THE PENNSYLVANIA STATE UNIVERSITY SCHREYER HONORS COLLEGE

DEPARTMENT OF BIOLOGY

SPECIES DELIMITATION AND THE EVOLUTION OF HIGHLY VARIABLE MORPHOLOGICAL TRAITS IN THE HOLARCTIC SOCIALLY PARASITIC BUMBLE BEE, BOMBUS FLAVIDUS

SARAH DANIELLE WILLIAMS SPRING 2018

A thesis submitted in partial fulfillment of the requirements for a baccalaureate degree in Biology with honors in Biology

Reviewed and approved* by the following:

Heather Hines Assistant Professor of Biology and Entomology Thesis Supervisor

James Marden Professor of Biology and Associate Director, Huck Institutes of the Life Sciences Honors Adviser

* Signatures are on file in the Schreyer Honors College. i

ABSTRACT

Bombus flavidus is a socially parasitic bumble bee with contentious species status.

Multiple separate species within Bombus flavidus have been suggested, both on local and global scales. Until recently recognition of a Nearctic B. fernaldae and Palearctic B. flavidus was favored, but limited genetic data suggested that even these could be a single widespread species,

B. flavidus. A combination of COI sequencing, color pattern, wing morphometric, and genitalia morphology analysis were used to resolve the species status of this lineage. In an initial analysis, male Bombus flavidus from Oregon, U.S.A. were determined to be part of one species. These individuals have high polymorphism in color but exhibit darker phenotypes in the darker Pacific mimicry zone. A broader analysis including Bombus flavidus specimens from Europe and Russia

(“Old World” specimens) and North America (“New World” Bombus fernaldae), revealed that

B. fernaldae is a distinct lineage, either a species or subspecies. However, B. fernaldae is not broadly Nearctic, but rather confined to the eastern Appalachian and boreal regions of the

United States and far southeastern Canada, whereas B. flavidus occurs throughout the western

U.S., Canada, and the Old World, a distribution broader than that achieved for any host bumble bee species. Analysis of phenotype data revealed that color polymorphisms are retained across the B. flavidus/fernaldae range and genitalic morphology is highly variable compared to other species.

ii

TABLE OF CONTENTS

LIST OF FIGURES ...... iv

LIST OF TABLES ...... v

ACKNOWLEDGEMENTS ...... vi

Chapter 1 Thesis Introduction ...... 1

1. Taxonomy, phylogenetics, and species delimitation in bumble bees ...... 1 2. Evolution of social parasitism in bumble bees ...... 3 3. The obligately socially parasitic subgenus Psithyrus ...... 4 a. Taxonomy and phylogenetic relationships ...... 4 b. Geographic distribution ...... 6 4. The socially parasitic bumble bee, Bombus flavidus ...... 6 5. Thesis goals ...... 7

Chapter 2 Bombus flavidus in Oregon, USA is a single highly polymorphic species . 9

1. Abstract ...... 9 2. Introduction ...... 9 3. Methods ...... 11 4. Results ...... 16 5. Discussion ...... 22

Chapter 3 Global analysis of Bombus flavidus species group supports the distinction of Bombus fernaldae ...... 26

1. Abstract ...... 26 2. Introduction ...... 26 3. Methods ...... 29 4. Results ...... 33 5. Discussion ...... 41

Appendix A Specimen Tables ...... 47

Appendix B Color Data ...... 57

Appendix C Nexus haplotype file ...... 59

Trimmed B. flavidus haplogroup Nexus file for popART: ...... 59

Appendix D Genitalia Images ...... 63

Appendix E Genitalic Data Matrices ...... 67 iii

Appendix F Wing Landmark-Based Morphometric Analysis Data (.tps file) ...... 73

Appendix G R Scripts ...... 86

BIBLIOGRAPHY ...... 95

iv

LIST OF FIGURES

Figure 1: Oregon Bombus flavidus localities ...... 11

Figure 2: (A) Template used for color pattern observation; (B) Black color B. flavidus pattern extreme from Oregon (specimen 300102); (C) Yellow color B. flavidus pattern extreme from Oregon (specimen 300304) ...... 12

Figure 3: B. flavidus male genitalia with labeled measurements ...... 14

Figure 4: (A) Average individual percent yellow pile for Oregon male Bombus flavidus; (B) Boxplot of total body pile percent yellow for individuals from Western vs. Eastern Oregon localities ...... 17

Figure 5: Extremes in B. flavidus gonobase shape (chosen using A:B ratio and visual observation) from each Oregon locality region (Figure 1), used for COI sequencing ...... 19

Figure 6: Histogram of Oregon B. flavidus gonobase A:B ratios ...... 19

Figure 7: (A) PCA graphic of Oregon B. flavidus male genitalia measurements by locality; (B) PCA graphic of Oregon B. flavidus male genitalia measurements by region ...... 20

Figure 8: Total body pile percentage yellow vs. locality elevation (m) ...... 22

Figure 9: Labeled measurements for sister species genitalia variation analysis ...... 32

Figure 10: Landmarks used in global B. flavidus wing morphometric analysis ...... 33

Figure 11: Global color pattern distribution for B. flavidus and B. fernaldae ...... 34

Figure 12: Haplotype map for New World and Old World Bombus “flavidus” specimens .... 36

Figure 13: (A) PCA results for genitalia measurements of B. flavidus specimens from Oregon, North Carolina, and Pennsylvania, USA; (B) PCA results with eigenvectors for genitalic analysis on B. flavidus from the United States ...... 36

Figure 14: Distribution of gonobase ratios for B. flavidus from the eastern United States and Oregon ...... 38

Figure 15: PCA results for genitalic analysis on B. flavidus from the United States and B. californicus, B. fervidus, B. insularis, and B. melanopygus...... 39

Figure 16: 3D figure from PCA of genitalia from B. flavidus, B. fervidus, B. melanopygus, B. californicus, and B. insularis...... 40

Figure 17: Wing morphometric analysis data for global B. flavidus specimens ...... 41

v

LIST OF TABLES

Table 1: Results of COI analysis of Oregon Bombus flavidus males based on color pattern and genitalia morphology extremes ...... 21

Table 2: Bombus flavidus specimen table for Oregon analysis ...... 47

Table 3: Bombus “flavidus” specimen table for global analysis ...... 50

Table 4: Oregon B. flavidus Total Body Pile Color Matrices ...... 57

Table 5: B. flavidus/fernaldae genitalia images ...... 63

Table 6: Additional species genitalia images: B. californicus, B. fervidus, B. insularis, B. melanopygus ...... 66

Table 7: Genitalia measurements (see Figure 3) for B. flavidus from Oregon, United States . 67

Table 8: Genitalia measurements (see Figure 11) for B. “flavidus” from Oregon, Pennsylvania, and North Carolina, United States, and for B. californicus, B. fervidus, B. insularis, and B. melanopygus specimens ...... 69

vi

ACKNOWLEDGEMENTS

First, I would like to thank Dr. Heather Hines for her invaluable guidance, wisdom, patience, and support throughout my three years working on this project; she has been an exceptional mentor and teacher, and has inspired me to always aim high and work hard. I will forever be grateful to her for my wonderful experience in the Hines Lab, and wish to thank her for all the ways she has helped me grow as both a researcher and an individual.

Additionally, I would like to thank Patrick Lhomme for the consistent support, guidance, and technical knowledge he provided throughout the completion of this project. Patrick was absolutely essential to developing the directions of this research and completing this thesis, and his expertise has helped me grow exponentially as a researcher.

I would also like to thank the other members of the Hines Laboratory for their assistance with this project. In particular, I would like to thank Briana Ezray and Li Tian for the patience, support, and technical knowledge they provided. They were integral parts of this research, and I had the pleasure of learning a great deal from working with them. Thank you to the rest of the

Hines Lab for their consistent support and feedback on my work.

I also wish to thank my Honors Advisor, Dr. James Marden, for his guidance throughout my undergraduate career and for the role he played in the completion of this thesis.

I would also like to thank the Eberly College of Science at the Pennsylvania State

University and the Departments of Biology and Entomology for the support they have provided me over the past three years. Finally, I would also like to thank the Schreyer Honors College for the research grant provided to help fund this research.

Chapter 1

Thesis Introduction

1. Taxonomy, phylogenetics, and species delimitation in bumble bees

The bumble bees are contained within a single genus Bombus (Apoidea: Apidae) that consists of roughly 250 species. They have been the focus of much previous research as these charismatic bees are dominant pollinators in temperate floral communities, and their primitive eusociality makes them an intriguing system to understand the evolution of sociality. Bombus is predicted to have an Old World ancestor ~34 million years ago, and originated and is most speciose in the Old World. It has experienced eighteen phylogenetically independent dispersal events from the Old World to the New World starting roughly 20 million years ago (Hines,

2008).

Bumble bees have been considered as morphologically monotonous (Michener, 2000), as they do not have many obvious characters to delimit species outside of their dramatic variation in color. The extraordinary variation observed within the color patterns of bumble bees and their tendency to locally converge on certain color patterns has caused great historical difficulties in identifying and describing Bombus species, as color is often polymorphic and has not been a reliable indicator of species boundaries (Plowright & Owen, 1980; Williams, Cameron, Hines,

Cederberg, & Rasmont, 2008; Meulemeester, Aytekin, Cameron, & Rasmont, 2011). Since 1758, taxonomists have described individuals belonging to Bombus using over 2800 formal names, most of which have been for taxa below the rank of species (Williams, 1998). In total, a median 2 of five names is ascribed to each currently valid species, with a maximum of 186 names, and bumble bees are argued to exhibit the highest known levels of synonymy (83-92%) of all insects

(Williams, 1998).

The decline in the number of Bombus taxa accepted as species since the nineteenth century reflects the shift in criteria used for recognizing species, from color patterns to morphological characters, particularly male genitalia morphology (Williams, 1998). The earliest classifications of bumble bees (Dalla Torre, 1880, 1882) placed them in species by color pattern.

Later classifications (Radoskowski, 1884; Vogt, 1911; Skorikov, 1922) expanded species numbers and found the most meaningful groups can be recognized by the morphology of male genitalia, which can vary quite drastically, especially between subgenera. The addition of molecular data (Cameron, Hines, & Williams, 2007) has provided a framework for higher-level revision and has been valuable for beginning to test species delimitation hypotheses (Williams et al., 2008; Lecoq et al., 2015).

Given the extensive focus on this group, the phylogeny of bumble bees is one of the most resolved and complete among all insect genera (Cameron et al., 2007; Hines, 2008). However, given the challenges posed by morphological monotony outside of color and the failure of color to sort well by species, uncertainty still remains about how to delimit some species at the tips of the Bombus phylogenetic tree. Recent work has been tackling the challenge of defining these species using integrative approaches.

A number of different methods are currently used in the species delimitation of bumble bees, the three most common of which include morphometric analyses of wing shape, sequence- based species delimitation methods, and differentiation of cephalic labial gland secretions used for mate recognition (Lecocq et al., 2015). These methods, for example, were used to analyze the

3 taxonomically doubtful Bombus lapidarius-group, where it was found that wing shape analyses were unable to delineate any obvious clusters but that data from nuclear/mitochondrial data and cephalic labial gland secretions produced congruent results (Lecocq et al., 2015).

2. Evolution of social parasitism in bumble bees

Parasitism is an extremely prevalent lifestyle in the natural world (Thompson, 1994). One type of parasitism, “brood parasitism,” involves the parasitic species exploiting their host’s brood care behavior. In bumble bees, individuals that invade nests of other species and recruit the invaded social brood towards rearing their own offspring are referred to as “social parasites.”

Although social parasites have arisen multiple times in social insects, social parasites tend to be of low abundance and species richness relative to host species (Lhomme & Hines, submitted).

Different forms of social parasitism vary in their levels of integration with the host. Some species are facultative social parasites in that they can produce their own worker caste and may exploit the labor and resources of their host species temporarily (Nash & Boosma, 2008). This is considered a step towards the more obligate social parasites which are completely dependent on their hosts, to an extent where females of these species are unable to produce a worker caste and instead produce only reproductives; in such case, these obligate social parasites are entirely dependent upon the host workers to raise their offspring (Alford, 1975; Cervo, 2006; Buschinger,

2009).

Social parasitism has ~21 origins within bees. Within the bumble bee lineage, obligate social parasitism has three known independent origins: Bombus hyperboreus in the subgenus

Alpinobombus, B. inexspectatus in the subgenus Thoracobombus, and the subgenus Psithyrus

4 which consists entirely of species of worker-less parasites (Hines & Cameron, 2010). In each of these lineages social parasitism has led to morphological convergences involving both the loss or reduction of certain traits, mainly those related to pollen collection and nest construction, and the development of new morphological traits, such as those related to self-defense against their hosts.

3. The obligately socially parasitic subgenus Psithyrus

Psithyrus, or cuckoo bumble bees, is a subgenus within the bumble bees that consists entirely of obligate socially parasitic species. Psithyrus species lack a pollen-collecting apparatus, are unable to produce a worker caste and produce insufficient amounts of wax to construct a nest; thus Psithyrus species are entirely dependent on their hosts for the rearing of their offspring (Lhomme & Hines, submitted). None of the other socially parasitic insect lineages achieve the diversity of Psithyrus (28 extant species). These species exhibit varying forms of host specialization and integration strategies ideal for understanding how social parasites achieve success and speciate relative to host lineages (Lhomme & Hines, submitted).

a. Taxonomy and phylogenetic relationships

Kirby (1802) first described the morphological specificities of obligately socially parasitic bees now ascribed to the subgenus Psithyrus. In 1806, Illiger proposed that cuckoo bumble bees should be separated from “true bumble bees” on the basis of these species having different habits from other Bombus species, and in 1835, Newman separated cuckoo bumble bees

5 into the genus name Apathus; while this genus name was used for over 40 years, today this group is referred to as Psithyrus as Lepeletier (1832) had priority in naming this group.

Psithyrus was accepted as a separate monophyletic socially parasitic genus from Bombus

(Gaschott, 1922) until molecular phylogenetic studies convincingly placed Psithyrus to be a derived lineage within the genus Bombus (Plowright & Stephen, 1973; Pekkarinen et al., 1979;

Ito, 1985; Pamilo, Pekkarinen, & Varvio, 1987; Williams, 1985, Cameron et al. 2007), leading to its current classification as a subgenus of Bombus (Williams, 1991; Williams et al., 2008).

Much taxonomic confusion still exists within the subgroups of Psithyrus (Lecocq et al.,

2011). Within the 28 Psithyrus species worldwide, there exists over 350 proposed specific or subspecific names (Williams, 1998). The rarity of many Psithyrus species only intensifies this taxonomic confusion (Lhomme & Hines, submitted). For example, although it is considered a center of diversity, few specimens have been obtained of species in central Asia, preventing adequate assessment of their species status.

Psithyrus is a fairly phylogenetically isolated subgenus that is estimated to have separated from its bumble bee sister lineage, the Holarctic Thoracobombus subgenus, around 20 million years ago (Cameron et al., 2007); given that bumble bees are estimated at 34 million years old

(Hines, 2008), this is a deep split. Although subtended by a long branch separating them from other bumble bees, within Psithyrus, species are fairly closely related with an estimated ancestor existing around 9 million years ago (Hines, 2008).

6 b. Geographic distribution

The subgenus Psithyrus follows a largely Holarctic distribution (Williams, 1998), and has a broad range when compared to other subgenera. Psithyrus has experienced four phylogenetically independent movements into the Nearctic from the Palearctic (Hines, 2008).

Despite their broad range, Psithyrus distribution is more limited than and is restricted by the geographic distribution of their hosts (Lundberg & Svensson, 1977; Antonovics & Edwards,

2011). Psithyrus are generally found at lower altitudes and latitudes (Alford, 1975; Løken, 1985;

Pekkarinen, Teras, Viramo, & Paatela, 1981), and are not found in the geographical extremes of other bumble bees, namely the Artic and inter-tropical regions (Hines, 2008). Studying parasitic species provides information about parasite-host geographic ranges and can inform overall bumble bee geographic patterns.

4. The socially parasitic bumble bee, Bombus flavidus

Among the Psithyrus, one of the species with unresolved species status is Bombus flavidus. B. flavidus is part of the Sylvestris species group within Psithyrus, a lineage that includes at least five species that tend to specialize on hosts within the subgenus Pyrobombus.

The closest clearly different species to B. flavidus is the relatively isolated species

Bombus skorikovi, which exhibits an Oriental distribution. Another close species to B. flavidus in this group is Bombus norvegicus, which displays a widespread distribution across the Palearctic.

B. flavidus has until recently been considered most closely related to the North American sister taxon Bombus fernaldae. Genetic analysis of a single specimen each from Europe and the western U.S. using four nuclear and one mitochondrial marker suggested these two species to be

7 so similar that they are likely conspecific (Cameron et al., 2007), leading to a tentative assignment of B. fernaldae to B. flavidus in the online bumble bee species checklist by Williams

(nhm.ac.uk/research-curation/research/projects/bombus/subgenericlist.html), although resolution of this is considered to await data on more specimens. Several other historically described species have also been synonymized with B. flavidus; for example, the described species B. wheeleri in Oregon and California was synonymized with B. flavidus (Frison, 1926).

If B. flavidus encompassed B. fernaldae it would give B. flavidus an unusually large range for bumble bees, including a broad Holarctic distribution spanning across Palearctic,

Western Nearctic, and Eastern Nearctic regions. Given that this widespread distribution is seen in very few other species of bumble bee, it is important to determine the validity of this species range (Hines, 2008).

5. Thesis goals

In this thesis, members of the B. flavidus species group from across its Holarctic distribution will be investigated to understand how they vary across their range and ultimately to refine the species status of its members. An integrative approach is applied towards answering these questions including data on color patterns, genetic data, male genitalia morphology and wing morphology.

In Chapter 2, I specifically analyze Bombus “flavidus” males in Oregon to determine based on color patterns, genetic data, and male genitalia whether or not the high degree of observed polymorphism in these populations is indicative of the presence of multiple distinct species. Historically a separate species was described from this region, Bombus wheeleri.

8 In Chapter 3, these same methods, with an added wing morphometric analysis, are used to investigate species status, population structure, and phenotype variability of Bombus flavidus on a global scale. In particular, “Old World” B. flavidus from European and Russian localities will be systematically compared to “New World” B. flavidus specimens from North America, previously designated as Bombus fernaldae, to see if enough differences in these characters exist within these populations to support the existence of a separate species in North America.

9 Chapter 2 Bombus flavidus in Oregon, USA is a single highly polymorphic species

1. Abstract

Like many Psithyrus species, Bombus flavidus has a history of confusion regarding its species status due to its broad range, rarity, and high degree of polymorphism. A number of historically described species have been synonymized with B. flavidus including Bombus wheeleri from Oregon and California, USA (Frison, 1926). The goal of this research was to understand patterns of species delimitation of this species in Oregon, USA, using an integrative approach involving analysis of color patterns, COI barcoding data, and male genitalia morphology. The data from this study support the idea that B. flavidus in Oregon, USA is one singular species that is highly polymorphic on traits of color pattern and male genitalia, and that

B. wheeleri is not a distinct population from B. flavidus.

2. Introduction

In the bumble bees, some of the areas of highest uncertainty regarding species boundaries are in the socially parasitic species of the subgenus Psithyrus. This uncertainty is compounded by the rarity of many of these species, which has presented few specimens for analysis.

Historically, 350 proposed specific or subspecific names were ascribed to what now is recognized as 28 extant Psithyrus species (Williams, 1998). Among the species with greatest taxonomic uncertainty is in the species Bombus flavidus.

In the Pacific United States, a high degree of polymorphism can be found in color patterns and male genitalia morphology of Bombus flavidus. Historically, this polymorphism has

10 led to B. flavidus individuals in this region being designated as separate species. In 1925,

Bequaert and Plath described the new species Bombus wheeleri from Oregon and California, noting morphological differences in male genitalia between “B. wheeleri” and B. flavidus (at the time, B. fernaldae), whereby the volsella was more slender and elongate in B. wheeleri than in B. fernaldae (cf. Fig. 3).

In 1926, however, Frison determined B. wheeleri to be a variant color morph of B. flavidus (B. fernaldae); he additionally noted that B. fernaldae (B. flavidus) was, at least from a color standpoint, likely one of the most variable species of Psithyrus in North America. Although he did not provide quantitative data, Frison noted that the observed differences in genitalia of male specimens designated as “B. wheeleri” by Bequaert and Plath were very slight and likely were either minor individual variations or arose from the manner in which the genitalia set while drying, and that the described B. wheeleri were identical to B. fernaldae in all other structural features.

In this chapter, I attempt to address these outstanding questions regarding the species delimitation of Bombus flavidus in Oregon, USA and the existence of Bombus wheeleri by assessing a diversity of male specimens across the described distribution of B. wheeleri. I utilize an integrative approach that merges color pattern data, COI genetic data, and male genitalia data towards understanding species status. Color pattern analysis will be utilized in this study to better understand the variance in B. flavidus color patterns throughout the distribution of this species and whether they might sort into genetically cohesive lineages. COI data and male genitalia morphology will be utilized due to their recognition as strong and consistent tools for differentiating Bombus species (Lecocq et al., 2015). As species delimitation criteria, if traits are

11 continuous across individuals, this would suggest a single species, whereas discrete sorting of individuals across traits would suggest multiple species.

3. Methods

Specimens Analyzed

In this study I analyzed a total of 77 male Bombus flavidus specimens collected from 16 different localities across Oregon, U.S.A, during July 2015 (Table 2, Appendix A). These specimens clustered into two major regions - the Cascade Mountain Range in the west and the mountain ranges in the Northeast corner of the state (Blue Mts., Wallow Mts., and Columbia plateau) – and are mapped in Figure 1.

Figure 1: Oregon Bombus flavidus localities

Color Data

Coloration in B. flavidus ranges from bees that are nearly entirely yellow to those that are largely black, with the last tergite exhibiting orange (see Fig. 2, parts B and C). To determine the

12 differences in pattern quantitatively across the state and whether color pattern variation may be associated with other measured traits, each specimen was observed under a microscope and their individual color patterns were recorded for the head, dorsal thorax, pleuron (lateral thorax), and each tergite. The color patterns for each individual were partitioned into 68 total squares for color quantification as indicated in Figure 2. I noted that the variation in yellow/black patterning was continuous and determined that the best metric for comparison was overall percent of yellow pile. Each square of each individual was given a score representing the percentage of the pile in that square that was black, yellow, and orange. The percentages of each color for each individual were summed, and each individual was given a total body pile percent black, yellow, and orange

(Table 4, Appendix B). An unpaired student t-test was performed on percent yellow color from

Western versus Eastern regions (Northeast + East in Figure 1).

Figure 2: (A) Template used for color pattern observation; (B) Black color B. flavidus pattern extreme from Oregon (specimen 300102); (C) Yellow color B. flavidus pattern extreme from Oregon (specimen 300304)

To assess the role of geography in coloration, I mapped the percent yellow coloration for clusters of localities. I also performed a regression analyses on the overall body percentage of

13 yellow pile for each individual against elevation to see if the different elevation of localities was driving variation in Oregon Bombus flavidus color patterns.

Genitalic Morphology

Given the previous records of high genitalic variation, special focus was applied to examining variation in the morphology of the male genitalia. For the male genitalia morphology analysis, the genital capsule was removed from specimens and images were taken of the genitalia, taking special care to ensure the genitalia lie in a similar way in a flat plane across specimens (see Table 5, Appendix D for genitalia images). Live and imaged specimens were examined carefully for diagnostic traits as well as major sources of variation.

From this assessment, several metrics of genitalia shape were chosen (Figure 3). Each of these characters measure fixed traits that do not vary with the opening and closing of the genitalia. Visual examination of these specimens indicated that a great deal of variation within the genitalia of these Oregon B. flavidus male specimens was in the length of the volsella, which

I captured with character D (Figure 3). Although character D may be subject to effects of sclerotization, characters A, B, E, F, and G correspond to highly sclerotized, rigid structures of the genitalia. Overall, the characters described in Figure 3 were chosen in an attempt to capture the overall shape of the genital capsule using fixed structures with clear landmarks unlikely to be affected by the relative differences in the degree of openness of the genital capsules or sclerotization.

Measurements of the structures labeled A-G shown in Figure 3 were taken from pictures of the genital capsules with ImageJ software (Schneider, Rasband, & Eliceiri, 2012) using a 790 pixels:1mm scale; characters D, E, and G are bilaterally paired in the genitalia, so measurements

14 from each side were taken and averaged, to account for any tilting of the specimens while photographed (see Table 7, Appendix E for genitalia measurements). Individuals from Site 42 and Site 43 were excluded for the sake of time.

Figure 3: B. flavidus male genitalia with labeled measurements

Using characteristic measurements for individuals depicted in Figure 3, a PCA was performed using the program R (R Core Team, 2013; see Appendix G for R script) to compare measurements from individuals between the different Oregon localities. Because the ImageJ measurements (Table 7, Appendix E) suggested that the gonobase of the B. flavidus males was the most variable structure of their genitalia, characters A and B from Figure 3 (gonobase width and length, respectively) were focused on for further comparison of individuals. For each of the individuals, a ratio of gonobase width:length (A:B) was determined. An additional PCA was run on genitalia measurements broken down by three general geographic regions: “West,”

“Northeast,” and “East” (Figure 1).

15 A spectrum of gonobase shape, represented by A:B ratio, ranging from a rather thin and tall on one end of the spectrum (small A:B) to a more wide and short shape on the other end

(large A:B), was found existing within these specimens. To more closely assess the discrete versus continuous nature of this highly variable structure, the A:B ratios were plotted using a histogram.

Molecular Data & Analysis

From each of the three regions within Oregon, “West,” “Northeast,” and “East,” two specimens were selected for COI sequencing on the basis of genitalia extremes to uncover any possible genetic variation that could suggest distinct species. I selected for sequencing the two extreme morphs originating from each region selecting individuals with distinct differences in

A:B gonobase ratio and observable differences in the genitalia (Figure 3; sequenced individual noted with an asterisk in Table 2, Appendix A and in Table 5, Appendix D).

An additional six specimens (noted with an asterisk in Table 2, Appendix A) were selected for genetic analysis on the basis of their color patterns. Two specimens from each of three localities were selected including one example of an extreme, mostly yellow-pile specimen and one of an extreme, mostly black-pile specimen from each site (see Table 4, Appendix B for total body pile color matrices for each specimen). Genetic differences in sequenced bases were compared across specimens to observe whether genotypes associated with either yellow/black color forms or genitalia morphology.

Thoracic muscle tissue was extracted from each of the twelve specimens and DNA was isolated from the samples following the QIAmp DNA Micro Handbook “Protocol: Isolation of

Genomic DNA from Tissues.” Polymerase Chain Reactions were then used to amplify the

16 mitochondrial barcoding gene cytochrome oxidase I (COI) for each of the isolated DNA samples. Primers utilized included LepF1 and LepR1 (Hebert et al., 2004) or COIL and COIH

Folmer primers (Folmer et al., 1994), primers that amplify the classic barcode fragment used across animals. Each PCR included 0.3µl each 10uM primer, 4.4 µl distilled water, 2.5 µl isolated DNA, and 7.5 µl AMRESCO Taq polymerase master mix, and the PCR annealing and elongation temperatures were 45C and 72C, respectively.

PCR products were then purified using ExoSAP (Thermo Fisher Scientific) and sequenced at the Penn State Genomics Core Facility. Sequences were edited and aligned using

Geneious version 2 (geneious.com; Kearse et al., 2012) and SNP variants were identified.

4. Results

Color data

The distribution of color patterns across the 77 male Bombus flavidus specimens from

Oregon is shown in part A of Figure 4. The distribution of percent yellow coloration across all specimens put the 25th percentile at roughly 40% yellow, the median at 48% yellow, and the 75th percentile roughly at 60% yellow, leading to the partitioning scheme selected for the figure.

17

Figure 4: (A) Average individual percent yellow pile for Oregon male Bombus flavidus; (B) Boxplot of total body pile percent yellow for individuals from Western vs. Eastern Oregon localities (A): A variety of sample sizes were obtained from the different Oregon localities, indicated by the “n = x” portion of the figure. For each specimen, the average total body percentage of yellow pile was calculated. For each locality, the number of specimens displaying the breakdown of total percentage of pile seen in the legend were calculated and depicted in a pie chart. The map also conveys altitude.

From this color mapping, a local pattern seemed to emerge wherein the specimens collected from more western sites in Oregon tend to have lower total average percent of yellow pile than did specimens from more eastern sites.

An unpaired two-tailed t-test was run on this data, splitting specimens into “Western” sites and “Eastern” sites (including those labeled as “East” and “Northeast” in Figure 1). This produced a t-value of 4.6789 and a highly significant p-value < 0.0001. The difference in average total body pile percent yellow between western and eastern Oregon localities can clearly be observed in the boxplot in part B of Figure 4.

18 The boxplot and the results of the t-test support the existence of local color patterns in B. flavidus in Oregon, where individuals from more western localities display color patterns with less overall yellow pile (observed total body pile yellow = 43.51%) than do individuals from more eastern localities (56.64%).

Genitalic Analysis

From observations on the genitalia of the Oregon B. flavidus specimens, the greatest variation appeared to be in the relative sizes and shapes of the volsella and the gonobase (Figure

3, Figure 5). While these structures seemed to be highly variable, the variation appeared to be continuous, rather than discrete (Figure 6). The gonobase A:B ratios for these Oregon specimens ranged from 2.216 to 3.546, with a median value of 2.697 and an average of 2.734. The sclerotization of the genital capsule was not highly variable between specimens; all specimens seemed to be rather weakly sclerotized (see Table 5, Appendix D for genitalia images).

The results of the principal components analysis (PCA) run on the genitalia measurements is shown in Figure 7 parts A and B, with part B breaking these down into the three regions of Oregon localities (Figure 1).

19

Figure 5: Extremes in B. flavidus gonobase shape (chosen using A:B ratio and visual observation) from each Oregon locality region (Figure 1), used for COI sequencing

Figure 6: Histogram of Oregon B. flavidus gonobase A:B ratios

20 In Figure 7, both by individual locality and by region, individuals could not be separated on the basis of genitalia morphology. There was a great degree of overlap in the measurements of these genitalia characters when specimens were separated by individual locality (part A) and more broadly by region in Oregon (part B), suggesting variation in these traits is continuous.

Figure 7: (A) PCA graphic of Oregon B. flavidus male genitalia measurements by locality; (B) PCA graphic of Oregon B. flavidus male genitalia measurements by region

Molecular Data

From the COI sequencing on the six Oregon male Bombus flavidus specimens representing extremes in color patterns and the specimens with different genitalic morphology, only one base out of 658 was found to be variable (Table 1). At position 401, three of the specimens had base T while the other three had base C. However, this variation did not correspond with mostly black or mostly yellow color forms of B. flavidus. Similarly, in the specimens chosen on the basis of gonobase morphology, there was no correlation between having either a T or a C at position 401 and having a certain gonobase shape.

21

Table 1: Results of COI analysis of Oregon Bombus flavidus males based on color pattern and genitalia morphology extremes

Specimen ID Site ID Region Color Pattern Base at position 401

300101 30 West Yellow T

300102 30 West Black C

300304 30 West Yellow C

300305 30 West Black T

260317 26 West Yellow C

260313 26 West Black T

Gonobase A:B Ratio

400102 40 Northeast 3.456 T

470503 47 Northeast 2.296 T

330402 33 West 3.281 C

330406 33 West 2.291 T

490102 49 East 3.111 T

480201 48 East 2.773 T

Results from an analysis of the relationship between locality elevation and the total body percentage of yellow pile is shown in Figure 8. An r2 value of approximately 3% was observed between the variables “Total Body Pile Percent Yellow” and “Locality Elevation (m)” (Figure 8) and a slight upward slope was inferred when all points are considered.

22

Figure 8: Total body pile percentage yellow vs. locality elevation (m)

An r2 value of 3% is very low and the p-value is not significant, meaning there is not a very strong relationship between locality elevation and total body pile percentage yellow in these

Oregon B. flavidus specimens. When slopes are attained from eastern vs. western specimens it is clear that the upward trend in the slope when considering all specimens occurs because the more yellow eastern specimens tend to occur at higher elevations than the western specimens (Figure

8).

5. Discussion

Data from across color, genitalia, and DNA analyses lend support to specimens of

Bombus flavidus from Oregon being part of one morphologically variable species.

23 The color data supports the existence of a single highly color polymorphic species B. flavidus in Oregon with some local tendencies towards darker or lighter patterns. Coloration in these bees exhibited a continuous gradation from mostly black to mostly yellow individuals, a pattern expected of a single species. Color mapping data suggests that western Oregon Bombus flavidus specimens exhibit significantly lower total percentage of yellow pile than do B. flavidus specimens found in more eastern and generally higher-elevation localities in Oregon (Figure 4).

These observed local color pattern tendencies seem to align with colors expected for western mimicry color patterns. In North America, western Bombus species tend to be mostly yellow and red in the Rockies but are more black with a few yellow stripes in the Pacific region. Hybrid zones occur in eastern Oregon for these mimicry patterns. It is possible that although B. flavidus is not red, it could be selected to favor lighter colors in the east to align with paler mimicry patterns there. These data align well with what has been found in B. californicus, where more coastal specimens exhibit color forms with a higher percentage of black pile than do those specimens found at more inland or eastern locations in Washington, Oregon, and California

(Koch, 2015, pg. 66).

There also could be a role of altitude in this color shift. Historically, a relationship between elevation and color patterns in Bombus has been noted, wherein male bumble bees at higher altitudes have been found to have lighter colored pile (Stiles, 1979). It has been hypothesized that this lighter coloration may aid in thermoregulation by preventing overheating at these higher altitudes (Stiles, 1979).

As previously discussed, male genitalia morphology is often used in the species delimitation of bumble bees, and because a great deal of variation of genitalia morphology was observed during the collection of male B. flavidus specimens from the Oregon localities, this

24 could have been indicative of multiple species. However, principal components analysis (PCA) of the collected genitalia measurements displayed no clustering by either individual Oregon localities or by the larger geographical region groupings within Oregon suggesting this is a result of high intraspecific variation in genitalic morphology.

Differences between specimens may not have been adequately accounted for through the use of this 2D landmark analysis; however, from visual analysis of this genitalia, the variation in morphology seemed to be continuous, rather than discrete. The two structures that appeared to be the most highly variable between specimens, the volsella and the gonobase, both exhibited continuous variation in their morphology. This observation of continuous variation is supported by the results of the genitalia morphology analysis, which could not separate the specimens into clusters based on the variation recorded in these structures. Specimens all appeared to have roughly the same degree of weak sclerotization, thus the sclerotization itself did not likely contribute to the shape variation (e.g., through different folding with preservation).

Finally, the genetic barcoding data does not suggest that color pattern differences or genitalic morphology differences are indicative of multiple species. The molecular variation that did occur, just one nucleotide for COI, did not sort in the same way as morphology does.

Furthermore, there is a rough rule that finding less than 2% difference in their DNA barcode means organisms are accepted as being the same species (Shields & Wilson, 1987; Avise &

Walker, 1998; Hebert, Ratnasingha, & Waard, 2003); in this case, the observed variance in COI barcoding data between the extreme color and genitalia morphology specimens was only 1 out of

658 bases, or 0.152%, clearly within expectations for within-population levels of differentiation.

Given the current data, I conclude that Oregon Bombus flavidus is a single, highly polymorphic species. It is very likely that the Bombus wheeleri described by Bequaert and Plath

25 (1925) is indeed a color morph of Bombus flavidus, as Frison (1926) concluded, because the sampling distribution used within this analysis covered the described range of B. wheeleri and therefore should have included some specimens that Bequaert and Plath would have assigned to

“B. wheeleri.” Furthermore, some specimens included in this study were observed to have some of the variation originally ascribed to B. wheeleri, particularly elongated/variable volsella, but the integrative analyses utilized did not support the separation of these individuals into a species separate and distinct from Bombus flavidus.

26 Chapter 3

Global analysis of Bombus flavidus species group supports the distinction of Bombus fernaldae

1. Abstract

Historically, New World socially parasitic bumble bee Bombus fernaldae was recognized as a separate species from its Old World sister taxon, Bombus flavidus. Recent molecular sequencing of a few individuals has suggested that these two species may be conspecific. To further investigate the species boundaries of B. flavidus, New World and Old World Bombus

“flavidus” specimens were systematically compared on the basis of color patterns, COI barcode data, male genitalia morphology, and wing morphology. These results support Bombus fernaldae as a genetically and somewhat morphologically distinct lineage, either a species or distinct subpopulation, from Bombus flavidus. However, this study redefines the geographic boundaries of each of these lineages. B. fernaldae is confined to the eastern United States and not the whole of North America, as previously thought. Furthermore, Bombus flavidus is exceptionally widespread for a bumble bee, occurring across the Palearctic and the western and northern

Nearctic, a range not achieved by any other bumble bee species. The distribution of social parasites relative to their hosts and the high variability in color and genitalic morphology of

Bombus flavidus across its global distribution are discussed.

2. Introduction

Much confusion still exists regarding the taxonomy of the socially parasitic subgenus

Psithyrus, particularly Bombus flavidus, on both local and global scales. While at the local level

27 in Oregon, USA, the observed variation in B. flavidus color patterns and male genitalia morphology was not indicative of the presence of a separate and distinct population (Chapter 2), the high degree of polymorphism in B. flavidus on these traits also exists on a global scale and could be suggestive of more than one species at a different geographic scale. To more clearly delimit this species, a more global approach to understanding the relationship between its high polymorphism and its species boundaries is needed.

When considering the species delimitation of Bombus flavidus, a significant area of confusion is in regard to the taxonomic distinction between Bombus flavidus and Bombus fernaldae. Historically, Old World B. flavidus was considered a sister species to the North

American species Bombus fernaldae. B. flavidus was originally described by Eversmann in 1852 from specimens from the Palearctic. In 1911, B. fernaldae was described by Franklin as a distinct species from specimens originating around the New England area of the United States, primarily based an assumption that any species in the New World would be different from species in the

Old World and without a consideration of existing Old World material; Franklin additionally noted that he had records of specimens fitting this species B. fernaldae from Washington,

Alaska, and New York, United States, and British Columbia, Canada, and that B. fernaldae overall belonged mainly to the Boreal region. The distinct status of these two species was recognized by Williams (1998) until recent genetic data came to light. Genetic analysis of a single specimen from Scandinavia and a specimen from the western United States utilizing four nuclear markers and one mitochondrial marker showed these two representatives to be nearly identical in sequences, suggestive of the two species being conspecific (Cameron et al., 2007).

As a result of these findings, New World B. fernaldae has tentatively been synonymized as B.

28 flavidus (nhm.ac.uk/research-curation/research/projects/bombus/ps.html#flavidus.); awaiting further information.

The species distinction and phylogeographic history of B. flavidus is interesting to consider among the bumble bees, given the reliance of this social parasite on host species for its survival. Once the patterns are observed they can be compared to the ranges of their respective hosts and to typical bumble bee ranges in general. B. flavidus in the Old World has been shown to specialize on Pyrobombus species B. jonellus and B. lapponicus, primarily. B. fernaldae has few definitive host records but is considered a broader generalist on the Pyrobombus subgenus

(Lhomme & Hines, submitted). Given that bumble bees are often primarily delimited by male genitalic variation and, often erroneously, by color variation, the study of trait variability in B. flavidus improves understanding of the evolution of these traits in bumble bees and of their value for taxonomy.

In this chapter, I integrate data on color patterns, genetic COI sequences, male genitalia morphometrics, and wing morphometrics on specimens from across parts of the B. flavidus

Holarctic range, including Scandinavia, Russia, and mostly focused on North America, towards understanding the species status and morphological variability of this species. To assess the degree of B. flavidus variation, I quantify male genitalic variability of Bombus flavidus relative to four other bumble bee species.

29 3. Methods

Specimens Analyzed

Specimens from “Old World” (Europe) and the “New World” (North America) were systematically compared on the basis of color patterns, COI sequences, wing morphometrics, and male genitalia morphology. The full collection of specimens of B. flavidus analyzed including the traits analyzed for each specimen is detailed in Table 3, Appendix A.

Color Data

Color pattern variation in B. flavidus was performed on numerous additional specimens across the B. flavidus range (Table 3, Appendix A). Procedures for color mapping followed methods outlined in Chapter 2 (e.g., template in Figure 2, part A). After recording color variation, the extremes and presence of intermediates were noted for each general region and representatives of the range of color variation were plotted on a map of global distribution. Some color data was pulled from existing literature; specifically, Scandinavian color patterns recorded by Løken (1985) were added to supplement the global survey of B. flavidus color patterns (noted by “*lit” in Figure 11).

Molecular Data & Analysis

COI barcode sequences were obtained from species across this range (Table 4, Appendix

A). Some of these were sequenced by myself and others in the Hines Lab (bolded in table) whereas others were gathered from Genbank (ncbi.nlm.nih.gov/genbank; noted with asterisk in table) or Barcode of Life (boldsystems.org). DNA extraction and COI sequencing followed the procedures outlined in Chapter 2. In total, 52 B. “flavidus” specimens were utilized, and three B.

30 norvegicus specimens were incorporated as an outgroup. This genetic analysis included 31 newly obtained sequences from B. “flavidus” specimens from Scandinavia, Russia, and from throughout the United States (Alaska, Oregon, Wyoming, Maine, Pennsylvania, and North

Carolina). Genbank and Barcode of life sequences were from throughout Canada and Alaska, except for one German B. norvegicus specimen.

Sequences were aligned and edited using the alignment algorithm in the software

Geneious version 2 (geneious.com; Kearse et al., 2012), and trimmed to be the same length

(~602 bases), to avoid missing data. Post-alignment, any detected SNP variants were double- checked with chromatograms to ensure they were true variants. The sequenced specimens were then clustered into haplotype groups..

A TCS haplotype network (Clement, Snell, Walke, Posada, & Crandall, 2002) was created using the program popART (Leigh & Bryant, 2015). A Nexus file (see Appendix C) was created and run in popART to identify the number of members in each haplotype group from each locality sampled in this genetic analysis. From the created haplotype network, genetic relationships between Bombus “flavidus” global populations would be visible; any genetically distinct populations would be separated in this haplotype network.

Genitalic Analysis

Male genitalia analysis was performed using a new set of genitalia measurements

(Figures 9 and 10) taken on the original Oregon B. flavidus specimens (Chapter 2) plus additional New World B. flavidus specimens from the Tussey Mountain area in Pennsylvania and the Smoky Mountain range in North Carolina, USA. Male genitalia analysis also incorporated specimens from other species of bumble bees including five Bombus californicus and three

31 Bombus fervidus (two closely related and potentially conspecific species in the subgenus

Thoracobombus), six Bombus insularis (another species within Psithyrus), and nine Bombus melanopygus (Pyrobombus). Genitalia were extracted from specimens and imaged with careful attention to ensure the genitalia lie in a flat plane. Genitalia images for all specimens in this analysis can be found in Table 6, Appendix D. Genitalia measurements were taken (Figure 9) using ImageJ software (Schneider, Rasband, & Eliceiri, 2012; see Table 8, Appendix E for genitalia measurements). Data were first analyzed with B. flavidus data alone using a Principal

Components Analysis performed in R (R Core Team, 2013). In a separate PCA analysis, data from these other species were then compared to B. flavidus data to determine how variation observed within B. flavidus genitalia morphology compares to variation in these other species. R scripts can be found in Appendix G.

These new measurements seen in Figure 9 were created in an attempt to capture the shape of genitalic structures, and therefore the present variation in the genitalia of B. flavidus and other

Bombus species, more accurately and comprehensively; the measurements in Figure 9 are, when compared to the measurements in Figure 3, greater in number, and attempt to more accurately triangulate the shapes of the individual genitalia structures. Some of the measurements from

Figure 3 were retained for this genitalic analysis, while some were added to capture the overall shape and variation of genitalic structures as accurately as possible; specifically, characters A, B,

F (D in Figure 9), and E (H in Figure 9) were retained because they were deemed to be the most useful and reliable measurements from the previous genitalic analysis, and all other measurements were added to help these original measurements capture individual genitalia structure shapes. As with the measurements in Figure 3, these measurements were chosen

32 because they were deemed unlikely to be affected by either weak sclerotization, differences in the openness of the genital capsule, or other differences in preservation.

Figure 9: Labeled measurements for sister species genitalia variation analysis

Wing Morphometrics

Lastly, a landmark-based wing morphometric analysis was performed on New World and

Old World B. flavidus specimens using the 18 landmarks depicted in Figure 10. These landmarks were chosen after a study by Løken and Framstad (1983), who noted that such measurements were highly diagnostic between Bombus species and could distinguish between closely related species B. flavidus, B. sylvestris, and B. norvegicus with very high accuracy in Scandinavia.

Additional points were added to the ones outlined by Løken and Framstad in an attempt to more comprehensively capture subtle differences in wing morphology.

33

Figure 10: Landmarks used in global B. flavidus wing morphometric analysis

A Procrustes superimposition was used to analyze the wings, and a PCA was then performed on the wing data in the program R (R Core Team, 2013; see Appendix G for .tps data file utilized) to examine clustering patterns based on these diagnostic measurements. A total of

77 Bombus flavidus from Oregon were utilized, in addition to 13 B. flavidus from Pennsylvania, two from Maine, two from Alaska, two from Norway, three from Sweden, and three from

Russia. Two additional B. norvegicus specimens from Russia were also incorporated, due to an erroneous identification as “B. flavidus” prior to COI sequencing.

4. Results

Color Data

On a global scale, Bombus flavidus was found to be highly color polymorphic. In Figure

11, for localities with many individuals, extremes in color pattern with respect to the relative amounts of black and yellow pile were chosen to be represented. For localities with limited

34 specimens, however, the available specimens are represented to give a larger sense of global variation in color patterns seen in B. flavidus, but these may not be indicative of the color pattern extremes found in these areas. For each locality, the pattern depicted on the left represents the specimen with the highest amount of yellow body pile, and the pattern depicted on the right for each locality displayed the lowest amount of yellow body pile; when possible, patterns displayed in the middle of these two extremes show an example of an intermediate color pattern found at this locality and represent the continuous variation in color patterns found at these localities.

Figure 11: Global color pattern distribution for B. flavidus and B. fernaldae

In each of the localities examined, the variation in color patterns seemed to be continuous, as it was in the specimens from Oregon, United States, in Chapter 2. As in Oregon, no localities displayed discrete color patterns. In general, the color variability ascribed to the B. flavidus group in Oregon occurs throughout its range, suggesting it is locally highly polymorphic across its distribution. As an exception, specimens from the eastern United States, particularly those from the Smoky Mountains region in North Carolina, appeared to be more yellow, on average, than were specimens from any other localities. Out of the 14 specimens from North

Carolina, the specimen with the highest amount of black body pile (the pattern showed on the

35 right for this locality in Figure 11) was still overall very yellow when compared to the most black color forms found at other localities. Although specimens from Pennsylvania and Maine were also found to be slightly more consistently yellow than specimens from elsewhere in the B. flavidus distribution, some specimens from these areas were found with amounts of black pile comparable to other localities across the B. flavidus distribution.

Molecular Data

In the COI haplotype network, 28 steps separated B. flavidus from the clearly distinct B. norvegicus (black in Figure 12), which is rooted with closer affinity to the western Nearctic B. flavidus. The network suggests two larger haplotype groups within B. flavidus. Specimens from the eastern United States as well as Nova Scotia and New Brunswick in far SE Canada (pink and red in Figure 12) separated out from other B. flavidus specimens (green and blue in Figure 12), with 9 unique SNPs separating the two broader groups (Figure 12). Specimens from elsewhere in

North America, including the western Rockies, Alaska, and east of the Great Lakes region in

Ontario were found to be more closely related to B. flavidus specimens from Russia and

Scandinavia than to the B. “flavidus” from the eastern United States. Russian specimens sampled were from the NE corner of the Palearctic and represented a central node in the B. flavidus haplotype network, sharing a haplotype with some of the Oregon specimens. Three separate haplotype branches occur from this node: one in Alaska plus southcentral Canada, one in Scandinavia, and the third in the western North American mountains. Genetic sequence divergences between the western Nearctic+Russian+Scandinavian “B. flavidus” and the eastern

Nearctic “B. fernaldae” average at ~2% COI divergence, putting these two groups right at the species-level of divergence.

36

Figure 12: Haplotype map for New World and Old World Bombus “flavidus” specimens

Genitalic Data

The PCA run on genitalia measurements (Figure 9) for B. “flavidus” specimens from different localities in the New World produced the results seen in Figure 13.

Figure 13: (A) PCA results for genitalia measurements of B. flavidus specimens from Oregon, North Carolina, and Pennsylvania, USA; (B) PCA results with eigenvectors for genitalic analysis on B. flavidus from the United States

37 In Figure 13, part A, a great deal of overlap is seen for specimens originating from localities within Oregon; however, specimens from the eastern United States, those from the

Smoky Mountains region in North Carolina and from the Tussey Mountain area in Pennsylvania, separated out from the B. flavidus specimens from Oregon, USA on the basis of their genitalia morphology.

In Figure 13 part B, eigenvectors were added to the PCA graphic in an attempt to elucidate which characters these groups differ on. It appears as if the B. “flavidus” groups from the eastern United States, the Smoky Mountains in North Carolina and Tussey Mountain in

Pennsylvania, differ the most from B. flavidus in Oregon on characters D and E (Figure 9), which correspond to measurements taken on the base of the gonocoxite (see Figure 3); specifically, these eastern groups appear to display smaller values of D and E than do Oregon B. flavidus, both in Figure 13 and when the raw data for these two groups are compared (Table 8,

Appendix E). These morphometric analysis data in Figure 13 could suggest that B. flavidus from the eastern United States, the tentative B. fernaldae, may be smaller on genitalic structures such as the gonocoxa than B. flavidus from Oregon, United States.

Based on the genitalic morphological analyses (Figure 13), these two groups of specimens also seem to differ in gonobase shape; the eight eastern United States specimens analyzed were found to be less continuously variable in gonobase shape (characters A and B,

Figure 9) than were specimens from Oregon, and displayed both smaller values and overall ranges for characters A and B than the Oregon B. flavidus (Table 8, Appendix E). However, variation still exists within this group and can be seen compared to these data from Oregon B. flavidus in Figure 14. The eastern United States data in Figure 14 appears to follow more of a discrete, rather than continuous, distribution, and exists within the upper range of A:B ratios

38 observed in B. flavidus from Oregon, but seeing as only eight total specimens from North

Carolina and Pennsylvania were utilized additional specimens must be added to this analysis in the future to elucidate the true distribution patter, be it continuous or truly discrete.

Figure 14: Distribution of gonobase ratios for B. flavidus from the eastern United States and Oregon

Visually, no glaring differences other than in the gonobase were apparent between the genitalia from these two populations. Character D was found to be smaller in B. fernaldae populations than in B. flavidus populations (Figure 13), however this difference is not obvious when visually comparing specimens from both species; such is the case for character E, as well.

It is unclear whether any apparent differences are due to preservation differences, as the eastern

United States specimens were pinned for preservation and the Oregon specimens were preserved in 95% ethanol, whether they are due to the relative dearth of specimens from the eastern United

States, or whether these are true morphological differences. B. fernaldae populations were found to be about as sclerotized as B. flavidus from Oregon (see Appendix D for all genitalia images).

39 The results of the PCA comparing the variation in the male genitalia of B. flavidus and additional species B. melanopygus, B. insularis, B. fervidus, and B. californicus can be seen in

Figure 15. From this analysis, it appears as if B. flavidus displays more variation in genitalia morphology than do these other Bombus species; the clusters created in the PCA by the four other Bombus species are all smaller than the cluster created by the B. flavidus genitalia measurements, showing a larger range of variation in the genitalia of B. flavidus.

Figure 15: PCA results for genitalic analysis on B. flavidus from the United States and B. californicus, B. fervidus, B. insularis, and B. melanopygus.

Separation of the different Bombus taxa may be more clearly seen in Figure 16. Here, the separation of groups, particularly B. flavidus from Oregon and B. flavidus (fernaldae) from the eastern United States on the basis of genitalia morphometrics may be more clearly seen. In

Figure 16, it becomes apparent that B. melanopygus displays variation in the genitalic structures measured that may rival that of B. flavidus. Overall, however, B. flavidus genitalia still appears to be more variable than genitalia of the other three Bombus species.

40

Figure 16: 3D figure from PCA of genitalia from B. flavidus, B. fervidus, B. melanopygus, B. californicus, and B. insularis.

Wing Morphometrics

Results from the landmark-based wing morphometric PCA involving these global B.

“flavidus” specimens can be seen in Figure 17 (for .tps file of data, see Appendix F). Based on these wing morphometric data, B. flavidus specimens from the United States could not be separated from Old World B. flavidus specimens from Russia and Scandinavia, or from B. norvegicus specimens. It seems, based on these results, that although wing morphometric analysis has proven useful in separating specimens from different species (Løken & Framstad,

1983), this method might not separate groups that may be sub-specific such as the B. flavidus and

B. fernaldae populations proposed here by genitalic and COI results. The finding that B. flavidus/fernaldae and B. norvegicus specimens could not be separated on the basis of wing morphometrics does not reflect Løken and Framstad’s finding that closely related species can be

41 separated on the basis of these measurements; however, it does reflect the finding of Lecocq et al. (2015) that wing shape analyses were unable to delineate any clusters of B. lapidarius-group specimens that were able to be separated on the basis of mitochondrial data. This discrepancy with Løken and Framstad may be due to geographical factors, as all specimens used by Løken and Framstad were from Scandinavia and specimens in this present study originated from additional localities within the United States and Russia, or it may be due to the fact that the measurements of Løken and Framstad were not followed exactly but rather were adapted and expanded upon for this analysis.

Figure 17: Wing morphometric analysis data for global B. flavidus specimens

5. Discussion

The COI data showed that Bombus flavidus specimens collected from the eastern

Nearctic, meaning localities in the states of Pennsylvania, Maine, and North Carolina and

42 localities in New Brunswick and Nova Scotia in Canada, separated out from all other B. flavidus specimens with a ~2% sequence divergence, a level of COI divergence typically seen among species at the species-population interface (Hines, 2008). The geographic cohesiveness of these haplotypes suggests that populations of what is considered Bombus flavidus in the eastern

Nearctic boreal and Appalachian region, which we will hereafter refer to as B. fernaldae, are indeed genetically distinct, on the basis of COI sequences, from B. flavidus populations elsewhere in North America and from the Palearctic. Overall the genetic data support Bombus flavidus sensu stricto having a very wide range with little sequence variability – spanning all the way across the Palearctic and into most of the Nearctic excluding the east, with only a few SNPs defining regional populations across B. flavidus and a fair amount of admixture of haplotypes spanning Old and New World divisions.

The genitalia results further support the COI data in that Bombus fernaldae specimens from the eastern United States were separated from Oregon B. flavidus specimens on the basis of their genitalia morphology; this strengthens the finding that B. fernaldae from the eastern United

States is a distinct population from B. flavidus found in Oregon, United States. However, although the two populations were able to be separated based on morphometric analysis, many of these differences were not visually obvious when comparing the two groups, and specimens from the eastern United States were only compared to specimens from Oregon with no specimens sampled in between. Additional B. flavidus samples from across the species distribution range need to be sampled in the future to see if these populations from the eastern United States consistently differentiate from B. flavidus specimens.

B. flavidus specimens in this analysis were also found to be more variable in male genitalia morphology than specimens from four other Bombus species: B. melanopygus, B.

43 insularis, B. fervidus, and B. californicus; however, B. melanopygus was found to exhibit a wide range of variability, as well. Overall, these findings support the observation of a high degree of variability in male genitalia of B. flavidus, more than is typical of most other Bombus species.

One potential explanation for the high degree of polymorphism observed in the male genitalia morphology of Bombus flavidus lies in the highly sclerotized and curved abdomen of females within the Sylvestris lineage of Psithyrus. Psithyrus females are thought to have evolved such a highly curved abdomen as an adaptation to better help them win in battles against host workers and queens, as the typical posture for stinging other bees involves grasping with the legs and curving the abdomen inward to sting. Because the females of this lineage, particularly B. flavidus, have such a rigid and curved abdomen, the males of these species may have evolved very weakly sclerotized and highly flexible genitalia to accommodate the females’ highly sclerotized genitalia. Weak sclerotization to accommodate inflexible females may release the selection pressure for a closer genitalic lock and key fit, thus enabling more morphological variation.

Regarding color features, Bombus flavidus specimens from across their range displayed a high degree of local polymorphism in relative amounts of yellow and black pile. However, B. flavidus was not able to be separated into distinct populations, namely one that may be B. fernaldae, on the basis of color patterns, further supporting the idea that color patterns are not a strong basis for species delimitation. However, given the finding that specimens from the eastern

United States, particularly North Carolina, showed less black pile than seen elsewhere throughout the Holarctic distribution of B. flavidus, it may be possible that color patterns do display slightly different tendencies between B. flavidus and B. fernaldae, wherein B. fernaldae may tend to be more consistently yellow and/or show less variation towards color patterns with

44 higher amounts of black pile than do B. flavidus. Further color pattern analysis needs to be done between these two lineages to see if this relationship holds true.

These data further support the notion that color is not a useful or reliable metric for separating species. The inability of color patterns to diagnose Bombus species, due to the tendency of the color patterns of these species to display convergence as a result of Müllerian mimicry, has been demonstrated recently in several bumble bees; for example, while COI barcoding revealed three distinct taxa within the cryptic Bombus lucorum complex, no uniquely diagnostic color pattern was found for any of these taxa and among the taxa the variation in color patterns appeared continuous (Carolan et al., 2012). Similarly, molecular studies have found that color can be discrete within intraspecific color dimorphisms, and these polymorphisms can sort differently across species (Hines, 2008 thesis). For example, B. shaposhnikovi and B. handlirschianus in central Asia were once defined by their color differences have now been found to be conspecific with dimorphic coloration (Meulemeester et al., 2011). B. impetuosus and B. potanini from China, once defined by yellow vs. white color, may have species boundaries that does not match these color boundaries (Hines, 2008).

Exemplifying this point, B. norvegicus also displays a high degree of color pattern variation, like B. flavidus. Although considered clearly different species, B. flavidus and B. norvegicus exhibit similar color polymorphisms in parts of their range (e.g., Russia), as well as similar genitalic morphology, making species assignment sometimes challenging. Initially, two

Russian specimens used within this analysis were designated as “B. flavidus” as they exhibited coloration more typical of B. flavidus than B. norvegicus. COI barcoding revealed these specimens to instead be B. norvegicus. This error only further demonstrates that color patterns are not useful for designating Bombus species as they can sort differently from ancestral

45 polymorphisms across species boundaries. It may be that high color variability is simply a trait of the broader Sylvestris lineage of Psithyrus.

From the COI and genitalia data, it seems as if B. flavidus and B. fernaldae are distinct lineages, but because B. flavidus specimens could not be separated from B. fernaldae using morphometric wing data, this suggests either that wing morphology is not a useful tool for differentiating lineages at this level or, alternatively, that these groups are conspecific.

Taken together, these data appear to support B. fernaldae, a species now confined only to the eastern Nearctic, as either a separate species or distinct subpopulation from B. flavidus found throughout the western Nearctic and the Palearctic. The combination of distant and non- admixing COI sequence haplotypes for these two groups and some genitalic distinction supports this conclusion. What is clear from these results is that the ranges of what is considered B. flavidus and B. fernaldae must be reconsidered. Historically, Bombus fernaldae was considered to include all North American individuals of this species group. At the present, the data appears to suggest that B. fernaldae occurs only in individuals in the eastern United States and far SE

Canada. B. fernaldae was originally described from specimens collected in the northeast United

States (Franklin, 1911), thus the species name of Bombus fernaldae must apply to this eastern group and, given priority (Eversmann, 1852), Bombus flavidus would apply to the rest. Nuclear genetic data are needed to provide further evidence regarding this species status.

Given that the distribution of Bombus flavidus spans across the western United States,

Canada, and the Old World, this gives B. flavidus a distribution broader than is achieved by any non-parasitic bumble bee species. It is possible that B. flavidus has achieved such an exceptional range as a parasite because they must only locate their hosts, which can include many different species, and are less limited by ecological factors related to nest starting than their hosts. B.

46 flavidus from the Palearctic is thought to be restricted mostly to host Pyrobombus species B. jonellus and B. lapponicus. B. jonellus is one of a few bumble bee species found in both the

Palearctic and Nearctic, although its Nearctic range is confined to the region around Alaska. The

Palearctic B. lapponicus has a sister species with debated species status relative to it in the

Nearctic, B. sylvicola. However, both B. sylvicola and B. jonellus are not abundant or very widely distributed in the Nearctic as they are very high altitude, cold-adapted species.

Interestingly, B. fernaldae/flavidus in North America are thought instead to be a broad

Pyrobombus generalists. It is possible that B. flavidus arrived in the New World on its main hosts that it still retains in the Old World. It subsequently may have moved to new hosts once established in the Nearctic. In the Nearctic, Pyrobombus are the most abundant and successful lineage of bumble bees, so opportunities abounded once it was able to acquire a more generalist strategy. Data suggests that in the Palearctic B. flavidus is rare, whereas this lineage is more successful in the Nearctic (Lhomme & Hines, submitted); perhaps this could be a consequence of host switching. Further information about host specificity and comparing Old World and New

World B. flavidus and B. fernaldae would be an interesting area for future research.

47 Appendix A

Specimen Tables

Table 2: Bombus flavidus specimen table for Oregon analysis

Specimen Site Locality State Country Latitude Longitude ID ID 260301 26 Grasshopper Mtn Oregon United States 43.90778 -122.19680 260302 26 Grasshopper Mtn Oregon United States 43.90778 -122.19680 260303 26 Grasshopper Mtn Oregon United States 43.90778 -122.19680 260304 26 Grasshopper Mtn Oregon United States 43.90778 -122.19680 260305 26 Grasshopper Mtn Oregon United States 43.90778 -122.19680 260306 26 Grasshopper Mtn Oregon United States 43.90778 -122.19680 260307 26 Grasshopper Mtn Oregon United States 43.90778 -122.19680 260308 26 Grasshopper Mtn Oregon United States 43.90778 -122.19680 260309 26 Grasshopper Mtn Oregon United States 43.90778 -122.19680 260310 26 Grasshopper Mtn Oregon United States 43.90778 -122.19680 260311 26 Grasshopper Mtn Oregon United States 43.90778 -122.19680 260312 26 Grasshopper Mtn Oregon United States 43.90778 -122.19680 260313* 26 Grasshopper Mtn Oregon United States 43.90778 -122.19680 260314 26 Grasshopper Mtn Oregon United States 43.90778 -122.19680 260315 26 Grasshopper Mtn Oregon United States 43.90778 -122.19680 260316 26 Grasshopper Mtn Oregon United States 43.90778 -122.19680 260317* 26 Grasshopper Mtn Oregon United States 43.90778 -122.19680 260318 26 Grasshopper Mtn Oregon United States 43.90778 -122.19680 260319 26 Grasshopper Mtn Oregon United States 43.90778 -122.19680 260320 26 Grasshopper Mtn Oregon United States 43.90778 -122.19680 260321 26 Grasshopper Mtn Oregon United States 43.90778 -122.19680 260322 26 Grasshopper Mtn Oregon United States 43.90778 -122.19680 260323 26 Grasshopper Mtn Oregon United States 43.90778 -122.19680 260324 26 Grasshopper Mtn Oregon United States 43.90778 -122.19680 260325 26 Grasshopper Mtn Oregon United States 43.90778 -122.19680 260326 26 Grasshopper Mtn Oregon United States 43.90778 -122.19680 260327 26 Grasshopper Mtn Oregon United States 43.90778 -122.19680 270301 27 NF-19 Forest Road past Oregon United States 43.99738 -122.17432 bend 270302 27 NF-19 Forest Road past Oregon United States 43.99738 -122.17432 bend 270303 27 NF-19 Forest Road past Oregon United States 43.99738 -122.17432 bend 270304 27 NF-19 Forest Road past Oregon United States 43.99738 -122.17432 bend 270305 27 NF-19 Forest Road past Oregon United States 43.99738 -122.17432 bend 280101 28 Cougar Reservoir Oregon United States 44.07661 -122.23217 290201 29 Road 242 up to Sisters Oregon United States 44.18146 -121.89674 Mountains 300101* 30 NFD Rd. 2047 between Oregon United States 44.37466 -121.75907 Hwy 20 and 22

48 300102* 30 NFD Rd. 2047 between Oregon United States 44.37466 -121.75907 Hwy 20 and 22 300103 30 NFD Rd. 2047 between Oregon United States 44.37466 -121.75907 Hwy 20 and 22 300104 30 NFD Rd. 2047 between Oregon United States 44.37466 -121.75907 Hwy 20 and 22 300301 30 NFD Rd. 2047 between Oregon United States 44.37466 -121.75907 Hwy 20 and 22 300302 30 NFD Rd. 2047 between Oregon United States 44.37466 -121.75907 Hwy 20 and 22 300303 30 NFD Rd. 2047 between Oregon United States 44.37466 -121.75907 Hwy 20 and 22 300304* 30 NFD Rd. 2047 between Oregon United States 44.37466 -121.75907 Hwy 20 and 22 300305* 30 NFD Rd. 2047 between Oregon United States 44.37466 -121.75907 Hwy 20 and 22 320301 32 NF-4220 Rd. to Olalie Oregon United States 44.79286 -121.83786 Lake from Breitenbush River Road 320302 32 NF-4220 Rd. to Olalie Oregon United States 44.79286 -121.83786 Lake from Breitenbush River Road 320303 32 NF-4220 Rd. to Olalie Oregon United States 44.79286 -121.83786 Lake from Breitenbush River Road 320601 32 NF-4220 Rd. to Olalie Oregon United States 44.79286 -121.83786 Lake from Breitenbush River Road 330401 33 Mirror Lake Trail at Mt. Oregon United States 45.30289 -121.79368 Hood, 4500ft 330402* 33 Mirror Lake Trail at Mt. Oregon United States 45.30289 -121.79368 Hood, 4500ft 330403 33 Mirror Lake Trail at Mt. Oregon United States 45.30289 -121.79368 Hood, 4500ft 330404 33 Mirror Lake Trail at Mt. Oregon United States 45.30289 -121.79368 Hood, 4500ft 330405 33 Mirror Lake Trail at Mt. Oregon United States 45.30289 -121.79368 Hood, 4500ft 330406* 33 Mirror Lake Trail at Mt. Oregon United States 45.30289 -121.79368 Hood, 4500ft 330407 33 Mirror Lake Trail at Mt. Oregon United States 45.30289 -121.79368 Hood, 4500ft 330408 33 Mirror Lake Trail at Mt. Oregon United States 45.30289 -121.79368 Hood, 4500ft 340401 34 Government Camp, Mt. Oregon United States 45.30301 -121.76964 Hood 340402 34 Government Camp, Mt. Oregon United States 45.30301 -121.76964 Hood 340403 34 Government Camp, Mt. Oregon United States 45.30301 -121.76964 Hood 400101 40 Blue Mts, Summit Rd., Oregon United States 45.50712 -118.11169 between Hwy 204 and Interstate 84, Middle 1/3 of Rd. 400102 40 Blue Mts, Summit Rd., Oregon United States 45.50712 -118.11169 between Hwy 204 and Interstate 84, Middle 1/3 of Rd. 470501 47 Lostine River Rd. Oregon United States 45.29559 -117.39569

49 470502 47 Lostine River Rd. Oregon United States 45.29559 -117.39569 470503* 47 Lostine River Rd. Oregon United States 45.29559 -117.39569 470504 47 Lostine River Rd. Oregon United States 45.29559 -117.39569 470505 47 Lostine River Rd. Oregon United States 45.29559 -117.39569 480201* 48 17mi W of Baker City Oregon United States 44.67081 -117.97805 on Powder Creek just before Philip Lake 490101* 49 NF-13 off of Hwy 62 S Oregon United States 44.2321 -118.51655 of Prairie City 490102* 49 NF-13 off of Hwy 62 S Oregon United States 44.2321 -118.51655 of Prairie City 500101 50 Strawberry Lake Oregon United States 44.31334 -118.67955 510501 51 NF-13 SE of Prairie Oregon United States 44.36929 City -118.48867 420101 42 Blue Mts, Summit Rd., Oregon United States 45.44389 -118.22850 between Hwy 204 and Interstate 84, Lower 1/3 of Rd. 420102 42 Blue Mts, Summit Rd., Oregon United States 45.44389 -118.22850 between Hwy 204 and Interstate 84, Lower 1/3 of Rd. 420103 42 Blue Mts, Summit Rd., Oregon United States 45.44389 -118.22850 between Hwy 204 and Interstate 84, Lower 1/3 of Rd. 430201 43 Wallowa Mt. Rd and Oregon United States 45.14772 -116.97160 NFD39 before intersection with Upper Imnaha Rd., Hells Canyon Recreation Area 430202 43 Wallowa Mt. Rd and Oregon United States 45.14772 -116.97160 NFD39 before intersection with Upper Imnaha Rd., Hells Canyon Recreation Area 430203 43 Wallowa Mt. Rd and Oregon United States 45.14772 -116.97160 NFD39 before intersection with Upper Imnaha Rd., Hells Canyon Recreation Area 430204 43 Wallowa Mt. Rd and Oregon United States 45.14772 -116.97160 NFD39 before intersection with Upper Imnaha Rd., Hells Canyon Recreation Area

50

Table 3: Bombus “flavidus” specimen table for global analysis

Specimen ID Species Locality State/Province Country Latitude Longitude Analysis FJ582117* fernaldae - Nova Scotia Canada 43.993 -66.146 COI COI, color, 1192Maine fernaldae Buckfield Maine United States 44.25035 -70.42218 wing North COI NCflav539 fernaldae Smoky Mountains Carolina United States 36.18 -81.81 North COI NCflav534 fernaldae Smoky Mountains Carolina United States 36.18 -81.81 FJ582115* fernaldae Nova Scotia Canada 44.927 -64.93 COI HHPA002 fernaldae Tussey Mountain Pennsylvania United States 40.732312 -77.533949 COI Tussey Mountain, COI, wing flavPA001 fernaldae Bear Meadows Pennsylvania United States 40.732312 -77.533949 flav15ME fernaldae Stockton Spring Maine United States 44.52786 -68.86844 COI Tussey Mountain, COI, wing flavPA004 fernaldae Bear Meadows Pennsylvania United States 40.732312 -77.533949 KR792639/HP Halifax: Point Pleasant COI PPC104-13* fernaldae Park Nova Scotia Canada 44.623 -63.569 North COI flav15116 fernaldae Swain Co. Carolina United States 35.5571 -83.4938 Kouchibouguac New COI SSKOA163 fernaldae National Park Brunswick Canada 46.812 -64.951 HCBNS118- Lunenburg County; COI 03* fernaldae Northwest Cove Nova Scotia Canada 44.319 -64.016 FJ582117* fernaldae - Nova Scotia Canada 43.993 -66.146 COI 116Maine fernaldae Steuban Maine United States 44.44116 -69.9047 COI, color GMNCDO49- North Cascades COI 12 flavidus National Park Washington United States 48.719 -121.117 Mount Revelstoke COI CNGLC070- National Park; nr. Mile British 13* flavidus 1 compound Columbia Canada 51.022 -118.207 Yoho National Park, British COI BBHYL226-10 flavidus Emerald Lake Trails Columbia Canada 51.443 -116.542 Mount Revelstoke NP; British COI BBHYL239-10 flavidus Summit Trails Columbia Canada 51.039 -118.148 Waterton Lakes NP, COI Akamina Parkway, KR899313* flavidus Rowe Tamarak Trail Alberta Canada 49.059 -114.013 Blue Mts., Summit COI flav400102 flavidus Road Oregon United States 45.50712 -118.11169 flav490102 flavidus Prairie City Oregon United States 44.2321 -118.51655 COI, color flav470503 flavidus Lostine River Road Oregon United States 45.29559 -117.39569 COI, color flav330406 flavidus Mirror Lake Oregon United States 45.30289 -121.79368 COI, color flav480201 flavidus Philip Lake Oregon United States 44.67081 -117.97805 COI, color Elkhard Park, Wind COI, color flavWY001 flavidus River Range Wyoming United States 43.01821 -109.75566 NFD Rd. 2047 COI, color between Hwy 20 and 101 flavidus 22 Oregon United States 44.37466 -121.75907 NFD Rd. 2047 COI, color between Hwy 20 and 305 flavidus 22 Oregon United States 44.37466 -121.75907 Grasshopper COI, color 313 flavidus Mountain Oregon United States 43.90778 -122.1968

51 Prince Albert NP, COI KR880890* flavidus Narrows Peninsula Trail Saskatchewan Canada 53.987 -106.282 Elk Island NP, COI peninsula in Astotin Lake, The Point near administration/warden KR788437* flavidus office Alberta Canada 53.6849 -112.86 Waterton Lakes NP, COI Foothills Parkland KR789327* flavidus Region Alberta Canada 49.083 -113.876 Banff NP, Cave and COI KR875887* flavidus Basin Area Alberta Canada 51.171 -115.586 Grasshopper COI, color 317 flavidus Mountain Oregon United States 43.90778 -122.1968 NFD Rd. 2047 COI, color between Hwy 20 and 102 flavidus 22 Oregon United States 44.37466 -121.75907 NFD Rd. 2047 COI, color between Hwy 20 and 304 flavidus 22 Oregon United States 44.37466 -121.75907 flav330402 flavidus Mirror Lake Oregon United States 45.30289 -121.79368 COI color COI, color, RV17 flavidus Lyugi Sakhalin Russia 53.4559 141.9752 wing COI, color, RV13 flavidus Lyugi Sakhalin Russia 53.4559 141.9752 wing norvegicus_Ge COI rmanyGU7059 16 norvegicus Bavaria Grafenau Germany 48.858 13.397 flavRU19 norvegicus Okha Saklhalin Russia 54.198401 142.753432 COI flavRU15 norvegicus Val Sakhalin Russia 52.33841 143.06434 COI COI, color, PRAS0846 flavidus Balsfjord Troms Norway 69.095000 19.711972 wing COI, color, PRAS0801 flavidus Norbotten Tornehamn Sweden 68.441306 18.629167 wing COI, color, PRAS0893 flavidus Kiruna, Ruatas Norbotten Sweden 67.992611 19.912528 wing - COI, color, PRAS1256 flavidus Dietrich River Alaska United States 67.931278 149.827639 wing Pukaskwa NP, Hattie COI KR874731* flavidus Cove Campground Ontario Canada 48.589 -86.292 Churchill, 5 km E COI JX832855* flavidus Churchill Manitoba Canada 58.76 -94.086 Yukon COI KR790163* flavidus Kluane National Park Territory Canada 60.7144 -137.432 Churchill, 10 km E COI JX829973* flavidus Churchill, Launch Road Manitoba Canada 58.755 -93.998 Riding Mountain COI TTHYW653- National Park; Brule 08* flavidus Trail Manitoba Canada 50.68 -99.884 Churchill, 4km SE COI JX831614* flavidus Curchill, Akdlik Marsh Manitoba Canada 58.746 -94.113 Galbraith lake Pump, - COI, color, flavPRAS1072 flavidus station 4 Alaska United States 68.425528 149.359111 wing KU874427* flavidus Delta Jct., UAF Farm Alaska United States 63.931 -145.388 COI PRAS 0843 flavidus - - Norway - - Color Bear Meadows, Tussey Color, BMAR 1157 fernaldae Mountain Pennsylvania United States 40.732312 77.533949 genitalia Bear Meadows, Tussey Color BMAR 1162 fernaldae Mountain Pennsylvania United States 40.732312 77.533949

52 Bear Meadows, Tussey Color, BMAR 1158 fernaldae Mountain Pennsylvania United States 40.732312 77.533949 genitalia Bear Meadows, Tussey Color BMAR 1165 fernaldae Mountain Pennsylvania United States 40.732312 77.533949 Bear Meadows, Tussey Color BMAR 1153 fernaldae Mountain Pennsylvania United States 40.732312 77.533949 Bear Meadows, Tussey Color BMAR 1159 fernaldae Mountain Pennsylvania United States 40.732312 77.533949 Bear Meadows, Tussey Color, BMAR 1152 fernaldae Mountain Pennsylvania United States 40.732312 77.533949 genitalia Teton Co., Pacific Color WY: Teton Co fernaldae Creek Rd Wyoming United States 43.92276 110.46481 Bear Meadows, Tussey Color BMAR 1154 fernaldae Mountain Pennsylvania United States 40.732312 77.533949 Bear Meadows, Tussey Color BMAR 1163 fernaldae Mountain Pennsylvania United States 40.732312 77.533949 RU17 flavidus Lyugi Sakhalin Russia 53.4559 141.9752 Color, wing RU16 flavidus Val Sakhalin Russia 52.33842 143.06435 Color, wing RU18 flavidus Lyugi Sakhalin Russia 53.4559 141.9752 Color, wing 15.0534 flavidus Stockton Spring Maine United States 44.52786 -68.86844 Color, wing PRAS 0953 flavidus Kebnekaise, Tarfala Norbotten Sweden 67.899750 18.627556 Color, wing NCflav539-01 fernaldae Smoky Mountains North Carolina United States 36.18 -81.81 Color, wing NCflav539-02 fernaldae Smoky Mountains North Carolina United States 36.18 -81.81 Color, wing NCflav534-01 fernaldae Smoky Mountains North Carolina United States 36.18 -81.81 Color, wing NCflav534-02 fernaldae Smoky Mountains North Carolina United States 36.18 -81.81 Color, wing NCflav534-08 fernaldae Smoky Mountains North Carolina United States 36.18 -81.81 Color, wing Color, wing, NCflav534-06 fernaldae Smoky Mountains North Carolina United States 36.18 -81.81 genitalia Color, wing, NCflav539-04 fernaldae Smoky Mountains North Carolina United States 36.18 -81.81 genitalia 260301 fernaldae Grasshopper Mtn Oregon United States 43.90778 -122.19680 Color, wing, genitalia 260302 fernaldae Grasshopper Mtn Oregon United States 43.90778 -122.19680 Color, wing, genitalia 260303 fernaldae Grasshopper Mtn Oregon United States 43.90778 -122.19680 Color, wing, genitalia 260304 fernaldae Grasshopper Mtn Oregon United States 43.90778 -122.19680 Color, wing, genitalia 260305 fernaldae Grasshopper Mtn Oregon United States 43.90778 -122.19680 Color, wing, genitalia 260306 fernaldae Grasshopper Mtn Oregon United States 43.90778 -122.19680 Color, wing, genitalia 260307 fernaldae Grasshopper Mtn Oregon United States 43.90778 -122.19680 Color, wing, genitalia 260308 fernaldae Grasshopper Mtn Oregon United States 43.90778 -122.19680 Color, wing, genitalia 260309 fernaldae Grasshopper Mtn Oregon United States 43.90778 -122.19680 Color, wing, genitalia 260310 fernaldae Grasshopper Mtn Oregon United States 43.90778 -122.19680 Color, wing, genitalia 260311 fernaldae Grasshopper Mtn Oregon United States 43.90778 -122.19680 Color, wing, genitalia 260312 fernaldae Grasshopper Mtn Oregon United States 43.90778 -122.19680 Color, wing, genitalia 260314 fernaldae Grasshopper Mtn Oregon United States 43.90778 -122.19680 Color, wing, genitalia 260315 fernaldae Grasshopper Mtn Oregon United States 43.90778 -122.19680 Color, wing, genitalia

53 260316 fernaldae Grasshopper Mtn Oregon United States 43.90778 -122.19680 Color, wing, genitalia 260318 fernaldae Grasshopper Mtn Oregon United States 43.90778 -122.19680 Color, wing, genitalia 260319 fernaldae Grasshopper Mtn Oregon United States 43.90778 -122.19680 Color, wing, genitalia 260320 fernaldae Grasshopper Mtn Oregon United States 43.90778 -122.19680 Color, wing, genitalia 260321 fernaldae Grasshopper Mtn Oregon United States 43.90778 -122.19680 Color, wing, genitalia 260322 fernaldae Grasshopper Mtn Oregon United States 43.90778 -122.19680 Color, wing, genitalia 260323 fernaldae Grasshopper Mtn Oregon United States 43.90778 -122.19680 Color, wing, genitalia 260324 fernaldae Grasshopper Mtn Oregon United States 43.90778 -122.19680 Color, wing, genitalia 260325 fernaldae Grasshopper Mtn Oregon United States 43.90778 -122.19680 Color, wing, genitalia 260326 fernaldae Grasshopper Mtn Oregon United States 43.90778 -122.19680 Color, wing, genitalia 260327 fernaldae Grasshopper Mtn Oregon United States 43.90778 -122.19680 Color, wing, genitalia 270301 fernaldae NF-19 Forest Road past Oregon United States 43.99738 -122.17432 Color, wing, bend genitalia 270302 fernaldae NF-19 Forest Road past Oregon United States 43.99738 -122.17432 Color, wing, bend genitalia 270303 fernaldae NF-19 Forest Road past Oregon United States 43.99738 -122.17432 Color, wing, bend genitalia 270304 fernaldae NF-19 Forest Road past Oregon United States 43.99738 -122.17432 Color, wing, bend genitalia 270305 fernaldae NF-19 Forest Road past Oregon United States 43.99738 -122.17432 Color, wing, bend genitalia 280101 fernaldae Cougar Reservoir Oregon United States 44.07661 -122.23217 Color, wing, genitalia 290201 fernaldae Road 242 up to Sisters Oregon United States 44.18146 -121.89674 Color, wing, Mountains genitalia 300103 fernaldae NFD Rd. 2047 between Oregon United States 44.37466 -121.75907 Color, wing, Hwy 20 and 22 genitalia 300104 fernaldae NFD Rd. 2047 between Oregon United States 44.37466 -121.75907 Color, wing, Hwy 20 and 22 genitalia 300301 fernaldae NFD Rd. 2047 between Oregon United States 44.37466 -121.75907 Color, wing, Hwy 20 and 22 genitalia 300302 fernaldae NFD Rd. 2047 between Oregon United States 44.37466 -121.75907 Color, wing, Hwy 20 and 22 genitalia 300303 fernaldae NFD Rd. 2047 between Oregon United States 44.37466 -121.75907 Color, wing, Hwy 20 and 22 genitalia 320301 fernaldae NF-4220 Rd. to Olalie Oregon United States 44.79286 -121.83786 Color, wing, Lake from Breitenbush genitalia River Road 320302 fernaldae NF-4220 Rd. to Olalie Oregon United States 44.79286 -121.83786 Color, wing, Lake from Breitenbush genitalia River Road 320303 fernaldae NF-4220 Rd. to Olalie Oregon United States 44.79286 -121.83786 Color, wing, Lake from Breitenbush genitalia River Road 320601 fernaldae NF-4220 Rd. to Olalie Oregon United States 44.79286 -121.83786 Color, wing, Lake from Breitenbush genitalia River Road

54 330401 fernaldae Mirror Lake Trail at Mt. Oregon United States 45.30289 -121.79368 Color, wing, Hood, 4500ft genitalia 330402 fernaldae Mirror Lake Trail at Mt. Oregon United States 45.30289 -121.79368 Color, wing, Hood, 4500ft genitalia 330403 fernaldae Mirror Lake Trail at Mt. Oregon United States 45.30289 -121.79368 Color, wing, Hood, 4500ft genitalia 330404 fernaldae Mirror Lake Trail at Mt. Oregon United States 45.30289 -121.79368 Color, wing, Hood, 4500ft genitalia 330405 fernaldae Mirror Lake Trail at Mt. Oregon United States 45.30289 -121.79368 Color, wing, Hood, 4500ft genitalia 330407 fernaldae Mirror Lake Trail at Mt. Oregon United States 45.30289 -121.79368 Color, wing, Hood, 4500ft genitalia 330408 fernaldae Mirror Lake Trail at Mt. Oregon United States 45.30289 -121.79368 Color, wing, Hood, 4500ft genitalia 340401 fernaldae Government Camp, Mt. Oregon United States 45.30301 -121.76964 Color, wing, Hood genitalia 340403 fernaldae Government Camp, Mt. Oregon United States 45.30301 -121.76964 Color, wing, Hood genitalia 400101 fernaldae Blue Mts, Summit Rd., Oregon United States 45.50712 -118.11169 Color, wing, between Hwy 204 and genitalia Interstate 84, Middle 1/3 of Rd. 470501 fernaldae Lostine River Rd. Oregon United States 45.29559 -117.39569 Color, wing, genitalia 470502 fernaldae Lostine River Rd. Oregon United States 45.29559 -117.39569 Color, wing, genitalia 470504 fernaldae Lostine River Rd. Oregon United States 45.29559 -117.39569 Color, wing, genitalia 470505 fernaldae Lostine River Rd. Oregon United States 45.29559 -117.39569 Color, wing, genitalia 490101 fernaldae NF-13 off of Hwy 62 S Oregon United States 44.2321 -118.51655 Color, wing, of Prairie City genitalia 500101 fernaldae Strawberry Lake Oregon United States 44.31334 -118.67955 Color, wing, genitalia 510501 fernaldae NF-13 SE of Prairie Oregon United States 44.36929 Color, wing City -118.48867 420101 fernaldae Blue Mts, Summit Rd., Oregon United States 45.44389 -118.22850 Color, wing between Hwy 204 and Interstate 84, Lower 1/3 of Rd. 420102 fernaldae Blue Mts, Summit Rd., Oregon United States 45.44389 -118.22850 Color, wing between Hwy 204 and Interstate 84, Lower 1/3 of Rd. 420103 fernaldae Blue Mts, Summit Rd., Oregon United States 45.44389 -118.22850 Color, wing between Hwy 204 and Interstate 84, Lower 1/3 of Rd. 430201 fernaldae Wallowa Mt. Rd and Oregon United States 45.14772 -116.97160 Color, wing NFD39 before intersection with Upper Imnaha Rd., Hells Canyon Recreation Area 430202 fernaldae Wallowa Mt. Rd and Oregon United States 45.14772 -116.97160 Color, wing NFD39 before intersection with Upper Imnaha Rd., Hells Canyon Recreation Area

55 430203 fernaldae Wallowa Mt. Rd and Oregon United States 45.14772 -116.97160 Color, wing NFD39 before intersection with Upper Imnaha Rd., Hells Canyon Recreation Area 430204 fernaldae Wallowa Mt. Rd and Oregon United States 45.14772 -116.97160 Color, wing NFD39 before intersection with Upper Imnaha Rd., Hells Canyon Recreation Area BMELR095 melanopygus Duniway Park Lilac Oregon United States 45.503753 -122.68427 Genitalia Garden, SW Sheridan St., Portland BMELR011 melanopygus NF-4220 Rd. to Olalie Oregon United States 44.79286 -121.83786 Genitalia Lake from Breitenbush River Road BMELR010 melanopygus Mirror Lake Trail at Mt. Oregon United States 45.30289 -121.79368 Genitalia Hood, 4500ft BMELB021 melanopygus Beaver Creek Rd from California/Ore United States 42 -122.77 Genitalia Hwy 96 to Mt. Ashland gon BMELB062 melanopygus Mt. Shasta, Everitt California United States 41.34678 -122.24143 Genitalia Memorial Hwy, 6000 ft. BMELB100 melanopygus Ashland Area (Mt. Oregon United States 42.081689 -122.70695 Genitalia Ashland and Hwy 273) (5219-5311 Old Hwy 99 S) BMELB023 melanopygus Florence - Dunes Oregon United States 43.9563833 -124.13710 Genitalia National Recreational Area BMELR016 melanopygus Gold Beach - Cape Oregon United States 42.3286083 -124.42800 Genitalia Sebastian State Park BMELB0TM0 melanopygus Patrick’s Point California United States 41.1782051 -124.07747 Genitalia 45 HH15_390101 californicus Summit Rd, Hwy 204 Oregon United States 45.64764 -118.12817 Genitalia & I-84 HH15_030601 californicus Steen Mt. Reer'n Area, Oregon United States 42.74953 -118.67723 Genitalia N. Loop, alp to subalp HH15_060301 californicus Modoc Natn'l Forest, California United States 41.54623 -120.24656 Genitalia Cedar Creek, Upper Trail HH15_430101 californicus Wallowa Mt. Rd at Oregon United States 45.14772 -116.9716 Genitalia Hells Canyon Rec Area HH15_520101 californicus NF-13, nr. Unity, dry Oregon United States 44.39914 -188.32017 Genitalia area HH15_040201 fervidus Dry area on upper Oregon United States 45.50189 -116.80758 Genitalia Imnaha Rd. HH15_450201 fervidus Steen Mt. Reer'n Area, Oregon United States 42.67524 -118.68547 Genitalia S. Loop dry temperature HH15_520201 fervidus NF-13, nr. Unity, dry Oregon United States 44.39914 -188.32017 Genitalia area HH15_130101 insularis Lassen Park: Paradise California United States 40.51667 -121.49402 Genitalia Meadows HH15_130102 insularis Lassen Park: Paradise California United States 40.51667 -121.49402 Genitalia Meadows HH15_170301 insularis Mt. Shasta, Everitt hwy, California United States 41.34678 -122.24143 Genitalia 6000 ft. HH15_400201 insularis Summit Rd, Hwy 204 Oregon United States 45.50712 -118.11169 Genitalia & I-84

56 HH15_430301 insularis Wallowa Mt. Rd at Oregon United States 45.14772 -116.9716 Genitalia Hells Canyon Rec Area HH15_430302 insularis Wallowa Mt. Rd at Oregon United States 45.14772 -116.9716 Genitalia Hells Canyon Rec Area PA002 fernaldae Tussey Mountain, Bear Pennsylvania United States 40.732312 -77.533949 Wing Meadows PA003 fernaldae Tussey Mountain, Bear Pennsylvania United States 40.732312 -77.533949 Wing Meadows PA004 fernaldae Tussey Mountain, Bear Pennsylvania United States 40.732312 -77.533949 Wing Meadows PA005 fernaldae Tussey Mountain, Bear Pennsylvania United States 40.732312 -77.533949 Wing Meadows PA006 fernaldae Tussey Mountain, Bear Pennsylvania United States 40.732312 -77.533949 Wing Meadows PA007 fernaldae Tussey Mountain, Bear Pennsylvania United States 40.732312 -77.533949 Wing Meadows PA008 fernaldae Tussey Mountain, Bear Pennsylvania United States 40.732312 -77.533949 Wing Meadows PA009 fernaldae Tussey Mountain, Bear Pennsylvania United States 40.732312 -77.533949 Wing Meadows PA010 fernaldae Tussey Mountain, Bear Pennsylvania United States 40.732312 -77.533949 Wing Meadows PA011 fernaldae Tussey Mountain, Bear Pennsylvania United States 40.732312 -77.533949 Wing Meadows PA012 fernaldae Tussey Mountain, Bear Pennsylvania United States 40.732312 -77.533949 Wing Meadows PA013 fernaldae Tussey Mountain, Bear Pennsylvania United States 40.732312 -77.533949 Wing Meadows PRAS0849 flavidus Helligskogen Troms Norway 69.163000 20.745083 Wing NCflav534-07 fernaldae Smoky Mountains North Carolina United States 36.18 -81.81 Genitalia NCflav539-03 fernaldae Smoky Mountains North Carolina United States 36.18 -81.81 Genitalia Bear Meadows, Tussey Genitalia BMAR 1161 fernaldae Mountain Pennsylvania United States 40.732312 77.533949

57 Appendix B

Color Data

Table 4: Oregon B. flavidus Total Body Pile Color Matrices

Specimen Site Total Body Pile Total Body Pile Percent Total Body Pile ID ID Percent Black Yellow Percent Orange 260301 26 29.7941176 58.2647059 11.9411765 260302 26 57.2647059 33.3235294 9.41176471 260303 26 45.5294118 45.6470588 8.82352941 260304 26 47.0294118 44.7352941 8.23552941 260305 26 51.8235294 39.3529412 8.82352941 260306 26 33.5882353 52.8823529 13.5294118 260307 26 41.558824 49.617647 8.8234294 260308 26 44.7941176 46.3823529 8.82352941 260309 26 45.1470588 46.0294118 8.82352941 260310 26 46.3529412 50.7058824 2.94117647 260311 26 66.3676471 24.5147059 9.11764706 260312 26 53.6911765 37.4852941 8.82352941 260313 26 65.8823529 24.4117647 9.70588235 260314 26 43.8529412 47.3235294 8.82352941 260315 26 65.8676471 27.6617647 6.47058824 260316 26 60.5882353 25.1470588 14.2647059 260317 26 40.2941176 56.4705882 3.23529412 260318 26 52.6470588 38.5294188 8.82352941 260319 26 47.7941176 40.5882353 11.6176471 260320 26 41.9117647 43.9705882 14.1176471 260321 26 54.6617647 36.4852941 8.85294118 260322 26 23.2794118 67.9558824 8.76470588 260323 26 44.058824 49.117647 6.8235294 260324 26 44.102941 53.250000 2.6470588 260325 26 68.558824 23.588235 7.8529412 260326 26 53.8235294 39.1911765 6.98529412 260327 26 33.8382353 57.7058824 8.45588235 270301 27 44.2941176 45.8529412 9.85294118 270302 27 60.441176 30.852941 8.7058824 270303 27 50.220588 40.955882 8.8235294 270304 27 43.926471 47.250000 8.8235294 270305 27 48.3088235 41.9117647 9.77941176 280101 28 32.7205882 56.9852941 10.2941176 290201 29 52.8088235 38.2794118 8.91176471 300101 30 31.029412 58.676471 10.294118 300102 30 69.267059 23.2352941 7.5000000 300103 30 44.7058824 48.3823529 6.91176471 300104 30 48.3088235 43.1617647 8.52941176 300301 30 30.9558824 54.3382353 14.7058824 300302 30 32.6176471 58.5588235 8.82352941 300303 30 45.5441176 44.1617647 10.2941176 300304 30 17.1617647 72.5441176 10.2941176 300305 30 63.4558824 27.7205882 8.82352941

58 320301 32 55.1323529 35.5147059 9.352941 320302 32 30.3676471 55.8088235 13.8235294 320303 32 53.2352941 35.4411765 11.3235294 320601 32 28.8823529 65.6764706 10.4411765 330401 33 66.4264706 24.7500000 8.82342941 330402 33 50.852941 40.323529 8.8235294 330403 33 54.7794118 35.2205882 10.0000000 330404 33 38.5294118 48.5294118 12.9411765 330405 33 33.6764706 54.5588235 11.7647059 330406 33 56.8381353 34.3382353 8.82352941 330407 33 42.1323529 47.7500000 10.1176471 330408 33 53.823529 34.779412 11.307059 340401 34 46.2500000 44.338235 9.4117647 340402 34 56.3970588 33.4558824 10.1470588 340403 34 47.3529412 39.7058824 12.9411765 400101 40 20.7352941 66.3235294 12.9411765 400102 40 27.9411765 59.1176471 12.9411765 470501 47 29.1176471 64.5588235 6.32352941 470502 47 24.7058824 62.3529412 12.9411765 470503 47 24.0441176 58.0147059 17.9411765 470504 47 41.6176471 48.0882353 10.2941176 470505 47 28.8235294 60.5882353 10.5882353 480201 48 40.3676471 47.2794118 12.3529412 490101 49 42.7205882 45.5147059 11.7647059 490102 49 39.0441176 52.2794118 8.67647059 500101 50 33.0147059 56.9852941 10.0000000 510501 51 33.6764706 53.3823529 12.9411765 420101 42 34.1911765 64.3382353 1.47058824 420102 42 22.8676471 64.1911765 12.9411765 420103 42 31.6176471 64.2647059 4.11764706 430201 43 30.735294 57.5000000 11.764706 430202 43 33.970588 50.147059 15.882353 430203 43 35.52941 49.73529 14.73529 430204 43 47.941176 51.470588 0.05882353

59 Appendix C

Nexus haplotype file

Trimmed B. flavidus haplogroup Nexus file for popART:

#NEXUS begin taxa; dimensions ntax=12; taxlabels h_9 h_11 h_10 h_6 h_14 h_5 h_1 h_12 h_8 h_2 h_3 h_13 ; end; begin characters; dimensions nchar=602; format datatype=dna missing=? gap=- interleave=yes; matrix h_9 GAATAATTGGATCATCAATAAGAATAATAATTCGAATAGAATTAAGTCATCCAGGTATAT h_11 GTATAATTGGGTCATCAATAAGAATAATAATTCGAATAGAATTAAGCCATCCAGGTATAT h_10 GTATAATTGGGTCATCAATAAGAATAATAATTCGAATAGAATTAAGCCATCCAGGTATAT h_6 GTATAATTGGATCATCAATAAGAATAATAATTCGAATAGAATTAAGCCATCCAGGTATAT h_14 GTATAATTGGATCATCAATAAGAATAATAATTCGAATAGAATTAAGCCATCCAGGTATAT h_5 GTATAATTGGATCATCAATAAGAATAATAATTCGAATAGAATTAAGCCATCCAGGTATAT h_1 GTATAATTGGATCATCAATAAGAATAATAATCCGAATAGAGTTAAGTCATCCAGGTATAT h_12 GTATAATTGGATCATCAATAAGAATAATAATTCGAATAGAATTAAGCCATCCAGGTATAT h_8 GAATAATTGGATCATCAATAAGAATAATAATTCGAATAGAATTAAGTCATCCAGGTATAT h_2 GAATAATTGGATCATCAATAAGAATAATAATCCGAATAGAGTTAAGTCATCCAGGTATAT h_3 GTATAATTGGATCATCAATAAGAATAATAATCCGAATAGAATTAAGTCATCCAGGTATAT h_13 GTATAATTGGATCATCAATAAGAATAATAATTCGAATAGAATTAAGCCATCCAGGTATAT

h_9 GAATTAATAATGATCAAATTTATAATTCTATAGTTACAAGTCATGCATTTTTAATAATTT h_11 GAATTAATAATGATCAAATTTATAATTCTATAGTTACAAGTCATGCATTTTTAATAATTT h_10 GAATTAATAATGATCAAATTTATAATTCTATAGTTACAAGTCATGCATTTTTAATAATTT h_6 GAATTAATAATGATCAAATTTATAATTCTATAGTTACAAGTCATGCATTTTTAATAATTT h_14 GAATTAATAATGATCAAATTTATAATTCTATAGTTACAAGTCATGCATTTTTAATAATTT h_5 GAATTAATAATGATCAAATTTATAATTCTATAGTTACAAGTCATGCATTTTTAATAATTT h_1 GGATTAATAATGATCAAATTTATAATTCTATAGTTACAAGTCATGCATTTCTAATAATTT h_12 GAATTAATAATGATCAAATTTATAATTCTATAGTTACAAGTCATGCATTTTTAATAATTT h_8 GAATTAATAATGATCAAATTTATAATTCTATAGTTACAAGTCATGCATTTTTAATAATTT h_2 GGATTAATAATGATCAAATTTATAATTCTATAGTTACAAGTCATGCATTTCTAATAATTT h_3 GGATTAATAATGATCAAATTTATAATTCTATAGTTACAAGTCATGCATTTCTAATAATTT h_13 GAATTAATAATGATCAAATTTATAATTCTATAGTTACAAGTCATGCATTTTTAATAATTT

h_9 TTTTTATAGTTATACCATTTTTAATTGGTGGATTCGGAAATTATTTAATTCCCTTAATAC

60 h_11 TTTTTATAGTTATACCCTTTCTAATTGGTGGATTCGGAAATTATTTAATTCCTTTAATAT h_10 TTTTTATAGTTATACCCTTTCTAATTGGTGGATTCGGAAATTATTTAATTCCTTTAATAT h_6 TTTTTATAGTTATACCCTTTCTAATTGGTGGATTCGGAAATTATTTAATTCCTTTAATAT h_14 TTTTTATAGTTATACCCTTTCTAATTGGTGGATTCGGAAATTATTTAATTCCCTTAATAT h_5 TTTTTATAGTTATACCCTTTCTAATTGGTGGATTCGGAAATTATTTAATTCCTTTAATAT h_1 TTTTTATAGTTATACCCTTTCTAATTGGTGGATTCGGAAATTATTTAATTCCTTTAATAT h_12 TTTTTATAGTTATACCCTTTCTAATTGGTGGATTCGGAAATTATTTAATTCCTTTAATAT h_8 TTTTTATAGTTATACCATTTTTAATTGGTGGATTCGGAAATTATTTAATTCCCTTAATAC h_2 TTTTTATAGTTATACCCTTTCTAATTGGTGGATTCGGAAATTATTTAATTCCTTTAATAT h_3 TTTTTATAGTTATACCCTTTCTAATTGGTGGATTCGGAAATTATTTAATTCCTTTAATAT h_13 TTTTTATAGTTATACCCTTTCTAATTGGTGGATTCGGAAATTATTTAATTCCTTTAATAT h_9 TAGGATCTCCTGATATAGCATTTCCACGATTAAATAACCTAAGATTTTGACTTTTACCTC h_11 TAGGATCTCCTGACATAGCATTTCCACGATTAAATAACTTAAGATTTTGACTTTTACCTC h_10 TAGGATCTCCTGACATAGCATTTCCACGATTAAATAACTTAAGATTTTGACTTTTACCTC h_6 TAGGATCTCCTGACATAGCATTTCCACGATTAAATAACTTAAGATTTTGACTTTTACCTC h_14 TAGGATCTCCTGACATAGCATTTCCACGATTAAATAACTTAAGATTTTGACTTTTACCTC h_5 TAGGATCTCCTGACATAGCATTTCCACGATTAAATAACTTAAGATTTTGACTTTTACCTC h_1 TAGGATCTCCTGACATAGCATTCCCACGATTAAATAACTTAAGATTTTGACTTTTACCTC h_12 TAGGATCTCCTGACATAGCATTTCCACGATTAAATAACTTAAGATTTTGACTTTTACCTC h_8 TAGGATCTCCTGATATAGCATTTCCACGATTAAATAACCTAAGATTTTGACTTTTACCTC h_2 TAGGATCTCCTGACATAGCATTCCCACGATTAAATAACTTAAGATTTTGACTTTTACCTC h_3 TAGGATCTCCTGACATAGCATTCCCACGATTAAATAACTTAAGATTTTGACTTTTACCTC h_13 TAGGATCTCCTGACATAGCATTTCCACGATTAAATAACTTAAGATTTTGACTTTTACCTC h_9 CATCATTAATATTATTAATTATAAGAAACCTTTTCACTCCAAATACTGGAACAGGATGAA h_11 CATCATTAATATTATTAATTATAAGAAACCTTTTCACTCCAAATACTGGTACAGGATGAA h_10 CATCATTAATATTATTAATTATAAGAAACCTTTTCACTCCAAATACTGGTACAGGATGAA h_6 CATCATTAATATTATTAATTATAAGAAACCTTTTCACTCCAAATACTGGTACAGGATGAA h_14 CATCATTAATATTATTAATTATAAGAAACCTTTTCACTCCAAATACTGGTACAGGATGAA h_5 CATCATTAATATTATTAATTATAAGAAACCTTTTCACTCCAAATACTGGTACAGGATGAA h_1 CATCATTAATATTATTAATTATAAGAAACCTTTTCACTCCAAATACTGGTACAGGATGAA h_12 CATCATTAATATTATTAATTATAAGAAACCTTTTCACTCCAAATACTGGTACAGGATGAA h_8 CATCATTAATATTATTAATTATAAGAAACCTTTTCACTCCAAATACTGGAACAGGATGAA h_2 CATCATTAATATTATTAATTATAAGAAACCTTTTCACTCCAAATACTGGTACAGGATGAA h_3 CATCATTAATATTATTAATTATAAGAAACCTTTTCACTCCAAATACTGGTACAGGATGAA h_13 CATCATTAATATTATTAATTATAAGAAACCTTTTCACTCCAAATACTGGTACAGGATGAA h_9 CAATTTACCCACCATTATCTTCTTATCTATTCCATTCATCACCTTCTGTAGATATAGCAA h_11 CAATTTATCCACCATTATCTTCTTATCTATTTCACTCATCACCTGCTGTAGATATAACAA h_10 CAATTTATCCACCATTATCTTCTTATCTATTTCACTCATCACCTGCTGTAGATATAACAA h_6 CAATTTATCCACCATTATCTTCTTATCTATTTCACTCATCACCTGCTGTAGATATAACAA h_14 CAATTTATCCACCATTATCTTCTTATCTATTTCACTCATCACCTGCTGTTGATATAACAA h_5 CAATTTATCCACCATTATCTTCTTATCTATTTCACTCATCACCTGCTGTAGATATAACAA h_1 CAATTTATCCACCATTATCTTCTTATCTATTTCACTCATCACCTGCTGTAGATATAACAA h_12 CAATTTATCCACCATTATCTTCTTATCTATTTCACTCATCACCTGCTGTAGATATAACAA h_8 CAATTTACCCACCATTATCTTCTTATCTATTCCATTCATCACCTTCTGTAGATATAGCAA h_2 CAATTTATCCACCATTATCTTCTTATCTATTTCACTCATCACCTGCTGTAGATATAACAA h_3 CAATTTATCCACCATTATCTTCTTATCTATTTCACTCATCACCTGCTGTAGATATAACAA h_13 CAATTTATCCACCATTATCTTCTTATCTATTTCACTCATCACCTGCTGGAGATATAACAA h_9 TTTTTTCATTACATATAACAGGTATTTCCTCAATTATTGGATCATTAAATTTTATAGTTT h_11 TTTTCTCACTACATATAACAGGTATCTCTTCAATTATTGGATCATTAAATTTTTTAGTTT h_10 TTTTCTCACTACATATAACAGGTATCTCTTCAATTATTGGATCATTAAATTTTTTAGTTT h_6 TTTTCTCACTACATATAACAGGTATCTCTTCAATTATTGGATCATTAAATTTTTTAGTTT h_14 TTTTCTCACTACATATAACAGGTATCTCTTCAATTATTGGATCATTAAATTTTTTAGTTT h_5 TTTTCTCATTACATATAACAGGTATCTCTTCAATTATTGGATCATTAAATTTTTTAGTTT h_1 TTTTCTCACTACATATAACAGGTATCTCTTCAATTATTGGATCATTAAATTTTTTAGTTT h_12 TTTTCTCACTACATATAACAGGTATCTCTTCAATTATTGGATCATTAAATTTTTTAGTTT h_8 TTTTTTCATTACATATAACAGGTATTTCCTCAATTATTGGATCATTAAATTTTATAGTTT h_2 TTTTCTCACTACATATAACAGGTATCTCTTCAATTATTGGATCATTAAATTTTTTAGTTT

61 h_3 TTTTCTCACTACATATAACAGGTATCTCTTCAATTATTGGATCATTAAATTTTTTAGTTT h_13 TTTTCTCACTACATATAACAGGTATCTCTTCAATTATTGGATCATTAAATTTTTTAGTTT

h_9 CAATTATAATAATAAAAAATTATTCAATAAATTTTGATCAAATTAATTTATTCTCTTGAT h_11 CAATTATAATAATAAAAAATCATTCAATAAATTTTGATCAAATTAACTTATTCTCCTGAT h_10 CAATTATAATAATAAAAAATCATTCAATAAATTTTGATCAAATTAACTTATTCTCCTGAT h_6 CAATTATAATAATAAAAAATCATTCAATAAATTTTGATCAAATTAACTTATTCTCCTGAT h_14 CAATTATAATAATAAAAAATCATTCAATAAATTTTGATCAAATTAACTTATTCTCCTGAT h_5 CAATTATAATAATAAAAAATCATTCAATAAATTTTGATCAAATTAACTTATTCTCCTGAT h_1 CAATTATAATAATAAAAAATCATTCAATAAATTTTGATCAAATTAACTTATTCTCCTGAT h_12 CAATTATAATAATAAAAAATCATTCAATAAATTTTGATCAAATTAACTTATTCTCCTGAT h_8 CAATTATAATAATAAAAAATTATTCAATAAATTTTGATCAAATTAATTTATTCTCTTGAT h_2 CAATTATAATAATAAAAAATCATTCAATAAATTTTGATCAAATTAACTTATTCTCCTGAT h_3 CAATTATAATAATAAAAAATCATTCAATAAATTTTGATCAAATTAACTTATTCTCCTGAT h_13 CAATTATAATAATAAAAAATCATTCAATAAATTTTGATCAAATTAACTTATTCTCCTGAT

h_9 CCGTTTGTATTACTGTAATTTTATTAACCTTATCTTTACCTGTTTTAGCAGGTGCAATTA h_11 CTGTTTGTATTACTGTAATCTTACTAACCTTATCTTTACCTGTTTTAGCAGGTGCAATTA h_10 CTGTTTGTATTACTGTAATATTACTAACCTTATCTTTACCTGTTTTAGCAGGTGCAATTA h_6 CTGTTTGTATTACTGTAATCTTACTAACCTTATCTTTACCTGTTTTAGCAGGTGCAATTA h_14 CTGTTTGTATTACTGTAATCTTACTAACCTTATCTTTACCCGTTTTAGCAGGTGCAATTA h_5 CTGTTTGTATTACTGTAATCTTACTAACCTTATCTTTACCTGTTTTAGCAGGTGCAATTA h_1 CTGTTTGTATTACTGTAATCTTACTAACCTTATCTTTACCTGTTTTAGCAGGTGCAATTA h_12 CTGTTTGTATTACTGTAATCTTACTAACCTTATCTTTACCCGTTTTAGCAGGTGCAATTA h_8 CCGTTTGTATTACTGTAATTTTATTAACCTTATCTTTACCTGTTTTAGCAGGTGCAATTA h_2 CTGTTTGTATTACTGTAATCTTACTAACCTTATCTTTACCTGTTTTAGCAGGTGCAATTA h_3 CTGTTTGTATTACTGTAATCTTACTAACCTTATCTTTACCTGTTTTAGCAGGTGCAATTA h_13 CTGTTTGTATTACTGTAATCTTACTAACCTTATCTTTACCCGTTTTAGCAGGTGCAATTA

h_9 CAATACTATTATTTGATCGAAATTTTAATACATCATTTTTTGATCCAATAGGAGGAGGTG h_11 CAATATTATTATTCGATCGAAATTTTAATACATCATTCTTTGATCCAATAGGTGGAGGTG h_10 CAATATTATTATTCGATCGAAATTTTAATACATCATTCTTTGATCCAATAGGTGGAGGTG h_6 CAATATTATTATTCGATCGAAATTTTAATACATCATTCTTTGATCCAATAGGTGGAGGTG h_14 CAATATTATTATTCGATCGAAATTTTAATACATCATTCTTTGATCCAATAGGTGGAGGTG h_5 CAATATTATTATTCGATCGAAATTTTAATACATCATTCTTTGATCCAATAGGTGGAGGTG h_1 CAATATTATTATTCGATCGAAATTTTAATACATCATTTTTTGACCCAATAGGTGGAGGTG h_12 CAATATTATTATTCGATCGAAATTTTAATACATCATTCTTTGATCCAATAGGTGGAGGTG h_8 CAATATTATTATTTGATCGAAATTTTAATACATCATTTTTTGATCCAATAGGAGGAGGTG h_2 CAATATTATTATTCGATCGAAATTTTAATACATCATTTTTTGACCCAATAGGTGGAGGTG h_3 CAATATTATTATTCGATCGAAATTTTAATACATCATTTTTTGACCCAATAGGTGGAGGTG h_13 CAATATTATTATTCGATCGAAATTTTAATACATCATTCTTTGATCCAATAGGTGGAGGTG

h_9 AT h_11 AC h_10 AC h_6 AC h_14 AC h_5 AC h_1 AT h_12 AC h_8 AT h_2 AT h_3 AT h_13 AC

; end;

[ BEGIN TRAITS; [The traits block is specific to PopART. The numbers in the matrix are number of

62 samples associated with each trait. The order of the columns must match the order of TraitLabels. Separator can be comma, space, or tab.] Dimensions NTRAITS=5; Format labels=yes missing=? separator=Comma; [Optional: if you include TraitLatitude and TraitLongitude they will be used to place trait groups on the map] TraitLatitude 65.922 55.604 54.928 51.282 45.344 55.030 46.631 52.918 35.722 44.910 51.098 43.704 40.864 62.339 54.574 68.170 47.311 42.914 63.938 48.858; TraitLongitude -151.948 -115.080 10.406 -69.140 -97.912 -66.363 -59.818 -79.061 -63.756 -85.886 -120.53 -77.869 93.379 - 105.765 23.194 -120.532 -107.556 -136.895 13.397; TraitLabels Alaska Alberta British_Columbia Germany Maine Manitoba New_Brunswick Newfoundland_and_Labrador North_Carolina Nova_Scotia Ontario Oregon Pennsylvania Russia Saskatchewan Scandinavia Washington Wyoming Yukon_Territory Norvegicus; Matrix h_1 0,0,0,0,2,0,1,0,3,4,0,0,3,0,0,0,0,0,0,0 h_2 0,0,0,0,0,0,0,0,0,1,0,0,0,0,0,0,0,0,0,0 h_3 0,0,0,0,1,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0 h_4 0,0,0,0,0,0,0,0,0,1,0,0,0,0,0,0,0,0,0,0 h_5 0,4,3,0,0,0,0,0,0,0,0,8,0,0,1,0,1,1,0,0 h_6 0,0,0,0,0,0,0,0,0,0,0,4,0,2,0,0,0,0,0,0 h_7 1,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0 h_8 0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,1 h_9 0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,2 h_10 0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,1,0,0,0,0 h_11 0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,2,0,0,0,0 h_12 1,0,0,0,0,3,0,0,0,0,1,0,0,0,0,0,0,0,1,0 h_13 0,0,0,0,0,1,0,0,0,0,0,0,0,0,0,0,0,0,0,0 h_14 2,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0 h_15 0,0,0,0,0,0,0,1,0,0,0,0,0,0,0,0,0,0,0,0

;

END; ]

63 Appendix D

Genitalia Images

Table 5: B. flavidus/fernaldae genitalia images

260301 260302 260303 260304 260305 260306 Oregon Oregon Oregon Oregon Oregon Oregon

260307 260308 260309 260310 260311 260312 Oregon Oregon Oregon Oregon Oregon Oregon

260313 260314 260315 260316 260317 260318 Oregon Oregon Oregon Oregon Oregon Oregon

260319 260320 230631 260322 260323 260324 Oregon Oregon Oregon Oregon Oregon Oregon

64

260325 260326 260327 270301 270302 270303 Oregon Oregon Oregon Oregon Oregon Oregon

270304 270305 280101 290201 300101 300102 Oregon Oregon Oregon Oregon Oregon Oregon

300103 300104 300301 300302 300303 300304 Oregon Oregon Oregon Oregon Oregon Oregon

300305 320301 320302 320303 320601 330401 Oregon Oregon Oregon Oregon Oregon Oregon

330402* 330403 330404 330405 330406* 330407

65 Oregon Oregon Oregon Oregon Oregon Oregon

330408 340401 340402 340403 400101* 400102 Oregon Oregon Oregon Oregon Oregon Oregon

470501 470502 470503* 470504 470505 480201* Oregon Oregon Oregon Oregon Oregon Oregon

490101 490102* 500101 510501 BMAR 1152 BMAR 1157 Oregon Oregon Oregon Oregon Pennsylvania Pennsylvania

BMAR 1161 BMAR 1165 NCflav534-06 NCflav534-07 NCflav539-03 NCflav539-04 Pennsylvania Pennsylvania North Carolina North Carolina North Carolina North Carolina

66 Table 6: Additional species genitalia images: B. californicus, B. fervidus, B. insularis, B. melanopygus

BMELB0TM045 BMELB021 BMELB023 BMELB100 BMELR010 BMELR011 B. melanopygus B. melanopygus B. melanopygus B. melanopygus B. melanopygus B. melanopygus

BMELR016 BMELR062 BMELR095 HH15_030601 HH15_060301 HH15_430101 B. melanopygus B. melanopygus B. melanopygus B. californicus B. californicus B. californicus

HH15_520101 HH15_390101 HH15_170301 HH15_130102 HH15_400201 HH15_410101 B. californicus B. californicus B. insularis B. insularis B. insularis B. insularis

HH15_130101 HH15_430301 HH15_430302 HH15_450201 HH15_040201 HH15_520201 B. insularis B. insularis B. insularis B. fervidus B. fervidus B. fervidus

67 Appendix E

Genitalic Data Matrices

Table 7: Genitalia measurements (see Figure 3) for B. flavidus from Oregon, United States

Locality Specimen A B C D E F G

ID

Grasshopper Mt 260301 1.443 0.486 0.761 0.444 1.083 0.55 1.143

Grasshopper Mt 260302 1.381 0.498 0.791 0.451 1.0105 0.471 1.219

Grasshopper Mt 260304 1.288 0.581 0.796 0.3715 1.1 0.541 1.049

Grasshopper Mt 260306 1.367 0.442 0.938 0.534 1.1225 0.546 1.226

Grasshopper Mt 260307 1.323 0.426 0.85 0.4365 1.018 0.52 1.046

Grasshopper Mt 260308 1.242 0.465 0.786 0.479 1.042 0.5675 1.0745

Grasshopper Mt 260309 1.316 0.515 0.779 0.489 1.073 0.4735 1.1195

Grasshopper Mt 260310 1.417 0.535 0.795 0.4685 1.055 0.553 1.0585

Grasshopper Mt 260311 1.329 0.475 0.828 0.425 0.9925 0.629 1.1385

Grasshopper Mt 260314 1.383 0.479 0.76 0.3805 1.0335 0.561 1.051

Grasshopper Mt 260315 1.281 0.486 0.776 0.3695 0.998 0.503 1.103

Grasshopper Mt 260316 1.327 0.533 0.835 0.456 1.1555 0.532 1.183

Grasshopper Mt 260319 1.335 0.549 0.769 0.439 1.0395 0.505 1.1255

Grasshopper Mt 260320 1.336 0.473 0.856 0.4275 1.074 0.4405 1.174

Grasshopper Mt 260321 1.418 0.438 0.823 0.3885 1.119 0.5255 1.138

Grasshopper Mt 260322 1.422 0.478 0.785 0.412 1.0425 0.479 1.108

Grasshopper Mt 260324 1.393 0.57 0.758 0.4215 1.0845 0.565 1.097

Grasshopper Mt 260325 1.327 0.5 0.822 0.518 1.004 0.5235 1.142

Grasshopper Mt 260326 1.236 0.489 0.762 0.43 1.079 0.4025 1.1285

Grasshopper Mt 260327 1.321 0.458 0.816 0.452 1.0405 0.552 1.104

Grasshopper Mt 260303 1.33 0.425 0.816 0.4385 1.1995 0.496 1.2065

Grasshopper Mt 260317 1.228 0.536 0.827 0.503 1.113 0.4885 1.1855

Grasshopper Mt 260303 1.272 0.475 0.854 0.502 1.01 0.5135 1.14

Grasshopper Mt 260305 1.374 0.486 0.848 0.469 1.0885 0.5245 1.21

Grasshopper Mt 260318 1.312 0.424 0.795 0.4075 1.169 0.527 1.1825

Bend 270301 1.409 0.539 0.817 0.427 1.0505 0.4775 1.1

68

Bend 270302 1.421 0.458 0.838 0.4415 1.0925 0.5755 1.1005

Bend 270303 1.344 0.481 0.817 0.4605 1.104 0.542 1.156

Bend 270305 1.389 0.464 0.848 0.4225 1.126 0.54 1.163

Bend 270304 1.361 0.546 0.918 0.4935 1.113 0.5375 1.187

Cougar 280101 1.408 0.494 0.768 0.4575 1.0635 0.516 1.0985

Reservoir

Sisters 290201 1.488 0.527 0.819 0.4405 1.1275 0.5945 1.1565

Mountains

North Sisters 300103 1.299 0.493 0.682 0.5065 1.107 0.492 1.135

North Sisters 300104 1.344 0.463 0.886 0.4475 1.124 0.4505 1.163

North Sisters 300301 1.3 0.535 0.81 0.465 1.151 0.4855 1.097

North Sisters 300302 1.256 0.451 0.86 0.4655 1.009 0.539 1.1195

North Sisters 300303 1.482 0.557 0.836 0.43 1.0755 0.5455 1.13

North Sisters 300101 1.361 0.546 0.918 0.4935 1.113 0.5375 1.187

North Sisters 300102 1.369 0.386 0.821 0.482 1.124 0.521 1.171

North Sisters 300304 1.471 0.532 0.846 0.4885 1.1025 0.53 1.1685

North Sisters 300305 1.412 0.5 0.727 0.367 1.039 0.516 1.042

Olalie Lake 320301 1.331 0.518 0.79 0.448 1.0725 0.4985 1.103

Olalie Lake 320302 1.322 0.509 0.811 0.485 0.992 0.505 1.14

Olalie Lake 320303 1.321 0.48 0.77 0.516 1.0005 0.546 1.1525

Olalie Lake 320601 1.311 0.537 0.802 0.4565 1.086 0.5155 1.175

Mirror Lake 330401 1.342 0.528 0.861 0.345 1.1145 0.552 1.138

Mirror Lake 330402 1.434 0.437 0.808 0.461 1.1335 0.5355 1.161

Mirror Lake 330403 1.324 0.501 0.814 0.4035 1.1015 0.501 1.1195

Mirror Lake 330404 1.33 0.526 0.848 0.3735 1.0255 0.497 1.106

Mirror Lake 330405 1.352 0.499 0.761 0.4405 1.023 0.4875 1.0935

Mirror Lake 330406 1.34 0.585 0.75 0.43 1.061 0.501 1.131

Mirror Lake 330407 1.397 0.503 0.806 0.517 1.1545 0.4725 1.197

Mirror Lake 330408 1.395 0.487 0.725 0.512 1.0475 0.56 1.1305

Mont Hood 340401 1.31 0.501 0.83 0.4305 1.048 0.5215 1.1895

Mont Hood 340402 1.467 0.491 0.902 0.419 1.2115 0.5405 1.243

Mont Hood 340403 1.298 0.522 0.792 0.5405 1.136 0.5025 1.224

69

Summerville 400101 1.301 0.552 0.934 0.3825 0.878 0.6075 1.014

Summerville 400102 1.348 0.39 0.722 0.5115 0.9795 0.502 1.1215

Lostine river 470502 1.213 0.459 0.811 0.4635 0.9675 0.4685 1.117

Lostine river 470503 1.327 0.578 0.713 0.4575 1.012 0.5055 1.1095

Lostine river 470504 1.345 0.437 0.79 0.408 1.0745 0.4395 1.104

Lostine river 470505 1.359 0.564 0.861 0.4755 1.0895 0.543 1.172

Baker City 480201 1.281 0.462 0.757 0.4395 1.024 0.525 1.0765

Prairie City 490101 1.285 0.476 0.809 0.426 1.025 0.4675 1.0515

Prairie City 490102 1.285 0.413 0.77 0.46 1.0605 0.4825 1.143

Strawberry 500101 1.322 0.512 0.762 0.4395 1.015 0.5055 1.1325

Lake

Table 8: Genitalia measurements (see Figure 11) for B. “flavidus” from Oregon, Pennsylvania, and North Carolina, United States, and for B. californicus, B. fervidus, B. insularis, and B. melanopygus specimens

Site Species ID A B C D E F G H I J K L oregon 26 flavidus 260302 1.381 0.498 0.45 0.56 0.9015 0.68 0.8465 0.9605 0.1065 0.51 0.3615 0.434 oregon 26 flavidus 260306 1.367 0.442 0.4505 0.6065 0.955 0.701 0.9655 1.1215 0.1235 0.5245 0.3965 0.4245 oregon 26 flavidus 260309 1.316 0.515 0.4525 0.556 0.7965 0.8315 0.9325 1.0855 0.1235 0.4035 0.41 0.4015 oregon 26 flavidus 260311 1.329 0.475 0.437 0.63 0.947 0.6685 0.8275 0.9995 0.1455 0.4765 0.342 0.3465 oregon 26 flavidus 260315 1.281 0.486 0.388 0.6005 0.928 0.674 0.847 1.006 0.105 0.4715 0.3595 0.4145 oregon 26 flavidus 260316 1.327 0.533 0.4675 0.5895 0.926 0.6915 1.031 1.3945 0.18 0.5055 0.4195 0.3885 oregon 26 flavidus 260319 1.335 0.549 0.4245 0.545 0.9245 0.7105 0.8625 1.0385 0.1335 0.489 0.427 0.4185 oregon 26 flavidus 260320 1.336 0.473 0.4275 0.526 0.9435 0.7175 0.8645 1.0725 0.102 0.3755 0.4225 0.409 oregon 26 flavidus 260324 1.393 0.57 0.443 0.609 0.9915 0.71 0.884 1.082 0.148 0.4705 0.3715 0.378 oregon 27 flavidus 270302 1.421 0.458 0.502 0.6245 1.0255 0.738 0.937 1.093 0.1765 0.536 0.418 0.465 oregon 27 flavidus 270304 1.361 0.546 0.439 0.604 0.9665 0.712 0.9005 1.078 0.178 0.4975 0.3575 0.466 oregon 27 flavidus 270303 1.344 0.481 0.45 0.6025 0.9725 0.722 0.933 1.111 0.1405 0.492 0.449 0.469 oregon 28 flavidus 280101 1.408 0.494 0.4125 0.588 0.927 0.688 0.98 1.084 0.141 0.49 0.366 0.4295 oregon 29 flavidus 290201 1.488 0.527 0.5235 0.678 1.0725 0.777 0.9485 1.1445 0.1315 0.5415 0.3915 0.4255 oregon 30 flavidus 300103 1.299 0.493 0.4105 0.547 0.885 0.6835 0.9495 1.109 0.1375 0.4675 0.402 0.413 oregon 30 flavidus 300101 1.361 0.546 0.4715 0.618 0.951 0.7065 1.0165 1.159 0.1405 0.4785 0.436 0.4275 oregon 30 flavidus 300302 1.256 0.451 0.4045 0.6115 0.901 0.6455 0.8875 1.013 0.1305 0.5055 0.3785 0.441

70 oregon 30 flavidus 300303 1.482 0.557 0.4855 0.608 0.9825 0.735 0.936 1.085 0.154 0.49 0.3805 0.4415 oregon 32 flavidus 320302 1.322 0.509 0.4425 0.5595 0.922 0.6535 0.808 1.0045 0.126 0.502 0.3565 0.4395 oregon 32 flavidus 320303 1.321 0.48 0.428 0.6145 0.96 0.689 0.8615 0.9975 0.162 0.3905 0.4045 0.4455 oregon 33 flavidus 330403 1.324 0.501 0.4465 0.5975 0.9425 0.672 0.952 1.1055 0.151 0.5305 0.4305 0.47 oregon 33 flavidus 330406 1.34 0.585 0.403 0.58 0.938 0.6785 0.904 1.0615 0.1595 0.5085 0.3765 0.4465 oregon 33 flavidus 330405 1.352 0.499 0.449 0.5715 0.916 0.6785 0.879 1.025 0.143 0.453 0.3305 0.429 +S22 oregon 33 flavidus 330408 1.395 0.487 0.424 0.647 0.9725 0.7145 0.893 1.0555 0.1425 0.504 0.396 0.422 oregon 34 flavidus 340401 1.31 0.501 0.4335 0.6115 0.9785 0.7135 0.854 1.061 0.157 0.469 0.3915 0.426 oregon 34 flavidus 340403 1.298 0.522 0.4065 0.5685 0.8985 0.663 0.9845 1.116 0.134 0.4825 0.3865 0.435 oregon 40 flavidus 400101 1.301 0.552 0.3895 0.702 1.059 0.712 0.614 0.8755 0.14 0.3925 0.3505 0.383 oregon 40 flavidus 400102 1.348 0.39 0.462 0.594 0.9385 0.6825 0.8015 0.994 0.094 0.47 0.4135 0.4405 oregon 47 flavidus 470502 1.213 0.459 0.3935 0.517 0.855 0.638 0.833 0.9795 0.102 0.4465 0.404 0.407 oregon 47 flavidus 470503 1.327 0.578 0.4085 0.578 0.9275 0.684 0.8375 1.012 0.1025 0.496 0.3695 0.433 oregon 47 flavidus 470504 1.345 0.437 0.456 0.5 0.844 0.6705 0.925 1.0785 0.143 0.491 0.3505 0.4275 oregon 47 flavidus 470505 1.359 0.564 0.4595 0.584 1.0205 0.678 0.828 1.0815 0.1225 0.488 0.369 0.4345 oregon 48 flavidus 480201 1.281 0.462 0.426 0.5865 0.8875 0.6555 0.9085 1.0325 0.1545 0.466 0.35 0.3915 oregon 49 flavidus 490102 1.285 0.413 0.406 0.5285 0.8775 0.6515 0.911 1.068 0.1865 0.4765 0.3735 0.4775 oregon 49 flavidus 490101 1.285 0.476 0.398 0.5225 0.844 0.645 0.8625 1.0165 0.1435 0.489 0.369 0.452 oregon 50 flavidus 500101 1.322 0.512 0.448 0.5705 0.9285 0.7255 0.8445 1.0125 0.1255 0.5015 0.402 0.4235 oregon 51 flavidus 510101 1.264 0.487 0.4235 0.534 0.8635 0.6455 0.85 1.0065 0.0855 0.402 0.3725 0.4255 pa tussey fernaldae bmar 1.222 0.393 0.388 0.4355 0.73 0.59 0.973 1.0815 0.1275 0.5215 0.389 0.3865 mtn 1157 pa tussey fernaldae bmar 1.245 0.435 0.45 0.481 0.827 0.656 0.7405 0.918 0.141 0.504 0.3895 0.4255 mtn 1161 pa tussey fernaldae bmar 1.294 0.477 0.49 0.5025 0.787 0.656 0.9475 1.0795 0.1875 0.498 0.3325 0.419 mtn 1165 pa tussey fernaldae bmar 1.187 0.437 0.442 0.484 0.7695 0.6115 0.796 0.933 0.1615 0.464 0.3725 0.407 mtn 1156 smoky fernaldae 53904 1.28 0.4 0.422 0.453 0.7645 0.6325 1 1.1465 0.154 0.5375 0.425 0.4695 mts smoky fernaldae 53406 1.171 0.36 0.3855 0.447 0.736 0.6055 0.8555 1 0.1645 0.479 0.3265 0.4665 mts

71 smoky fernaldae 53903 1.235 0.367 0.447 0.341 0.7765 0.622 0.7975 0.971 0.156 0.5045 0.3565 0.4135 mts smoky fernaldae 53407 1.284 0.474 0.4885 0.4695 0.8005 0.6595 0.944 1.0805 0.177 0.504 0.33 0.4325 mts

Oregon melanop- BMEL 1.663 0.601 0.395 0.5665 0.69 0.6965 1.2015 1.27 0.194 0.26 0.1935 0.3205

ygus R095

Oregon melanop- BMEL 1.722 0.611 0.4215 0.3855 0.811 0.7065 1.2675 1.271 0.178 0.21 0.176 0.2645

ygus R011

Oregon melanop- BMEL 1.749 0.591 0.439 0.397 0.7875 0.81 1.39 1.491 0.2225 0.316 0.2315 0.3885

ygus R010

California melanop- BMEL 1.727 0.713 0.434 0.5625 0.6985 0.7345 1.316 1.344 0.239 0.2515 0.198 0.2885

/Oregon ygus B021

California melanop- BMEL 1.717 0.691 0.449 0.454 0.8945 0.7225 1.24 1.294 0.2305 0.28 0.196 0.315

ygus B062

Oregon melanop- BMEL 1.724 0.658 0.4765 0.418 0.8475 0.7315 1.182 1.2225 0.2175 0.2265 0.163 0.276

ygus B100

Oregon melanop- BMEL 1.794 0.564 0.451 0.5075 0.732 0.771 1.2855 1.4445 0.238 0.3255 0.25 0.399

ygus B023

Oregon melanop- BMEL 1.715 0.608 0.424 0.374 0.843 0.685 1.244 1.3005 0.2205 - - -

ygus R016

California melanop- BMEL 1.615 0.523 0.431 0.3825 0.7525 0.6945 1.2725 1.39 0.2395 0.312 0.216 0.3525

ygus B0TM0

45

Oregon californi- HH15_ 2.411 1.007 0.6645 0.49 1.1915 1.047 1.3335 1.5595 0.353 0.7605 0.4105 0.6715

cus 390101

Oregon californi- HH15_ 2.288 1.015 0.7195 0.4175 1.0595 0.9915 1.294 1.495 0.394 - - 0.6725

cus 030601

California californi- HH15_ 2.345 1.083 0.7055 0.546 1.121 489.05 1.4115 1.5175 0.411 367.35 0.4195 0.7185

cus 060301 45 1

Oregon californi- HH15_ 2.432 1.11 0.7195 0.582 1.039 1.0175 1.3605 1.476 0.4015 - - 0.748

cus 430101

Oregon californi- HH15_ 2.479 1.003 0.651 0.5445 1.1865 1.1245 1.246 1.5445 0.397 0.775 0.4345 0.657

cus 520101

72

Oregon fervidus HH15_ 2.208 1.059 0.605 0.38 1.041 0.938 1.2725 1.387 0.3925 - - 0.623

040201

Oregon fervidus HH15_ 2.32 0.984 0.704 0.528 1.201 1.05 1.318 1.491 0.3595 0.687 0.3465 0.691

450201

Oregon fervidus HH15_ 0.429 1.055 0.696 0.614 1.054 1.077 1.3415 1.536 0.3675 0.835 0.388 0.7465

520201

California insularis HH15_ 1.532 0.318 0.519 0.268 0.774 0.756 1.2165 1.5225 0.357 0.6695 0.7485 0.3725

130101

California insularis HH15_ 1.517 0.5 0.553 0.291 0.8225 0.7745 1.182 1.4715 0.323 0.6415 0.626 0.3785

130102

California insularis HH15_ 1.513 0.46 0.488 0.281 0.754 0.72 1.2115 1.4145 0.2885 0.643 0.674 0.3965

170301

Oregon insularis HH15_ 1.519 0.397 0.537 0.258 0.75 0.7315 1.0625 1.3105 0.3155 0.5825 0.647 0.4125

400201

Oregon insularis HH15_ 1.454 0.496 0.521 0.3005 0.8145 0.7465 1.1085 1.416 0.2545 0.6085 0.613 0.432

430301

Oregon insularis HH15_ 1.391 0.37 0.457 0.2295 0.722 0.6695 1.047 1.294 0.26 0.578 0.616 0.484

430302

73 Appendix F

Wing Landmark-Based Morphometric Analysis Data (.tps file)

LM=18 2820.00000 2079.00000 1771.00000 1772.00000 1918.00000 1662.00000 2156.00000 1694.00000 2360.00000 1783.00000 2530.00000 1548.00000 2441.00000 1502.00000 2132.00000 1501.00000 1869.00000 1417.00000 1698.00000 1496.00000 1459.00000 1516.00000 915.00000 1060.00000 1601.00000 1180.00000 1712.00000 1000.00000 2276.00000 1197.00000 1706.00000 858.00000 987.00000 904.00000 971.00000 1027.00000 IMAGE=ON_oxford_fla.jpg ID=0 SCALE=0.002924 LM=18 2685.00000 2027.00000 1625.00000 1601.00000 1779.00000 1504.00000 1973.00000 1540.00000 2188.00000 1661.00000 2396.00000 1437.00000 2311.00000 1385.00000 1938.00000 1349.00000 1697.00000 1243.00000 1532.00000 1327.00000 1301.00000 1325.00000 720.00000 790.00000 1452.00000 974.00000 1574.00000 789.00000 2132.00000 1066.00000 1593.00000 663.00000 825.00000 633.00000 805.00000 749.00000 IMAGE=ON_stockton_fla.jpg ID=1 SCALE=0.002924 LM=18 2822.00000 2133.00000 1833.00000 1647.00000 1985.00000 1578.00000 2211.00000 1650.00000 2421.00000 1791.00000 2604.00000 1560.00000 2544.00000 1505.00000 2222.00000 1449.00000 1982.00000 1329.00000 1822.00000 1382.00000 1577.00000 1392.00000 1060.00000 842.00000 1750.00000 1046.00000 1859.00000 880.00000 2388.00000 1172.00000 1863.00000 737.00000 1160.00000 662.00000 1112.00000 811.00000 IMAGE=PA001_fla.jpg ID=2 SCALE=0.002924 LM=18 2613.00000 1926.00000 1644.00000 1469.00000 1765.00000 1389.00000 1985.00000 1444.00000 2188.00000 1564.00000 2409.00000 1353.00000 2323.00000 1285.00000 1990.00000 1236.00000 1755.00000 1125.00000 1596.00000 1201.00000 1379.00000 1211.00000 878.00000 673.00000 1554.00000 878.00000 1660.00000 715.00000 2183.00000 975.00000 1652.00000 573.00000 979.00000 492.00000 956.00000 644.00000 IMAGE=PA002_fla.jpg ID=3 SCALE=0.002924 LM=18 2938.00000 1757.00000 1803.00000 1643.00000 1918.00000 1526.00000 2155.00000 1504.00000 2376.00000 1550.00000 2537.00000 1287.00000 2435.00000 1256.00000 2098.00000 1319.00000 1823.00000 1287.00000 1700.00000 1397.00000 1459.00000 1480.00000 787.00000 1140.00000 1556.00000 1111.00000 1617.00000 910.00000 2219.00000 995.00000 1581.00000 791.00000 863.00000 952.00000 873.00000 1088.00000 IMAGE=PA003_fla.jpg ID=4 SCALE=0.002924 LM=18 2700.00000 1963.00000 1637.00000 1588.00000 1775.00000 1502.00000 1990.00000 1539.00000 2205.00000 1639.00000 2383.00000 1405.00000 2312.00000 1358.00000 1981.00000 1337.00000 1725.00000 1259.00000 1569.00000 1341.00000 1329.00000 1348.00000 720.00000 899.00000 1459.00000 1018.00000 1557.00000 830.00000 2156.00000 1032.00000 1538.00000 701.00000 806.00000 706.00000 805.00000 854.00000 IMAGE=PA004_fla.jpg ID=5 SCALE=0.002924 LM=18 2690.00000 1946.00000 1668.00000 1469.00000 1822.00000 1377.00000 2056.00000 1434.00000 2218.00000 1541.00000 2463.00000 1355.00000 2388.00000 1288.00000 2060.00000 1229.00000 1837.00000 1105.00000 1613.00000 1176.00000 1369.00000 1163.00000 850.00000 577.00000 1569.00000 814.00000 1702.00000 638.00000 2256.00000 946.00000 1721.00000 502.00000 969.00000 418.00000 931.00000 553.00000 IMAGE=PA005_fla.jpg ID=6 SCALE=0.002924 LM=18 2813.00000 1855.00000 1730.00000 1574.00000 1893.00000 1462.00000 2095.00000 1480.00000 2316.00000 1566.00000 2501.00000 1324.00000 2415.00000 1283.00000 2058.00000 1291.00000 1801.00000 1216.00000 1664.00000 1304.00000 1399.00000 1317.00000 799.00000 894.00000 1526.00000 983.00000 1632.00000 793.00000 2198.00000 971.00000 1609.00000 658.00000 909.00000 725.00000 881.00000 854.00000 IMAGE=PA006_fla.jpg ID=7 SCALE=0.002923 LM=18 2791.00000 2036.00000 1799.00000 1594.00000 1946.00000 1513.00000

74 2154.00000 1561.00000 2359.00000 1678.00000 2570.00000 1456.00000 2506.00000 1413.00000 2151.00000 1361.00000 1914.00000 1251.00000 1762.00000 1325.00000 1518.00000 1333.00000 975.00000 819.00000 1672.00000 991.00000 1794.00000 826.00000 2359.00000 1076.00000 1805.00000 679.00000 1060.00000 651.00000 1058.00000 787.00000 IMAGE=PA007_fla.jpg ID=8 SCALE=0.002924 LM=18 2821.00000 2112.00000 1797.00000 1675.00000 1929.00000 1581.00000 2164.00000 1637.00000 2337.00000 1734.00000 2545.00000 1516.00000 2456.00000 1462.00000 2171.00000 1442.00000 1898.00000 1321.00000 1732.00000 1380.00000 1508.00000 1376.00000 951.00000 844.00000 1654.00000 1040.00000 1769.00000 882.00000 2333.00000 1139.00000 1761.00000 753.00000 1038.00000 682.00000 1022.00000 814.00000 IMAGE=PA008_fla.jpg ID=9 SCALE=0.002924 LM=18 2690.00000 1935.00000 1598.00000 1705.00000 1741.00000 1581.00000 1971.00000 1580.00000 2210.00000 1674.00000 2385.00000 1392.00000 2293.00000 1350.00000 1934.00000 1388.00000 1662.00000 1313.00000 1501.00000 1433.00000 1253.00000 1480.00000 615.00000 1073.00000 1364.00000 1120.00000 1477.00000 928.00000 2088.00000 1070.00000 1445.00000 789.00000 710.00000 888.00000 698.00000 1030.00000 IMAGE=PA009_fla.jpg ID=10 SCALE=0.002924 LM=18 2827.00000 2080.00000 1781.00000 1755.00000 1902.00000 1659.00000 2134.00000 1693.00000 2355.00000 1794.00000 2538.00000 1553.00000 2484.00000 1516.00000 2115.00000 1501.00000 1866.00000 1418.00000 1705.00000 1500.00000 1479.00000 1528.00000 901.00000 1087.00000 1609.00000 1199.00000 1718.00000 1020.00000 2299.00000 1219.00000 1697.00000 890.00000 1002.00000 914.00000 1004.00000 1045.00000 IMAGE=PA011_fla.jpg ID=11 SCALE=0.002924 LM=18 2775.00000 1884.00000 1645.00000 1722.00000 1802.00000 1595.00000 2007.00000 1590.00000 2231.00000 1647.00000 2388.00000 1374.00000 2309.00000 1344.00000 1963.00000 1389.00000 1713.00000 1341.00000 1554.00000 1452.00000 1285.00000 1497.00000 652.00000 1148.00000 1411.00000 1131.00000 1485.00000 932.00000 2104.00000 1051.00000 1447.00000 797.00000 749.00000 940.00000 726.00000 1093.00000 IMAGE=PA012_fla.jpg ID=12 SCALE=0.002923 LM=18 2953.00000 1962.00000 1795.00000 1830.00000 1910.00000 1687.00000 2148.00000 1671.00000 2388.00000 1733.00000 2525.00000 1446.00000 2439.00000 1416.00000 2071.00000 1474.00000 1818.00000 1438.00000 1657.00000 1564.00000 1393.00000 1625.00000 750.00000 1268.00000 1497.00000 1247.00000 1582.00000 1031.00000 2208.00000 1132.00000 1556.00000 916.00000 837.00000 1066.00000 846.00000 1207.00000 IMAGE=PA013_fla.jpg ID=13 SCALE=0.002924 LM=18 4532.00000 3016.00000 3216.00000 2528.00000 3429.00000 2421.00000 3738.00000 2502.00000 4009.00000 2645.00000 4239.00000 2336.00000 4115.00000 2257.00000 3730.00000 2241.00000 3355.00000 2110.00000 3188.00000 2203.00000 2872.00000 2202.00000 2148.00000 1558.00000 3044.00000 1763.00000 3201.00000 1537.00000 3930.00000 1843.00000 3194.00000 1345.00000 2287.00000 1320.00000 2227.00000 1514.00000 IMAGE=bend_or_hh27301.jpg ID=0 SCALE=0.002604 LM=18 4418.00000 2955.00000 3083.00000 2669.00000 3254.00000 2529.00000 3524.00000 2544.00000 3782.00000 2629.00000 3994.00000 2322.00000 3889.00000 2277.00000 3488.00000 2310.00000 3131.00000 2274.00000 3013.00000 2384.00000 2697.00000 2445.00000 1872.00000 1962.00000 2775.00000 1993.00000 2883.00000 1757.00000 3633.00000 1947.00000 2869.00000 1591.00000 1961.00000 1782.00000 1961.00000 1906.00000 IMAGE=bend_or_hh27302.jpg ID=1 SCALE=0.002604 LM=18 4432.00000 2862.00000 3056.00000 2649.00000 3193.00000 2507.00000 3476.00000 2496.00000 3748.00000 2574.00000 3945.00000 2255.00000 3835.00000 2214.00000 3417.00000 2263.00000 3068.00000 2208.00000 2891.00000 2347.00000 2614.00000 2413.00000 1754.00000 1933.00000 2651.00000 1963.00000 2770.00000 1709.00000 3537.00000 1871.00000 2748.00000 1536.00000 1814.00000 1704.00000 1805.00000 1883.00000 IMAGE=bend_or_hh27303.jpg ID=2 SCALE=0.002604 LM=18 4305.00000 2886.00000 2993.00000 2537.00000 3170.00000 2409.00000 3433.00000

75 2437.00000 3683.00000 2533.00000 3885.00000 2234.00000 3779.00000 2183.00000 3394.00000 2196.00000 3035.00000 2104.00000 2893.00000 2218.00000 2593.00000 2248.00000 1854.00000 1724.00000 2712.00000 1829.00000 2859.00000 1615.00000 3546.00000 1827.00000 2830.00000 1440.00000 1959.00000 1512.00000 1933.00000 1673.00000 IMAGE=bend_or_hh27304.jpg ID=3 SCALE=0.002604 LM=18 4384.00000 3032.00000 3121.00000 2628.00000 3292.00000 2509.00000 3571.00000 2550.00000 3811.00000 2660.00000 4061.00000 2373.00000 3963.00000 2321.00000 3568.00000 2317.00000 3226.00000 2198.00000 3025.00000 2318.00000 2700.00000 2333.00000 1978.00000 1788.00000 2896.00000 1908.00000 3019.00000 1694.00000 3715.00000 1954.00000 3014.00000 1546.00000 2091.00000 1599.00000 2060.00000 1742.00000 IMAGE=bend_or_hh27305.jpg ID=4 SCALE=0.002604 LM=18 3950.00000 2747.00000 2754.00000 2393.00000 2912.00000 2280.00000 3168.00000 2322.00000 3423.00000 2434.00000 3627.00000 2182.00000 3520.00000 2128.00000 3134.00000 2108.00000 2840.00000 2016.00000 2672.00000 2102.00000 2419.00000 2110.00000 1783.00000 1585.00000 2556.00000 1726.00000 2693.00000 1547.00000 3342.00000 1784.00000 2680.00000 1407.00000 1894.00000 1414.00000 1852.00000 1552.00000 IMAGE=bluemts_or_400101.jpg ID=5 SCALE=0.002604 LM=18 4406.00000 2568.00000 3165.00000 2383.00000 3301.00000 2240.00000 3537.00000 2233.00000 3832.00000 2327.00000 4007.00000 2016.00000 3882.00000 1969.00000 3468.00000 2030.00000 3172.00000 1985.00000 3040.00000 2100.00000 2770.00000 2168.00000 2043.00000 1764.00000 2853.00000 1768.00000 2950.00000 1555.00000 3665.00000 1696.00000 2918.00000 1401.00000 2090.00000 1554.00000 2089.00000 1717.00000 IMAGE=bluemts_or_400102.jpg ID=6 SCALE=0.002604 LM=18 4155.00000 2973.00000 2916.00000 2501.00000 3092.00000 2401.00000 3365.00000 2475.00000 3612.00000 2608.00000 3853.00000 2329.00000 3758.00000 2269.00000 3368.00000 2231.00000 3050.00000 2116.00000 2849.00000 2204.00000 2584.00000 2206.00000 1877.00000 1613.00000 2737.00000 1800.00000 2863.00000 1591.00000 3563.00000 1874.00000 2861.00000 1446.00000 2012.00000 1410.00000 1956.00000 1571.00000 IMAGE=bluemts_or_hh420101.jpg ID=7 SCALE=0.002604 LM=18 4363.00000 2761.00000 3032.00000 2529.00000 3195.00000 2398.00000 3449.00000 2411.00000 3744.00000 2495.00000 3916.00000 2174.00000 3807.00000 2133.00000 3386.00000 2174.00000 3080.00000 2121.00000 2924.00000 2251.00000 2631.00000 2297.00000 1902.00000 1871.00000 2727.00000 1898.00000 2832.00000 1652.00000 3542.00000 1821.00000 2797.00000 1489.00000 1948.00000 1654.00000 1946.00000 1824.00000 IMAGE=bluemts_or_hh420102.jpg ID=8 SCALE=0.002604 LM=18 4108.00000 2904.00000 2839.00000 2497.00000 3018.00000 2395.00000 3262.00000 2434.00000 3539.00000 2566.00000 3777.00000 2269.00000 3660.00000 2207.00000 3283.00000 2204.00000 2959.00000 2094.00000 2782.00000 2195.00000 2476.00000 2206.00000 1792.00000 1642.00000 2646.00000 1784.00000 2772.00000 1571.00000 3463.00000 1849.00000 2762.00000 1403.00000 1908.00000 1433.00000 1881.00000 1590.00000 IMAGE=bluemts_or_hh420103.jpg ID=9 SCALE=0.002604 LM=18 4499.00000 2638.00000 3191.00000 2523.00000 3334.00000 2380.00000 3646.00000 2367.00000 3830.00000 2410.00000 3998.00000 2115.00000 3878.00000 2081.00000 3558.00000 2149.00000 3181.00000 2113.00000 3025.00000 2249.00000 2740.00000 2329.00000 1905.00000 1927.00000 2805.00000 1886.00000 2898.00000 1641.00000 3607.00000 1760.00000 2837.00000 1504.00000 1963.00000 1715.00000 1966.00000 1872.00000 IMAGE=ghm_or_hh260301.jpg ID=10 SCALE=0.002604 LM=18 4526.00000 2952.00000 3193.00000 2707.00000 3352.00000 2582.00000 3623.00000 2594.00000 3915.00000 2675.00000 4100.00000 2371.00000 3990.00000 2316.00000 3576.00000 2346.00000 3214.00000 2290.00000 3082.00000 2398.00000 2826.00000 2448.00000 2018.00000 1954.00000 2888.00000 2005.00000 3000.00000 1775.00000 3726.00000 1952.00000 2967.00000 1585.00000 2061.00000 1703.00000 2078.00000 1898.00000

76 IMAGE=ghm_or_hh260302.jpg ID=11 SCALE=0.002604 LM=18 4371.00000 2929.00000 3085.00000 2622.00000 3217.00000 2507.00000 3547.00000 2525.00000 3821.00000 2633.00000 3991.00000 2344.00000 3886.00000 2292.00000 3502.00000 2304.00000 3189.00000 2228.00000 2975.00000 2346.00000 2699.00000 2381.00000 1970.00000 1916.00000 2855.00000 1990.00000 2956.00000 1766.00000 3670.00000 1958.00000 2934.00000 1632.00000 2089.00000 1726.00000 2071.00000 1868.00000 IMAGE=ghm_or_hh260303.jpg ID=12 SCALE=0.002604 LM=18 4347.00000 2796.00000 3052.00000 2516.00000 3196.00000 2375.00000 3468.00000 2398.00000 3735.00000 2490.00000 3919.00000 2160.00000 3851.00000 2124.00000 3402.00000 2147.00000 3112.00000 2081.00000 2911.00000 2213.00000 2651.00000 2251.00000 1883.00000 1795.00000 2754.00000 1827.00000 2864.00000 1590.00000 3551.00000 1757.00000 2840.00000 1442.00000 1987.00000 1574.00000 1968.00000 1738.00000 IMAGE=ghm_or_hh260304.jpg ID=13 SCALE=0.002604 LM=18 4553.00000 2793.00000 3258.00000 2550.00000 3404.00000 2430.00000 3641.00000 2436.00000 3899.00000 2515.00000 4088.00000 2228.00000 3985.00000 2185.00000 3578.00000 2233.00000 3290.00000 2166.00000 3112.00000 2289.00000 2886.00000 2334.00000 2165.00000 1888.00000 2946.00000 1966.00000 3053.00000 1747.00000 3731.00000 1900.00000 3028.00000 1591.00000 2264.00000 1741.00000 2229.00000 1845.00000 IMAGE=ghm_or_hh260305.jpg ID=14 SCALE=0.002604 LM=18 4461.00000 2657.00000 3078.00000 2518.00000 3232.00000 2375.00000 3546.00000 2364.00000 3820.00000 2427.00000 3979.00000 2080.00000 3847.00000 2048.00000 3470.00000 2127.00000 3092.00000 2095.00000 2934.00000 2230.00000 2640.00000 2305.00000 1825.00000 1898.00000 2698.00000 1873.00000 2791.00000 1642.00000 3546.00000 1735.00000 2717.00000 1484.00000 1878.00000 1671.00000 1883.00000 1846.00000 IMAGE=ghm_or_hh260306.jpg ID=15 SCALE=0.002604 LM=18 4192.00000 2746.00000 2889.00000 2586.00000 3023.00000 2450.00000 3269.00000 2442.00000 3547.00000 2504.00000 3707.00000 2197.00000 3583.00000 2157.00000 3194.00000 2226.00000 2872.00000 2198.00000 2763.00000 2313.00000 2462.00000 2397.00000 1673.00000 2024.00000 2527.00000 1994.00000 2602.00000 1760.00000 3332.00000 1869.00000 2580.00000 1613.00000 1748.00000 1815.00000 1736.00000 1971.00000 IMAGE=ghm_or_hh260307.jpg ID=16 SCALE=0.002604 LM=18 4445.00000 2916.00000 3167.00000 2644.00000 3339.00000 2503.00000 3569.00000 2518.00000 3812.00000 2610.00000 4024.00000 2337.00000 3899.00000 2275.00000 3548.00000 2312.00000 3222.00000 2232.00000 3071.00000 2344.00000 2821.00000 2376.00000 2091.00000 1899.00000 2925.00000 1989.00000 3039.00000 1769.00000 3735.00000 1966.00000 3012.00000 1622.00000 2183.00000 1706.00000 2164.00000 1846.00000 IMAGE=ghm_or_hh260308.jpg ID=17 SCALE=0.002604 LM=18 4500.00000 2863.00000 3190.00000 2592.00000 3344.00000 2455.00000 3619.00000 2478.00000 3860.00000 2556.00000 4052.00000 2255.00000 3960.00000 2210.00000 3548.00000 2246.00000 3237.00000 2181.00000 3071.00000 2296.00000 2776.00000 2333.00000 1991.00000 1868.00000 2889.00000 1929.00000 2981.00000 1706.00000 3693.00000 1880.00000 2957.00000 1558.00000 2102.00000 1666.00000 2090.00000 1820.00000 IMAGE=ghm_or_hh260309.jpg ID=18 SCALE=0.002604 LM=18 4417.00000 2855.00000 3084.00000 2572.00000 3248.00000 2432.00000 3543.00000 2446.00000 3790.00000 2535.00000 4002.00000 2236.00000 3886.00000 2190.00000 3480.00000 2215.00000 3151.00000 2138.00000 2957.00000 2277.00000 2702.00000 2318.00000 1934.00000 1830.00000 2783.00000 1884.00000 2908.00000 1657.00000 3660.00000 1834.00000 2879.00000 1501.00000 1997.00000 1614.00000 1985.00000 1787.00000 IMAGE=ghm_or_hh260310.jpg ID=19 SCALE=0.002604 LM=18 4462.00000 2950.00000 3117.00000 2698.00000 3322.00000 2542.00000 3621.00000 2575.00000 3897.00000 2677.00000 4081.00000 2335.00000 3968.00000 2287.00000 3603.00000 2322.00000 3231.00000 2246.00000 3070.00000 2385.00000 2757.00000 2421.00000 1966.00000 1919.00000 2854.00000

77 1966.00000 2959.00000 1739.00000 3731.00000 1945.00000 2925.00000 1603.00000 2027.00000 1706.00000 2015.00000 1876.00000 IMAGE=ghm_or_hh260311.jpg ID=20 SCALE=0.002604 LM=18 4484.00000 2945.00000 3179.00000 2610.00000 3343.00000 2490.00000 3583.00000 2511.00000 3860.00000 2611.00000 4019.00000 2328.00000 3933.00000 2288.00000 3557.00000 2299.00000 3234.00000 2203.00000 3084.00000 2328.00000 2793.00000 2351.00000 2067.00000 1847.00000 2892.00000 1936.00000 3001.00000 1728.00000 3707.00000 1966.00000 3003.00000 1563.00000 2175.00000 1647.00000 2140.00000 1804.00000 IMAGE=ghm_or_hh260312.jpg ID=21 SCALE=0.002604 LM=18 4596.00000 2583.00000 3237.00000 2346.00000 3409.00000 2212.00000 3686.00000 2219.00000 3968.00000 2306.00000 4146.00000 1976.00000 4043.00000 1935.00000 3651.00000 1988.00000 3301.00000 1909.00000 3102.00000 2056.00000 2821.00000 2108.00000 1974.00000 1639.00000 2903.00000 1668.00000 3032.00000 1434.00000 3751.00000 1586.00000 2977.00000 1264.00000 2039.00000 1431.00000 2025.00000 1595.00000 IMAGE=ghm_or_hh260313.jpg ID=22 SCALE=0.002604 LM=18 4476.00000 2877.00000 3139.00000 2676.00000 3281.00000 2537.00000 3529.00000 2534.00000 3846.00000 2621.00000 3990.00000 2322.00000 3868.00000 2283.00000 3480.00000 2330.00000 3162.00000 2287.00000 3056.00000 2380.00000 2723.00000 2449.00000 1958.00000 2041.00000 2751.00000 2046.00000 2846.00000 1834.00000 3597.00000 1959.00000 2825.00000 1687.00000 2009.00000 1829.00000 1997.00000 1996.00000 IMAGE=ghm_or_hh260314.jpg ID=23 SCALE=0.002604 LM=18 4341.00000 3074.00000 3057.00000 2552.00000 3247.00000 2460.00000 3512.00000 2517.00000 3788.00000 2667.00000 4021.00000 2393.00000 3898.00000 2306.00000 3518.00000 2267.00000 3215.00000 2143.00000 3006.00000 2244.00000 2729.00000 2243.00000 2077.00000 1631.00000 2871.00000 1824.00000 3029.00000 1611.00000 3739.00000 1931.00000 3040.00000 1453.00000 2185.00000 1432.00000 2140.00000 1595.00000 IMAGE=ghm_or_hh260315.jpg ID=24 SCALE=0.002604 LM=18 4405.00000 2740.00000 3033.00000 2561.00000 3180.00000 2419.00000 3489.00000 2416.00000 3735.00000 2479.00000 3933.00000 2162.00000 3819.00000 2123.00000 3430.00000 2184.00000 3039.00000 2134.00000 2862.00000 2275.00000 2592.00000 2351.00000 1716.00000 1886.00000 2672.00000 1892.00000 2781.00000 1650.00000 3526.00000 1793.00000 2716.00000 1494.00000 1848.00000 1647.00000 1817.00000 1821.00000 IMAGE=ghm_or_hh260316.jpg ID=25 SCALE=0.002604 LM=18 4428.00000 2928.00000 3122.00000 2767.00000 3267.00000 2638.00000 3535.00000 2630.00000 3856.00000 2702.00000 3998.00000 2363.00000 3891.00000 2329.00000 3495.00000 2386.00000 3134.00000 2341.00000 2976.00000 2485.00000 2719.00000 2552.00000 1915.00000 2162.00000 2785.00000 2138.00000 2886.00000 1898.00000 3589.00000 2014.00000 2842.00000 1763.00000 1986.00000 1953.00000 1990.00000 2109.00000 IMAGE=ghm_or_hh260317.jpg ID=26 SCALE=0.002604 LM=18 4196.00000 3059.00000 2996.00000 2491.00000 3176.00000 2383.00000 3428.00000 2455.00000 3657.00000 2596.00000 3951.00000 2335.00000 3852.00000 2267.00000 3436.00000 2193.00000 3119.00000 2051.00000 2914.00000 2143.00000 2620.00000 2128.00000 1978.00000 1499.00000 2809.00000 1725.00000 2993.00000 1511.00000 3696.00000 1864.00000 2992.00000 1343.00000 2090.00000 1307.00000 2054.00000 1466.00000 IMAGE=ghm_or_hh260318.jpg ID=27 SCALE=0.002604 LM=18 4440.00000 2635.00000 3172.00000 2392.00000 3322.00000 2262.00000 3582.00000 2271.00000 3843.00000 2351.00000 4026.00000 2033.00000 3914.00000 1987.00000 3524.00000 2027.00000 3171.00000 1970.00000 3045.00000 2086.00000 2790.00000 2149.00000 1973.00000 1662.00000 2844.00000 1712.00000 2940.00000 1478.00000 3676.00000 1648.00000 2914.00000 1310.00000 2100.00000 1422.00000 2048.00000 1605.00000 IMAGE=ghm_or_hh260319.jpg ID=28 SCALE=0.002604 LM=18 4400.00000 2929.00000 3097.00000 2813.00000 3237.00000 2668.00000 3487.00000 2655.00000 3771.00000 2710.00000 3895.00000 2393.00000 3783.00000

78 2358.00000 3403.00000 2439.00000 3073.00000 2417.00000 2946.00000 2553.00000 2669.00000 2624.00000 1887.00000 2260.00000 2731.00000 2216.00000 2820.00000 1981.00000 3526.00000 2064.00000 2790.00000 1794.00000 1956.00000 2033.00000 1941.00000 2202.00000 IMAGE=ghm_or_hh260320.jpg ID=29 SCALE=0.002604 LM=18 4296.00000 2915.00000 2989.00000 2583.00000 3142.00000 2467.00000 3419.00000 2490.00000 3707.00000 2599.00000 3851.00000 2296.00000 3739.00000 2248.00000 3387.00000 2266.00000 3033.00000 2192.00000 2877.00000 2295.00000 2612.00000 2316.00000 1841.00000 1826.00000 2688.00000 1921.00000 2816.00000 1706.00000 3525.00000 1903.00000 2792.00000 1550.00000 1910.00000 1632.00000 1880.00000 1787.00000 IMAGE=ghm_or_hh260321.jpg ID=30 SCALE=0.002604 LM=18 4273.00000 2935.00000 2986.00000 2780.00000 3155.00000 2632.00000 3430.00000 2625.00000 3637.00000 2677.00000 3830.00000 2376.00000 3713.00000 2344.00000 3347.00000 2400.00000 2981.00000 2363.00000 2836.00000 2489.00000 2559.00000 2551.00000 1799.00000 2137.00000 2604.00000 2129.00000 2711.00000 1901.00000 3425.00000 2017.00000 2682.00000 1764.00000 1855.00000 1938.00000 1853.00000 2092.00000 IMAGE=ghm_or_hh260322.jpg ID=31 SCALE=0.002604 LM=18 4467.00000 2837.00000 3146.00000 2565.00000 3334.00000 2434.00000 3597.00000 2454.00000 3868.00000 2547.00000 4050.00000 2231.00000 3941.00000 2190.00000 3530.00000 2221.00000 3195.00000 2160.00000 3044.00000 2278.00000 2725.00000 2318.00000 1992.00000 1808.00000 2860.00000 1879.00000 2980.00000 1653.00000 3691.00000 1868.00000 2957.00000 1503.00000 2079.00000 1598.00000 2079.00000 1758.00000 IMAGE=ghm_or_hh260323.jpg ID=32 SCALE=0.002604 LM=18 4458.00000 2840.00000 3177.00000 2486.00000 3364.00000 2365.00000 3617.00000 2400.00000 3899.00000 2523.00000 4088.00000 2214.00000 3989.00000 2160.00000 3588.00000 2160.00000 3264.00000 2076.00000 3088.00000 2192.00000 2799.00000 2231.00000 2060.00000 1654.00000 2931.00000 1774.00000 3041.00000 1555.00000 3758.00000 1811.00000 3010.00000 1390.00000 2140.00000 1451.00000 2126.00000 1610.00000 IMAGE=ghm_or_hh260324.jpg ID=33 SCALE=0.002604 LM=18 4526.00000 3010.00000 3254.00000 2575.00000 3424.00000 2466.00000 3708.00000 2506.00000 3944.00000 2618.00000 4190.00000 2342.00000 4058.00000 2275.00000 3697.00000 2277.00000 3355.00000 2157.00000 3151.00000 2272.00000 2872.00000 2287.00000 2146.00000 1711.00000 3018.00000 1857.00000 3157.00000 1632.00000 3858.00000 1901.00000 3157.00000 1472.00000 2254.00000 1505.00000 2241.00000 1664.00000 IMAGE=ghm_or_hh260326.jpg ID=34 SCALE=0.002604 LM=18 4455.00000 2555.00000 3186.00000 2457.00000 3326.00000 2310.00000 3565.00000 2294.00000 3814.00000 2339.00000 3992.00000 2030.00000 3866.00000 1994.00000 3508.00000 2081.00000 3171.00000 2054.00000 3045.00000 2186.00000 2792.00000 2271.00000 1972.00000 1906.00000 2834.00000 1855.00000 2909.00000 1628.00000 3598.00000 1703.00000 2849.00000 1467.00000 2051.00000 1693.00000 2073.00000 1841.00000 IMAGE=ghm_or_hh260327.jpg ID=35 SCALE=0.002604 LM=18 4192.00000 3210.00000 2825.00000 2564.00000 3068.00000 2469.00000 3398.00000 2576.00000 3614.00000 2722.00000 3905.00000 2414.00000 3802.00000 2339.00000 3428.00000 2299.00000 3041.00000 2131.00000 2813.00000 2215.00000 2473.00000 2174.00000 1786.00000 1403.00000 2698.00000 1696.00000 2882.00000 1478.00000 3589.00000 1868.00000 2879.00000 1273.00000 1899.00000 1181.00000 1836.00000 1367.00000 IMAGE=ghm_or_hh260328.jpg ID=36 SCALE=0.002604 LM=18 4438.00000 2625.00000 3079.00000 2398.00000 3254.00000 2259.00000 3514.00000 2270.00000 3761.00000 2342.00000 3945.00000 2025.00000 3829.00000 1982.00000 3445.00000 2037.00000 3119.00000 1989.00000 2983.00000 2106.00000 2716.00000 2168.00000 1916.00000 1740.00000 2757.00000 1757.00000 2856.00000 1535.00000 3560.00000 1659.00000 2829.00000 1369.00000 1968.00000 1534.00000 1961.00000 1695.00000 IMAGE=gmh_or_hh260325.jpg ID=37 SCALE=0.002604 LM=18 4193.00000

79 2946.00000 2935.00000 2594.00000 3101.00000 2481.00000 3355.00000 2505.00000 3603.00000 2602.00000 3846.00000 2296.00000 3738.00000 2241.00000 3313.00000 2243.00000 2990.00000 2160.00000 2819.00000 2283.00000 2572.00000 2328.00000 1793.00000 1795.00000 2668.00000 1880.00000 2774.00000 1664.00000 3511.00000 1862.00000 2756.00000 1492.00000 1893.00000 1608.00000 1877.00000 1740.00000 IMAGE=govcamp_or_hh340401.jpg ID=38 SCALE=0.002604 LM=18 4535.00000 2731.00000 3212.00000 2518.00000 3374.00000 2371.00000 3678.00000 2360.00000 3926.00000 2437.00000 4097.00000 2124.00000 3981.00000 2091.00000 3602.00000 2137.00000 3206.00000 2073.00000 3058.00000 2202.00000 2763.00000 2274.00000 1910.00000 1827.00000 2834.00000 1875.00000 2937.00000 1627.00000 3701.00000 1741.00000 2890.00000 1455.00000 2000.00000 1626.00000 1979.00000 1780.00000 IMAGE=govcamp_or_hh340402.jpg ID=39 SCALE=0.002604 LM=18 4465.00000 2590.00000 3143.00000 2501.00000 3302.00000 2349.00000 3578.00000 2329.00000 3842.00000 2385.00000 4017.00000 2061.00000 3895.00000 2032.00000 3491.00000 2120.00000 3132.00000 2081.00000 3005.00000 2217.00000 2737.00000 2313.00000 1905.00000 1919.00000 2764.00000 1895.00000 2839.00000 1654.00000 3569.00000 1735.00000 2791.00000 1516.00000 1944.00000 1713.00000 1942.00000 1877.00000 IMAGE=govcamp_or_hh340403.jpg ID=40 SCALE=0.002604 LM=18 4544.00000 2770.00000 3252.00000 2597.00000 3412.00000 2455.00000 3653.00000 2451.00000 3898.00000 2521.00000 4083.00000 2218.00000 3984.00000 2190.00000 3575.00000 2232.00000 3260.00000 2183.00000 3106.00000 2316.00000 2832.00000 2381.00000 2083.00000 1999.00000 2924.00000 1985.00000 3009.00000 1736.00000 3723.00000 1875.00000 2975.00000 1599.00000 2180.00000 1785.00000 2173.00000 1943.00000 IMAGE=hellscanyon_or_h430201.jpg ID=41 SCALE=0.002604 LM=18 4390.00000 2658.00000 3102.00000 2492.00000 3266.00000 2345.00000 3536.00000 2343.00000 3763.00000 2398.00000 3990.00000 2095.00000 3870.00000 2053.00000 3449.00000 2119.00000 3130.00000 2081.00000 2989.00000 2214.00000 2708.00000 2292.00000 1889.00000 1868.00000 2728.00000 1870.00000 2823.00000 1626.00000 3584.00000 1761.00000 2800.00000 1469.00000 1970.00000 1660.00000 1947.00000 1816.00000 IMAGE=hellscanyon_or_h430202.jpg ID=42 SCALE=0.002604 LM=18 4044.00000 2846.00000 2839.00000 2515.00000 3009.00000 2399.00000 3250.00000 2435.00000 3476.00000 2524.00000 3685.00000 2261.00000 3587.00000 2210.00000 3239.00000 2214.00000 2920.00000 2131.00000 2790.00000 2216.00000 2491.00000 2253.00000 1811.00000 1829.00000 2609.00000 1893.00000 2721.00000 1695.00000 3410.00000 1892.00000 2681.00000 1533.00000 1887.00000 1632.00000 1854.00000 1783.00000 IMAGE=hellscanyon_or_h430203.jpg ID=43 SCALE=0.002604 LM=18 4165.00000 2720.00000 2955.00000 2374.00000 3124.00000 2264.00000 3354.00000 2289.00000 3657.00000 2410.00000 3857.00000 2126.00000 3751.00000 2078.00000 3308.00000 2053.00000 3062.00000 1977.00000 2883.00000 2085.00000 2617.00000 2130.00000 1894.00000 1628.00000 2738.00000 1731.00000 2854.00000 1506.00000 3529.00000 1735.00000 2830.00000 1359.00000 1988.00000 1430.00000 1962.00000 1582.00000 IMAGE=hellscanyon_or_h430204.jpg ID=44 SCALE=0.002604 LM=18 3876.00000 2798.00000 2609.00000 2460.00000 2767.00000 2348.00000 3042.00000 2371.00000 3295.00000 2468.00000 3514.00000 2179.00000 3420.00000 2133.00000 3025.00000 2141.00000 2675.00000 2051.00000 2506.00000 2151.00000 2238.00000 2190.00000 1509.00000 1679.00000 2347.00000 1785.00000 2480.00000 1574.00000 3168.00000 1800.00000 2451.00000 1415.00000 1611.00000 1487.00000 1588.00000 1636.00000 IMAGE=lostine_or_hh470501.jpg ID=45 SCALE=0.002604 LM=18 4187.00000 2817.00000 3068.00000 2581.00000 3196.00000 2469.00000 3392.00000 2468.00000 3681.00000 2564.00000 3819.00000 2270.00000 3733.00000 2233.00000 3357.00000 2260.00000 3082.00000 2198.00000 2947.00000 2306.00000 2690.00000 2350.00000 2013.00000 1921.00000 2762.00000 1964.00000 2852.00000 1758.00000 3500.00000 1897.00000 2831.00000

80 1609.00000 2077.00000 1729.00000 2068.00000 1882.00000 IMAGE=lostine_or_hh470502.jpg ID=46 SCALE=0.002604 LM=18 4474.00000 2865.00000 3207.00000 2710.00000 3351.00000 2582.00000 3593.00000 2579.00000 3839.00000 2628.00000 4029.00000 2306.00000 3931.00000 2272.00000 3530.00000 2347.00000 3238.00000 2304.00000 3071.00000 2439.00000 2811.00000 2512.00000 2088.00000 2160.00000 2872.00000 2117.00000 2931.00000 1886.00000 3609.00000 1959.00000 2886.00000 1731.00000 2129.00000 1993.00000 2127.00000 2115.00000 IMAGE=lostine_or_hh470504.jpg ID=48 SCALE=0.002604 LM=18 4127.00000 3037.00000 2924.00000 2500.00000 3128.00000 2410.00000 3398.00000 2488.00000 3588.00000 2607.00000 3857.00000 2360.00000 3779.00000 2300.00000 3408.00000 2247.00000 3111.00000 2095.00000 2889.00000 2181.00000 2586.00000 2152.00000 1976.00000 1494.00000 2811.00000 1734.00000 2959.00000 1534.00000 3601.00000 1889.00000 2961.00000 1378.00000 2102.00000 1320.00000 2082.00000 1466.00000 IMAGE=lostine_or_hh470505.jpg ID=49 SCALE=0.002604 LM=18 4225.00000 2987.00000 3001.00000 2550.00000 3195.00000 2444.00000 3476.00000 2509.00000 3718.00000 2634.00000 3914.00000 2371.00000 3818.00000 2311.00000 3477.00000 2287.00000 3154.00000 2167.00000 2983.00000 2249.00000 2690.00000 2267.00000 2053.00000 1746.00000 2849.00000 1885.00000 2941.00000 1684.00000 3652.00000 1933.00000 2919.00000 1539.00000 2140.00000 1559.00000 2117.00000 1706.00000 IMAGE=malheurnf_or_hh490101.jpg ID=50 SCALE=0.002604 LM=18 4416.00000 2927.00000 3132.00000 2737.00000 3265.00000 2602.00000 3523.00000 2596.00000 3804.00000 2676.00000 3984.00000 2369.00000 3883.00000 2331.00000 3487.00000 2374.00000 3163.00000 2301.00000 2981.00000 2466.00000 2739.00000 2541.00000 1920.00000 2080.00000 2825.00000 2065.00000 2913.00000 1840.00000 3653.00000 2008.00000 2875.00000 1696.00000 2015.00000 1861.00000 2004.00000 2016.00000 IMAGE=malheurnf_or_hh490102.jpg ID=51 SCALE=0.002604 LM=18 4453.00000 2997.00000 3087.00000 2621.00000 3225.00000 2492.00000 3545.00000 2527.00000 3817.00000 2645.00000 4043.00000 2346.00000 3943.00000 2288.00000 3509.00000 2264.00000 3166.00000 2144.00000 2936.00000 2282.00000 2675.00000 2316.00000 1880.00000 1716.00000 2803.00000 1861.00000 2949.00000 1605.00000 3739.00000 1891.00000 2943.00000 1436.00000 1972.00000 1497.00000 1931.00000 1669.00000 IMAGE=mirrorlake_or_hh330402.jpg ID=52 SCALE=0.002604 LM=18 4474.00000 2759.00000 3150.00000 2483.00000 3326.00000 2341.00000 3604.00000 2351.00000 3830.00000 2431.00000 4036.00000 2128.00000 3932.00000 2083.00000 3559.00000 2114.00000 3194.00000 2033.00000 3012.00000 2166.00000 2716.00000 2218.00000 1909.00000 1716.00000 2825.00000 1778.00000 2929.00000 1527.00000 3691.00000 1728.00000 2904.00000 1376.00000 2009.00000 1499.00000 1985.00000 1672.00000 IMAGE=mirrorlake_or_hh330403.jpg ID=53 SCALE=0.002604 LM=18 4527.00000 2766.00000 3282.00000 2640.00000 3437.00000 2479.00000 3686.00000 2466.00000 3932.00000 2527.00000 4083.00000 2223.00000 3969.00000 2185.00000 3608.00000 2250.00000 3292.00000 2209.00000 3140.00000 2348.00000 2863.00000 2419.00000 2076.00000 2027.00000 2906.00000 1987.00000 2987.00000 1763.00000 3690.00000 1881.00000 2929.00000 1619.00000 2103.00000 1800.00000 2139.00000 1965.00000 IMAGE=mirrorlake_or_hh330404.jpg ID=54 SCALE=0.002604 LM=18 4502.00000 2759.00000 3215.00000 2524.00000 3386.00000 2399.00000 3645.00000 2411.00000 3900.00000 2483.00000 4079.00000 2190.00000 3993.00000 2160.00000 3603.00000 2189.00000 3305.00000 2114.00000 3116.00000 2244.00000 2836.00000 2289.00000 2074.00000 1786.00000 2935.00000 1849.00000 3010.00000 1616.00000 3758.00000 1828.00000 2986.00000 1476.00000 2141.00000 1586.00000 2142.00000 1742.00000 IMAGE=mirrorlake_or_hh330405.jpg ID=55 SCALE=0.002604 LM=18 4510.00000 2737.00000 3159.00000 2605.00000 3277.00000 2451.00000 3565.00000 2431.00000 3888.00000 2501.00000 4002.00000 2169.00000 3908.00000 2143.00000 3499.00000 2218.00000 3159.00000 2173.00000

81 2996.00000 2317.00000 2733.00000 2387.00000 1897.00000 2023.00000 2786.00000 1954.00000 2865.00000 1726.00000 3610.00000 1833.00000 2806.00000 1559.00000 1924.00000 1780.00000 1943.00000 1971.00000 IMAGE=mirrorlake_or_hh330406.jpg ID=56 SCALE=0.002604 LM=18 4432.00000 2785.00000 3116.00000 2525.00000 3253.00000 2388.00000 3525.00000 2399.00000 3789.00000 2486.00000 4014.00000 2186.00000 3899.00000 2138.00000 3468.00000 2169.00000 3182.00000 2103.00000 2988.00000 2241.00000 2719.00000 2282.00000 1975.00000 1798.00000 2837.00000 1847.00000 2943.00000 1616.00000 3676.00000 1811.00000 2919.00000 1454.00000 2059.00000 1578.00000 2038.00000 1746.00000 IMAGE=mirrorlake_or_hh330407.jpg ID=57 SCALE=0.002604 LM=18 4507.00000 2778.00000 3151.00000 2420.00000 3329.00000 2301.00000 3653.00000 2336.00000 3943.00000 2445.00000 4134.00000 2137.00000 4020.00000 2082.00000 3650.00000 2095.00000 3251.00000 2005.00000 3055.00000 2128.00000 2751.00000 2160.00000 1966.00000 1633.00000 2875.00000 1730.00000 3011.00000 1500.00000 3760.00000 1720.00000 2978.00000 1337.00000 2095.00000 1394.00000 2050.00000 1582.00000 IMAGE=mirrorlake_or_hh330408.jpg ID=58 SCALE=0.002604 LM=18 4313.00000 2803.00000 2978.00000 2479.00000 3119.00000 2368.00000 3421.00000 2383.00000 3690.00000 2475.00000 3875.00000 2183.00000 3759.00000 2121.00000 3390.00000 2154.00000 3017.00000 2079.00000 2857.00000 2186.00000 2551.00000 2215.00000 1808.00000 1746.00000 2682.00000 1811.00000 2805.00000 1587.00000 3545.00000 1780.00000 2791.00000 1425.00000 1898.00000 1567.00000 1883.00000 1697.00000 IMAGE=mtwash_or_300101.jpg ID=59 SCALE=0.002604 LM=18 4543.00000 2697.00000 3190.00000 2613.00000 3304.00000 2465.00000 3569.00000 2445.00000 3898.00000 2498.00000 4021.00000 2177.00000 3893.00000 2139.00000 3502.00000 2216.00000 3139.00000 2185.00000 3007.00000 2322.00000 2718.00000 2400.00000 1888.00000 2035.00000 2769.00000 1974.00000 2848.00000 1726.00000 3614.00000 1826.00000 2779.00000 1578.00000 1968.00000 1793.00000 1951.00000 1977.00000 IMAGE=mtwash_or_300102.jpg ID=60 SCALE=0.002604 LM=18 4388.00000 2944.00000 3121.00000 2655.00000 3286.00000 2543.00000 3537.00000 2561.00000 3797.00000 2651.00000 3967.00000 2347.00000 3845.00000 2292.00000 3473.00000 2305.00000 3183.00000 2239.00000 3005.00000 2360.00000 2708.00000 2370.00000 1999.00000 1906.00000 2834.00000 1962.00000 2942.00000 1768.00000 3624.00000 1955.00000 2903.00000 1605.00000 2077.00000 1688.00000 2061.00000 1852.00000 IMAGE=mtwash_or_300103.jpg ID=61 SCALE=0.002604 LM=18 4250.00000 2903.00000 3087.00000 2503.00000 3220.00000 2400.00000 3478.00000 2434.00000 3719.00000 2542.00000 3950.00000 2276.00000 3846.00000 2208.00000 3493.00000 2202.00000 3157.00000 2114.00000 2977.00000 2215.00000 2690.00000 2235.00000 2048.00000 1769.00000 2852.00000 1853.00000 2969.00000 1654.00000 3692.00000 1872.00000 2971.00000 1499.00000 2083.00000 1572.00000 2091.00000 1728.00000 IMAGE=mtwash_or_300104.jpg ID=62 SCALE=0.002604 LM=18 4205.00000 2919.00000 2898.00000 2518.00000 3070.00000 2379.00000 3350.00000 2429.00000 3622.00000 2547.00000 3813.00000 2247.00000 3702.00000 2183.00000 3316.00000 2180.00000 2986.00000 2099.00000 2829.00000 2216.00000 2527.00000 2226.00000 1796.00000 1655.00000 2666.00000 1787.00000 2806.00000 1561.00000 3520.00000 1814.00000 2783.00000 1374.00000 1955.00000 1417.00000 1884.00000 1605.00000 IMAGE=mtwash_or_300301.jpg ID=63 SCALE=0.002604 LM=18 4388.00000 2834.00000 3195.00000 2577.00000 3351.00000 2468.00000 3616.00000 2480.00000 3845.00000 2552.00000 4009.00000 2244.00000 3941.00000 2213.00000 3588.00000 2236.00000 3248.00000 2191.00000 3086.00000 2307.00000 2834.00000 2345.00000 2113.00000 1872.00000 2921.00000 1926.00000 3018.00000 1709.00000 3718.00000 1860.00000 2972.00000 1551.00000 2170.00000 1701.00000 2160.00000 1829.00000 IMAGE=mtwash_or_300302.jpg ID=64 SCALE=0.002604 LM=18 4240.00000 2949.00000 2973.00000 2544.00000 3153.00000 2437.00000 3422.00000

82 2488.00000 3703.00000 2621.00000 3894.00000 2319.00000 3783.00000 2258.00000 3395.00000 2244.00000 3059.00000 2148.00000 2897.00000 2230.00000 2615.00000 2249.00000 1937.00000 1693.00000 2770.00000 1875.00000 2897.00000 1672.00000 3539.00000 1910.00000 2874.00000 1512.00000 2050.00000 1540.00000 2005.00000 1665.00000 IMAGE=mtwash_or_300303.jpg ID=65 SCALE=0.002604 LM=18 4428.00000 2860.00000 3048.00000 2534.00000 3186.00000 2426.00000 3493.00000 2445.00000 3776.00000 2536.00000 3979.00000 2220.00000 3827.00000 2161.00000 3454.00000 2191.00000 3101.00000 2135.00000 2923.00000 2249.00000 2658.00000 2266.00000 1904.00000 1759.00000 2734.00000 1838.00000 2845.00000 1611.00000 3603.00000 1820.00000 2828.00000 1420.00000 1959.00000 1572.00000 1955.00000 1711.00000 IMAGE=mtwash_or_300304.jpg ID=66 SCALE=0.002604 LM=18 4317.00000 2801.00000 3055.00000 2675.00000 3197.00000 2534.00000 3421.00000 2523.00000 3721.00000 2587.00000 3850.00000 2302.00000 3737.00000 2264.00000 3366.00000 2321.00000 3050.00000 2285.00000 2908.00000 2411.00000 2637.00000 2478.00000 1891.00000 2066.00000 2699.00000 2085.00000 2783.00000 1858.00000 3462.00000 1997.00000 2770.00000 1701.00000 1985.00000 1870.00000 1949.00000 2025.00000 IMAGE=mtwash_or_300305.jpg ID=67 SCALE=0.002604 LM=18 4342.00000 3004.00000 3032.00000 2720.00000 3183.00000 2578.00000 3431.00000 2588.00000 3680.00000 2673.00000 3933.00000 2370.00000 3795.00000 2314.00000 3416.00000 2357.00000 3069.00000 2282.00000 2896.00000 2417.00000 2633.00000 2475.00000 1859.00000 1982.00000 2715.00000 2034.00000 2862.00000 1800.00000 3593.00000 1968.00000 2843.00000 1631.00000 1943.00000 1759.00000 1926.00000 1929.00000 IMAGE=olalielake_or_hh320301.jpg ID=68 SCALE=0.002604 LM=18 4260.00000 2730.00000 3038.00000 2578.00000 3168.00000 2439.00000 3427.00000 2440.00000 3675.00000 2500.00000 3811.00000 2210.00000 3715.00000 2177.00000 3345.00000 2238.00000 3061.00000 2207.00000 2913.00000 2330.00000 2664.00000 2386.00000 1946.00000 2011.00000 2708.00000 2005.00000 2798.00000 1786.00000 3465.00000 1878.00000 2754.00000 1636.00000 2002.00000 1858.00000 1999.00000 1962.00000 IMAGE=olalielake_or_hh320302.jpg ID=69 SCALE=0.002604 LM=18 4450.00000 2728.00000 3117.00000 2559.00000 3251.00000 2421.00000 3532.00000 2422.00000 3822.00000 2489.00000 3997.00000 2195.00000 3834.00000 2144.00000 3470.00000 2219.00000 3108.00000 2171.00000 2948.00000 2299.00000 2693.00000 2346.00000 1851.00000 1947.00000 2712.00000 1951.00000 2821.00000 1722.00000 3603.00000 1855.00000 2785.00000 1582.00000 1935.00000 1735.00000 1915.00000 1895.00000 IMAGE=olalielake_or_hh320303.jpg ID=70 SCALE=0.002604 LM=18 4491.00000 2530.00000 3160.00000 2363.00000 3307.00000 2216.00000 3614.00000 2224.00000 3872.00000 2292.00000 4024.00000 1978.00000 3891.00000 1936.00000 3548.00000 1996.00000 3205.00000 1958.00000 3061.00000 2082.00000 2754.00000 2152.00000 1962.00000 1711.00000 2837.00000 1719.00000 2921.00000 1487.00000 3653.00000 1609.00000 2853.00000 1335.00000 2014.00000 1493.00000 2020.00000 1660.00000 IMAGE=olalielake_or_hh320601.jpg ID=71 SCALE=0.002604 LM=18 4368.00000 2599.00000 3093.00000 2452.00000 3234.00000 2313.00000 3502.00000 2314.00000 3789.00000 2379.00000 3960.00000 2072.00000 3817.00000 2024.00000 3448.00000 2089.00000 3093.00000 2054.00000 2954.00000 2172.00000 2661.00000 2238.00000 1901.00000 1853.00000 2747.00000 1832.00000 2829.00000 1605.00000 3559.00000 1734.00000 2797.00000 1459.00000 1976.00000 1645.00000 1981.00000 1791.00000 IMAGE=philiplake_or_hh480201.jpg ID=72 SCALE=0.002604 LM=18 4458.00000 2492.00000 3156.00000 2373.00000 3313.00000 2221.00000 3558.00000 2214.00000 3782.00000 2269.00000 3939.00000 2008.00000 3845.00000 1974.00000 3503.00000 2045.00000 3154.00000 1991.00000 3034.00000 2103.00000 2783.00000 2196.00000 1978.00000 1838.00000 2806.00000 1830.00000 2900.00000 1626.00000 3605.00000 1712.00000 2880.00000 1484.00000 2039.00000 1693.00000 2028.00000 1797.00000

83 IMAGE=prairiecity_or_hh510501.jpg ID=73 SCALE=0.002604 LM=18 4523.00000 2910.00000 3169.00000 2576.00000 3336.00000 2458.00000 3643.00000 2486.00000 3850.00000 2563.00000 4077.00000 2269.00000 3962.00000 2225.00000 3610.00000 2248.00000 3214.00000 2158.00000 3040.00000 2272.00000 2727.00000 2294.00000 1988.00000 1775.00000 2875.00000 1884.00000 3028.00000 1661.00000 3748.00000 1879.00000 3009.00000 1523.00000 2085.00000 1597.00000 2044.00000 1742.00000 IMAGE=SC15026.jpg ID=74 SCALE=0.002604 LM=18 4609.00000 2754.00000 3200.00000 2646.00000 3353.00000 2491.00000 3645.00000 2478.00000 3885.00000 2525.00000 4072.00000 2215.00000 3950.00000 2175.00000 3570.00000 2250.00000 3215.00000 2208.00000 3041.00000 2357.00000 2765.00000 2416.00000 1953.00000 1995.00000 2822.00000 1981.00000 2912.00000 1731.00000 3674.00000 1861.00000 2873.00000 1573.00000 2015.00000 1766.00000 2003.00000 1941.00000 IMAGE=SC15028.jpg ID=75 SCALE=0.002604 LM=18 4428.00000 2861.00000 3062.00000 2590.00000 3201.00000 2460.00000 3531.00000 2474.00000 3790.00000 2558.00000 3971.00000 2237.00000 3850.00000 2191.00000 3434.00000 2221.00000 3101.00000 2148.00000 2896.00000 2292.00000 2650.00000 2330.00000 1866.00000 1834.00000 2706.00000 1889.00000 2809.00000 1653.00000 3586.00000 1837.00000 2767.00000 1482.00000 1935.00000 1627.00000 1934.00000 1785.00000 IMAGE=SC15041.jpg ID=76 SCALE=0.002604 LM=18 4334.00000 3091.00000 3067.00000 2491.00000 3255.00000 2394.00000 3557.00000 2479.00000 3807.00000 2629.00000 4083.00000 2322.00000 3993.00000 2254.00000 3577.00000 2192.00000 3231.00000 2046.00000 3010.00000 2146.00000 2720.00000 2109.00000 2006.00000 1434.00000 2886.00000 1688.00000 3070.00000 1499.00000 3769.00000 1840.00000 3080.00000 1314.00000 2161.00000 1237.00000 2102.00000 1397.00000 IMAGE=sismount_or_hh29201.jpg ID=77 SCALE=0.002604 LM=18 4362.00000 2798.00000 3148.00000 2406.00000 3320.00000 2294.00000 3548.00000 2318.00000 3770.00000 2415.00000 3984.00000 2172.00000 3907.00000 2124.00000 3524.00000 2118.00000 3222.00000 2013.00000 3058.00000 2122.00000 2772.00000 2124.00000 2090.00000 1606.00000 2894.00000 1724.00000 3036.00000 1516.00000 3691.00000 1772.00000 3023.00000 1370.00000 2218.00000 1406.00000 2166.00000 1570.00000 IMAGE=strawberrylake_or_hh500101.jpg ID=78 SCALE=0.002604 LM=18 4194.00000 3150.00000 3008.00000 2638.00000 3168.00000 2541.00000 3423.00000 2599.00000 3668.00000 2725.00000 3907.00000 2482.00000 3820.00000 2420.00000 3418.00000 2369.00000 3115.00000 2238.00000 2938.00000 2319.00000 2631.00000 2316.00000 2015.00000 1725.00000 2823.00000 1938.00000 2955.00000 1735.00000 3639.00000 2069.00000 2950.00000 1584.00000 2093.00000 1554.00000 2065.00000 1693.00000 IMAGE=alaska_pras1072_fla.jpg ID=0 SCALE=0.002604 LM=18 4114.00000 2640.00000 2898.00000 2391.00000 3080.00000 2255.00000 3333.00000 2262.00000 3557.00000 2338.00000 3755.00000 2043.00000 3653.00000 1996.00000 3265.00000 2036.00000 2957.00000 1975.00000 2790.00000 2107.00000 2526.00000 2160.00000 1799.00000 1722.00000 2634.00000 1734.00000 2724.00000 1515.00000 3404.00000 1679.00000 2676.00000 1355.00000 1880.00000 1495.00000 1861.00000 1666.00000 IMAGE=alaska_pras1256_fla.jpg ID=1 SCALE=0.002604 LM=18 2928.00000 1938.00000 2036.00000 1637.00000 2162.00000 1551.00000 2307.00000 1568.00000 2485.00000 1655.00000 2647.00000 1465.00000 2571.00000 1422.00000 2308.00000 1419.00000 2088.00000 1339.00000 1987.00000 1410.00000 1783.00000 1427.00000 1263.00000 1010.00000 1858.00000 1136.00000 1950.00000 992.00000 2428.00000 1177.00000 1956.00000 873.00000 1338.00000 878.00000 1316.00000 984.00000 IMAGE=Sakhalin1_fla.jpg ID=2 SCALE=0.003413 LM=18 2987.00000 2040.00000 2056.00000 1707.00000 2177.00000 1617.00000 2365.00000 1647.00000 2520.00000 1720.00000 2709.00000 1531.00000 2634.00000 1486.00000 2360.00000 1474.00000 2131.00000 1388.00000 2003.00000 1472.00000 1794.00000 1490.00000 1283.00000 1069.00000 1886.00000 1180.00000 1987.00000 1017.00000 2482.00000 1213.00000 1985.00000

84 906.00000 1342.00000 916.00000 1323.00000 1038.00000 IMAGE=Sakhalin2_fla.jpg ID=3 SCALE=0.003413 LM=18 2990.00000 2026.00000 2018.00000 1669.00000 2132.00000 1596.00000 2334.00000 1634.00000 2519.00000 1721.00000 2690.00000 1519.00000 2594.00000 1470.00000 2323.00000 1459.00000 2068.00000 1377.00000 1952.00000 1440.00000 1724.00000 1446.00000 1198.00000 1051.00000 1845.00000 1163.00000 1930.00000 1014.00000 2445.00000 1201.00000 1920.00000 893.00000 1285.00000 935.00000 1248.00000 1026.00000 IMAGE=Sakhalin3_fla.jpg ID=4 SCALE=0.003413 LM=18 2894.00000 2235.00000 1895.00000 1670.00000 2062.00000 1609.00000 2279.00000 1682.00000 2484.00000 1831.00000 2700.00000 1623.00000 2638.00000 1566.00000 2314.00000 1500.00000 2031.00000 1355.00000 1887.00000 1412.00000 1632.00000 1377.00000 1115.00000 791.00000 1843.00000 1078.00000 1976.00000 912.00000 2518.00000 1214.00000 1978.00000 764.00000 1231.00000 626.00000 1184.00000 773.00000 IMAGE=Sakhalin5_fla.jpg ID=6 SCALE=0.003413 LM=18 4264.00000 2912.00000 3089.00000 2386.00000 3262.00000 2299.00000 3516.00000 2373.00000 3755.00000 2505.00000 3985.00000 2265.00000 3872.00000 2186.00000 3516.00000 2147.00000 3223.00000 2009.00000 3044.00000 2081.00000 2746.00000 2064.00000 2171.00000 1478.00000 2948.00000 1713.00000 3106.00000 1526.00000 3710.00000 1830.00000 3094.00000 1374.00000 2249.00000 1305.00000 2213.00000 1449.00000 IMAGE=scand_pras0801_fla.jpg ID=7 SCALE=0.002604 LM=18 4445.00000 2514.00000 3173.00000 2232.00000 3308.00000 2099.00000 3574.00000 2115.00000 3806.00000 2181.00000 4027.00000 1912.00000 3889.00000 1855.00000 3539.00000 1891.00000 3200.00000 1812.00000 3044.00000 1929.00000 2760.00000 2002.00000 1959.00000 1522.00000 2844.00000 1569.00000 2934.00000 1337.00000 3654.00000 1529.00000 2917.00000 1187.00000 2041.00000 1311.00000 2020.00000 1469.00000 IMAGE=scand_pras0846_fla.jpg ID=8 SCALE=0.002604 LM=18 4237.00000 2961.00000 3026.00000 2431.00000 3210.00000 2338.00000 3456.00000 2401.00000 3690.00000 2527.00000 3932.00000 2294.00000 3840.00000 2229.00000 3457.00000 2182.00000 3168.00000 2057.00000 2995.00000 2128.00000 2686.00000 2102.00000 2065.00000 1489.00000 2874.00000 1715.00000 3017.00000 1526.00000 3675.00000 1853.00000 3020.00000 1369.00000 2182.00000 1305.00000 2157.00000 1450.00000 IMAGE=scand_pras0849_fla.jpg ID=9 SCALE=0.002604 LM=18 4397.00000 2710.00000 3156.00000 2361.00000 3304.00000 2238.00000 3558.00000 2266.00000 3810.00000 2369.00000 4008.00000 2095.00000 3905.00000 2047.00000 3536.00000 2055.00000 3217.00000 1962.00000 3054.00000 2063.00000 2786.00000 2102.00000 2077.00000 1583.00000 2891.00000 1678.00000 2999.00000 1462.00000 3680.00000 1700.00000 2987.00000 1310.00000 2142.00000 1383.00000 2138.00000 1536.00000 IMAGE=scand_pras0893_fla.jpg ID=10 SCALE=0.002604 LM=18 4320.00000 3007.00000 3155.00000 2596.00000 3310.00000 2488.00000 3542.00000 2524.00000 3823.00000 2658.00000 3984.00000 2400.00000 3878.00000 2344.00000 3540.00000 2331.00000 3262.00000 2221.00000 3117.00000 2320.00000 2834.00000 2352.00000 2141.00000 1771.00000 2951.00000 1918.00000 3025.00000 1723.00000 3699.00000 1996.00000 3027.00000 1600.00000 2243.00000 1602.00000 2215.00000 1734.00000 IMAGE=scand_pras0953_fla.jpg ID=11 SCALE=0.002604 LM=18 2079.00000 1420.00000 1278.00000 1455.00000 1358.00000 1355.00000 1534.00000 1321.00000 1689.00000 1328.00000 1777.00000 1089.00000 1708.00000 1073.00000 1482.00000 1160.00000 1273.00000 1181.00000 1182.00000 1292.00000 1036.00000 1352.00000 536.00000 1212.00000 1038.00000 1061.00000 1070.00000 917.00000 1484.00000 898.00000 1018.00000 800.00000 533.00000 1061.00000 568.00000 1160.00000 IMAGE=ApApApBoBomSkoF_MD2797.JPG ID=0 SCALE=0.004737 LM=18 2084.00000 1390.00000 1352.00000 1303.00000 1449.00000 1222.00000 1598.00000 1220.00000 1755.00000 1253.00000 1846.00000 1052.00000 1800.00000 1035.00000 1557.00000 1071.00000 1390.00000 1059.00000 1308.00000

85 1137.00000 1154.00000 1178.00000 710.00000 954.00000 1202.00000 912.00000 1249.00000 786.00000 1619.00000 831.00000 1214.00000 667.00000 725.00000 817.00000 746.00000 918.00000 IMAGE=ApApApBoBomSkoF_MD2798.JPG ID=1 SCALE=0.004948 LM=18 2085.00000 1438.00000 1333.00000 1347.00000 1433.00000 1266.00000 1598.00000 1263.00000 1752.00000 1299.00000 1864.00000 1084.00000 1797.00000 1056.00000 1566.00000 1105.00000 1373.00000 1095.00000 1279.00000 1177.00000 1119.00000 1211.00000 677.00000 986.00000 1179.00000 941.00000 1224.00000 816.00000 1613.00000 855.00000 1197.00000 691.00000 689.00000 843.00000 719.00000 940.00000 IMAGE=ApApApBoBomSkoF_MD2799.JPG ID=2 SCALE=0.004974 LM=18 2164.00000 1621.00000 1367.00000 1522.00000 1461.00000 1439.00000 1650.00000 1437.00000 1801.00000 1470.00000 1930.00000 1243.00000 1862.00000 1214.00000 1634.00000 1270.00000 1397.00000 1258.00000 1300.00000 1346.00000 1142.00000 1381.00000 652.00000 1147.00000 1189.00000 1088.00000 1249.00000 956.00000 1663.00000 1005.00000 1215.00000 826.00000 676.00000 999.00000 698.00000 1094.00000 IMAGE=ApApApBoBomSkoF_MD2800.JPG ID=3 SCALE=0.004975 LM=18 1868.00000 1701.00000 1191.00000 1273.00000 1316.00000 1243.00000 1470.00000 1313.00000 1594.00000 1409.00000 1791.00000 1262.00000 1741.00000 1213.00000 1517.00000 1155.00000 1327.00000 1056.00000 1219.00000 1091.00000 1053.00000 1049.00000 727.00000 633.00000 1218.00000 812.00000 1320.00000 722.00000 1658.00000 943.00000 1352.00000 594.00000 804.00000 511.00000 787.00000 615.00000 IMAGE=ApApApBoBomSkoF_MD2801.JPG ID=4 SCALE=0.004974

86 Appendix G

R Scripts

R script for Oregon B. flavidus genitalia morphometric analysis:

# Reset R's brain (important if you deal with different data sets) rm(list=ls())

# Tells R where to look, where your data are setwd("/Users/sarahwilliams/Desktop/bombus flavidus project")

# Read data (R reads txt or csv files, always transform your excell file into txt file) read.table("flavidus_genitalia_data for analysis.txt")

# Assign a name to the data flavgen <- read.table("flav_gen1.txt", ,col.names=c('location','specimen','A','B','C','D','E','F','G'), header=TRUE, sep="\t", na.strings="NA", dec=".", strip.white=TRUE)

# assign another name to the table corresponding to the variables only (data only) bc the pca requires only numerical data flavgendata <- flavgen[c(3, 4, 5, 6, 7, 8, 9)]

#PCA (specified that variables are correlated "cor=TRUE" and PCA scores) pc<-princomp(flavgendata,cor=TRUE, score=TRUE) summary(pc) # show proportion of variance explain by each variable plot(pc) # same but visualized into plots plot(pc, type="l") # same but visualized into line biplot(pc) library(ggplot2) library(ggfortify)

# Visualize the data autoplot(prcomp(flavgendata))

# To add colors depending on the location autoplot(prcomp(flavgendata), data = flavgen, colour = 'location')

# If you want to replace dots by the specimen numbers autoplot(prcomp(flavgendata), data = flavgen, colour = 'location', shape=FALSE, label.size = 3)

# If you want to visualize the eigenvectors on the graph autoplot(prcomp(flavgendata), data = flavgen, colour = 'location', loadings = TRUE)

# To frame the points corresponding to each location autoplot(prcomp(flavgendata), data = flavgen, colour = 'location',frame = TRUE)

# If you want to visualize the eigenvectors on the graph autoplot(prcomp(flavgendata), data = flavgen, colour = 'location', loadings = TRUE, loadings.colour = 'grey', loadings.label = TRUE, loadings.label.colour='black',loadings.label.size = 4)

#Here are the same graphics but without grey background etc.. i prefer when it looks more like a classic graphic :) autoplot(prcomp(flavgendata), data = flavgen, colour = 'location') + theme_bw() + theme(panel.border = element_blank(), panel.grid.major = element_blank(), panel.grid.minor = element_blank(), axis.line = element_line(colour = "black")) autoplot(prcomp(flavgendata), data = flavgen, colour = 'location',frame = TRUE) + theme_bw() + theme(panel.border = element_blank(), panel.grid.major = element_blank(), panel.grid.minor = element_blank(), axis.line = element_line(colour = "black"))

87

R script for global B. “flavidus” genitalia morphometric analysis:

# Reset R's brain (important if you deal with different data sets) rm(list=ls())

# Tells R where to look, where your data are setwd("/Users/patricklhomme/Documents/Postdoc_PSU/stats_psu")

# Read data (R reads txt or csv files, always transform your excell file into txt file) read.table("flavidus_genitalia_complete.txt")

# Assign a name to the data flavgen <- read.table("flavidus_genitalia_complete.txt", ,col.names=c('site','specimen','A','B','C','D','E','F','G','H','I','J','K','L','M','N','O'), header=TRUE, sep="\t", na.strings="NA", dec=".", strip.white=TRUE)

# assign another name to the table corresponding to the variables only (data only) bc the pca requires only numerical data flavgendata <- flavgen[c(3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17)]

#PCA (specified that variables are correlated "cor=TRUE" and PCA scores) pc<-princomp(flavgendata,cor=TRUE, score=TRUE) summary(pc) # show proportion of variance explain by each variable plot(pc) # same but visualized into plots plot(pc, type="l") # same but visualized into line biplot(pc)

# For great visuals the package ggplot2 is cool # Download needed libraries library(ggplot2) library(ggfortify)

# Visualize the data autoplot(prcomp(flavgendata))

# To add colors depending on the location autoplot(prcomp(flavgendata), data = flavgen, colour = 'site')

# If you want to replace dots by the specimen numbers autoplot(prcomp(flavgendata), data = flavgen, colour = 'site', shape=FALSE, label.size = 3)

# If you want to visualize the eigenvectors on the graph autoplot(prcomp(flavgendata), data = flavgen, colour = 'site', loadings = TRUE)

# To frame the points corresponding to each location autoplot(prcomp(flavgendata), data = flavgen, colour = 'site',frame = TRUE)

# If you want to visualize the eigenvectors on the graph autoplot(prcomp(flavgendata), data = flavgen, colour = 'site', loadings = TRUE, loadings.colour = 'grey', loadings.label = TRUE, loadings.label.colour='black',loadings.label.size = 4) + theme_bw() + theme(panel.border = element_blank(), panel.grid.major = element_blank(), panel.grid.minor = element_blank(), axis.line = element_line(colour = "black"))

#Here are the same graphics but without grey background etc.. i prefer when it looks more like a classic graphic :) autoplot(prcomp(flavgendata), data = flavgen, colour = 'site') + theme_bw() + theme(panel.border = element_blank(), panel.grid.major = element_blank(), panel.grid.minor = element_blank(), axis.line = element_line(colour = "black")) autoplot(prcomp(flavgendata), data = flavgen, colour = 'site',frame = TRUE) + theme_bw() + theme(panel.border = element_blank(), panel.grid.major = element_blank(), panel.grid.minor = element_blank(), axis.line = element_line(colour = "black"))

88

R script for global wing morphometric analysis:

# Reset R's braingetwd rm(list=ls())

# Tells R where to look setwd("/Users/patricklhomme/Documents/Postdoc_PSU/stats_psu")

#############1_FUNCTIONS################

# The centroid coordinates Mc of the configuration are the arithmetic mean for each coordinate dimension centcoord<-function(M){apply(M,2,mean)} centsiz<-function(M) {p<-dim(M)[1] size<-sqrt(sum(apply(M, 2,var))*(p-1)) list("centroid_size" = size,"scaled" = M/size)}

# f4.10 transl<-function(M) {M - matrix(centcoord(M), nrow(M), ncol(M), byrow=T)} # f4.11 trans1<-function(M){scale(M,scale=F)}

#computes an averaged shape from an A array object of p, k and n dimensions mshape<-function(A){apply(A, c(1,2), mean)}

## tps2d<-function(M, matr, matt) {p<-dim(matr)[1]; q<-dim(M)[1]; n1<-p+3 P<-matrix(NA, p, p) for (i in 1:p) {for (j in 1:p){ r2<-sum((matr[i,]-matr[j,])^2) P[i,j]<- r2*log(r2)}} P[which(is.na(P))]<-0 Q<-cbind(1, matr) L<-rbind(cbind(P,Q), cbind(t(Q),matrix(0,3,3))) m2<-rbind(matt, matrix(0, 3, 2)) coefx<-solve(L)%*%m2[,1] coefy<-solve(L)%*%m2[,2] fx<-function(matr, M, coef) {Xn<-numeric(q) for (i in 1:q) {Z<-apply((matr-matrix(M[i,],p,2,byrow=T))^2,1,sum) Xn[i]<-coef[p+1]+coef[p+2]*M[i,1]+coef[p+3]*M[i,2]+sum(coef[1:p]*(Z*log(Z)))} Xn} matg<-matrix(NA, q, 2) matg[,1]<-fx(matr, M, coefx) matg[,2]<-fx(matr, M, coefy) matg} tps<-function(matr, matt, n){ xm<-min(matt[,1]) ym<-min(matt[,2]) xM<-max(matt[,1]) yM<-max(matt[,2]) rX<-xM-xm; rY<-yM-ym a<-seq(xm-1/5*rX, xM+1/5*rX, length=n)

89 b<-seq(ym-1/5*rX, yM+1/5*rX,by=(xM-xm)*7/(5*(n-1))) m<-round(0.5+(n-1)*(2/5*rX+ yM-ym)/(2/5*rX+ xM-xm)) M<-as.matrix(expand.grid(a,b)) ngrid<-tps2d(M,matr,matt) plot(ngrid, cex=0.2,asp=1,axes=F,xlab="",ylab="") for (i in 1:m){lines(ngrid[(1:n)+(i-1)*n,])} for (i in 1:n){lines(ngrid[(1:m)*n-i+1,])}} orp<-function(A) {p<-dim(A)[1];k<-dim(A)[2];n<-dim(A)[3] Y1<-as.vector(centsiz(mshape(A))[[2]]) oo<-as.matrix(rep(1,n))%*%Y1 I<-diag(1,k*p) mat<-matrix(NA, n, k*p) for (i in 1:n){mat[i,]<-as.vector(A[,,i])} Xp<-mat%*%(I-(Y1%*%t(Y1))) Xp1<-Xp+oo array(t(Xp1), dim=c(p, k, n))} ild2<-function(M1, M2){sqrt(apply((M1-M2)^2, 1, sum))} pPsup<-function(M1,M2) {k<-ncol(M1) Z1<-trans1(centsiz(M1)[[2]]) Z2<-trans1(centsiz(M2)[[2]]) sv<-svd(t(Z2)%*%Z1) U<-sv$v; V<-sv$u; Delt<-sv$d sig<-sign(det(t(Z1)%*%Z2)) Delt[k]<-sig*abs(Delt[k]) ; V[,k]<-sig * V[,k] Gam<-U%*%t(V) beta<-sum(Delt) list(Mp1=Z1%*%Gam,Mp2=Z2, rotation=Gam,DP=sqrt(sum(ild2(Z1%*%Gam, Z2)^2)),rho=acos(beta))} pgpa<-function(A) {p<-dim(A)[1];k<-dim(A)[2];n<-dim(A)[3] temp2<-temp1<-array(NA, dim=c(p,k,n)); Siz<-numeric(n) for (i in 1:n) {Acs<-centsiz(A[,,i]) Siz[i]<-Acs[[1]] temp1[,,i]<-trans1(Acs[[2]])} Qm1<-dist(t(matrix(temp1,k*p,n))) Q<-sum(Qm1); iter<-0 while (abs(Q)>0.00001) {for(i in 1:n){ M<-mshape(temp1[,,-i]) temp2[,,i]<-pPsup(temp1[,,i],M)[[1]]} Qm2<-dist(t(matrix(temp2,k*p,n))) Q<-sum(Qm1)-sum(Qm2) Qm1<-Qm2 iter=iter+1 temp1<-temp2} list("rotated"=temp2,"it.number"=iter,"Q"=Q,"intereucl.dist"=Qm2,"mshape"=centsiz(mshape(temp2))[[2]],"cent.size"=Siz)}

procalign<-function(A) {pA<-pgpa(A); n<-dim(A)[3]; k<-dim(A)[2] A<-pA$rotated; msh<-pA$mshape A1<-A sv<-eigen(var(msh)) V<-sv$vectors rotmsh<-msh%*%V for (i in 1:n){A1[,,i]<-pPsup(A[,,i],rotmsh)$Mp1}

90 list("rotated"=orp(A1), "meansh"=rotmsh)} uniform2D<-function(A) {n<-dim(A)[3] kp<-dim(A)[1]*dim(A)[2] temp<-procalign(A) msh<-temp$meansh proc<-temp$rotated X<-t(matrix(proc,kp,n)) V<-X-rep(1, n)%*%t(as.vector(msh)) alph<-sum(msh[,1]^2) gam<-sum(msh[,2]^2) U1<-c(sqrt(alph/gam)*msh[,2],sqrt(gam/alph)*msh[,1]) U2<-c(-sqrt(gam/alph)*msh[,1],sqrt(alph/gam)*msh[,2]) score<-V%*%cbind(U1,U2) list("scores"=score,"uniform"=cbind(U1,U2),"meanshape"=msh,"rotated"=proc)}

Hotellingsp<-function(SSef, SSer, dfef, dfer, exact=F) {library(MASS) p <- qr(SSef+SSer)$rank k<-dfef; w<-dfer s<-min(k,p) m<-(w-p-1)/2 t1<-(abs(p-k)-1)/2 Ht<-sum(diag(SSef%*%ginv(SSer))) Fapprox<-Ht*(2 * (s*m+1))/(s^2*(2*t1+s+1)) ddfnum<-s*(2*t1+s+1) ddfden<-2*(s*m+1) pval= 1-pf(Fapprox, ddfnum, ddfden) if (exact) {b<-(p+2*m)*(k+2*m)/((2*m+1)*(2*m-2)) c1<-(2+(p*k+2)/(b-1))/(2*m) Fapprox<-((4+(p*k+2)/(b-1))/(p*k))*(Ht/c1) ddfnum<-p*k ddfden<-4+(p*k+2)/(b-1)} unlist(list("dfeffect"=dfef,"dferror"=dfer,"T2"=Ht,"Approx_F"=Fapprox,"df1"=ddfnum,"df2"=ddfden,"p"=pval))}

############2_LIBRARIES#################

#### Shape Analyses library(relimp) library(MASS) library(mclust) library(cluster) library(ape) options(rgl.useNULL=TRUE) library(rgl) library(shapes) library(geomorph)

#### Image Tool library(rtiff)

###########3_IMPORTING_TPS######################

######### [importing TPS files] ######### setwd("/Users/patricklhomme/Documents/Postdoc_PSU/stats_psu/morphoanalysis") #flavidus flasko<-scan("fla_east_sko.TPS", what="char",quote="", sep="\n", strip.white=T) flasko<-casefold(flasko, upper=F)

91

#bohemicus bohwing<-scan("bohashto_ves_final.TPS", what="char",quote="", sep="\n", strip.white=T) bohwing<-casefold(bohwing, upper=F) sp<-grep("lm=", flasko) n<-length(sp) p <-as.numeric(unlist(strsplit(unlist(strsplit(flasko[sp[1]], "="))[2], " "))[1]) k<-length(unlist(strsplit(flasko[sp[1]+1],split=" +"))) n;k;p config<-matrix(NA, n, p*k) for (i in 1:n) {config[i,]<-as.numeric(unlist(strsplit( flasko[(sp[i]+1):(sp[i]+p)], split=" +")))} dim(config) n<-dim(config)[1] nLM<-dim(config)[2]/2 xLAN<-((1:nLM)*2)-1 yLAN<-((1:nLM)*2) for(i in 1:n){ if (i==1){xyLAN<-as.numeric(c(config[i,xLAN],config[i,yLAN]))} else{ xyLAN<-c(xyLAN,as.numeric(c(config[i,xLAN],config[i,yLAN])))} } M<-array(xyLAN, c(nLM, 2, n)) dim(M) paste("n=",dim(M)[3], sep=""); paste("LM=",dim(M)[1], sep=""); paste("dim=",dim(M)[2], sep="") plot(c(max(M[,1,]),min(M[,1,])),c(max(M[,2,]),min(M[,2,])), type="n", xlab="x", ylab="y") for (i in 1:n){points(M[,,i])} title(paste(n,"configuration after superimposition"))

################4_IMPORTING_LIST########################## #flavidus t.NAME <- read.table(("/Users/patricklhomme/Documents/Postdoc_PSU/stats_psu/morphoanalysis/fla_east_sko_name.txt"), header=FALSE, sep="", na.strings="NA", dec=".", strip.white=TRUE);t.NAME<-as.character(t.NAME[,]) t.IND <- read.table(("/Users/patricklhomme/Documents/Postdoc_PSU/stats_psu/morphoanalysis/fla_east_sko_ind.txt"), header=FALSE, sep="", na.strings="NA", dec=".", strip.white=TRUE);t.IND<-as.character(t.IND[,])

#bohemicus t.NAME <- read.table(("/Users/patricklhomme/Documents/Postdoc_PSU/stats_psu/morphoanalysis/bohvesfinal_list_name.txt"), header=FALSE, sep="", na.strings="NA", dec=".", strip.white=TRUE);t.NAME<-as.character(t.NAME[,]) t.IND <- read.table(("/Users/patricklhomme/Documents/Postdoc_PSU/stats_psu/morphoanalysis/bohvesfinal_list_ind.txt"), header=FALSE, sep="", na.strings="NA", dec=".", strip.white=TRUE);t.IND<-as.character(t.IND[,])

rbind(c("length verification of uploaded dataset:"), paste("n=",dim(M)[3], sep=""), paste("n=",length(t.NAME), sep=""), paste("n=",length(t.IND), sep="")) table(t.NAME) t.CODE<-as.matrix(as.numeric(as.factor(t.NAME))) table(t.CODE) #########5_[Superimposition] ######### #display the plot of rotated plotshapes(M,joinline=c(1,2,3,11,12,18,17,16,14,15,7,6,5,1)) procM<-procGPA(M) plotshapes(procM$rotated,joinline=c(1,2,3,11,12,18,17,16,14,15,7,6,5,1)) rot<-procM$rotated

92 ms<-procM$mshape

#Full Procrustes superimposition of the configurations par(mar=c(0.5,0.5,0.5,0.5)) rot<-procM$rotated ms<-procM$mshape plot(rot[,1,],rot[,2,],axes=F,asp=1, cex=0.6,xlab="",ylab="", main="plot of the superimposed coordinates") plot(rot[,1,],rot[,2,],axes=F,asp=1, cex=1,xlab="",ylab="", main="plot with links between landmarks of the mean shape configuration") joinline<-c(1,2,3,11,12,18,17,16,14,15,7,6,5,1) for (i in 1:n) {lines(rot[joinline,,i],col="grey")} points(rot[,1,],rot[,2,],cex=0.7) lines(ms[joinline,],col="black")

#########6_[PCA] ######### #superimposing configurations projM<-orp(procM$rotated) m<-t(matrix(projM, dim(M)[1]*dim(M)[2], dim(M)[3])) pcs<-prcomp(m) summary(pcs) plot(pcs, type="l") biplot(pcs)

#go down at the end for visuals with the package ggplot2

#plot the PCA scores and display the variance explained by each PC with a barplot par(mar=c(4,4,1,1)) layout(matrix(1:4,2,2)) plot(pcs$x, pch=as.character(t.NAME), main="PCA", frame=TRUE) barplot(pcs$sdev^2/sum(pcs$sdev^2),ylab="% of variance") title(sub="PC Rank",mgp=c(0,0,0))

#estimate the mean configuration, and record the maximal and minimal scores for the two first PCs mesh<-as.vector(mshape(projM)) max1<-matrix(mesh+max(pcs$x[,1])*pcs$rotation[,1],dim(M)[1],dim(M)[2]) min1<-matrix(mesh+min(pcs$x[,1])*pcs$rotation[,1],dim(M)[1],dim(M)[2]) joinline plot(min1,axes=F,frame=F,asp=1,xlab="",ylab="",pch=22) points(max1,pch=17) title("PC1") lines(max1[joinline,],lty=1) lines(min1[joinline,],lty=2) max2<-matrix(mesh+max(pcs$x[,2])*pcs$rotation[,2],dim(M)[1],dim(M)[2]) min2<-matrix(mesh+min(pcs$x[,2])*pcs$rotation[,2],dim(M)[1],dim(M)[2]) plot(min2,axes=F,frame=F,asp=1,xlab="",ylab="",pch=22) points(max2,pch=17) title("PC2", sub="dotted links: min. scores, full links: max. scores",mgp=c(0,0,0)) lines(max2[joinline,],lty=1) lines(min2[joinline,],lty=2) #Result:Graphical display of shape variation depicted by the two first principal components of total shape variation #on the left: plot of PC scores and barplot of PC contributions #on the right: illustration of shape variation along each PC

#visualize shape variation along PC using thin-plate splines par(mfrow=c(2,2)) msh<-mshape(projM) tps(msh, min1,12) points(min1, pch=21, bg="black") lines(min1[joinline,],lty=2) title("PC1: left extreme")

93 tps(msh,max1,12) points(max1,pch=22, bg="black") lines(max1[joinline,],lty=1) title("PC1: right extreme") tps(msh, min2,12) points(min2, pch=21, bg="black") lines(min2[joinline,],lty=2) title("PC2: left extreme") tps(msh,max2,12) points(max2,pch=22, bg="black") lines(max2[joinline,],lty=1) title("PC2: right extreme")

#plots PC scores and provides a graphical display for visualizing shape changes along axes shapepca(procM,pcno=c(1,2), joinline=joinline, axes3=TRUE)

# For great visuals the package ggplot2 is cool # Download needed libraries library(ggplot2) library(ggfortify) library(ggthemes) # Visualize the data autoplot(pcs)+ theme_classic() + theme(panel.border = element_blank(), panel.grid.major = element_blank(), panel.grid.minor = element_blank(), axis.line = element_line(colour = "black"))

# To add colors depending on the location autoplot(pcs, data = flavgen, colour = 'location')

# If you want to replace dots by the specimen numbers autoplot(prcomp(flavgendata), data = flavgen, colour = 'location', shape=FALSE, label.size = 3)

# If you want to visualize the eigenvectors on the graph autoplot(prcomp(flavgendata), data = flavgen, colour = 'location', loadings = TRUE)

# To frame the points corresponding to each location autoplot(prcomp(flavgendata), data = flavgen, colour = 'location',frame = TRUE)

# If you want to visualize the eigenvectors on the graph autoplot(prcomp(flavgendata), data = flavgen, colour = 'location', loadings = TRUE, loadings.colour = 'grey', loadings.label = TRUE, loadings.label.colour='black',loadings.label.size = 4) + theme_bw() + theme(panel.border = element_blank(), panel.grid.major = element_blank(), panel.grid.minor = element_blank(), axis.line = element_line(colour = "black"))

#Here are the same graphics but without grey background etc.. i prefer when it looks more like a classic graphic :) autoplot(prcomp(flavgendata), data = flavgen, colour = 'location') + theme_bw() + theme(panel.border = element_blank(), panel.grid.major = element_blank(), panel.grid.minor = element_blank(), axis.line = element_line(colour = "black")) autoplot(prcomp(flavgendata), data = flavgen, colour = 'location',frame = TRUE) + theme_bw() + theme(panel.border = element_blank(), panel.grid.major = element_blank(), panel.grid.minor = element_blank(), axis.line = element_line(colour = "black")) autoplot(pcs) + theme_bw() + theme(panel.border = element_blank(), panel.grid.major = element_blank(), panel.grid.minor = element_blank(), axis.line = element_line(colour = "black"))

###COOL THINGS TO DO WITH R ##cool visualization library(ggplot2)

#save figures in high quality (ex: eps) library(Cairo)

94 #applies functions after splitting up your data however you wish, then combines it all again at the end. library(dplyr)

#share data creating ppt like library(knitr)

95 BIBLIOGRAPHY

Alford, D. V. (1975). Bumblebees.

Antonovics, J., & Edwards, M. (2011). Spatio-temporal dynamics of bumblebee nest parasites (Bombus

subgenus Psythirus ssp.) and their hosts (Bombus spp.). Journal of Animal Ecology, 80(5), 999-

1011. doi:10.1111/j.1365-2656.2011.01846.x

Avise, J. C., & Walker, D. E. (1998). Pleistocene phylogeographic effects on avian populations and the

speciation process. Proceedings of the Royal Society B: Biological Sciences, 265(1395), 457-463.

doi:10.1098/rspb.1998.0317

BARCODE OF LIFE DATA SYSTEM v4. (n.d.). Retrieved from http://www.boldsystems.org/

Bequaert, J. C., & Plath, O. E. (1925). Description of a new Psithyrus: With an account of Psithyrus

laboriosus and notes on bumblebees. Cambridge, Mass: Printed for the Museum.

Buschinger, A. (2009). Social parasitism among ants: a review (Hymenoptera:

Formicidae). Myrmecological News, 12(3), 219-235.

Cameron, S. A., Hines, H. M., & Williams, P. H. (2007). A comprehensive phylogeny of the bumble bees

(Bombus). Biological Journal of the Linnean Society, 91(1), 161-188. doi:10.1111/j.1095-

8312.2007.00784.x

Carolan, J. C., Murray, T. E., Fitzpatrick, U., Crossley, J., Schmidt, H., Cederberg, B., . . . Brown, M. J.

(2012). Colour Patterns Do Not Diagnose Species: Quantitative Evaluation of a DNA Barcoded

Cryptic Bumblebee Complex. PLoS ONE, 7(1). doi:10.1371/journal.pone.0029251

Cervo, R. (2006, January). Polistes wasps and their social parasites: an overview. In Annales Zoologici

Fennici (pp. 531-549). Finnish Zoological and Botanical Publishing Board.

Clement, M., Snell, Q., Walke, P., Posada, D., & Crandall, K. (2002). TCS: Estimating gene

genealogies. Proceedings 16th International Parallel and Distributed Processing Symposium.

doi:10.1109/ipdps.2002.1016585

Dalla Torre K.W.v. (1880) Unsere Hummel- (Bombus) Arten, Naturhistoriker 2, 40–41.

96 Dalla Torre K.W.v. (1882) Bemerkungen zur Gattung Bombus Latr., II, Ber. Naturw.-med. Ver. Innsbruck

12, 14–31.

Eversmann, E. F. (1852). Fauna Hymenopterologica Volgo-Uralensis: exhibens Hymenopterorum species

quas in provinciis Volgam fluvium inter et montes Uralenses sitis observavit et nunc descripsit.

Folmer, O., Black, M., Hoeh, W., Lutz, R., & Vrijenhoek, R. (1994). DNA primers for amplification of

mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol Mar Biol

Biotechnol, 3, 294–299.

Franklin, H. J. (1911). New North American Bombidae. Transactions of the American Entomological

Society, 37, 157-168.

Frison, T. H. (1926). Descriptions and records of North American Bremidae, together with notes on the

synonymy of certain species (Hymenoptera). Transactions of the American Entomological

Society (1890-), 52(2), 129-145.

Gaschott, O. (1922). Zur phylogenie von Psithyrus. Zool. Anz, 54(1922), 225.

GenBank Overview. (n.d.). Retrieved from http://www.ncbi.nlm.nih.gov/genbank

Hebert, P. D., Ratnasingham, S., & de Waard, J. R. (2003). Barcoding animal life: cytochrome c oxidase

subunit 1 divergences among closely related species. Proceedings of the Royal Society of London

B: Biological Sciences, 270(Suppl 1), S96-S99.

Hebert, P. D., Stoeckle, M. Y., Zemlak, T. S., & Francis, C. M. (2004). Identification of Birds through

DNA Barcodes. PLoS Biology, 2(10). doi:10.1371/journal.pbio.0020312

Hines, H. M., & Cameron, S. A. (2010). The phylogenetic position of the bumble bee inquiline Bombus

inexspectatus and implications for the evolution of social parasitism. Insectes Sociaux, 57(4),

379-383. doi:10.1007/s00040-010-0094-1

Hines, H. M. (2008). Chapter 4 – Species delimitation in bumble bees (Apidae: Bombus) using

mitochondrial 16S sequence divergence. In Bumble bees (Apidae: Bombus) through the ages:

Historical biography and the evolution of color diversity. PhD thesis, University of Illinois.

97 Hines, H. M. (2008). Historical Biogeography, Divergence Times, and Diversification Patterns of Bumble

Bees (Hymenoptera: Apidae: Bombus). Systematic Biology, 57(1), 58-75.

doi:10.1080/10635150801898912

Illiger, K. (1806). William Kirby’s Familien der bienenartigen Insekten mit Zusätzen, Nachweisungen

und Bemerkungen. Mag Insektenk, 5, 28–175.

Ito, M. (1985). Supraspecific classification of bumblebees based on the characters of male genitalia,

Contr. Instit. Low Temp. Sci. Hokkaido Univ. B, 20, 1-143.

Kearse, M., Moir, R., Wilson, A., Stones-Havas, S., Cheung, M., Sturrock, S., Buxton, S., Cooper, A.,

Markowitz, S., Duran, C., Thierer, T., Ashton, B., Mentjies, P., & Drummond, A. (2012).

Geneious Basic: an integrated and extendable desktop software platform for the organization and

analysis of sequence data. Bioinformatics, 28(12), 1647-1649.

Kirby, W. (1802). Monographia apum Angliaea. doi:10.5962/bhl.title.10346

Koch, 2015. Biogeography, population genetics, and community structure of North American Bumble

Bees. PhD Thesis, Utah State University.

Lecocq, T., Dellicour, S., Michez, D., Dehon, M., Dewulf, A., Meulemeester, T. D., . . . Rasmont, P.

(2015). Methods for species delimitation in bumblebees (Hymenoptera, Apidae,Bombus):

Towards an integrative approach. Zoologica Scripta, 44(3), 281-297. doi:10.1111/zsc.12107

Lecocq, T., Lhomme, P., Michez, D., Dellicour, S., Valterová, I., & Rasmont, P. (2011). Molecular and

chemical characters to evaluate species status of two cuckoo bumblebees: Bombus barbutellus

and Bombus maxillosus (Hymenoptera, Apidae, Bombini). Systematic Entomology, 36(3), 453-

469. doi:10.1111/j.1365-3113.2011.00576.x

Leigh, J.W., & Bryant, D. (2015). PopART: Full-feature software for haplotype network construction.

Methods Ecol Evol 6(9):1110–1116.

98 Lepeletier de Saint-Fargeau, A. L. M. (1832). Observations sur l’ouvrage intitulé:‘Bombi scandinaviae

monographice tractato, etc., à Gustav. Dahlbom. Annales de la Société entomologique de France,

1, 366-382.

Lhomme, P., & Hines, H. (2018). Ecology and evolution of cuckoo bumble bees. Submitted to Annals of

the Entomological Society of America.

Løken, A. (1985). Scandinavian species of the genus Psithyrus Lepeletier (Hymenoptera: Apidae).

Entomologica Scandinavica.

Loken, A., & Framstad, E. B. (1983). Contribution to the taxonomy of Psithyrus

(Fernaldaespsithyrus)(Hymenoptera: Apidae). Acta entomologica fennica.

Meulemeester, T. D., Aytekin, A. M., Cameron, S., & Rasmont, P. (2011). Nest architecture and species

status of the bumble bee Bombus (Mendacibombus) shaposhnikovi (Hymenoptera: Apidae:

Bombini). Apidologie, 42(3), 301-306. doi:10.1007/s13592-011-0022-z

Michener, C. D. (2000). The bees of the world (Vol. 1). JHU press.

Nash, D. R., & Boomsma, J. J. (2008). Communication between hosts and social parasites. Sociobiology

of Communication, 55-80. doi:10.1093/acprof:oso/9780199216840.003.0004

Newman, E. (1835). The grammar of entomology. F. Westley and AH Davis.

Pamilo, P., Pekkarinen, A., & Varvio, S. L. (1987). Clustering of bumblebee subgenera based on

interspecific genetic relationships (Hymenoptera, Apidae: Bombus and Psithyrus). Annales

zoologici fennici, 19-27.

Pekkarinen, A., Varvio-Aho, S. L., & Pamilo, P. (1979). Evolutionary relationships in northern European

Bombus and Psithyrus species (Hymenoptera, Apidae) studied on the basis of allozymes. Annales

entomologici fennici.

Pekkarinen, A., Teras, I., Viramo, J., & Paatela, J. (1981). Distribution of bumblebees (Hymenoptera,

Apidae: Bombus and Psithyrus) in eastern fennoscandia. Notulae Entomologicae.

99 Plowright, R. C., & Owen, R. E. (1980). The Evolutionary Significance of Bumble Bee Color Patterns: A

Mimetic Interpretation. Evolution, 34(4), 622. doi:10.2307/2408017

Plowright, R. C., & Stephen, W. P. (1973). A Numerical Taxonomic Analysis Of The Evolutionary

Relationships Of Bombus And Psithyrus (Apidae: Hymenoptera). The Canadian Entomologist,

105(05), 733-743. doi:10.4039/ent105733-5

QIAmp DNA Micro Handbook, “Protocol: Isolation of Genomic DNA from Tissues,” p. 25

R Core Team (2013). R: A language and environment for statistical

computing. R Foundation for Statistical Computing, Vienna, Austria.

http://www.R-project.org/.

Radoszkowski, O. (1884) Révision des armures copulatrices des mâles du genre Bombus, Byulletin'

Moskovskogo Obshchestva Ispytatelei Prirody, 59, 51–92.

Rasband, W.S., ImageJ, U. S. National Institutes of Health, Bethesda, Maryland, USA,

https://imagej.nih.gov/ij/, 1997-2016.

Schneider, C. A., Rasband, W. S., & Eliceiri, K. W. (2012). NIH Image to ImageJ: 25 years of image

analysis. Nature methods, 9(7), 671.

Shields, G. F. and A. C. Wilson. 1987. Calibration of mitochondrial DNA evolution in geese. Journal of

Molecular Evolution, 24, 212–217

Skorikov A.S. (1922) Bumblebees of the Petrograd Province, Faunae Petropolitanae catalogus,

Petrogradskii Agronomicheskii Institut, Petrograd, 51.

Stiles, E. W. (1979). Evolution of Color Pattern and Pubescence Characteristics in Male Bumblebees:

Automimicry vs. Thermoregulation. Evolution, 33(3), 941. doi:10.2307/2407657

Svensson, B. G., & Lundberg, H. (1977). Distribution of bumble bee nests in a subalpine/alpine area in

relation to altitude and habitat (Hymenoptera, Apidae). Zoon.

Thompson, S., & Kavaliers, M. (1994). Physiological bases for parasite-induced alterations of host

behaviour. Parasitology, 109(S1), S119-S138. doi:10.1017/S0031182000085139

100 Vogt, O. (1911) Studien über das Artproblem. 2. Mitteilung. Über das Variieren der Hummeln. 2. Teil.

(Schluss), Sitz.ber. Ges. Naturforsch. Freunde Berl., 31–74.

Williams, P. H. (1985). A preliminary cladistic investigation of relationships among the bumble bees

(Hymenoptera, Apidae). Systematic Entomology, 10(2), 239-255. doi:10.1111/j.1365-

3113.1985.tb00529.x

Williams, P. H. (1991). The bumble bees of the Kashmir Himalaya (Hymenoptera: Apidae, Bombini).

British Museum (Natural History).

Williams, P. H. (1998). An annotated checklist of bumble bees with an analysis of patterns of description

(Hymenoptera: Apidae, Bombini). Bulletin-Natural History Museum Entomology Series, 67, 79-

152.

Williams, P.H. (2000, March 03). Bumblebees of the world. Retrieved from

http://www.nhm.ac.uk/research-curation/research/projects/bombus/subgenericlist.html

Williams, P. H., Cameron, S. A., Hines, H. M., Cederberg, B., & Rasmont, P. (2008). A simplified

subgeneric classification of the bumblebees (genus Bombus). Apidologie, 39(1), 46-74.

doi:10.1051/apido:2007052

ACADEMIC VITA

SARAH DANIELLE WILLIAMS [email protected]

EDUCATION

Bachelor of Science May 2018 The Pennsylvania State University, Schreyer Honors College Major in Biology: Genetics and Development Minor in Psychology Honors in Biology

EXPERIENCE

Undergraduate Research Assistant Fall 2015- Hines Laboratory, The Pennsylvania State University Present Independent research on the species delimitation of Bombus flavidus. Learning Assistant for Introductory Physics II Spring 2016- The Pennsylvania State University Present Attend biweekly lectures to help students solve in-class problems and encourage collaborative work. Independently host weekly out-of-class problem-solving sessions for students. Physician Shadowing May-June 2016 The Pennsylvania Psychiatric Institute Shadowed Dr. Sam Al-Saadi during adult inpatient psychiatric treatments.

AWARDS/HONORS, GRANTS RECEIVED

UP 4 Year Provost Fund (4k) Scholarship Fall 2014- The Pennsylvania State University Present

Academic Excellence Scholarship Fall 2014- The Pennsylvania State University Present

Dean’s List Fall 2014; Fall The Pennsylvania State University 2015-Present

Research Grant Fall 2017 Schreyer Honors College, The Pennsylvania State University

LEADERSHIP & EXTRACURRICULAR INVOLVEMENT

Penn State IFC/Panhellenic Dance MaraTHON, Operations (OPP) Committee Fall 2015- Member Present The Pennsylvania State University Volunteer and fundraise for the Four Diamonds Foundation and THON, the largest student-run philanthropy in the world, financially and emotionally supporting families affected by pediatric cancer. Volunteered during THON weekend to ensure a clean and safe event space. Pen Pal Chair (2015-2016) – served as a liaison between my OPP committee and a Four Diamonds family, organizing and shipping gifts and letters to emotionally support a Four Diamonds child. Administrator (2017-2018) – assisted my committee captain with various organizational tasks, such as taking attendance at our weekly meetings and sending out recap emails and reminders to all committee members.

The National Society of Leadership and Success – Community Service Chair Fall 2016- The Pennsylvania State University Present Coordinate and execute community service opportunities for Society Members, such as blood drives with the American Red Cross. Facilitate and plan Society events, such as Induction Ceremony and Speaker Broadcasts. Track members’ community service involvement towards receiving the National Engaged Leadership Award.

Community Volunteer Fall 2017- Centre County Women’s Resource Center Present Help educate the Centre County community about issues such as domestic violence, sexual assault, and unhealthy relationships. Assist in the creation of informational displays for community events.