[CANCER RESEARCH 63, 3364–3369, June 15, 2003] Testican 2 Abrogates Inhibition of Membrane-type Matrix Metalloproteinases by Other Testican Family Proteins1 Mitsutoshi Nakada,2 Hisashi Miyamori,2 Junkoh Yamashita, and Hiroshi Sato3 Department of Molecular Virology and Oncology [M. N., H. M., H. S.], Center for the Development of Molecular Target Drugs, Cancer Research Institute [H. S.], Department of Neurosurgery, Division of Neuroscience, Graduate School of Medical Science [M. N., J. Y.], Kanazawa University, Ishikawa 920-0934, Japan ABSTRACT activation of pro-MMP-2 is a common functional role proposed for all of the MT-MMPs (4–8), expression of MT1-MMP most closely Testican family proteins are putative extracellular heparan/chondroitin correlates with invasive phenotype of human tumors (9–13). sulfate proteoglycans of unknown function. We identified recently N-Tes, Testican was first defined as an unnamed chondroitin/heparan which is a product of testican 3 splicing variant gene, as an inhibitor of membrane-type matrix metalloproteinases (MT-MMPs). The inhibitory sulfate proteoglycan in seminal plasma (14). Corresponding cDNAs function is common among testican family members except for testican 2, were isolated from human testis libraries, and the deduced protein was which was shown to uniquely abolish inhibition of MT1-MMP- or MT3- named testican (15). To date 3 members of the testican family were MMP-mediated pro-MMP-2 activation by other testican family members. identified by cDNA cloning, with deduced amino acid homologies of Testican 2 inactivates N-Tes by binding to the COOH-terminal extracel- 42%, 51%, and 44% for testican 1/testican 2, testican 1/testican 3, and lular calcium-binding domain of N-Tes through its NH2-terminal unique testican 2/testican 3, respectively (15–17). Testican 1 and testican 2 domain as demonstrated by coimmunoprecipitation analysis, and, thus, are extracellular proteoglycans highly expressed in brain, and it was testican 2 was unable to inactivate a N-Tes deletion mutant lacking the expected that testicans might contribute to the proteoglycan-rich ECM ⌬ extracellular calcium-binding domain (N-Tes- 122). Migration of U251 of the brain and associate with neurogenesis (17–19). However, the cells on collagen, which was dependent on MT1-MMP activity under biological function of testicans has not been extensively explored. We serum-free condition, was inhibited by N-Tes or N-Tes-⌬122 deposited on collagen. Testican 2 was not incorporated into collagen by itself, and was identified recently a splicing variant of the testican 3 gene by the deposited only in the presence of N-Tes, suggesting that testican 2 binds to expression cloning method, the product of which inhibits pro-MMP-2 N-Tes deposited on collagen. Binding of testican 2 to N-Tes deposited on processing mediated by MT-MMPs (20). Furthermore, we revealed collagen allowed migration of cells expressing MT1-MMP. Unlike wild- that all members of testican except testican 2 interfered with pro- type N-Tes, N-Tes-⌬122 did not bind to testican 2, and, thus, expression of MMP-2 activation mediated by MT1-MMP or MT3-MMP (20). This testican 2 did not recover cell migration blocked by N-Tes-⌬122. In situ suggests that testicans may regulate ECM degradation by interacting hybridization showed that neurons are a major source of all of the testican with MT-MMPs. However, its biological role in controlling ECM family members in the normal brain. The quantitative reverse transcrip- turnover has not been explored thus far. In addition, the expression tion-PCR analysis demonstrated that all of the testican family members level and tissue localization of testican mRNA in tumor tissues have are expressed prominently in normal brain, and their expression levels not been studied. decrease as tumor grade increases. The expression level of testican 2 was the highest among testican family members regardless of histological In this study, we examined the interaction between testican 2 and grade of astrocytic tumors. These results suggest that abundant distribu- other testican family proteins, and demonstrated that testican 2 abol- tion of testican 2 may contribute to glioma invasion by inactivating other ishes inactivation of MT-MMPs by other testican family, and permits testican family members including N-Tes, which all inhibit MT-MMPs. migration of glioma cells expressing MT1-MMP in the presence of We propose that N-Tes-⌬122, which is resistant to testican 2, may have other testican family proteins. Furthermore, we showed that testican 2 therapeutic potential as a barrier against glioma invasion. was expressed more highly than other testican family members both in normal and malignant astrocytic tissues. These results suggest that in contrast to other testican family members, only testican 2 contributes INTRODUCTION to malignant behavior of astrocytic tumors. MMPs4 are a family of Zn2ϩ-dependent enzymes that are essential for ECM turnover in normal and pathological conditions (1–3). To MATERIALS AND METHODS date, 21 mammalian MMPs have been identified by cDNA cloning, and they can be subgrouped into 15 soluble-type and 6 MT-MMPs. Reagents. DMEM was from Nissui Pharmaceutical Co., Ltd. (Tokyo, MMPs are overexpressed in various human malignancies (2, 3). The Japan). Primers were synthesized by Genset (Kyoto, Japan). Anti-FLAG M2 first MT-MMP (MT1-MMP) was identified as an activator of pro- and anti-HA antibodies were purchased from Sigma and Santa Cruz Biotech MMP-2, which functions on the cell surface (4). Although the proteolytic (Santa Cruz, CA), respectively. Cell Culture. Human embryonic kidney 293T cells, and U251, U87, U373, and T98G glioma cells were obtained from Health Science Resources Bank Received 9/5/02; accepted 4/15/03. The costs of publication of this article were defrayed in part by the payment of page (Osaka, Japan) and cultured in DMEM supplemented with 10% fetal bovine charges. This article must therefore be hereby marked advertisement in accordance with serum. 18 U.S.C. Section 1734 solely to indicate this fact. Expression Plasmids. Expression plasmids for MT1-MMP, MT3-MMP, 1 Supported by grants-in-aid for young scientists (B-14770707 to M. N.) and for MMP-2, and TIMP-2 were as described previously (4, 21). Expression plas- scientific research (B2-13470290 to J. Y., and B2-14370053 and 11240203 to H. S., respectively) from the Ministry of Education, Science and Culture of Japan, and a grant mids for testican 1, testican 2, testican 3, N-Tes, and N-Tes/testican-2 chimeric from the Hokkoku Foundation for Cancer Research (to M. N.). proteins tagged with FLAG or HA epitope at the COOH terminus were 2 These authors have equally contributed to this work. constructed as described previously (20, 22). Expression plasmids for N-Tes- 3 To whom requests for reprints should be addressed, at Department of Molecular ⌬122, testican 2-⌬-133, and testican 2-⌬-89 tagged with FLAG or HA epitope Virology and Oncology, Cancer Research Institute, Kanazawa University, 13-1 Takara- machi, Kanazawa, Ishikawa 920-0934, Japan. Phone: 81-76-265-2750; Fax: 81-76-234- were constructed by inserting cDNA fragment into respective plasmids. N-Tes- 4504; E-mail: [email protected]. ⌬122 cDNA fragment was PCR-amplified with pEAK8 5Ј primer and N-Tes 4 The abbreviations used are: MMP, matrix metalloproteinase; ECM, extracellular reverse primer TCTAGATCCTGCTTCTTTCATCCTG that starts at nucleotide matrix; TIMP, tissue inhibitor of metalloproteinase; MT, membrane type; HA, influenza 2ϩ 473 (GenBank accession no. AB054866) with an extra Xba I site (italicized). virus hemagglutinin; EC, extracellular C -binding; RT-PCR, reverse transcription-PCR; ⌬ ⌬ GAPDH, glyceraldehydes-3-phosphate dehydrogenase; ISH, in situ hybridization; The cDNA fragments encoding testican 2- -133 and testican 2- -89 were N-, NH2-. amplified with testican 2 forward primer GAATTCCAGACCACGAT- 3364 Downloaded from cancerres.aacrjournals.org on September 28, 2021. © 2003 American Association for Cancer Research. INTERACTION AMONG TESTICAN FAMILY PROTEINS Table 1 Nucleotide sequence of primers and probesa Product size Target Sequence 5Ј-3Ј (bp) Testican 1 Forward primer ACACTAGCATCCTGCCCATCT (1147–1167) 86 Reverse primer AGGGTCAAGCAGGAGGTCATAG (1232–1211) Probe CTCCCTGGGCTGGATGTTCAACAA (1175–1198) Testican 2 Forward primer GCAATTTCATGGAGGACGAGC (393–413) 77 Reverse primer GAAGCGGTTCCAGTGCTTGAT (469–449) Probe ATGGCTGTCGTCCATCTCGCAGTACA (415–440) Testican 3 Forward primer GATAAGCCCACCAGTACAAGCA (683–704) 80 Reverse primer CGCAATCTGTTTGCCACTTC (762–743) Probe TAAGAGAGCATGCAGTGACCTGGAGTTCAG (712–741) N-Tes Forward primer CTAATAATGAGTGGTGCTACTGCTT (13–37) 82 Reverse primer ATGCAGGTCAACTATTTGCATC (94–73) Probe CAGAGACAGCAAGGTAAAAGATGAGACCC (39–67) a All of the TaqMan probes carried a 5Ј FAM (6-carboxy-fluorescein) reporter dye and a 3Ј TAMRA (6-carboxy-tetramethyl-rhodamine) quencher dye and contained a 3Ј phosphate group (p) to prevent extension during PCR. Nucleotide numbers for each primers are presented in parenthesis (GeneBank accession nos. CAA51999, CAA04774, NM_016950, and AB056866 for testican 1, testican 2, testican 3, and N-Tes, respectively). Table 2 Nucleotide sequences of oligo probes used for in situ hybridizationa RESULTS Probe Sequence 5Ј-3Ј Testican 2 Abolishes Inactivation of MT-MMPs by Other Tes- Testican 1 GGGGCCCGCGCCTCCGGCGAGCGCGTCCAG (504–533) Testican 2 GTGCGCGTGCCAGTCAGCTCCAGGCCCAGC (1366–1395) ticans. Testican family members, except for testican 2, inhibit pro- Testican 3 AATGTATACATCATGGTCATCACCACCATC