DOCSLIB.ORG

Cleavage of Lumican by Membrane-Type Matrix Metalloproteinase-1 Abrogates This Proteoglycan-Mediated Suppression of Tumor Cell Colony Formation in Soft Agar

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Cleavage of Lumican by Membrane-Type Matrix Metalloproteinase-1 Abrogates This Proteoglycan-Mediated Suppression of Tumor Cell Colony Formation in Soft Agar [CANCER RESEARCH 64, 7058–7064, October 1, 2004] Cleavage of Lumican by Membrane-Type Matrix Metalloproteinase-1 Abrogates This Proteoglycan-Mediated Suppression of Tumor Cell Colony Formation in Soft Agar Yingyi Li,1 Takanori Aoki,1,3 Yuya Mori,1 Munirah Ahmad,1 Hisashi Miyamori,1 Takahisa Takino,1 and Hiroshi Sato1,2 1Department of Molecular Virology and Oncology and 2Center for the Development of Molecular Target Drugs, Cancer Research Institute, Kanazawa University, Kanazawa, Ishikawa, Japan; and 3Daiichi Fine Chemical Co. Ltd., Takaoka, Toyama, Japan ABSTRACT or tumorigenicity in nude mice of rat fibroblast F204 cells trans- formed by K-ras or v-src oncogene (12). The small leucine-rich proteoglycan lumican was identified from a Matrix metalloproteinases (MMPs) are a family of Zn2ϩ-dependent human placenta cDNA library by the expression cloning method as a gene product that interacts with membrane-type matrix metalloproteinase-1 enzymes that are known to cleave extracellular matrix proteins in (MT1-MMP). Coexpression of MT1-MMP with lumican in HEK293T cells normal and pathological conditions (13). Currently, 23 MMP genes reduced the concentration of lumican secreted into culture medium, and have been identified in humans, and they can be subgrouped into this reduction was abolished by addition of the MMP inhibitor BB94. soluble-type and membrane-type MMPs (MT-MMPs; refs. 13, 14). Lumican protein from bovine cornea and recombinant lumican core MMPs are overexpressed in various human malignancies and have protein fused to glutathione S-transferase was shown to be cleaved at been thought to contribute to tumor invasion and metastasis by de- multiple sites by recombinant MT1-MMP. Transient expression of lumi- grading extracellular matrix components (13). Thus, the level of MMP can in HEK293 cells induced expression of tumor suppressor gene product expression correlates with the invasiveness or malignancy of tumors p21/Waf-1, which was abrogated by the coexpression of MT1-MMP con- comitant with a reduction in lumican concentration in culture medium. (15, 16). Particularly, MT1-MMP, MMP-2, MMP-7, and MMP-9 Stable expression of lumican in HeLa cells induced expression of p21 and have been reported to be most closely associated with tumor invasion reduction of colony formation in soft agar, which were both abolished by and metastasis. Although degradation of extracellular matrix is an the expression of MT1-MMP. HT1080 fibrosarcoma cells stably trans- important aspect of MMP biology, growing evidence has shown fected with the lumican cDNA (HT1080/Lum), which express endogenous specific processing/activation or degradation of cell surface receptors MT1-MMP, secreted moderate levels of lumican; however, treatment of and ligands. Fas ligand (17), tumor necrosis factor ␣ (18), the ectodo- HT1080/Lum cells with BB94 resulted in accumulation of lumican in main of the fibroblast growth factor receptor-1 (19), the heparin- culture medium. The expression levels of p21 in HT1080/Lum were pro- portional to the concentration of secreted lumican and showed reverse binding epidermal growth factor (20), and interleukin (IL)-8 (21) were corelation with colony formation in soft agar. These results suggest that reported to be released or activated by MMPs. MMPs also cleave and MT1-MMP abrogates lumican-mediated suppression of tumor cell colony inactivate IL-1␤ (22), insulin-like growth factor binding proteins (23), formation in soft agar by degrading this proteoglycan, which down- fibrinogen and factor XII (24), the CC chemokine MCP-3 (25), CXC regulates it through the induction of p21. chemokines stromal cell-derived factor 1 ␣ and ␤ (26, 27), metastasis suppressor gene product KiSS-1/metastin (28), and heparan sulfate INTRODUCTION proteglycan syndecan-1 (29). Previously, we have developed an expression cloning method to Lumican belongs to the family of small leucine-rich proteoglycans screen genes, the products of which not only modulate pro-MMP-2 that includes decorin, biglycan, fibromodulin, keratocan, epiphycan, activation mediated by MT1-MMP but also serve as substrates of and osteoglycin. Lumican is the major keratan sulfate proteoglycan of MT1-MMP (28–31). In this study, we have identified lumican as a the corneal stroma, but it is also expressed in other extracellular substrate of MT1-MMP and showed that cleavage of lumican by matrices, such as skin, muscle, and cartilage (1–6). Gene-targeting MT1-MMP suppressed induction of p21/Waf-1 expression by lumi- studies indicate that lumican plays an important role in determining can, which in turn enhanced colony formation of tumor cells in soft the structural phenotype of the mature collagen fibril in various agar. tissues. Decorin is also a member of the small leucine-rich proteogly- can protein family, and the phenotypes of decorin-deficient mice were very similar to those of lumican-targeted mice (7, 8). Decorin is MATERIALS AND METHODS emerging as a powerful modulator of cell growth by affecting several key elements, including matrix assembly, growth factor binding, and Proteins and Antibodies. DMEM was from Sigma (St. Louis, MO). Prim- receptor tyrosine kinase activity (3, 9, 10). Suppression of decorin ers were synthesized by Genset (Kyoto, Japan). A human placenta cDNA expression was found to be related to the induction of anchorage- library constructed in the pEAK8 expression vector was obtained from Edge- independent growth caused by v-src in human fetal lung fibroblasts Bio Systems (Gaithersburg, MD). Lumican protein from bovine cornea was (11). Lumican was also shown to reduce colony formation in soft agar purchased from Sigma. Recombinant MT1-MMP, the inert mutant of MT1- MMP (MT1-E/A), and MT3-MMP catalytic domains tagged with the FLAG Received 3/24/04; revised 6/16/04; accepted 7/28/04. epitope at the COOH-terminus and purified MMP-2 protein were prepared as Grant support: Grants-in-Aid for Scientific Research from the Ministry of Education, described previously (28, 32, 33). Monoclonal antibodies against FLAG Science and Culture of Japan (B2-11240203 and 14370053; H. Sato). epitope and glutathione S-transferase (GST) were purchased from Sigma and The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with Santa Cruz Biotechnology (Santa Cruz, CA), respectively. Recombinant 18 U.S.C. Section 1734 solely to indicate this fact. TIMP-1 and TIMP-2 proteins and monoclonal antibody against MT1-MMP Requests for reprints: Hiroshi Sato, Department of Molecular Virology and Oncol- (113-5B7) were gifts from Daiichi Fine Chemical Co. Ltd. (Toyama, Japan). ogy, Cancer Research Institute, Kanazawa University, 13-1 Takara-machi, Kanazawa, Cell Culture. Human embryonic kidney HEK293, HEK293T, HeLa, and Ishikawa 920-0934, Japan. Phone: 81-76-265-2750; Fax: 81-76-234-4505; E-mail: [email protected]. fibrosarcoma HT1080 cells were obtained from American Type Culture Col- ©2004 American Association for Cancer Research. lection (Manassas, VA) and cultured in DMEM supplemented with 5% FCS. 7058 Downloaded from cancerres.aacrjournals.org on September 28, 2021. © 2004 American Association for Cancer Research. CLEAVAGE OF LUMICAN BY MT1-MMP Fig. 1. Degradation of lumican by MT-MMPs. A. The expression plasmid for lumican tagged with FLAG epitope (Lum-FLAG) or empty pSG5 plasmid (Ϫ) was cotransfected (0.4 ␮g) with the indicated amount of MT1-MMP or E/A mutant plasmid (1.6 ␮g) into 293T cells cultured in 35-mm diameter dishes. Total plasmid DNA was adjusted to 2 ␮g/dish with pSG5 plasmid. At 36 hours after transfection, the culture medium was replaced with serum-free medium with or without 0.1 ␮mol/L BB94, and cells were incubated additionally for 24 hours. Culture supernatants and cell lysates were then analyzed by Western blotting with anti-FLAG M2 antibody as described under Materials and Methods (top and middle panels). Expression of MT1-MMP was examined by Western blotting of cell lysates using anti-MT1-MMP antibody (bottom panel). B. The expression plasmid for lumican tagged with FLAG epitope (0.4 ␮g) or empty pSG5 plasmid was cotransfected with 1.6 ␮g of control plasmid (Lane Ϫ) or expression plasmid for MT-MMP family members, as indicated by number into 293T cells cultured in 35-mm diameter dishes. Culture supernatants and cell lysates were analyzed as described above (top and middle panels, respectively). MT-MMPs, except for MT2-MMP, were tagged with FLAG epitope and were detected in cell lysates with anti-FLAG M2 antibody together with lumican core protein (middle panel). MT2-MMP was detected with anti-MT2-MMP monoclonal antibody 162-4E3, which cross-reacted with MT3-MMP (bottom panel). Expression Cloning. Expression cloning to identify genes, the products of M2 antibody (Sigma). A lumican cDNA fragment, which has a BglII restric- which interact with MMP-2, MMP-9, or MT1-MMP, was done as described tion site in place of the stop codon, was generated by PCR with lumican cDNA previously (30). cloned in pEAK8 plasmid as a template and pEAK8 forward primer (TTCAT- Construction of an Expression Plasmid for Lumican Tagged with TCTCAAGCCTCAGACAGTGG)/flanking reverse primer with an extra BglII FLAG. An expression plasmid for lumican tagged with the FLAG epitope at site (underlined) starting at nucleotide 1098 of lumican gene (GenBank acces- the COOH-terminus was constructed to detect lumican protein by anti-FLAG sion no. U21128; AGAGATCTATTAAGAGTGACTTCGTTAGCAA). The Fig. 2. Cleavage of lumican protein by MT1- MMP. A. Lumican protein (6 ␮g) was incubated with or without recombinant MT1-MMP catalytic domain (0.6 ␮g) in 30 ␮L TNC buffer containing 0.3% Brij at 37°C for 3 hours, separated on 10% SDS-PAGE, and stained with Coomassie Brilliant Blue. B. Lumican-GST fusion protein (3 ␮g) was incubated with the indicated amount of recombi- nant MT1-MMP catalytic domain in the presence or absence of 0.1 ␮mol/L BB-94 as described above, separated on 10% SDS-PAGE, and ana- lyzed by Western blotting with anti-GST antibody.
Load more

Recommended publications
  • Curcumin Alters Gene Expression-Associated DNA Damage, Cell Cycle, Cell Survival and Cell Migration and Invasion in NCI-H460 Human Lung Cancer Cells in Vitro
    ONCOLOGY REPORTS 34: 1853-1874, 2015 Curcumin alters gene expression-associated DNA damage, cell cycle, cell survival and cell migration and invasion in NCI-H460 human lung cancer cells in vitro I-TSANG CHIANG1,2, WEI-SHU WANG3, HSIN-CHUNG LIU4, SU-TSO YANG5, NOU-YING TANG6 and JING-GUNG CHUNG4,7 1Department of Radiation Oncology, National Yang‑Ming University Hospital, Yilan 260; 2Department of Radiological Technology, Central Taiwan University of Science and Technology, Taichung 40601; 3Department of Internal Medicine, National Yang‑Ming University Hospital, Yilan 260; 4Department of Biological Science and Technology, China Medical University, Taichung 404; 5Department of Radiology, China Medical University Hospital, Taichung 404; 6Graduate Institute of Chinese Medicine, China Medical University, Taichung 404; 7Department of Biotechnology, Asia University, Taichung 404, Taiwan, R.O.C. Received March 31, 2015; Accepted June 26, 2015 DOI: 10.3892/or.2015.4159 Abstract. Lung cancer is the most common cause of cancer CARD6, ID1 and ID2 genes, associated with cell survival and mortality and new cases are on the increase worldwide. the BRMS1L, associated with cell migration and invasion. However, the treatment of lung cancer remains unsatisfactory. Additionally, 59 downregulated genes exhibited a >4-fold Curcumin has been shown to induce cell death in many human change, including the DDIT3 gene, associated with DNA cancer cells, including human lung cancer cells. However, the damage; while 97 genes had a >3- to 4-fold change including the effects of curcumin on genetic mechanisms associated with DDIT4 gene, associated with DNA damage; the CCPG1 gene, these actions remain unclear. Curcumin (2 µM) was added associated with cell cycle and 321 genes with a >2- to 3-fold to NCI-H460 human lung cancer cells and the cells were including the GADD45A and CGREF1 genes, associated with incubated for 24 h.
    [Show full text]
  • Appendix 2. Significantly Differentially Regulated Genes in Term Compared with Second Trimester Amniotic Fluid Supernatant
    Appendix 2. Significantly Differentially Regulated Genes in Term Compared With Second Trimester Amniotic Fluid Supernatant Fold Change in term vs second trimester Amniotic Affymetrix Duplicate Fluid Probe ID probes Symbol Entrez Gene Name 1019.9 217059_at D MUC7 mucin 7, secreted 424.5 211735_x_at D SFTPC surfactant protein C 416.2 206835_at STATH statherin 363.4 214387_x_at D SFTPC surfactant protein C 295.5 205982_x_at D SFTPC surfactant protein C 288.7 1553454_at RPTN repetin solute carrier family 34 (sodium 251.3 204124_at SLC34A2 phosphate), member 2 238.9 206786_at HTN3 histatin 3 161.5 220191_at GKN1 gastrokine 1 152.7 223678_s_at D SFTPA2 surfactant protein A2 130.9 207430_s_at D MSMB microseminoprotein, beta- 99.0 214199_at SFTPD surfactant protein D major histocompatibility complex, class II, 96.5 210982_s_at D HLA-DRA DR alpha 96.5 221133_s_at D CLDN18 claudin 18 94.4 238222_at GKN2 gastrokine 2 93.7 1557961_s_at D LOC100127983 uncharacterized LOC100127983 93.1 229584_at LRRK2 leucine-rich repeat kinase 2 HOXD cluster antisense RNA 1 (non- 88.6 242042_s_at D HOXD-AS1 protein coding) 86.0 205569_at LAMP3 lysosomal-associated membrane protein 3 85.4 232698_at BPIFB2 BPI fold containing family B, member 2 84.4 205979_at SCGB2A1 secretoglobin, family 2A, member 1 84.3 230469_at RTKN2 rhotekin 2 82.2 204130_at HSD11B2 hydroxysteroid (11-beta) dehydrogenase 2 81.9 222242_s_at KLK5 kallikrein-related peptidase 5 77.0 237281_at AKAP14 A kinase (PRKA) anchor protein 14 76.7 1553602_at MUCL1 mucin-like 1 76.3 216359_at D MUC7 mucin 7,
    [Show full text]
  • MALE Protein Name Accession Number Molecular Weight CP1 CP2 H1 H2 PDAC1 PDAC2 CP Mean H Mean PDAC Mean T-Test PDAC Vs. H T-Test
    MALE t-test t-test Accession Molecular H PDAC PDAC vs. PDAC vs. Protein Name Number Weight CP1 CP2 H1 H2 PDAC1 PDAC2 CP Mean Mean Mean H CP PDAC/H PDAC/CP - 22 kDa protein IPI00219910 22 kDa 7 5 4 8 1 0 6 6 1 0.1126 0.0456 0.1 0.1 - Cold agglutinin FS-1 L-chain (Fragment) IPI00827773 12 kDa 32 39 34 26 53 57 36 30 55 0.0309 0.0388 1.8 1.5 - HRV Fab 027-VL (Fragment) IPI00827643 12 kDa 4 6 0 0 0 0 5 0 0 - 0.0574 - 0.0 - REV25-2 (Fragment) IPI00816794 15 kDa 8 12 5 7 8 9 10 6 8 0.2225 0.3844 1.3 0.8 A1BG Alpha-1B-glycoprotein precursor IPI00022895 54 kDa 115 109 106 112 111 100 112 109 105 0.6497 0.4138 1.0 0.9 A2M Alpha-2-macroglobulin precursor IPI00478003 163 kDa 62 63 86 72 14 18 63 79 16 0.0120 0.0019 0.2 0.3 ABCB1 Multidrug resistance protein 1 IPI00027481 141 kDa 41 46 23 26 52 64 43 25 58 0.0355 0.1660 2.4 1.3 ABHD14B Isoform 1 of Abhydrolase domain-containing proteinIPI00063827 14B 22 kDa 19 15 19 17 15 9 17 18 12 0.2502 0.3306 0.7 0.7 ABP1 Isoform 1 of Amiloride-sensitive amine oxidase [copper-containing]IPI00020982 precursor85 kDa 1 5 8 8 0 0 3 8 0 0.0001 0.2445 0.0 0.0 ACAN aggrecan isoform 2 precursor IPI00027377 250 kDa 38 30 17 28 34 24 34 22 29 0.4877 0.5109 1.3 0.8 ACE Isoform Somatic-1 of Angiotensin-converting enzyme, somaticIPI00437751 isoform precursor150 kDa 48 34 67 56 28 38 41 61 33 0.0600 0.4301 0.5 0.8 ACE2 Isoform 1 of Angiotensin-converting enzyme 2 precursorIPI00465187 92 kDa 11 16 20 30 4 5 13 25 5 0.0557 0.0847 0.2 0.4 ACO1 Cytoplasmic aconitate hydratase IPI00008485 98 kDa 2 2 0 0 0 0 2 0 0 - 0.0081 - 0.0
    [Show full text]
  • Development and Validation of a Protein-Based Risk Score for Cardiovascular Outcomes Among Patients with Stable Coronary Heart Disease
    Supplementary Online Content Ganz P, Heidecker B, Hveem K, et al. Development and validation of a protein-based risk score for cardiovascular outcomes among patients with stable coronary heart disease. JAMA. doi: 10.1001/jama.2016.5951 eTable 1. List of 1130 Proteins Measured by Somalogic’s Modified Aptamer-Based Proteomic Assay eTable 2. Coefficients for Weibull Recalibration Model Applied to 9-Protein Model eFigure 1. Median Protein Levels in Derivation and Validation Cohort eTable 3. Coefficients for the Recalibration Model Applied to Refit Framingham eFigure 2. Calibration Plots for the Refit Framingham Model eTable 4. List of 200 Proteins Associated With the Risk of MI, Stroke, Heart Failure, and Death eFigure 3. Hazard Ratios of Lasso Selected Proteins for Primary End Point of MI, Stroke, Heart Failure, and Death eFigure 4. 9-Protein Prognostic Model Hazard Ratios Adjusted for Framingham Variables eFigure 5. 9-Protein Risk Scores by Event Type This supplementary material has been provided by the authors to give readers additional information about their work. Downloaded From: https://jamanetwork.com/ on 10/02/2021 Supplemental Material Table of Contents 1 Study Design and Data Processing ......................................................................................................... 3 2 Table of 1130 Proteins Measured .......................................................................................................... 4 3 Variable Selection and Statistical Modeling ........................................................................................
    [Show full text]
  • Human Induced Pluripotent Stem Cell–Derived Podocytes Mature Into Vascularized Glomeruli Upon Experimental Transplantation
    BASIC RESEARCH www.jasn.org Human Induced Pluripotent Stem Cell–Derived Podocytes Mature into Vascularized Glomeruli upon Experimental Transplantation † Sazia Sharmin,* Atsuhiro Taguchi,* Yusuke Kaku,* Yasuhiro Yoshimura,* Tomoko Ohmori,* ‡ † ‡ Tetsushi Sakuma, Masashi Mukoyama, Takashi Yamamoto, Hidetake Kurihara,§ and | Ryuichi Nishinakamura* *Department of Kidney Development, Institute of Molecular Embryology and Genetics, and †Department of Nephrology, Faculty of Life Sciences, Kumamoto University, Kumamoto, Japan; ‡Department of Mathematical and Life Sciences, Graduate School of Science, Hiroshima University, Hiroshima, Japan; §Division of Anatomy, Juntendo University School of Medicine, Tokyo, Japan; and |Japan Science and Technology Agency, CREST, Kumamoto, Japan ABSTRACT Glomerular podocytes express proteins, such as nephrin, that constitute the slit diaphragm, thereby contributing to the filtration process in the kidney. Glomerular development has been analyzed mainly in mice, whereas analysis of human kidney development has been minimal because of limited access to embryonic kidneys. We previously reported the induction of three-dimensional primordial glomeruli from human induced pluripotent stem (iPS) cells. Here, using transcription activator–like effector nuclease-mediated homologous recombination, we generated human iPS cell lines that express green fluorescent protein (GFP) in the NPHS1 locus, which encodes nephrin, and we show that GFP expression facilitated accurate visualization of nephrin-positive podocyte formation in
    [Show full text]
  • Electronic Supplementary Material (ESI) for Analyst. This Journal Is © the Royal Society of Chemistry 2020
    Electronic Supplementary Material (ESI) for Analyst. This journal is © The Royal Society of Chemistry 2020 Table S1.
    [Show full text]
  • Proteoglycan Form and Function: a Comprehensive Nomenclature of Proteoglycans
    HHS Public Access Author manuscript Author ManuscriptAuthor Manuscript Author Matrix Biol Manuscript Author . Author manuscript; Manuscript Author available in PMC 2016 May 06. Published in final edited form as: Matrix Biol. 2015 March ; 42: 11–55. doi:10.1016/j.matbio.2015.02.003. Proteoglycan form and function: A comprehensive nomenclature of proteoglycans Renato V. Iozzo1 and Liliana Schaefer2 1Department of Pathology, Anatomy and Cell Biology and the Cancer Cell Biology and Signaling Program, Kimmel Cancer Center, Sidney Kimmel Medical College at Thomas Jefferson University, Philadelphia, PA 19107, USA 2Pharmazentrum Frankfurt/ZAFES, Institut für Allgemeine Pharmakologie und Toxikologie, Klinikum der Goethe-Universität Frankfurt am Main, Frankfurt am Main, Germany Abstract We provide a comprehensive classification of the proteoglycan gene families and respective protein cores. This updated nomenclature is based on three criteria: Cellular and subcellular location, overall gene/protein homology, and the utilization of specific protein modules within their respective protein cores. These three signatures were utilized to design four major classes of proteoglycans with distinct forms and functions: the intracellular, cell-surface, pericellular and extracellular proteoglycans. The proposed nomenclature encompasses forty-three distinct proteoglycan-encoding genes and many alternatively-spliced variants. The biological functions of these four proteoglycan families are critically assessed in development, cancer and angiogenesis, and in various acquired and genetic diseases where their expression is aberrant. Keywords Proteoglycan; Glycosaminoglycan; Cancer growth; Angiogenesis; Growth factor modulation Introduction It has been nearly 20 years since the original publication of a comprehensive classification of proteoglycan gene families [1]. For the most part, these classes have been widely accepted. However, a broad and current taxonomy of the various proteoglycan gene families and their products is not available.
    [Show full text]
  • Fibroblasts from the Human Skin Dermo-Hypodermal Junction Are
    cells Article Fibroblasts from the Human Skin Dermo-Hypodermal Junction are Distinct from Dermal Papillary and Reticular Fibroblasts and from Mesenchymal Stem Cells and Exhibit a Specific Molecular Profile Related to Extracellular Matrix Organization and Modeling Valérie Haydont 1,*, Véronique Neiveyans 1, Philippe Perez 1, Élodie Busson 2, 2 1, 3,4,5,6, , Jean-Jacques Lataillade , Daniel Asselineau y and Nicolas O. Fortunel y * 1 Advanced Research, L’Oréal Research and Innovation, 93600 Aulnay-sous-Bois, France; [email protected] (V.N.); [email protected] (P.P.); [email protected] (D.A.) 2 Department of Medical and Surgical Assistance to the Armed Forces, French Forces Biomedical Research Institute (IRBA), 91223 CEDEX Brétigny sur Orge, France; [email protected] (É.B.); [email protected] (J.-J.L.) 3 Laboratoire de Génomique et Radiobiologie de la Kératinopoïèse, Institut de Biologie François Jacob, CEA/DRF/IRCM, 91000 Evry, France 4 INSERM U967, 92260 Fontenay-aux-Roses, France 5 Université Paris-Diderot, 75013 Paris 7, France 6 Université Paris-Saclay, 78140 Paris 11, France * Correspondence: [email protected] (V.H.); [email protected] (N.O.F.); Tel.: +33-1-48-68-96-00 (V.H.); +33-1-60-87-34-92 or +33-1-60-87-34-98 (N.O.F.) These authors contributed equally to the work. y Received: 15 December 2019; Accepted: 24 January 2020; Published: 5 February 2020 Abstract: Human skin dermis contains fibroblast subpopulations in which characterization is crucial due to their roles in extracellular matrix (ECM) biology.
    [Show full text]
  • Gene Expression Alterations in Salivary Gland Epithelia of Sjögren's
    www.nature.com/scientificreports OPEN Gene expression alterations in salivary gland epithelia of Sjögren’s syndrome patients are associated with clinical and histopathological manifestations Ariana Dela Cruz1,7, Vinay Kartha2,7, Andrew Tilston‑Lunel3,7, Rongjuan Mi1,3, Taylor L. Reynolds4, Michael Mingueneau4, Stefano Monti2, Janicke L. Jensen5, Kathrine Skarstein6, Xaralabos Varelas3* & Maria A. Kukuruzinska1* Sjögren’s syndrome (SS) is a complex autoimmune disease associated with lymphocytic infltration and secretory dysfunction of salivary and lacrimal glands. Although the etiology of SS remains unclear, evidence suggests that epithelial damage of the glands elicits immune and fbrotic responses in SS. To defne molecular changes underlying epithelial tissue damage in SS, we laser capture microdissected (LCM) labial salivary gland epithelia from 8 SS and 8 non‑SS controls for analysis by RNA sequencing (RNAseq). Computational interrogation of gene expression signatures revealed that, in addition to a division of SS and non‑SS samples, there was a potential intermediate state overlapping clustering of SS and non‑SS samples. Diferential expression analysis uncovered signaling events likely associated with distinct SS pathogenesis. Notable signals included the enrichment of IFN‑γ and JAK/STAT‑ regulated genes, and the induction of genes encoding secreted factors, such as LTF, BMP3, and MMP7, implicated in immune responses, matrix remodeling and tissue destruction. Identifcation of gene expression signatures of salivary epithelia associated with mixed clinical and histopathological characteristics suggests that SS pathology may be defned by distinct molecular subtypes. We conclude that gene expression changes arising in the damaged salivary epithelia may ofer novel insights into the signals contributing to SS development and progression.
    [Show full text]
  • 3364.Full.Pdf
    [CANCER RESEARCH 63, 3364–3369, June 15, 2003] Testican 2 Abrogates Inhibition of Membrane-type Matrix Metalloproteinases by Other Testican Family Proteins1 Mitsutoshi Nakada,2 Hisashi Miyamori,2 Junkoh Yamashita, and Hiroshi Sato3 Department of Molecular Virology and Oncology [M. N., H. M., H. S.], Center for the Development of Molecular Target Drugs, Cancer Research Institute [H. S.], Department of Neurosurgery, Division of Neuroscience, Graduate School of Medical Science [M. N., J. Y.], Kanazawa University, Ishikawa 920-0934, Japan ABSTRACT activation of pro-MMP-2 is a common functional role proposed for all of the MT-MMPs (4–8), expression of MT1-MMP most closely Testican family proteins are putative extracellular heparan/chondroitin correlates with invasive phenotype of human tumors (9–13). sulfate proteoglycans of unknown function. We identified recently N-Tes, Testican was first defined as an unnamed chondroitin/heparan which is a product of testican 3 splicing variant gene, as an inhibitor of membrane-type matrix metalloproteinases (MT-MMPs). The inhibitory sulfate proteoglycan in seminal plasma (14). Corresponding cDNAs function is common among testican family members except for testican 2, were isolated from human testis libraries, and the deduced protein was which was shown to uniquely abolish inhibition of MT1-MMP- or MT3- named testican (15). To date 3 members of the testican family were MMP-mediated pro-MMP-2 activation by other testican family members. identified by cDNA cloning, with deduced amino acid homologies of Testican 2 inactivates N-Tes by binding to the COOH-terminal extracel- 42%, 51%, and 44% for testican 1/testican 2, testican 1/testican 3, and lular calcium-binding domain of N-Tes through its NH2-terminal unique testican 2/testican 3, respectively (15–17).
    [Show full text]
  • Ncomms2128.Pdf
    ARTICLE Received 10 Jul 2012 | Accepted 6 Sep 2012 | Published 9 Oct 2012 DOI: 10.1038/ncomms2128 A combinatorial extracellular matrix platform identifies cell-extracellular matrix interactions that correlate with metastasis Nathan E. Reticker-Flynn1,2, David F. Braga Malta1,2,3,4, Monte M. Winslow1,5, John M. Lamar1, Mary J. Xu2, Gregory H. Underhill1,6, Richard O. Hynes1,7,8, Tyler E. Jacks1,7,8,9 & Sangeeta N. Bhatia1,2,8,10,11 Extracellular matrix interactions have essential roles in normal physiology and many pathological processes. Although the importance of extracellular matrix interactions in metastasis is well documented, systematic approaches to identify their roles in distinct stages of tumorigenesis have not been described. Here we report a novel-screening platform capable of measuring phenotypic responses to combinations of extracellular matrix molecules. Using a genetic mouse model of lung adenocarcinoma, we measure the extracellular matrix-dependent adhesion of tumour-derived cells. Hierarchical clustering of the adhesion profiles differentiates metastatic cell lines from primary tumour lines. Furthermore, we uncovered that metastatic cells selectively associate with fibronectin when in combination with galectin-3, galectin-8 or laminin. We show that these molecules correlate with human disease and that their interactions are mediated in part by α3β1 integrin. Thus, our platform allowed us to interrogate interactions between metastatic cells and their microenvironments, and identified extracellular matrix and integrin interactions that could serve as therapeutic targets. 1 David H. Koch Institute for Integrative Cancer Research, Massachusetts Institute of Technology, Cambridge, Massachusetts 02139, USA. 2 Harvard- MIT Division of Health Sciences and Technology, Massachusetts Institute of Technology, Cambridge, Massachusetts 02139, USA.
    [Show full text]
  • Clues from the Gene and Protein Side Offer Novel Perspectives in Molecular Diversity and Function
    REVIEW Proteoglycans of the extracellular environment: clues from the gene and protein side offer novel perspectives in molecular diversity and function RENATO V. IOZZO’ AND ALAN D. MURDOCH Department of Pathology, Anatomy, and Cell Biology, and the Jefferson Cancer Institute, Thomas Jefferson University, Philadelphia, Pennsylvania 19107, USA ABSTRACT This review focuses on the extracellu- and multifunctional molecules of the animal kingdom. lar proteoglycans. Special emphasis is placed on the They carry a variety of structural units that vary from structural features of their protein cores, their gene simple linear sugars to the most highly charged, sulfated organization, and their transcriptional control. A polysaccharide in nature: heparin. They provide struc- simplified nomenclature comprising two broad tural constraints, function as growth-supportive or sup- groups of extracellular proteoglycans is offered: the pressive molecules, possess adhesive and anti-adhesive small leucine-rich proteoglycans or SLRPS, pro- properties, act as major biological filters, promote angio- nounced “slurps,” and the modular proteoglycans. genesis, induce neurite outgrowth, and bind, store, and The first group encompasses at least five distinct deliver growth factors to target cells during normal devel- members of a gene family characterized by a central opment and in pathologic states. This review centers on domain composed of leucine-rich repeats flanked by the extracellular proteoglycans, those molecules whose two cysteine-rich regions. The second
    [Show full text]