS) is a complex autoimmune disease associated with lymphocytic infltration and secretory dysfunction of salivary and lacrimal glands. Although the etiology of SS remains unclear, evidence suggests that epithelial damage of the glands elicits immune and fbrotic responses in SS. To defne molecular changes underlying epithelial tissue damage in SS, we laser capture microdissected (LCM) labial salivary gland epithelia from 8 SS and 8 non‑SS controls for analysis by RNA sequencing (RNAseq). Computational interrogation of gene expression signatures revealed that, in addition to a division of SS and non‑SS samples, there was a potential intermediate state overlapping clustering of SS and non‑SS samples. Diferential expression analysis uncovered signaling events likely associated with distinct SS pathogenesis. Notable signals included the enrichment of IFN‑γ and JAK/STAT‑ regulated genes, and the induction of genes encoding secreted factors, such as LTF, BMP3, and MMP7, implicated in immune responses, matrix remodeling and tissue destruction. Identifcation of gene expression signatures of salivary epithelia associated with mixed clinical and histopathological characteristics suggests that SS pathology may be defned by distinct molecular subtypes. We conclude that gene expression changes arising in the damaged salivary epithelia may ofer novel insights into the signals contributing to SS development and progression.
    [Show full text]
  • Ncomms2128.Pdf
    ARTICLE Received 10 Jul 2012 | Accepted 6 Sep 2012 | Published 9 Oct 2012 DOI: 10.1038/ncomms2128 A combinatorial extracellular matrix platform identifies cell-extracellular matrix interactions that correlate with metastasis Nathan E. Reticker-Flynn1,2, David F. Braga Malta1,2,3,4, Monte M. Winslow1,5, John M. Lamar1, Mary J. Xu2, Gregory H. Underhill1,6, Richard O. Hynes1,7,8, Tyler E. Jacks1,7,8,9 & Sangeeta N. Bhatia1,2,8,10,11 Extracellular matrix interactions have essential roles in normal physiology and many pathological processes. Although the importance of extracellular matrix interactions in metastasis is well documented, systematic approaches to identify their roles in distinct stages of tumorigenesis have not been described. Here we report a novel-screening platform capable of measuring phenotypic responses to combinations of extracellular matrix molecules. Using a genetic mouse model of lung adenocarcinoma, we measure the extracellular matrix-dependent adhesion of tumour-derived cells. Hierarchical clustering of the adhesion profiles differentiates metastatic cell lines from primary tumour lines. Furthermore, we uncovered that metastatic cells selectively associate with fibronectin when in combination with galectin-3, galectin-8 or laminin. We show that these molecules correlate with human disease and that their interactions are mediated in part by α3β1 integrin. Thus, our platform allowed us to interrogate interactions between metastatic cells and their microenvironments, and identified extracellular matrix and integrin interactions that could serve as therapeutic targets. 1 David H. Koch Institute for Integrative Cancer Research, Massachusetts Institute of Technology, Cambridge, Massachusetts 02139, USA. 2 Harvard- MIT Division of Health Sciences and Technology, Massachusetts Institute of Technology, Cambridge, Massachusetts 02139, USA.
    [Show full text]
  • Clues from the Gene and Protein Side Offer Novel Perspectives in Molecular Diversity and Function
    REVIEW Proteoglycans of the extracellular environment: clues from the gene and protein side offer novel perspectives in molecular diversity and function RENATO V. IOZZO’ AND ALAN D. MURDOCH Department of Pathology, Anatomy, and Cell Biology, and the Jefferson Cancer Institute, Thomas Jefferson University, Philadelphia, Pennsylvania 19107, USA ABSTRACT This review focuses on the extracellu- and multifunctional molecules of the animal kingdom. lar proteoglycans. Special emphasis is placed on the They carry a variety of structural units that vary from structural features of their protein cores, their gene simple linear sugars to the most highly charged, sulfated organization, and their transcriptional control. A polysaccharide in nature: heparin. They provide struc- simplified nomenclature comprising two broad tural constraints, function as growth-supportive or sup- groups of extracellular proteoglycans is offered: the pressive molecules, possess adhesive and anti-adhesive small leucine-rich proteoglycans or SLRPS, pro- properties, act as major biological filters, promote angio- nounced “slurps,” and the modular proteoglycans. genesis, induce neurite outgrowth, and bind, store, and The first group encompasses at least five distinct deliver growth factors to target cells during normal devel- members of a gene family characterized by a central opment and in pathologic states. This review centers on domain composed of leucine-rich repeats flanked by the extracellular proteoglycans, those molecules whose two cysteine-rich regions. The second
    [Show full text]