Final Report on UGC Major Research Project (MRP)

Anthropogenetic Profile of "denotified" Tribes (Vimukt Jatis) of Punjab (North-West India) and its Social Implication

(From 01/ 04/ 2013 to 31/ 03/ 2017)

Submitted to

The University Grants Commission, New Delhi

by

Prof. (Dr.) S. M .S. Chahal

Principal Investigator

Department of Human Genetics (earlier Department of Human Biology)

Punjabi University, Patiala 147002 (Punjab)

"Anthropogenetic Profile of "denotified" Tribes (Vimukt Jatis) of Punjab (North-West India) and its Social Implication"

INTRODUCTION

The “denotified” tribes, also known as the Vimukt Jatis, are the tribes that were originally listed under the Criminal Tribes Act of 1871, as Criminal Tribes and "addicted to the systematic commission of non-bailable offences." Once a tribe became "notified" as criminal, all its members were required to register with the local magistrate, failing which they would be charged with a crime under the Indian Penal Code.

The Act was repealed in August 1949 and former "criminal tribes" were “denotified” in 1952, when the Act was replaced with the Habitual Offenders Act 1952 of Government of India, and in 1961 state governments started releasing lists of such tribes. At the time of the independence in 1947, there were 13 million people in 127 communities who faced constant surveillance, search and arrest without warrant if any member of the group was found outside the prescribed area.

The creation of these categories should be seen in the context of colonialism. The British authorities listed them separately by creating a category of castes or tribes labeled as criminal. The first Census of India was conducted in 1871 and at that time there was no consensus or any definition of "tribe". The terms "Tribe" and "Caste" were used interchangeably for these communities. In this colonial context, the term "Tribe" connoted the notions of primitiveness and backwardness and hence the assumption that these tribes needed to be civilized or transformed.

Today, there are 313 Nomadic Tribes and 198 “denotified” tribes in India, yet the legacy of the Act continues to haunt the majority of 60 million people belonging to these tribes, especially as their notification over a century ago has meant not just alienation and stereotyping by the police and the media, but also economic hardships. A large number of them can still only subscribe to a slightly altered label, the "Vimukt jatis" (or the Ex-Criminal Tribes). Located on the North-West border of India, Punjab has been the gateway of the country for the entry of different racial/ethnic stocks over millennia. Historically, the people of Punjab are supposed to be progeny of a mixture of several proto- and post-Harappa invaders who entered this land from the West from time to time, and of original autochthonous settlers of the area (Rose, 1919).

Officially, presently there is no tribe in Punjab. However, there are seven “denotified” tribes inhabiting the state namely, the Bauria, Bazigar, Bangala, Barad, Gandhila, Nat and Sansi. Most of these have their pockets of concentration though few are distributed all over Punjab. Their total population as per the Census of India 2001 was 436,809, the Bazigar having the highest population (208,442), followed by the Sansi (105,337), Bauria (102,232), Barar (8,679), Bangali (7,765), Gandhila (3,283) and Nat (1,071). The distribution of these “denotified” tribes in Punjab is shown in Table 1.

Table 1. The “denotified” tribes and their distribution in Punjab (Census of India, 2001).

“Denotified” tribe Population District(s) of Punjab

Bauria 102,232 Faridkot, Bathinda, Mansa, Moga, Ferozepur, Muktsar, Sangrur, Ludhiana, Kapurthala

Bazigar 208,442 Whole State

Ropar, Gurdaspur, Amritsar, Ludhiana, Bathinda, Sangrur, Jalandhar, Kapurthala, Bangali 7,765 Muktsar, Hoshiarpur

Barar 8,679 Hoshiarpur, Gurdaspur, Jalandhar, Amritsar

Gandhila 3,283 Patiala

Nat 1,071 Amritsar, Ferozepur, Sangrur, Ludhiana, Jalandhar

Sansi 105,337 Gurdaspur, Hoshiarpur, Jalandhar, Ludhiana, Patiala, Sangrur

Total 436,809 All districts

The “denotified” tribes (Vimukt Jatis) of Punjab had been struggling since India’s independence, first to remove the tag of criminality attached to them during the British colonial regime and second, to acquire the status of Schedule Tribe (ST). It is ironic that they had been wrongly placed in the category of Scheduled Caste (SC) in Punjab and they see this as an attempt to denigrate them.

The Vimukt Jatis had been contesting for Scheduled Tribe (ST) status for long so that they have a stake in reservation quota for jobs, admissions, scholarships and other benefits announced from time to time by the government for the ST. Since as of now they are clubbed with the Scheduled Castes of Punjab, the so-called ‘creamy SC layer’ (e.g. the Ramdasia, Balmiki etc.) takes all the benefits meant for SC. In fact, the illiteracy and backwardness of the Vimukt Jatis are coming in their way to garner the benefits of any govermental reservation policy.

The present study is a biological anthropology approach to establish the genetic profile of the Vimukt Jatis of Punjab. As a detailed social anthropological study is already available on the Vimukt Jatis of Punjab which indicate a tribal status for them (Singh, 2010), it would be interesting to examine if the results from the present anthropogenetic approach corroborate this finding. That is, the present study is an attempt to provide genetic basis to the findings of the social-anthropological inquiry already reported in literature on the Vimukt Jatis of Punjab. This will help make the case of the Vimukt Jatis, a socially disadvantaged group of people, for a tribal status more rational and logical thereby helping them get their true identity validated, enabling them get the financial and other benefits due to them.

Social anthropological evidence

The “denotified” tribes have been relevant to other communities of Punjab, directly or indirectly, but they neither adopted the Punjabi culture nor mixed with them till they were settled forcibly by the colonial British government. Even then the “denotified” tribes maintained distance from the other communities. These people were suspected to pose threat to the law and order, as thieves and burglars. Thus they were interned in the reformatories – industrial and agricultural settlements – where they were compelled to work for their living. After remaining in denial over the existence of Scheduled Tribes in Punjab, the Punjab government has now been handed a report of a survey conducted by the Punjabi University, Patiala (Singh, 2010) that concludes that seven ex-criminal (“denotified”) tribes and Gurjar fulfill the parameters of "tribe" laid down by the Union Government and the social anthropologists. It states that the conditions under which the “denotified” tribes live in are dismal compared to the major Scheduled Caste communities of Punjab such as Adharmis and Balmikis, but even then the former have been denied the benefits of any reservation policy.

Physical (biological) anthropological evidence

With only a couple of serological observations on the ABO blood groups (Sidhu and Sidhu, 1980, 1988) in the Bazigar and Sansi and a solitary report on the RH(D) blood groups in the Bazigar (Sidhu and Sidhu, 1988), the “denotified” Tribe populations of Punjab are little represented on the genetic map of the state.

AIM AND OBJECTIVES

The main aim of the present investigation was to anthropogenetically characterize the “denotified” tribes of Punjab using original data from 10 different genetic markers and 5 anthropometric measurements and use the results thus generated to address the problem of their tribal status scientifically and rationally. The two main objectives of the present investigation were as follows.

1. To characterize genetically the 7 "denotified" tribes (Vimukt Jatis) of Punjab viz., the Bazigar, Sansi, Bauria, Barad, Bangala, Gandhila and Nat using original allele frequency data from a battery of serological and DNA markers. Their anthropometric profile will also be investigated.

2. To ascertain the tribal character, if any, of the "denotified" tribes (Vimukt Jatis) of Punjab using the present genetic data and that reported in the literature on common markers on different non-tribal and tribal populations of North and Central India, respectively.

METHODOLOGY

The anthropometric measurements such as stature and those required for the calculation of the cephalic index i.e. maximum head breadth and maximum head length, and nasal index i.e. nasal breadth and nasal height were taken in the field on a total of 1,154 male and female subjects belonging to seven "denotified" tribes of Punjab viz., the Bazigar, Sansi, Bauria, Bangala, Barad, Gandhila and Nat (Table 2), following standard anthropometric techniques as given in Martin and Saller (1957) and Singh and Bhasin (1989). Ethical clearance for the present project was obtained from the Institutional Ethical Committee of the Punjabi University, Patiala.

Table 2. Village and district wise sampling and sample sizes for the present study.

Sample size "Denotified" Village District tribe Genetic Anthropometry analysis Arnetu Patiala 68 Bazigar Sanour Patiala 64 Bahadurgarh Patiala 28 Amargarh Sangrur 72 Total 232 303 Dudhad Patiala 15 Langroi Patiala 23 Mithu Majra Patiala 14 Sansi Bagrian Sangrur 25 Kheri Jattan Sangrur 34 Rohti Channa Patiala 20 Kakrala Patiala 28 Samadgarh Sangrur 63 Total 222 241

Bauria Leelan Megh Singh Ludhiana 198

Sherpur Kalan Ludhiana 2 Total 200 202 Bangala Doraha Ludhiana 68 Dugri 37 Total 105 105 Barar Piplanwala 37 Saila Khurd Hoshiarpur 30 Singdiwala 07 Banga Shaheed Bhagat Singh 43 Nagar Total 117 114 Gandhila Arnetu (n=89) Patiala Sadharanpur 13 Bakraha 12

Total 114 134 Bhedpura 10 Dhablan 07 Mehmadpur Patiala 04 Shutrana 02 Aakad 02 Nat Wazirpur 07 Sangrur Chuharpur 03 Khunimajra Rupnagar 22 Bhankarpur Sahibzada Ajit Singh 04 Nagar Total 55 55 Grand total 1055 1154

Anthropometry

The following 5 anthropometric measurements were taken on subjects belonging to seven "denotified" tribes of Punjab following the standardized techniques as given by Martin and Saller (1957) and Singh and Bhasin (1989). Stature (height vertex) was measured with the help of an anthropometric rod. For head and nose measurements, respectively, spreading and sliding calipers were used. 1. Stature: It was taken as the vertical distance from the highest point on the head (vertex) of the subject to the floor in the Frankfort horizontal (F-H) plane. 2. Head length: It was measured as the distance from the most prominent point in the mid-sagittal plane of forehead (glabella) to the most prominent point on external Occipital protuberance of the subject. 3. Head breadth: It was taken as the greatest transverse diameter on the head of the subject from euryon to euryon (a bilaterally paired point that forms the terminus of the line of greatest breadth of the skull). 4. Nasal height: It was measured as a distance from the point of deepest concavity of the soft tissue contour of the root of the nose (nasion) of the subject to the point where the lowest border of the nose meets the outer contour of the lip (subnasale). 5. Nasal breadth: It was measured as the distance between two alar points on the nose of the subject.

The head and nose measurements so obtained were used to calculate the following two indices.

Cephalic Index (C.I.) = (Head Breadth / Head Length) X 100 Nasal Index (N.I.) = (Nasal Breadth /Nasal Height) X 100

After obtaining the prior informed consent (Appendix-I), 3-5 ml blood sample was collected in sterile EDTA.K2 vial from a total of 1,051 randomly chosen, unrelated, healthy adult male and female subjects belonging to the seven "denotified" tribes of Punjab viz. the Bazigar (n=232), Sansi (n=222), Bauria (n=200), Bangala (n=105), Barad (n=117), Gandhila (n=114) and Nat (n=61) (Table 2). The samples were collected from various districts of Punjab in different field works transported personally to the laboratory in the Department of Human Genetics, Punjabi University, Patiala for their detailed laboratory analyses.

Serological analyses

In the laboratory, the red cells were typed for A1A2BO and RH(D) blood groups by the tube method using Anti-A, Anti-A1, Anti-B and Anti-D, following standard serological techniques (Dunsford and Bowley, 1967). DNA genotyping

For the genetic analysis, genomic DNA was extracted from the collected blood samples using the inorganic method of Miller et al. (1988) and it was subjected to quality and quantity checks using a spectrophotometer. Each DNA sample was genotyped for a battery of 8 Alu Ins/Del loci (APO, CD4, PV92, TPA25, FXIIIB, ACE, PLAT, D1) following the primer sequences and annealing temperatures listed in Table 3. Genotyping involved amplification of the DNA by polymerase chain reaction (PCR) using locus-specific primers for 8 Alu Ins/Del loci. The amplified PCR products were run on 2% agarose gel with Ethidium Bromide (EtBr) as a stain dye. The results were visualized in a UVP Gel Doc-It Imaging System and recorded (Figs. 1-8). Table 3. Primer sequences and annealing temperatures for the studied Alu Ins/Del loci. Annealing Marker Primer sequence temperature Reference

ACE F : 5’– CTGGAGACCACTCCCATCCTTTCT - 3’ 58° C Majumder et R : 5’– GATGTGGCCATCACATTCGTCAGAT - 3’ al. (1999) APO F : 5’– AAGTGCTGTAGGCCATTTAGATTAG - 3’ 50° C Majumder et R : 5’–AGTCTTCGATGACAGCGTATACAGA - 3’ al. (1999) CD4 F : 5’-AGGCCTTGTAGGGTTGGTCTGATA - 3’ 63° C Majumder et R : 5’- TGCAGCTGCTGAGTGAAAGAACTG-3’ al. (1999) D1 F : 5’-TGCTGATGCCCAGGGTTAGTAAA - 3’ 56.8° C Majumder et R : 5’TTTCTGCTATGCTCTTCCCTCTC -3’ al. (1999)

FXIIIB F : 5’ TCAACTCCATGAGATTTTCAGAAGT - 3’ 54.4° C Majumder et

R : 5’- CTGGAAAAATGTATTCAGGTGAGT -3’ al. (1999) PLAT F : 5’-GTG AAA AGC AAG GTCTAC CAG - 3’ 59° C Stoneking et R : 5’- TGCAGCTGCTGAGTAAAGAATG-3’ al. (1999) PV92 F:5’AACTGGGAAAATTTGAAGAGAAAGT - 3’ 52.5° C Majumder et R : 5’GAC ACC GAG TTC ATC TTG AC -3’ al. (1999)

TPA25 F : 5’- GTAAGAGTTCCGTAACAGGAC AGCT- 3’ 54° C Majumder et R : 5’- CCCCACCCTAGGAGAACTTCT CTTT-3’ al. (1999)

Fig. 1. Gel image of genotypes of Alu ACE

Allele Genotype Band size Lane number(s) Insertion (I) Homozygous insertion (I/I) 490bp 2, 3, 6 Deletion (D) Heterozygous (I/D) 490bp, 190bp 1, 4, 5, 7, 8, 9 - Homozygous deletion (D/D) 190bp -

Fig. 2. Gel image of genotypes of Alu APO

Allele Genotype Band Size Lane number(s) Insertion (I) Homozygous insertion (I/I) 400bp 1, 2, 3, 4 Deletion (D) Heterozygous (I/D) 400bp, 100bp 5, 7 Homozygous deletion (D/D) 100bp 6

Fig. 3. Gel image of genotypes of Alu CD4

Allele Genotype Band Size Lane number(s) Insertion (I) Homozygous insertion (I/I) 1500bp 1, 2, 4, 5, 6, 7 Deletion (D) Heterozygous (I/D) 1500bp, 1200bp 3 Homozygous deletion (D/D) 1200bp -

Fig. 4. Gel image of genotypes of Alu D1

Allele Genotype Band Size Lane number(s) Insertion (I) Homozygous insertion (I/I) 650bp 2, 3, 5, 8, 9 Deletion (D) Heterozygous (I/D) 650bp, 350bp 1, 7 Homozygous deletion (D/D) 350bp 4, 6

Fig. 5. Gel image of genotypes of Alu FXIIIB

Allele Genotype Band Size Lane number(s) Insertion (I) Homozygous insertion (I/I) 700bp 1, 2, 6, 8 Deletion (D) Heterozygous (I/D) 700bp, 460bp 5, 7 - Homozygous deletion (D/D) 460bp 3, 4, 9

Fig. 6. Gel image of genotypes of Alu PLAT

Allele Genotype Band Size Lane number(s) Insertion (I) Homozygous insertion (I/I) 570bp 3, 6 Deletion (D) Heterozygous (I/D) 570bp, 260bp 4, 5, 7 - Homozygous deletion (D/D) 260bp 1, 2

Fig. 7. Gel image of genotypes of Alu PV92

Allele Genotype Band Size Lane number(s) Insertion (I) Homozygous insertion (I/I) 400bp 4 Deletion (D) Heterozygous (I/D) 400bp, 110bp 1, 2, 3, 5, 6 - Homozygous deletion (D/D) 110bp 7

Fig. 8. Gel image of genotypes of Alu TPA25

Allele Genotype Band Size Lane number(s) Insertion (I) Homozygous insertion (I/I) 400bp 1, 2, 3, 4 Deletion (D) Heterozygous (I/D) 400bp, 100bp 5, 7 Homozygous deletion (D/D) 100bp 6 Statistical Analyses Allele frequencies were calculated in the ABO blood group system following Yasuda (1984), in the RH(D) blood group system by the square root method and in the DNA markers by the gene counting method (Mourant et al., 1976). Deviations from the Hardy–Weinberg 2 equilibrium were studied by the goodness-of-fit chi-square (χ HW) test using phenotype/genotype data. Contingency χ2 test was used to study overall inter-group differences using phenotype counts of A1A2BO and RH(D) loci and genotype counts for Alu Ins/Del markers. To assess the extent of gene differentiation among the present "denotified" ” tribes of Punjab, the Nei’s (1973) measure of gene differentiation was calculated. To seek genomic affinities among the present "denotified" ” tribes of Punjab, the pair wise estimates of genetic distance (D) (Nei, 1972) were calculated and dendrograms were constructed by UPGMA method (Sneath and Sokal, 1973) using PHYLIP 3.695 Software

RESULTS

Anthropometric Analysis

Five anthropometric measurements (Stature, head breadth, head length, nasal height and nasal breadth) were taken on a total of 1154 male and female subjects belonging to 7 "denotified" tribes of Punjab viz., the Gandhila, Barad, Bangala, Bazigar, Sansi, Bauria and Nat, using the standard anthropometric instruments and techniques (Martin and Saller, 1957; Singh and Bhasin, 1989).

Head and nose measurements were used to calculate cephalic index (C.I.) and nasal index (N.I.), respectively. Tables 4-11 present the results of the anthropometric investigation in the present study.

Stature, Nasal Index and Cephalic Index

Descriptive statistics for the stature, nasal index and cephalic index such as mean, standard deviation (S.D.) and standard error (S.E.) are given in Table 4.

Table 4. Descriptive statistics of the Stature, Nasal Index and Cephalic Index in various "denotified" tribes of Punjab, North West India.

"Denotified" Stature Nasal Index Cephalic Index tribe Gender n (mm) (N.I.) (C.I.) Mean S.D. S.E. Mean S.D. S.E. Mean S.D. S.E.

Male 26 1563.8 70.0 13.7 79.6 9.1 1.8 77.1 3.9 0.8

Gandhila Female 108 1577.1 73.3 7.1 82.5 9.1 0.9 76.5 3.8 0.4

Total 134 1574.5 72.6 6.3 81.9 9.1 0.8 76.6 3.9 0.3

Male 38 1532.1 86.0 14.0 80.5 11.8 1.9 79.6 3.7 0.6

Barad Female 76 1536.3 63.1 7.2 79.0 9.6 1.1 79.2 2.9 0.3

Total 114 1534.9 71.2 6.7 79.5 10.4 1.0 79.3 3.2 0.3

Male 27 1714.2 56.0 10.8 76.5 8.1 1.6 78.2 4.3 0.8

Bangala Female 78 1542.6 52.1 5.9 74.1 7.6 0.9 83.1 3.2 0.4

Total 105 1586.7 92.1 9.0 74.7 7.8 0.7 81.9 4.1 0.4

Male 84 1678.6 63.2 6.9 78.7 9.3 1.0 75.4 3.4 0.4

Bazigar Female 219 1538.5 53.9 3.6 75.7 8.7 0.6 78.2 3.1 0.2

Total 303 1577.4 84.5 4.9 76.5 8.9 0.5 77.5 3.4 0.2

Male 55 1650.9 68.2 9.2 73.8 8.4 1.1 78.6 3.3 0.5 Bauria Female 147 1537.3 54.1 4.5 70.5 8.4 0.7 80.7 3.5 0.3

Total 202 1568.1 77.0 5.4 71.4 8.5 0.6 80.1 3.5 0.3

Male 72 1596.9 88.2 10.4 84.9 4.8 0.6 78.6 3.4 0.4

Sansi Female 169 1571.6 71.8 5.5 71.5 5.2 0.4 79.0 4.1 0.3

Total 241 1579.1 77.8 5.0 75.5 7.9 0.5 78.9 3.9 0.3 Male 11 1677.3 39.8 12.0 72.4 8.9 2.7 76.9 4.0 1.2 Nat Female 44 1532.6 54.3 8.2 68.4 7.1 1.1 77.7 5.0 0.8

Total 55 1561.5 77.8 10.5 69.2 7.6 1.0 77.5 4.8 0.7

Stature

Table 5 presents gender wise classification of the stature as proposed by Martin and Saller (1957). Based on the results of the stature observed in the present "denotified" tribes of Punjab, the subjects were classified into different categories as shown in Table 6. Short stature was common only in the Barad with a total (male + female) frequency of 40.3%. The Gandhila, Bazigar and Sansi showed an overall preponderance for lower medium stature while the Bauria and Nat were observed to have medium type of stature and tall stature was observed to be common in the Bangala. No subject was classified under pygmy and giant stature types in the present "denotified" tribes of Punjab.

Table 5. Classification of stature according to Martin and Saller (1957).

Stature range (mm) Class Males Females

Pygmy Under 1290 Under 1209 Very Short 1300 - 1499 1210 – 1399 Short 1500 – 1599 1400 – 1489 Lower Medium 1600 – 1639 1490 – 1529 Medium 1640 – 1669 1530 – 1559 Upper Medium 1670 – 1699 1560 – 1589 Tall 1700 – 1799 1590 – 1679 Very Tall 1800 – 1999 1680 – 1869 Giant 2000 and above 1870 and above

Table 6. Distribution of subjects of seven "denotified" tribes of Punjab according to stature type.

Stature type “Denotified” Gender tribe Very Short Lower Medium Upper Tall Very Short Medium Medium Tall Male 00 04 04 03 05 09 01 Gandhila (0.0%) (3.0%) (3.0%) (2.2%) (3.7%) (6.7%) (0.75%) (n=134) Female 00 09 30 26 19 23 01 (0.0%) (6.7%) (22.4%) (19.4%) (14.2%) (17.2%) (0.75%) Total 00 13 34 29 24 32 02 (0.0%) (9.7%) (25.4%) (21.6%) (17.9%) (23.9%) (1.5%) Male 01 20 11 04 00 02 00 Barad (0.9%) (17.5%) (9.6%) (3.5%) (0.0%) (1.7%) (0.0%) (n=114) Female 02 26 22 15 07 04 00 (1.7%) (22.8%) (19.3%) (13.2%) (6.1%) (3.5%) (0.0%) Total 03 46 33 19 07 06 00 (2.6%) (40.3%) (28.9%) (16.7%) (6.1%) (5.2%) (0.0%) Male 00 00 02 04 03 17 01 Bangala (0.0%) (0.0%) (1.9%) (3.8%) (2.8%) (16.2%) (0.95%) (n=105) Female 01 10 20 19 15 13 00 (0.95%) (9.5%) (19.0%) (18.1%) (14.3%) (12.4%) (0.0%) Total 01 10 22 23 18 30 01 (0.95%) (9.5%) (20.9%) (21.9%) (17.1%) (28.6%) (0.95%) Male 00 08 13 14 15 31 01 Bazigar (0.0%) (2.6%) (4.3%) (4.6%) (4.9%) (10.2%) (0.3%) (n=303) Female 00 42 55 49 40 32 03 (0.0%) (13.9%) (18.1%) (16.2%) (13.2%) (10.6%) (1.0%) Total 00 50 68 63 55 63 04 (0.0%) (16.5%) (22.4%) (20.8%) (18.1%) (20.8%) (1.3%) Male 02 09 13 10 08 12 01 Bauria (1.0%) (4.4%) (6.4%) (5.0%) (3.9%) (5.9%) (0.5%) (n=202) Female 00 28 31 36 29 22 01 (0.0%) (13.9%) (15.3%) (17.8%) (14.4%) (10.9%) (0.5%) Total 02 37 44 46 37 34 02 (1.0%) (18.3%) (21.7%) (22.8%) (18.3%) (16.8%) (1.0%) Male 00 08 16 13 18 15 02 Sansi (0.0%) (3.3%) (6.6%) (5.4%) (7.5%) (6,2%) (0.8%) (n=241) Female 00 25 44 44 28 24 04 (0.0%) (10.4%) (18.3%) (18.3%) (11.6%) (10.0% (1.7%) Total 00 33 60 57 46 39 06 (0.0%) (13.7%) (24.9%) (23.6%) (19.1%) (16.2%) (2.5%) Male 00 00 00 05 03 03 00 Nat (n=55) (0.0%) (0.0%) (0.0%) (9.1%) (5.5%) (5.5%) (0.0%) Female 01 07 12 12 08 04 00 (1.8%) (12.7%) (21.8%) (21.8%) (14.5%) (7.3%) (0.0%) Total 01 07 12 17 11 07 00 (1.8%) (12.7%) (21.8%) (30.9%) (20.0%) (12.8%) (0.0%) Nasal Index

Table 7 presents the classification of nose type based on mean Nasal Index (NI) proposed by Martin and Saller (1957).

Table 7. Different nose types on the basis of Nasal Index (NI) according to Martin and Saller (1957).

Nose type Nasal Index Range (mm)

Leptorrhine < 69.9 Mesorrhine 70 – 84.9 Platyrrhine 85 – 99.9 Hyperplatyrrhine > 100

Table 8 shows the frequency distribution of different nose types in seven "denotified" tribes of Punjab. The table shows that mesorrhine nose type was commonly found in all of them with a frequency distribution ranging from 66.7% in the Bangala to 50.0% in the Bauria except for the Nat (38.2%). The frequency distribution of different nose types in the present Bangala, Bazigar, Bauria and Sansi "denotified" tribes of Punjab followed a sequence pattern mesorrhine > leptorrhine > platyrrhine > hyperplatyrrhine. While for the Gandhila and Barad the sequence pattern observed was mesorrhine > platyrrhine > leptorrhine > hyperplatyrrhine. Hyperplatyrrhine showed the lowest frequency in all the studied "denotified" tribes of the present study and the nose type was found absent in both the Sansi and Nat.

Table 8. Frequency distribution of nose types in 7 "denotified" tribes of Punjab, North West India.

Nasal index "Denotified" (NI) Nose type Male % Female % Total % tribe

< 69.9 Leptorrhine 3 2.2 9 6.7 12 8.9

Gandhila 70 – 84.9 Mesorrhine 15 11.2 59 44.0 74 55.2

85 – 99.9 Platyrrhine 8 6.0 36 26.9 44 32.9 > 100 Hyperplatyrrhine 0 0.0 4 3.0 4 3.0

Total 26 19.4 108 80.6 134 100

< 69.9 Leptorrhine 7 6.1 17 15.0 24 21.1

70 – 84.9 Mesorrhine 21 18.4 37 32.5 58 50.9

Barad 85 – 99.9 Platyrrhine 9 7.9 20 17.5 29 25.4

> 100 Hyperplatyrrhine 1 0.9 2 1.7 3 2.6

Total 38 33.3 76 66.7 114 100

< 69.9 Leptorrhine 4 3.8 23 21.9 27 25.7

70 – 84.9 Mesorrhine 21 20.0 49 46.7 70 66.7

Bangala 85 – 99.9 Platyrrhine 2 1.9 6 5.7 8 7.6

> 100 Hyperplatyrrhine 0 0.0 0 0.0 0 0.0

Total 27 25.7 78 74.3 105 100

< 69.9 Leptorrhine 13 4.3 53 17.5 66 21.8

70 – 84.9 Mesorrhine 51 16.8 133 43.9 184 60.7

Bazigar 85 – 99.9 Platyrrhine 20 6.6 31 10.2 51 16.8

> 100 Hyperplatyrrhine 0 0.0 2 0.6 2 0.6

Total 84 27.7 219 72.3 303 100

< 69.9 Leptorrhine 18 8.9 69 34.2 87 43.1

70 – 84.9 Mesorrhine 32 15.8 69 34.2 101 50.0

Bauria 85 – 99.9 Platyrrhine 4 2.0 9 4.5 13 6.4

> 100 Hyperplatyrrhine 1 0.5 0 0.0 1 0.5

Total 55 27.2 147 72.8 202 100

< 69.9 Leptorrhine 16 6.6 43 17.9 59 24.5

70 – 84.9 Mesorrhine 47 19.5 108 44.8 155 64.3 Sansi 85 – 99.9 Platyrrhine 9 3.7 18 7.5 27 11.2

> 100 Hyperplatyrrhine 0 0 0 0 0 0

Total 72 29.8 169 70.2 241 100

< 69.9 Leptorrhine 6 10.9 26 47.3 32 58.2

70 – 84.9 Mesorrhine 3 5.5 18 32.7 21 38.2

Nat 85 – 99.9 Platyrrhine 2 3.6 0 0.0 2 3.6

> 100 Hyperplatyrrhine 0 0.0 0 0.0 0 0.0

Total 11 20.0 44 80.0 55 100

Cephalic Index

Table 9 presents the classification of head types based on Cephalic Index (C.I.) as proposed by Martin and Saller (1957).

Table 9. Different head types on the basis of Cephalic Index (C.I.) according to Martin and Saller (1957).

Head type Cephalic Index range (mm) Dolichocephalic < 74.9 Mesocephalic 75 – 79.9 Brachycephalic 80 – 84.9 Hyperbrachycephalic > 85

The distribution frequency for different head types in present “denotified” tribes of Punjab is given in Table 10 according to which mesocephalic head was observed in the highest frequency among the Gandhila, Barad, Bazigar, Sansi and Nat ranging from as high as 57.4% in the Bazigar to 45.4% in the Nat. However, brachycephalic head type was observed in highest frequency in the Bangala (44.8%) and Bauria (42.1%). The sequence pattern for distribution of different head types in order of high to low frequency was observed to be similar in the Gandhila and Nat (mesocephalic > doliococephalic >brachycephalic > hyperbrachycephalic). While a similar pattern as mesocephalic >brachycephalic > dolicocephalic > hyperbrachycephalic was observed in the Barad, Bazigar and Sansi. The Bauria and Bangala showed a different pattern from rest of the five populations, the sequence pattern observed in former two populations was brachycephalic > mesocephalic > hyperbrachycephalic > dolicocephalic and brachycephalic > hyperbrachycephalic > mesocephalic > dolicocephalic.

Table 10. Distribution of head types in 7 "denotified" tribes of Punjab, North West India.

"Denotified" Cephalic Head type Male % Female % Total % tribe Index (CI)

< 74.9 Dolichocephalic 10 7.5 35 26.1 45 33.6

Gandhila 75 – 79.9 Mesocephalic 10 7.5 52 38.8 62 46.3

80 – 84.9 Brachycephalic 5 3.7 19 14.2 24 17.9

> 85 Hyperbrachycephalic 1 0.7 2 1.5 3 2.2

Total 26 19.4 108 80.6 134 100

< 74.9 Dolichocephalic 4 3.5 6 5.3 10 8.8

Barad 75 – 79.9 Mesocephalic 21 18.4 35 30.7 56 49.1

80 – 84.9 Brachycephalic 9 7.9 34 29.8 43 37.7

> 85 Hyperbrachycephalic 4 3.5 1 0.9 5 4.4

Total 38 33.3 76 66.7 114 100

< 74.9 Dolichocephalic 6 5.7 2 1.9 8 7.6

Bangala 75 – 79.9 Mesocephalic 15 14.3 8 7.6 23 21.9

80 – 84.9 Brachycephalic 4 3.8 43 41.0 47 44.8

> 85 Hyperbrachycephalic 2 1.9 25 23.8 27 25.7

Total 27 25.7 78 74.3 105 100

< 74.9 Dolichocephalic 34 11.2 29 9.6 63 20.8

Bazigar 75 – 79.9 Mesocephalic 43 14.2 131 43.2 174 57.4 80 – 84.9 Brachycephalic 7 2.3 57 18.8 64 21.1

> 85 Hyperbrachycephalic 0 0.0 2 0.7 2 0.7

Total 84 27.7 219 72.3 303 100

< 74.9 Doliochocephalic 7 3.4 6 3 13 6.4

Bauria 75 – 79.9 Mesocephalic 27 13.4 56 27.7 83 41.1

80 – 84.9 Brachycephalic 19 9.4 66 32.7 85 42.1

> 85 Hyperbrachycephalic 2 1 19 9.4 21 10.4

Total 55 27.2 147 72.8 202 100

< 74.9 Dolichocephalic 22 9.1 15 6.2 37 15.3

Sansi 75 – 79.9 Mesocephalic 41 17.0 71 29.5 112 46.5

80 – 84.9 Brachycephalic 9 3.7 70 29.1 79 32.8

> 85 Hyperbrachycephalic 0 0.0 13 5.4 13 5.4

Total 72 29.8 169 70.2 241 100

< 74.9 Dolichocephalic 3 5.5 11 20.0 14 25.5

Nat 75 – 79.9 Mesocephalic 6 10.9 19 34.5 25 45.4

80 – 84.9 Brachycephalic 2 3.6 11 20.0 13 23.6

> 85 Hyperbrachycephalic 0 0.0 3 5.5 3 5.5

Total 11 20.0 44 80.0 55 100

Table 11 presents gender wise distribution of stature, head and nose type in male and female subjects of the seven “denotified” tribes of Punjab. As inferred from the mean stature in male subjects of the seven “denotified” tribes, the short stature type was found most common in the Gandhila, Barad and Sansi populations followed by medium stature type in the Bauria males and upper medium in the Bazigar and Nat males. In contrast to this the female subjects of the “denotified” tribes showed a preponderance of medium stature in all except Gandhila and Sansi females among which upper medium stature was most commonly found. The mesorrhine nose type was most commonly observed for all “denotified” tribes of Punjab except for the Nat females in which leptorrhine nose type was most commonly observed and mesocephalic head type was most commonly observed in all “denotified” tribes of Punjab except in the Bauria and Bangala females in which brachycephalic head type was found to be most common.

Table 11. Gender wise distribution of the stature, head type and nose type in 7"denotified" tribes of Punjab.

"Denotified" Mean Stature type Mean Mean tribe Gender Stature Nasal Nose type Cephalic Head type (mm) Index Index Gandhila Male 1563.8 Short 79.6 Mesorrhine 77.1 Mesocephalic Female 1577.1 Upper medium 82.5 Mesorrhine 76.5 Mesocephalic Barad Male 1532.1 Short 80.5 Mesorrhine 79.6 Mesocephalic Female 1536.3 Medium 79.0 Mesorrhine 79.2 Mesocephalic Bangala Male 1714.2 Tall 76.5 Mesorrhine 78.2 Mesocephalic Female 1542.6 Medium 83.6 Mesorrhine 83.1 Brachycephalic Bazigar Male 1678.6 Upper medium 78.7 Mesorrhine 75.4 Mesocephalic Female 1538.5 Medium 75.7 Mesorrhine 78.2 Mesocephalic Bauria Male 1650.9 Medium 73.8 Mesorrhine 78.6 Mesocephalic Female 1537.3 Medium 70.5 Mesorrhine 80.7 Brachycephalic Sansi Male 1596.9 Short 84.9 Mesorrhine 78.6 Mesocephalic Female 1571.6 Upper medium 71.5 Mesorrhine 79.0 Mesocephalic Nat Male 1677.3 Upper medium 72.4 Mesorrhine 76.9 Mesocephalic Female 1532.6 Medium 68.4 Leptorrhine 77.7 Mesocephalic

A1A2BO and RH(D) blood groups

The results of serological analysis are presented in Table 12-13. No typing could be done for the Barad population due to haemolysis of blood during the transportation from field area to the laboratory. Table 12 shows the observed phenotype numbers of A1A2BO blood groups for six "denotified" tribes of Punjab investigated. The frequency of phenotype B was observed high in the Gandhila (38.05%), Sansi (52.61%) and Bauria (52.74%) whereas the phenotype O showed high frequency in the Bangala (49.52%), Nat (42.00%) and Bazigar (42.96%). Phenotype A2 was found in low proportions in all "denotified" tribes of Punjab (range 0.88% in Gandhila - 6.67% in Bangala) barring the Bauria. The phenotype A2B was not observed in the Bangala and Bauria while it was found in low frequency in the Bazigar (0.43%) and Sansi (1.61%). Hardy Weinberg Chi-square test revealed that barring the Nat (χ2=10.4621, p<0.05, statistically significant) all studied populations were in genetic equilibrium with respect to the distribution of A1A2BO blood groups. One possible reason for genetic disequilibrium in the Nat may be the genetic drift due to its small sample size.

Table 12. Distribution of the A1A2BO blood groups in "denotified" tribes of Punjab. 2 χ HW “Denotified” Number A1 A2 B A1B A2B O (d.f. 2) tribe tested Gandhila 113 25 01 43 21 02 21 3.1844 (22.12) (0.88) (38.05) (18.58) (1.77) (18.58) Bangala 105 22 07 22 02 00 52 1.8993 (20.95) (6.67) (20.95) (1.90) (0.00) (49.52) Nat 50 11 01 13 02 02 21 10.4621* (22.00) (2.00) (26.00) (4.00) (4.00) (42.00) Bazigar 233 30 03 85 16 01 98 2.0255 (12.88) (1.29) (36.48) (6.87) (0.43) (42.06) Sansi 249 26 09 131 21 04 58 1.5513 (10.44) (3.61) (52.61) (8.43) (1.61) (23.29) Bauria 201 17 00 106 10 00 68 0.0087 (8.46) (0.00) (52.74) (4.98) (0.00) (33.83) Figures in parentheses are percentages *Statistically significant (p≤ 0.05)

For RH(D) blood group system (Table 13). The absence of RH(D)- phenotype is considered to be a tribal characteristic in populations of India which in the present study was the case observed in the Nat "denotified" tribe. However, RH(D)- phenotype was detected in other 5 "denotified" tribes of Punjab, albeit in low frequency, ranging from 1.77% (Gandhila) to 8.03% (Sansi). Table 13. Distribution of the RH(D) blood groups in "denotified" tribes of Punjab.

“Denotified” tribe Number tested RH(D) + RH(D) –

Gandhila 113 111 (98.23) 02 (1.77)

Bangala 105 99 (94.29) 06 (5.71)

Nat 50 50 (100.00) 00 (0.00)

Bazigar 233 222 (95.28) 11 (4.72)

Sansi 249 229 (91.97) 20 (8.03)

Bauria 201 190 (94.53) 11 (5.47)

Figures in parentheses are percentages.

Distribution of allele frequencies for the A1A2BO blood groups for the studied six “denotified” tribes of Punjab are presented in Table 14. The frequency of the B allele was found to be high in all the "denotified" tribes of Punjab ranging from 0.1235 in the Bangala to 0.3888 in the Sansi and the frequency of allele A1 was observed in a range of 0.0695 in the Bauria to 0.2243 in the Gandhila while, A2 was detected in low frequency (range 0.0097 in the Bazigar to 0.0461 in the Bangala) in all but the Bauria "denotified" tribe of Punjab. Overall the distribution pattern of A1A2BO locus allele frequencies observed in the "denotified" tribes of Punjab was 0>B>A1>A2. At the RH(D) locus, the frequency of d allele was observed low in the "denotified" tribes of Punjab ranging from 0.1330 (Gandhila) to 0.2834 (Sansi) while the allele was lacking in the Nat.

Table 14. Distribution of the allele frequencies of the A1A2BO and RH(D) blood group systems in six "denotified" tribes of Punjab.

Allele frequencies “Denotified” A1A2BO RH(D) tribe A1 A2 B O D d Gandhila 0.2243 0.0099 0.3437 0.4221 0.8670 0.1330 Bangala 0.1226 0.0461 0.1235 0.7078 0.7609 0.2391 Nat 0.1411 0.0155 0.1856 0.6578 1.0000 0.0000 Bazigar 0.1029 0.0097 0.2471 0.6402 0.7827 0.2173 Sansi 0.0986 0.0357 0.3888 0.4769 0.7166 0.2834 Bauria 0.0695 0.0000 0.3494 0.5811 0.7661 0.2339

Contingency χ2 test

Contingency χ2 test was conducted to study overall inter-group variation among the six "denotified" tribes of Punjab with respect to A1A2BO and RH(D) blood group systems and the results are presented in Tables 15 and 16, respectively. The contingency χ2 for A1A2BO blood groups (χ2=130.2237, p<0.05 at 25 d.f.) demonstrated statistically significant heterogeneity among the six "denotified" tribes of Punjab. However, the contingency χ2 test for RH(D) blood groups (χ2 = 9.5794, p>0.05 at 5 d.f.) revealed no such inter-group differences demonstrating genetic homogeneity among the six "denotified" tribes of Punjab for RH(D) blood groups distribution.

Table 15. Contingency Chi Square test for the A1A2BO blood group system among six "denotified" tribes of Punjab

Phenotype Number Gandhila Bangala Nat Bazigar Sansi Bauria Chi square (d.f. 25)

A1 Obs. No. 25 22 11 30 26 17

Exp. No. 15.56 14.46 6.88 32.10 34.30 27.68

A2 Obs. No. 01 07 01 03 09 00

Exp. No. 2.49 2.31 1.10 5.14 5.49 4.44 B Obs. No. 43 22 13 85 131 106 130.2237 Exp. No. 47.52 44.16 21.03 98.00 104.73 84.54 A1B Obs No. 21 02 02 16 21 10 Exp. No. 8.55 7.95 3.78 17.64 18.85 15.21 A2B Obs. No. 02 00 02 01 04 00 Exp. No. 1.07 0.99 0.47 2.20 2.35 1.90 0 Obs. No. 21 52 21 98 58 68 Exp. No. 37.78 35.11 16.72 77.91 83.26 67.21

Obs. No. = Observed number, Exp. No. = Expected number Table 16. Contingency Chi Square test for the RH(D) blood group system among six "denotified" tribes of Punjab.

Phenotype Number Gandhila Bangala Nat Bazigar Sansi Bauria Chi square (d.f. 5) RH(D) + Obs. No. 111 99 50 222 229 190 Exp. No. 107.06 99.48 47.37 220.75 235.91 190.43 9.5794 RH(D) - Obs. No. 02 06 00 11 20 11 Exp. No. 5.94 5.52 2.63 12.25 13.09 10.57 Obs. No. = Observed number, Exp. No. = Expected number.

Heterozygosity

In the present study the heterozygosity (h), a measure of genetic variation, was estimated at the A1A2BO and RH(D) loci in the six “denotified” tribes of Punjab following Nei (1973) and the results are presented in Table 17. For A1A2BO locus h was found to be high for all the seven “denotified" tribes of Punjab ranging from 0.4666 in the Bangala to 0.6533 in the Gandhila with an average of 0.5495. For RH(D) locus, heterozygosity was observed nil in the Nat while in the remaining “denotified” tribes of Punjab the range was 0.2306 in the Gandhila to 0.4062 in the Sansi with an average of 0.2832. The average heterozygosity (H) for both A1A2BO and RH(D) varied from 0.2564 in the Nat to 0.5084 in the Sansi.

Table 17. Heterozygosity (h) values at the A1A2BO and RH(D) loci in six "denotified" tribes of Punjab.

“Denotified” tribe Heterozygosity (h) Average Heterozygosity (H) A1A2BO RH(D) Gandhila 0.6533 0.2306 0.4420 Bangala 0.4666 0.3639 0.4153 Nat 0.5127 0.0000 0.2564 Bazigar 0.5184 0.3402 0.4293 Sansi 0.6105 0.4062 0.5084 Bauria 0.5354 0.3584 0.4469 Average 0.5495 0.2832 0.4164 Gene diversity and differentiation

Nei's gene diversity estimates (Nei, 1973) for the A1A2BO and RH(D) in the seven “denotified” tribes of Punjab are presented in Table 18. For A1A2BO locus the total gene diversity (HT) was high 0.5715 and most of it was attributed to the intra-populational gene diversity (HS) 0.5495 than the inter-populational gene diversity (DST) 0.0220. For RH(D) locus total genetic diversity was found moderate (HT) 0.3009 , and like A1A2BO locus, most of it was due to intra-populational gene diversity (HS) 0.2832 while only a small fraction (0.0177) was due to inter-populational gene diversity (DST). The coefficient of gene differentiation (GST) at A1A2BO locus was 0.0386 which was less than that obtained at RH(D) locus (0.0588), with an average of 0.0487 at both serological loci.

Table 18. Coefficient of gene differentiation (GST) at the A1A2BO and RH(D) loci in 6 "denotified" tribes of Punjab, North West India

Total gene Intra- Inter- Coefficient of diversity of populational populational gene Locus the population gene diversity gene diversity differentiation

(HT) (HS) (DST) (GST)

A1A2BO 0.5715 0.5495 0.0220 0.0386

RH(D) 0.3009 0.2832 0.0177 0.0588

Average 0.4362 0.4164 0.0199 0.0487

Genetic Distance To study genetic relationships among the present "denotified" tribes of Punjab, the Nei's measure of genetic distance (D) was estimated from the allele frequencies and the results are presented in Table 19. The D value varied from a low of 0.0058 between the Bazigar and Nat, suggesting close genomic affinities between them to as high as 0.1526 between the Gandhila and Bangala suggesting little affinities between them.

Table 19. Pair wise genetic distance (D) among various "denotified" tribes of Punjab.

“Denotified” Gandhila Bangala Nat Bazigar Sansi Bauria tribe Gandhila - Bangala 0.1526 - Nat 0.0964 0.0064 - Bazigar 0.0770 0.0202 0.0058 - Sansi 0.0279 0.1324 0.0847 0.0504 - Bauria 0.0521 0.0725 0.0405 0.0160 0.0133 -

An UPGMA dendrogram was constructed using this distance matrix (Table 19) and is presented in Fig. 9. The figure shows that the present "denotified" tribes of Punjab were placed into two sub-clusters, each with three "denotified" tribes - one cluster comprised the Sansi, Bauria and Gandhila while the other included the Bazigar, Nat and Bangala.

Fig. 9. UPGMA Tree depicting genetic affinities among the six "denotified" tribes of Punjab based on blood groups data.

Alu Ins/Del POLYMORPHISMS

Distribution of Alu Ins/Del genotype counts The observed genotype numbers for the 8 Alu Ins/Del loci studied in the 7 "denotified" tribes of Punjab were tested for genetic equilibrium by Hardy–Weinberg (HW) χ2 goodness of fit test and for inter-group heterogeneity by the contingency χ2 test (Table 20). The results showed that the distribution of genotypes of Alu ACE, APO, FXIIIB and PV92 were in Hardy–Weinberg equilibrium (HWE) in all the seven "denotified" tribes investigated. Overall statistically significant departures were observed for 11 out of total 56 HWE tests. Notably as many as 6 of the 11 departures were found at D1 locus, while CD4 locus showed significant departures in the Bazigar and Sansi, PLAT locus showed such departures in the Gandhila and Barad and TPA25 locus showed it only in the Gandhila. Further, to rule out fluke findings as a result of expected genotype number obtained as less than 5, Yates’ correction was applied for CD4 locus in the Sansi and for PLAT locus in the Barad. Contingency χ2 test was carried out at each of the eight loci with respect to seven populations and the χ2 values were found to be statistically significant (p≤ 0.05 at 12 d. f.) for all of them (Table 10).

2 Table 20. Observed genotype numbers, allele frequencies, H.-W. Chi-square (χ H-W) and

2 Contingency χ for eight Alu Ins/Del loci in the seven "denotified" tribes of Punjab

Contingency 2 2 Marker "Denotified" Number Genotype numbers Allele χ H-W χ locus tribe tested observed frequencies (d.f. 1) (d.f. 12) I/I I/D D/D I D

APO Gandhila 92 79 12 1 0.9239 0.0761 0.0723 Barad 104 51 47 6 0.7163 0.2837 1.3056

Bangala 78 44 25 9 0.7244 0.2756 3.0380 154.4945* Bazigar 200 160 35 5 0.8875 0.1125 2.1803 Bauria 198 82 95 21 0.6540 0.3460 0.7181 Sansi 190 165 25 0 0.9342 0.0658 0.9422 Nat 60 45 12 3 0.85 0.15 1.7542

ACE Gandhila 100 14 52 34 0.4000 0.6000 0.6945

Barad 96 55 32 9 0.7396 0.2604 1.7404

Bangala 96 48 44 4 0.7292 0.2708 2.4711

Bazigar 192 72 87 33 0.6016 0.3985 0.5755 78.8431* Bauria 189 60 90 39 0.5556 0.4444 0.2411 Sansi 192 63 102 27 0.5937 0.4063 1.9670 Nat 58 29 26 3 0.7241 0.2759 0.8636

CD4 Gandhila 86 73 11 2 0.9128 0.0872 1.6485

Barad 100 88 10 2 0.9300 0.0700 2.8086

Bangala 85 83 2 0 0.9882 0.0118 0.0120

Bazigar 194 154 26 14 0.8608 0.1392 35.0145* 64.6330* Bauria 195 186 9 0 0.9770 0.0230 0.1088 Sansi 197 189 6 2 0.9746 0.0254 16.3156#* Nat 61 47 12 2 0.8688 0.1312 0.4735

D1 Gandhila 98 48 18 34 0.5612 0.4388 38.5341*

Barad 98 12 18 68 0.2143 0.7857 20.2480*

Bangala 104 18 24 62 0.2885 0.7115 19.9370*

Bazigar 195 81 42 72 0.5231 0.4769 62.9800* 116.7084* Bauria 195 30 42 123 0.2615 0.7385 38.1653* Sansi 201 87 24 90 0.4925 0.5075 116.446* Nat 58 5 22 31 0.2759 0.7241 0.1484

FXIIIB Gandhila 96 18 52 26 0.4583 0.5417 0.7934

Barad 94 34 50 10 0.6277 0.3723 1.7905

Bangala 96 46 36 14 0.6667 0.3333 2.3437 Bazigar 201 54 105 42 0.5299 0.4701 0.4731 41.1978* Bauria 192 57 84 51 0.5157 0.4843 2.9591 Sansi 180 69 81 30 0.6083 0.3917 0.5578 Nat 61 13 29 19 0.4508 0.5492 0.0970

PLAT Gandhila 91 24 61 6 0.5989 0.4011 14.2167*

Barad 101 9 24 68 0.2080 0.7920 6.8334#*

Bangala 97 8 47 42 0.3247 0.6753 1.0656

Bazigar 195 48 87 60 0.4692 0.5308 2.1213 144.6662* Bauria 191 35 88 68 0.4136 0.5864 0.4810 Sansi 197 18 99 80 0.3426 0.6574 2.6313 Nat 60 28 29 3 0.7083 0.2917 1.7288

PV92 Gandhila 95 9 43 43 0.3210 0.6790 0.1390

Barad 95 36 50 9 0.6421 0.3579 2.0010

Bangala 96 20 52 24 0.4792 0.5208 0.6971 56.1548* Bazigar 183 36 88 59 0.4372 0.5628 0.0952

Bauria 195 21 99 75 0.3616 0.6384 1.9390

Sansi 188 41 88 59 0.4521 0.5479 0.5722

Nat 60 13 29 18 0.4583 0.5417 0.0423

TPA25 Gandhila 94 26 62 6 0.6064 0.3936 13.6951*

Barad 96 32 40 24 0.5417 0.4583 2.4834

Bangala 96 40 42 14 0.6354 0.3646 0.2982

Bazigar 194 78 96 20 0.6495 0.3505 1.4628 Bauria 190 42 95 53 0.4710 0.5290 0.0021 52.7877* Sansi 191 57 105 29 0.5733 0.4267 2.9190 Nat 60 22 32 6 0.6333 0.3667 1.3200

*Statistically significant (p≤0.05) #* Yates' correction applied

Distribution of Alu Ins/Del allele frequencies Out of the eight Alu Ins/del loci, 7 are insertion polymorphisms while 1 locus (CD4) is a deletion polymorphism and All of them were polymorphic in the present material of the seven "denotified" tribes of Punjab. The allele frequencies were calculated by the gene counting method (Mourant et al., 1976) and are listed in Table 10. It was observed that the APO (I) allele was found with high frequency ranging from 0.6540 in the Sansi to 0.9342 in the Bauria. Whereas, CD4 (D) allele was observed with low frequency in all the seven "denotified" tribes, ranging from 0.0118 in the Bangala to 0.1392 in Bazigar. ACE (I) allele was found with moderate to high frequency as 0.4000 in the Gandhila to 0.7396 in the Barad. For PLAT (I) allele the range was observed from as low of 0.2080 in the Barad to as high of 0.7083 in Nat. Similarly, D1 (I) allele was found in the range of 0.2143 in the Barad to 0.5612 in Gandhila. The (I) allele of FXIIIB (ranging from 04508 in the Nat to 0.6667 in the Bangala) and TPA25 (ranging from 04710 in the Bauria to 0.6495 in the Bazigar) was found to have moderate frequencies in the present populations. Fig. 10 demonstrates the distribution of insertion/deletion allele frequency at 8 Alu loci studied in the seven “denotified” tribes of Punjab.

1 0.9 0.8 Gandhila 0.7 Barad 0.6 Bangala 0.5 Bazigar 0.4 Bauria 0.3 Sansi 0.2 Nat 0.1 0 APO ACE CD4 D1 FXIIIB PLAT PV92 TPA25

Fig. 10. Distribution of insertion/deletion allele frequency for eight Alu loci studied in seven “denotified” tribes of Punjab.

Heterozygosity (h) Heterozygosity estimates were obtained from eight Alu Ins/Del markers in the seven denotified tribes of Punjab following the method of Nei (1973) and the results are presented in Table 21. Considerably high heterozygosity estimates were found at 6 Alu loci viz., ACE (range 0.3852-0.4582), D1 (range 0.3367-0.4999), PLAT (range 0.3294-0.4981), PV92 (range 0.4054- 0.4991), TPA25 (range 0.4553-0.4987), FXIIIB (range 0.4444-0.4995) across all seven populations investigated, while low amount of heterozygosity was observed at CD4 locus (range 0.0232-0.2396). The average heterozygosity (H) was considerably high for all the seven “denotified” tribes ranging from 0.3721 in the Sansi to 0.4202 in the Bazigar.

Table 21. Locus wise distribution of Nei’s heterozygosity (h) and average heterozygosity (H) in 7 "denotified" tribes of Punjab

Heterozygosity (h) Average heterozygosity "Denotified" APO ACE CD4 D1 FXIIIB PLAT PV92 TPA25 tribe (H) Gandhila 0.1406 0.4800 0.1592 0.4925 0.4965 0.4804 0.4360 0.4774 0.3953

Barad 0.4064 0.3852 0.1302 0.3367 0.4674 0.3294 0.4596 0.4965 0.3764

Bangala 0.3993 0.3950 0.0232 0.4105 0.4444 0.4386 0.4991 0.4633 0.3842

Bazigar 0.1997 0.4794 0.2396 0.4990 0.4982 0.4981 0.4921 0.4553 0.4202

Bauria 0.4525 0.4938 0.0451 0.3863 0.4995 0.4851 0.4617 0.4983 0.4153

Sansi 0.1230 0.4824 0.0495 0.4999 0.4765 0.4505 0.4054 0.4892 0.3721

Nat 0.2550 0.3995 0.2280 0.3995 0.4952 0.4132 0.4965 0.4644 0.3939

Nei's gene diversity analysis

Gene diversity estimates (HS, HT and DST) and the coefficient of gene differentiation (GST) at eight Alu Ins/Del loci in the seven "denotified" tribes of Punjab following Nei (1973) are

presented in Table 22. The results showed that the total gene diversity (HT) in the present populations ranged between 0.1297 (CD4) and 0.4972 (PLAT) with an average of 0.4181. Most

of it was attributable to intra-subpopulational gene diversity (HS) with an average of 0.3988 (ranging from 0.1250 at CD4 to 0.4825 at FXIIIB). By comparison, the inter-subpopulational gene

diversity (DST) was rather low ranging from 0.0047 at CD4 to 0.0550 at PLAT loci. The coefficient

of gene differentiation (GST) was quite high ranging from 0.0146 for TPA25 to 0.1106 for PLAT with an average of 0.0540, demonstrating a high degree of gene differentiation among the seven "denotified" tribes of Punjab.

Table 22. Gene diversity estimates (HS, HT, DST) and the coefficient of gene differentiation

(GST) at eight Alu loci in the 7 "denotified" tribes of Punjab.

Total gene Intra- Inter- Coefficient of gene Locus diversity of the subpopulational subpopulational differentiation population gene diversity gene diversity (GST) (HT) (HS) (DST) APO 0.3042 0.2823 0.0219 0.0720 ACE 0.4709 0.4450 0.0259 0.0550 CD4 0.1297 0.1250 0.0047 0.0362 D1 0.4682 0.4321 0.0361 0.0771 FXIIIB 0.4948 0.4825 0.0123 0.0249 PLAT 0.4972 0.4422 0.0550 0.1106 PV92 0.4950 0.4772 0.0178 0.0360 TPA25 0.4848 0.4777 0.0071 0.0146 Average 0.4181 0.3955 0.0226 0.0540

Genetic distance The pair wise standard genetic distances (D) were estimated from the observed allele frequencies using the method of Nei (1972) and the results are listed in Table 23. It was evident from this table that the genetic distance between the Bazigar and Sansi was lowest (0.0088), suggesting their genetic closeness while D value was highest (0.1227) between the Barad and Gandhila, suggesting their little genetic affinities. A tree depicting genomic relationships among seven "denotified" tribes of Punjab based on Alu Ins/Del markers is depicted in Fig. 11

Table 23. Pair wise genetic distance (D) among the various "denotified" tribes of Punjab based on Alu Ins/Del markers. "Denotified" Gandhila Barad Bangala Bazigar Bauria Sansi Nat tribe Gandhila - Barad 0.1227 - Bangala 0.0794 0.0121 - Bazigar 0.0175 0.0592 0.0326 - Bauria 0.0535 0.0230 0.0222 0.0393 - Sansi 0.0317 0.0419 0.0231 0.0088 0.0347 - Nat 0.0477 0.0735 0.0470 0.0301 0.0440 0.0512 -

Fig. 11. UPGMA Tree depicting genomic relationships among seven "denotified" tribes of Punjab based on Alu Ins/Del markers.

DISCUSSION Stature, Nasal Index and Cephalic Index

Table 24 presents the mean stature (mm) of the present “denotified” tribes of Punjab as well as various other tribal and non tribal populations from India. Most of the data reported was for males, whereas very little data was available on females. It was evident that 7 out of the 9 tribes reported from Central India had lower medium stature (reported for males) and the mean stature ranged from 1611.6 mm in the Kol to 1631.9 mm in the Oraon tribe (Gautam and Adak, 2008). The males of Halba tribe (mean 1613.1 mm) from Central India and females of Santhal tribe (mean 1510.4) from East India also had lower medium stature (Ghosh and Malik, 2006).

With respect to their mean stature, out of the present seven "denotified" tribes of Punjab, none was observed to have lower medium stature. Short stature was common in males of the Sansi, Gandhila and Barad. These present results were similar to that reported in males of Santhal tribe (1598.4 mm) from West Bengal, and the Majhi (1584.3 mm) and Korwa tribes (1551.2 mm) from Central India. Medium stature was commonly observed among Bauria males (1650.9 mm) and the upper medium stature was common in the Bazigar (1678.6 mm) and Nat males (1677.3 mm) while tall stature was most common in the Bangala males (1714.2 mm) similar to that reported from Jat Sikh males (1704.0 mm) from Punjab and Gujjar males (1723.1 mm) from North India.

The medium stature was commonly observed among females of the Bauria (1537.3 mm), Nat (1532.6 mm), Bazigar (1538.8 mm), Bangala (1542.6 mm) and Barad (1536.8 mm) "denotified" tribes of Punjab. These results were similar to those reported for the Santhal females tribe (1510.4 mm). Upper medium stature was common in the Gandhila (1577.1 mm) and Sansi (1571.6 mm) females which was similar to that reported for the Jat Sikh females (1579.1 mm) (Table 24).

As for the nose types, the present findings suggest that the mesorrhine (medium nose) was common in the males of the seven "denotified" tribes of Punjab with mean Nasal Index (NI) ranging from 72.4 (Nat) to 84.9 (Sansi). Similar results were observed in the females (except for the Nat females who had leptorrhine (fine nose) type of nose with mean NI 68.4) with mean NI ranging from 70.5 in the Bauria to 83.6 in the Bangala (Table 24). These findings were similar to nose type of various caste and tribal populations reported from North, West India and Central India (Table 24).

As for the head types, the mean Cephalic Index (CI) observed in 7 "denotified" tribes of Punjab demonstrated that mesocephalic head type was common in males and females with mean CI ranging from 75.4 to 79.6. Whereas, brachycephalic head type was observed only in the Bangala (mean CI = 83.1) and the Bauria (mean CI = 80.7) females (Table 24). The present results on mesocephaly preponderance were similar to that reported from Bhil, Barelia, Halba and Gond tribes from Central (Bhargav and Kher, 1961; Ghosh and Malik, 2006; Chatterjee et al., 2015) as well as to the populations from West (Uttekar et al., 2013; Jadhav et al., 2011; Jaiswal et al., 2016) India. While the Brachycephalic head type observed common among the present Bangala and Bauria females was similar to that reported from North India populations (Anupama et al., 2010, Seema and Verma, 2016). Table 24. Mean stature, NI and CI in seven “denotified tribes” of Punjab and in various other tribal and non tribal populations of India. Mean Stature Mean Nasal Index Mean Cephalic Index Population Area (mm) (NI) (CI) Reference Male Female Male Femal Male Female e Gandhila North India 1563.8 1577.1 79.6 82.5 71.1 76.5 Present study Barad North India 1532.1 1536.3 80.5 79.0 79.6 79.2 Present study Bangala North India 1714.2 1542.6 76.5 83.6 78.2 83.1 Present study Bazigar North India 1678.6 1538.5 78.7 75.7 75.4 78.2 Present study Bauria North India 1650.9 1537.3 73.8 70.5 76.6 80.7 Present study Sansi North India 1596.9 1571.6 84.9 71.5 78.6 79.0 Present study Nat North India 1677.3 1532.6 72.4 68.4 76.9 77.7 Present study Jat Sikh North India 1704.0 - Singh et al. (1988) Jat Sikh North India - 1579.1 Sidhu et al. Bania North India - 1542.8 (1982) Bania North India 70.0 Jat Sikh North India 72 Singla (2005) Majhabi-Sikh North India 76.5 Brahmin North India 70.2 69.9 Mazhabi Sikh North India 76.5 68.9 Kaushal et al. Muslim North India 67.0 69.4 (2013) Punjabi North India - - - - 84.4 82.1 Mahajan et al. Population (2009) Punjabi North India - - - - 80.5 84.3 Seema and Verma Population (2016) Bania North India 1687.1 1551.8 - - - - Kumar and Patnaik (2013) Koli North India 1526.5 - Krishan and Kumar (2007) Gujjar North India 1723.1 - Krishan (2008) Indian North India 1688.6 1563.9 Asha and Prabha population (2011) UP Population North India 75.8 72.1 Ray et al. (2016) Indian South India 1696.2 1568.2 Asha and Prabha population (2011) Santhal Tribe East India 1598.4 1510.4 79.7 79.4 73.4 75.9 Ghosh and Malik (2006) Orissa East India 77.3 78.4 Patro et al. (2014) Population Bhil Tribe Central India 76.9 Bhargav and Kher (1960) Barela Tribe Central India 79.8 Bhargav and Kher (1961) Bhil Tribe Central India 1614.2 - Gautam and Adak (2008) Gond Tribe Central India 1623.5 - 79.9 77.5 Gautam and Adak (2008) Kol Tribe Central India 1611.6 - Gautam and Adak (2008) Korku Tribe Central India 1624.5 - Gautam and Adak (2008) Majhi Tribe Central India 1584.3 - Gautam and Adak (2008) Oraon Tribe Central India 1631.9 - Gautam and Adak (2008) Sonr Tribe Central India 1620.6 - Gautam and Adak (2008) Korwa Tribe Central India 1551.2 - Gautam and Adak (2008) Saharia Tribe Central India 1627.8 - Gautam and Adak (2008) Halba Tribe Central India 1613.1 81.7 Chatterjee et al. (2015) Ahirwar Central India 81 82.4 73.7 73.4 Dhangi Central India 76.5 76.2 71.9 71.6 Singh and Purkit (2006) Bhopal Central India - - 81.2 80.3 Nair et al. (2014) Reva Central India 75.8 79.2 Mishra et al. (2014) Gujarat West India 1659.2 - 81.2 80.4 Jadhav and Shah Population (2004) Gujarat West India - 82.5 Uttekar et al. Population (2013) Bheel Meena West India - - 83.0 79.7 - - Gangrade (2012) Rabari West India 80.8 - Bhil West India 80.8 - Sindhi West India 77.8 - Jadhav et al. Siddi West India 78.8 - (2011) Sindhi West India 82.8 - Patel West India 81.0 - Kharwa West India 79.8 - Bania West India 77.0 78.0 Brahmin West India 75.7 78.3 Jat West India 76.7 78.8 Jaiswal et al. Meena West India 77.0 78.6 (2016) Others West India 78.1 77.3 Jat West India 68.1 Choudhary et al. Sindhi West India 70.7 (2012)

A1A2BO and RH(D) blood group systems

Table 25 presents the distribution of A1+A2, B, O and RH allele frequencies in different caste and tribal populations of India. In the present study the average frequencies of A1+A2 (range 0.0695-0.2342), B (range 0.1235-0.3888) and O (range 0.4221-0.7071) alleles for six (out of seven) "denotified" tribes of Punjab were 0.1459, 0.2730 and 0.5809, respectively. These frequencies were not comparable with the allele frequency data of other caste populations of Punjab, viz., the Jat Sikh (0.216, 0.239, 0.545) and the Khatri (0.283, 0.320, 0.442) (Kaur et al., 1981). On the other hand, the present ABO results were similar to the A, B, O allele frequencies of the scheduled caste population of Punjab reported by Kaur et al. (1981) (0.196, 0.274, 0.530) and the Balmiki (0.1840, 0.2560, 0.5600), Dhanak (0.1570, 0.3230, 0.5200), Ravidasi (0.1850, 0.2870, 0.5790) and Ramdasi (0.1710, 0.2460, 0.5690) Scheduled Castes of Punjab (Sidhu, 2003). The present results were also similar to the 7 nomadic tribal populations of Rajasthan with average values being 0.209, 0.286, 0.505, respectively for A1+A2, B and O alleles (Sachdev, 2012) as well as the tribal Bhil of Rajasthan (Alisha, 2017) with frequencies 0.2008, 0.2143 and 0.5848, respectively for A1+A2, B and O alleles (Table 25). The average Rh(D) + allele frequency was observed high (range 0.7166-1.0000) in the present "denotified" tribes of Punjab. The results were similar to those reported in were reported for four Scheduled Caste populations viz., the Balmiki (0.8330), Dhanak (0.8420), Ravidasi (0.8270) and Ramdasi (0.8450) (Sidhu, 2003) and the Jat Sikh (0.8451) of Punjab (Kaur, 2017) as well as with 7 nomadic tribal populations of West (range 0.8650-1.000; Sachdev, 2012), while the tribal Bhil surprisingly showed moderate frequency for Rh(D)+ allele (0.6914) (Alisha, 2017) (Table 25).

Table 25. Distribution of ABO and RH(D) allele frequencies in different caste and tribal populations of India Distribution of allele frequencies Population Region A/ B O D D Reference A1+A2 Gandhila North India 0.2342 0.3437 0.4221 0.8670 0.1330 Bangala North India 0.1687 0.1235 0.7078 0.7609 0.2391 Nat North India 0.1566 0.1856 0.6578 1.0000 0.0000 Present study Bazigar North India 0.1126 0.2471 0.6402 0.7827 0.2173 Sansi North India 0.1343 0.3888 0.4769 0.7166 0.2834 Bauria North India 0.0695 0.3494 0.5811 0.7661 0.2339 Jat Sikh North India 0.2160 0.3490 0.5450 Kaur et al. Khatri North India 0.2830 0.3200 0.4420 (1981) Scheduled Castes North India 0.1960 0.2740 0.5340 Jat Sikh North India 0.1560 0.2440 0.5998 0.8451 0.1549 Kaur (2017) Balmiki North India 0.1840 0.256 0.5600 0.8330 0.1670 Dhanak North India 0.1570 0.323 0.5200 0.8420 0.1580 Sidhu (2003) Ravidasi North India 0.1850 0.287 0.5790 0.8270 0.1730 Ramdasi North India 0.1710 0.246 0.5690 0.8450 0.1550 Brahmin North India 0.1988 0.3100 0.4906 0.7261 0.2739 Mukhopadhyay Rajput North India 0.2561 0.3288 0.4151 0.7838 0.2161 and Kshatriya (2004) Malha North India 0.0400 0.3560 0.6040 0.9000 0.1000 Banjara North India 0.2860 0.3600 0.3540 0.5940 0.4060 Jaggi et al. Kumhar North India 0.2200 0.3680 0.4120 0.6610 0.3390 (2014) Saini North India 0.2310 0.3220 0.4470 0.8000 0.2000 Syed North India 0.2833 0.1781 0.5476 0..6559 0.3441 Sheikh North India 0.2386 0.2079 0.5592 0.5631 0.4369 Pathan North India 0.2098 0.1953 0.6020 0.6616 0.3384 Shia North India 0.1654 0.2952 0.5419 0.5835 0.4165 Hussain et al. Sherwani North India 0.1995 0.2163 0.5925 0.5687 0.4313 (2013) Ansari North India 0.2115 0.2576 0.5370 0.5959 0.4041 Buksa North India 0.2839 0.1904 0.5256 0.8833 0.1167 Singh et al. (2013) Hindu East India 0.1900 0.2100 0.6000 - - Chakraborty Muslim East India 0.1800 0.1900 0.6300 - - (2011) Banjara West India 0.1950 0.2610 0.5440 0.8950 0.105 Natt West India 0.2190 0.3550 0.4260 0.8910 0.1.9 Sapara West India 0.2100 0.2610 0.5720 0.8360 0.164 Bawariya West India 0.0880 0.340 0.5720 0.8650 0.135 Sachdev (2012) Sansui West India 0.2580 0.3340 0.4080 1.0000 Nil Bhopa West India 0.2750 0.2090 0.5720 0.8650 0.135 Gujjar West India 0.1910 0.2200 0.5890 1.0000 Nil Rajput West India 0.1955 0.2288 0.5757 0.7263 0.2737 Alisha et al. Bhil West India 0.2008 0.2143 0.5848 0.6914 0.3086 (2017)

Alu Ins/Del polymorphisms

Table 26 presents the distribution of allele frequencies of six Alu loci (ACE, APO, CD4, D1, PV92, FXIIIB) in the present “denotified” tribes and various other tribal and caste populations reported from North (Kaur et al., 2002; Panjaliya et al., 2012, 2013; Majumder et al., 1999; Chakrabarti et al., 2002), Central (Mukherjee et al., 2000) and West (Dada et al., 2011; Kshatriya et al., 2011) India.

The frequency APO (I) allele was observed varying from moderate to high in the present “denotified” tribes of Punjab (range 0.6540-0.9342) as observed in other populations reported from North (range 0.4400-0.9460), Central (range 0.4810-0.7140) and West (range 0.6290- 0.9480) India. The frequency of CD4 (D) allele was observed low in seven “denotified” tribes (range 0.0118-0.1392) of Punjab as well as in other populations reported from North (range nil- 0.1650), Central (range 0.0180-0.1011) and West (range 0.0170-0.2320) India. The overall allele frequency distribution pattern of the present denotified tribes of Punjab was found similar to the Indo-European speaking tribes of West India (Kshatriya et al., 2011). The higher heterozygosity (range 0.3721-0.4202) with respect to eight Alu loci reflected greater genetic variability in the seven “denotified tribes of Punjab”. The coefficient of gene differentiation (GST=5.4%) in the present “denotified” tribes of Punjab depicted the extent of genetic heterogeneity prevalent in the present study populations. Gene differentiation (GST) recorded in the present study was much greater than that reported among various caste populations of Punjab viz., the Jat Sikh, Brahmin, Khatri and Scheduled Castes (GST=1.3%)

(Kaur et al., 2002) and various endogamous populations of Haryana (GST=2.7%, Yadav and

Arora, 2011). Various studies on some tribal populations of India have reported GST values ranging from 2.5% (Mukherjee et al., 2000) followed by 4.9% reported among tribal populations from West India (Dada et al., 2011) to as high as 6.8% reported by on various tribal and caste populations of India (Majumder et al., 1999). Thus the present value of GST (5.4%) was much higher than caste populations but similar to GST values reported among tribal populations of India.

Table 26. Distribution of insertion/deletion allele frequencies of common six Alu markers in 7 “denotified” tribes of Punjab and various other populations reported from India. Population Area Allele frequency Reference ACE APO D1 CD4* FXIIIB PV92 Gandhila1 North India 0.4000 0.9239 0.5612 0.0872 0.4583 0.3210

Bangala1 North India 0.7292 0.7244 0.2885 0.0118 0.6667 0.4792

Barad1 North India 0.7396 0.7163 0.2143 0.0700 0.6277 0.6421 1 Bazigar North India 0.6016 0.8875 0.5231 0.1392 0.5299 0.4372 Present study Bauria1 North India 0.5556 0.6540 0.2615 0.0230 0.5157 0.3616 Sansi1 North India 0.5937 0.9342 0.4925 0.0254 0.6083 0.4521 Nat1 North India 0.7241 0.8500 0.2759 0.1312 0.4508 0.4583 Jat Sikh1 North India 0.5150 0.8866 0.3775 0.1650 0.6100 0.3655 Kaur et al. Brahmin1 North India 0.4895 0.9062 0.4687 0.0834 0.5418 0.3541 (2002) Khatri1 North India 0.6250 0.8750 0.5104 0.0625 0.5937 0.4062 Scheduled North India 0.4791 0.9062 0.3645 0.0521 0.6875 0.5000 Castes1 Brahmin2 North India 0.7200 0.6150 0.4400 0.1100 0.4850 0.5500 Panjaliya et al. Rajput2 North India 0.5750 0.7400 0.4900 0.1400 0.6500 0.4750 (2012) and Gujjar2 North India 0.3800 0.4400 0.5700 0.1300 0.5700 0.3600 Panjaliya et al. (2013) Jat Sikh2 North India 0.6200 0.8100 0.5000 0.1600 0.6700 0.3000 Brahmin3 North India 0.5930 0.8890 0.3700 0.1150 0.5930 0.3330 Majumdar Chamar3 North India 0.7000 0.7200 0.5000 0.0000 0.7800 0.5400 et al. (1999) Muslim3 North India 0.6430 0.9460 0.4640 0.0370 0.5000 0.3150 Rajput3 North India 0.5380 0.9020 0.3070 0.0200 0.7040 0.3370 Katharia North India 0.5690 0.8470 0.4170 0.0140 0.7920 0.6940

Tharu3 Chakrabarti Rana Tharu3 North India 0.6230 0.7260 0.4430 0.0290 0.8210 0.8210 et al. (2002) Toto4 North East 0.5670 0.8500 0.3330 0.0000 0.9140 0.9330 India Ho4 North East 0.7310 0.8490 0.4520 0.0000 0.8020 0.5650 India Mizo5 North East 0.6030 0.8450 0.2860 0.0000 0.6480 0.8620 India Paite5 North East 0.6750 0.9050 0.3150 0.0000 0.5420 0.7790

India

Meitei5 North East 0.5440 0.9170 0.2630 0.0340 0.6330 0.6760 Meitei et al. (2010) India Kom5 North East 0.2590 0.9060 0.4540 0.0000 0.7860 0.4370 India Thadou5 North East 0.7780 0.9170 0.3970 0.0400 0.3970 0.8170 India Kabui5 North East 0.5610 0.7930 0.2690 0.0000 0.7840 0.8680 India Aimol5 North East 0.5870 0.9230 0.3500 0.0000 0.6640 0.8820 India Manipur North East 0.5730 0.8240 0.2800 0.0000 0.4760 0.4400 Muslim5 India Manipur North East 0.5910 0.7220 0.3510 0.0000 0.6200 0.6330 Bamon5 India Zeme5 North East 0.4710 0.5290 0.2170 0.4530 0.6100 0.8350 Panmei et al. India (2016) Liangmai5 North East 0.4510 0.7750 0.2200 0.1110 0.5933 0.8680 India Rongmei5 North East 0.5090 0.7280 0.2790 0.1880 0.5740 0.7440 India Muria6 Central India 0.5310 0.7140 0.3470 0.1011 0.7860 0.5200 Mukherjee Halba6 Central India 0.6460 0.6910 0.4270 0.0940 0.6980 0.5630 et al. (2000) Kamar6 Central India 0.6400 0.6490 0.3420 0.0180 0.7460 0.5540 Chinda Central India 0.7960 0.4810 0.6200 0.0380 0.7310 0.4070 Bhunjia6 Chakhutia Central India 0.6490 0.6220 0.2890 0.0900 0.7500 0.4120 Bhunjia6 Rajput7 West India 0.6130 0.8940 0.3360 0.0380 0.7090 0.4220

Bhil7 West India 0.5100 0.8800 0.2340 0.0358 0.7150 0.4050 Dada et al. Saharia7 West India 0.5780 0.8000 0.3120 0.0709 0.6290 0.4330 (2011) Mina7 West India 0.4160 0.6290 0.3260 0.0170 0.5830 0.5230 Garasia7 West India 0.7300 0.9230 0.4610 0.0800 0.5190 0.4030 Damaria7 West India 0.5440 0.9480 0.3100 0.2320 0.4210 0.2960 Vasava8 West India 0.7500 0.8020 0.3140 0.1180 0.5380 0.5290

Gamit8 West India 0.6900 0.7300 0.3040 0.0500 0.4010 0.4120

Konkana8 West India 0.4710 0.7840 0.3230 0.1150 0.4510 0.5120 Kshatriya et al. (2011) Mota West India 0.5800 0.6910 0.3040 0.1060 0.2200 0.3060 Chaudhary8 Pavagadhi West India 0.5610 0.7890 0.3540 0.0730 0.5730 0.4880 Chaudhary8 Nana West India 0.6180 0.7750 0.4000 0.0500 0.6270 0.3730 Chaudhary8 Dhodia8 West India 0.6380 0.8320 0.3510 0.0480 0.4100 0.4780 Dubla8 West India 0.7240 0.8130 0.3170 0.0620 0.5900 0.4900 *Denotes the frequency of deletion allele 1=Punjab, 2=Jammu, 3=Uttar Pradesh, 4=West Bengal, 5=Manipur, 6=Madhya Pradesh, 7=Rajasthan, 8=Gujarat Genetic affinities of the “denotified” tribes of Punjab with other caste populations of state

The genetic affinities of the seven investigated “denotified” tribes of Punjab with other caste populations of the state viz., the Jat Sikh, Brahmin, Khatri and Scheduled Castes (Kaur et al., 2002) were studied using 7 Alu Ins/Del loci viz., ACE, APO, CD4, D1, FXIIIB, PV92, PLAT. The UPGMA tree (Fig. 12) depicting the hierarchial clustering between populations clearly presented that the five out of the seven “denotified” tribes viz., the Barad, Bangala, Bazigar, Bauria and Nat formed a separate cluster while, the Sansi was observed clustered with the caste populations reported from Punjab (Kaur et al., 2002). Interestingly Gandhila was separated from this major cluster. The MDS plot (Fig. 13) clearly separated the “denotified” tribes of Punjab from the caste populations suggesting no genetic closeness between the “denotified” tribes and caste populations reported from Punjab.

SC = Scheduled Castes

Fig.12. UPGMA tree depicting genetic affinities of the seven denotified tribes with other caste populations reported from Punjab based on 7 Alu loci.

Fig.13. MDS plot demonstrating genetic affinities of the seven "denotified" tribes of Punjab with other caste populations reported from the state based on 7 Alu loci.

Genetic affinities of the investigated seven “denotified” tribes of Punjab with different populations reported from India

The genetic affinities of the seven investigated “denotified” tribes with various caste and tribal populations from North (Kaur et al., 2002; Panjaliya et al., 2012, 2013; Majumder et al., 1999; Chakrabarti et al., 2002), Central (Mukherjee et al., 2000) and West (Dada et al., 2011; Kshatriya et al., 2011) India were studied using data on 6 common Alu Ins/Del loci viz., ACE, APO, CD4, D1, FXIIIB, PV92 (Table 23). As per the UPGMA tree (Fig. 14) four “denotified” tribes viz., the Bangala, Bauria, Barad and Nat were observed clustered with Indo-European speaking tribes (Vasava, Gamit, Dubla, Dhodia, Konkana) of West India (Kshatriya et al., 2011) while the remaining three, the Gandhila, Bazigar and Sansi were observed clustered together and close to the MC (Mota Choudhary) tribe from West India (Kshatriya et al., 2011). The MDS plot (Fig. 15) showed that the “denotified” tribes were clustered away from the caste populations from North India and appeared relatively close to the Indo-European speaking tribal populations from West India (Kshatriya et al., 2011).

Fig.14. UPGMA tree depicting genetic affinities of the seven “denotified” tribes of Punjab with various caste and tribal populations of India.

Fig. 15. MDS plot genetic affinities of the even “denotified” tribes of Punjab with various caste and tribal populations of India.

CONCLUSIONS

(i) Short stature was predominantly observed in males of the Sansi, Gandhila, and Barad "denotified" tribes of Punjab which was similar to that reported in males of Santhal tribe of West Bengal as well as the Majhi and Korwa tribes of Central India. The medium stature was commonly observed among females of the Bauria, Nat, Bazigar, Bangala and Barad "denotified" tribes of Punjab, similar to that reported from females of the Santhal tribe. (ii) The present results suggested the preponderance of mesorrhine (medium nose) in the males of the seven "denotified" tribes of Punjab, barring the Nat females. These results were similar to the findings reported on predominance of mesorrhine in different tribal and non tribal populations from North, Central and West India. (iii) Mesocephalic head type was found to be common in males of the 7 "denotified" tribes of Punjab as well as in females of 5 (Gandhila, Barad, Bazigar, Sansi and Nat) out of 7 “denotified” tribes of Punjab demonstrated the preponderance of mesocephaly. These results were similar to that reported in the Bhil, Barelia, Santhal and Gond tribes of Central and East India. The brachycephalic head type was common in the present Bangala and the Bauria females, a finding which was similar to that reported in population of West India. (iv) The average frequencies of A, B, O alleles for six (out of seven) "denotified" tribes of Punjab were similar to the scheduled caste populations of Punjab (Kaur et al., 1981; Sidhu et al., 2003) as well as to 7 nomadic tribal populations of Rajasthan (Sachdev, 2012) and the tribal Bhil of Rajasthan (Alisha, 2017). (v) The Rh(D)+ allele frequency in the present study six "denotified" tribes (range 0.8156) was similar to the value reported in the Scheduled Castes (0.836; Sidhu, 2003) and Jat Sikh (0.8451; Kaur, 2017) of Punjab as well as to the Rajputs (0.7260; Alisha, 2017) and 7 nomadic tribal populations of Rajasthan (range 0.8650-1.0000; Sachdev, 2012). (vi) In case of 8 Alu Ins/Del markers studied in the seven “denotified” tribes of Punjab, the average allele frequency distribution pattern was similar to the Indo-European speaking tribes of South Gujarat, West India (Kshatriya et al., 2011).The frequency of APO (I) allele was observed varying from moderate to high in the seven “denotified” tribes (range 0.6540-0.9342) of Punjab similar to the tribal population reported from West India (range 0.6290-0.9480). The frequency of CD4 (D) allele was observed low in seven “denotified” tribes (range 0.0118-0.1392) of Punjab which was similar to the caste and tribal populations reported from North (range nil-0.1650), Central (range 0.0180- 0.1011) and West (range 0.0170-0.2320) India. (vii) The coefficient of gene differentiation value estimated in the present “denotified” tribes of Punjab (GST = 5.4%) demonstrated great genetic heterogeneity in the present study populations. The GST value recorded in present “denotified” tribes of Punjab was greater than that reported in caste populations (the Jat Sikh, Brahmin, Khatri and

Scheduled Castes) of the state (GST = 1.3%) (Kaur et al., 2002) but similar to GST value (4.9%) reported among tribal populations from West India (Dada et al., 2011). (viii) The UPGMA tree of populations of Punjab (Fig. 12) demonstrated that the Gandhila separated at an early stage of evolution from the remaining six “denotified” tribes. The Barad, Bangala, Bazigar, Bauria and Nat formed a subcluster while, the Sansi was observed clustered with the caste populations reported from Punjab (Kaur et al., 2002). The MDS plot (Fig.13) clearly separated the “denotified” tribes of Punjab from the caste populations, suggesting no genetic closeness between them. (ix) The UPGMA tree (Fig. 14) and MDS plot (Fig. 15) of the genetic affinity of the seven “denotified” tribes of Punjab with various caste and tribal populations of India, clearly showed that the “denotified” tribes were clustered away from the caste populations of North India and appeared relatively close to the Indo-European speaking tribal populations of West India.

SUMMARY

There are seven “denotified” tribes inhabiting the state namely, the Bauria, Bazigar, Bangala, Barad, Gandhila, Nat and Sansi. Their total population as per the Census of India 2001 was 436,809, the Bazigar having the highest population (208,442), followed by the Sansi (105,337), Bauria (102,232), Barar (8,679), Bangali (7,765), Gandhila (3,283) and Nat (1,071).

The “denotified” tribes (Vimukt Jatis) of Punjab had been struggling since India’s independence, first to remove the tag of criminality attached to them during the British colonial regime and second, to acquire the status of Schedule Tribe (ST). It is ironic that they had been wrongly placed in the category of Scheduled Caste (SC) in Punjab and they see this as an attempt to denigrate them. The Vimukt Jatis had been contesting for Scheduled Tribe (ST) status for long so that they have a stake in reservation quota for jobs, admissions, scholarships and other benefits announced from time to time by the government for the ST. Since as of now they are clubbed with the Scheduled Castes of Punjab, the so-called ‘creamy SC layer’ (e.g. the Ramdasia, Balmiki etc.) takes all the benefits meant for SC.

The present study is a biological anthropology approach to establish the genetic profile of the Vimukt Jatis of Punjab. As a detailed social anthropological study is already available on the Vimukt Jatis of Punjab which indicate a tribal status for them (Singh, 2010), it would be interesting to examine if the results from the present anthropogenetic approach corroborate this finding. That is, the present study is an attempt to provide genetic basis to the findings of the social-anthropological inquiry already reported in literature on the Vimukt Jatis of Punjab. This will help make the case of the Vimukt Jatis, a socially disadvantaged group of people, for a tribal status more rational and logical thereby helping them get their true identity validated, enabling them get the financial and other benefits due to them. The main findings of the present project are listed below.

1. The stature was predominantly observed short in males of the Sansi, Gandhila, and Barad "denotified" tribes of Punjab which was similar to that reported in males of Santhal tribe of West Bengal as well as the Majhi and Korwa tribes of Central India. The medium stature was commonly observed among females of the Bauria, Nat, Bazigar, Bangala and Barad "denotified" tribes of Punjab, similar to that reported from females of the Santhal tribe. The present results suggested the preponderance of mesorrhine (medium nose) in the males of the seven "denotified" tribes of Punjab, barring the Nat females. These results were similar to the findings reported on predominance of mesorrhine in different tribal and non tribal populations from North, Central and West India. Mesocephalic head type was found to be common in males of the 7 "denotified" tribes of Punjab as well as in females of 5 (Gandhila, Barad, Bazigar, Sansi and Nat) out of 7 “denotified” tribes of Punjab demonstrated the preponderance of mesocephaly. These results were similar to that reported in the Bhil, Barelia, Santhal and Gond tribes of Central and East India. The brachycephalic head type was common in the present Bangala and the Bauria females, a finding which was similar to that reported in population of West India. 2. As for the average frequencies of A, B, O alleles for six (out of seven) "denotified" tribes of Punjab, these were similar to the scheduled caste populations of Punjab (Kaur et al., 1981; Sidhu et al., 2003) as well as to 7 nomadic tribal populations of Rajasthan (Sachdev, 2012) and the tribal Bhil of Rajasthan (Alisha, 2017). The Rh(D)+ allele frequency in the present study six "denotified" tribes (range 0.8156) was similar to the value reported in the Scheduled Castes (0.836; Sidhu, 2003) and Jat Sikh (0.8451; Kaur, 2017) of Punjab as well as to the Rajputs (0.7260; Alisha, 2017) and 7 nomadic tribal populations of Rajasthan (range 0.8650-1.0000; Sachdev, 2012). 3. In case of 8 Alu Ins/Del markers studied in the seven “denotified” tribes of Punjab, the average allele frequency distribution pattern was similar to the Indo-European speaking tribes of South Gujarat, West India (Kshatriya et al., 2011).The frequency of APO (I) allele was observed varying from moderate to high in the seven “denotified” tribes (range 0.6540-0.9342) of Punjab similar to the tribal population reported from West India (range 0.6290-0.9480). The frequency of CD4 (D) allele was observed low in seven “denotified” tribes (range 0.0118-0.1392) of Punjab which was similar to the caste and tribal populations reported from North (range nil-0.1650), Central (range 0.0180-0.1011) and West (range 0.0170-0.2320) India.

4. The coefficient of gene differentiation (GST) value estimated in the present “denotified” tribes of Punjab (5.4%) showed great genetic heterogeneity in the present study

populations of the state. The GST value recorded in present “denotified” tribes of Punjab was greater than that reported in caste populations (the Jat Sikh, Brahmin, Khatri and

Scheduled Castes) of the state (GST = 1.3%) (Kaur et al., 2002) but similar to GST value (4.9%) reported among tribal populations from West India (Dada et al., 2011). 5. The assessment of the genetic affinities of the “denotified” tribes of Punjab with other caste populations of state (Fig. 12) demonstrated that the Gandhila separated at an early stage of evolution from the remaining six “denotified” tribes. The Barad, Bangala, Bazigar, Bauria and Nat formed a subcluster while, the Sansi was observed clustered with the caste populations reported from Punjab (Kaur et al., 2002). The MDS plot (Fig.13) clearly separated the “denotified” tribes of Punjab from the caste populations, suggesting no genetic closeness between them. 6. The UPGMA tree (Fig. 14) and MDS plot (Fig. 15) of the genetic affinity of the seven “denotified” tribes of Punjab with various caste and tribal populations of India, clearly demonstrated that these “denotified” tribes were clustered away from the caste populations of North India and appeared relatively close to the Indo-European speaking tribal populations of West India.

Like the social anthropological evidence already available on the “denotified” tribes (Vimukt Jatis) of Punjab indicating a tribal status for them (Singh, 2010), the present physical (biological) anthropological project on these populations also corroborate their affinities with various tribal populations of West India than the caste populations of Punjab. Thus it is suggested/recommended that the Bauria, Bazigar, Bangala, Barad, Gandhila, Nat and Sansi populations of Punjab should be provided the scheduled tribe (ST) status in the state to so that they have a stake in reservation quota for jobs, admissions, scholarships and other benefits provided by the Central government for the ST enabling these illiterate and backward populations of Punjab get social justice.

ACKNOWLEDGEMENT

The Principal Investigator is grateful to the UGC, New Delhi for providing the financial assistance for the Major Research Project entitled "Anthropogenetic Profile of "denotified" Tribes (Vimukt Jatis) of Punjab (North-West India) and its Social Implication" vide UGC approval reference File No. 42-494/2013(SR).

REFERENCES

Alisha. 2017. A study of A1A2BO blood group and Rho (D) status among Bhils and Rajputs of Sirohi district, Mt. Abu, Rajasthan. International Journal of Applied Research 3: 421- 428. Asha, K.R. and Laxmi-Prabha, R. 2011. Estimation of stature from cephalic dimensions in Indian population. Anatomica 5(1):1-5. Bhargava, I. and Kher, G.A. 1960. An anthropometric study of Central India Bhils of Dhar district of Madhya Pradesh. Journal of Anatomical Society of India 9: 14 - 19. Bhargava, I. and Kher, G.A. 1961. A comparative anthropometric study of Bhils and Barelas of Central India. Journal of Anatomical Society of India 10: 26 - 33. Basu, A. 1963. Anthropometry of the Kayasthas of Bengal. Journal of Anatomical Society of India 3: 20-25.

Chakraborty, S. 2011. Heterozygosity and fixation index for ABO gene in Barak valley populations vis-à-vis a few exotic populations. Notulae Scientia Biologicae 3(1): 07-11. Chatterjee, M., Mehra, K.P., Pander, K., Banerjee, C. and Roul, B. 2015. Anthropometric study of Gond tribe in Gariyaband district of Chhattisgarh state. International Journal of Advanced Research 3: 612 - 617. Chatterjee, M. and Pandher, K. 2015. Anthropometric study of Halba tribe in Gariyaband district of Chhattisgarh state. Journal of Anatomical society of India 64: 521-522. Choudhary, A. and Choudhary, D.S. 2012. Comparative anthropometric study of nasal parameters between two ethnic groups of Rajasthan state. International Journal of Medicine and Public Health 2: 46-48. Dada, R., Saraswathy, K.N., Meitei, K.S., Mondal, P.R., Kaur, H., Kucheria, K., Bhardwaj, S., Gaznavi, I. 2011. Genetic sketch of the six population groups of Rajasthan: a study based on 12 autosomal loci. Anthropological Science 119: 259-264.

Felsenstein, J. 2005. PHYLIP (Phylogeny Inference Package) Version 3.6. Department of Genome Sciences, University of Washington, Seattle. Gangrade, P. R. and Babel, H. 2012. Anthropometric study of the nasal index of the Bheel - Meena tribe of southern Rajasthan. IJCRR 4: 88-91. Gautam and Adak. 2008. Nutrition and variation among Central Indian Tribes. Proceedings of National Symposium on Tribal Health 141-153. Ghosh, S. and Malik, S. 2006. Assessing intergenerational differences in anthropo-physiological variables: case study of a tribal population. The Internet Journal of Biological Anthropology 1(1). Hussain, R., fareed, M., Shah, A. and Afzal, M. 2013. Prevalence and gene frequencies of A1A2BO and RH(D) blood group alleles among some Muslim populations of North India. The Egyptian Journal of medical Human Genetics 14: 69-76. Jadav, H. R., Kariya, V. B., Kodiyatar and Pensi, C. A. 2011. A study to correlate cephalic Index of various castes/races of Gujarat state. NJIRM 2(2): 18-22. Jaggi, S. and Yadav, A. S. 2014. Distribution of ABO and RH (D allele frequency among four endogamous populations of Haryana. International Journal of Research in Applied, Natural and Social Sciences 2(2): 77-80. Jaiswal, P., Rathore, K. B. and Masih, W. F. 2016. Cephalic Index and head shape in various castes of Hadoti region. International Journal of Scientific Study 4 (2): 242-246. Kaur, H., Sehajpal, P. K. and Shrivastava, P. K. 1981. Distribution of some genetic traits in three population groups from Punjab, North West India. Anthropologischer Anzeiger 39: 66 - 69. Kaur, I., Roy, S., Chakrabarti, S., Sarhadi, K. V., Majumder, P. P., Bhanwer, A. J. S. and Singh, J. R. 2002. Genomic diversities and affinities among four endogamous groups of Punjab (India) based on autosomal and mitochondrial DNA polymorphisms. Human Biology 74: 819 - 836. Kaur, H.P. 2017. Genetic structure of Jat Sikh of Faridkot district. WJPPS, ISSN – 22784357. Kaushal, S., Patnaik, V.V.G. and Kaur, P. 2013. Somatometric analysis of nasal morphology in the endogamous groups of Punjab. Human Biology Review 2: 1-11. Krishan, K. and Kumar, R. 2007. Determination of stature from cephalo-facial dimensions in a North Indian population. Leg Med. 9: 128-133. Krishan, K. 2008. Estimation of stature from cephalo-facial anthropometry in North Indian Population. Forensic Intern. 18: 1-3. Kumar, M. and Patnaik, V.V.G. 2013. The Anthropometric variation among Haryanvi population. International Journal of Science and Research 2: 446-449. Mahajan, A., Khurana B.S., Seema and Batra, A.P. 2009. The study of cephalic index in Punjabi students. Journal of Punjab Academy of Forensic Medicine & Toxicology 10: 24-26. Majumder, P.P., Roy, B., Banerjee, S., Chakraborty, M., Dey, B., Mukherjee, N., Roy, M., Thakurta, P.G. and Sil, S.K. 1999. Human-specific insertion/deletion polymorphisms in Indian populations and their possible evolutionary implications. Eur. J. Hum. Genet.7: 435-446. Martin, R., and Saller, K. 1957. Lehrbuch der anhropologie. Gustav Fischer Verlag. Vol II. Miller, S.A., Dykes, D.D. and Polesky, H.F. 1988. A simple salting out procedure for extracting DNA from human nucleated cells. Nuc. Acids Res. 16: 1215. Mishra, M., Tiwari, A., Naik, D.C. 2014. Study of Cephalic Index in Vindhya region of Madhya Pradesh. International Journal of Medical Science and Public Health 3(12): 1464-1465.

Mourant, A.E, Kopec, A.C. and Domaniewska-Sobczak, K. 1976. The Distribution of the Human Blood Groups and Other Polymorphisms, 2nd ed. Oxford University Press, London.

Mukherjee, N., Mitra, M., Chakraborty, M., and Majumder, P.P. 2000. Congruence of genomic

and ethnolinguistic affinities among five tribal populations of Madhya Pradesh. Journal

of Genetics 79: 41- 46. Mukhopadhyay, R. and Kshatriya, G. K. 2004. Distribution of blood groups among Brahmins and Rajputs of Himachal Pradesh. Anthropologist 6 (4): 293-294.

Nair, K.S., Ajankar, V.P, Singh, S., Bindra, M., Satpathy, D.K. 2014. The study of cephalic index of medical students of Central India. Asian Journal of Biomedical and Pharmaceutical Sciences 28: 48-50. Nei, M. 1972. Genetic distance between populations. Am. Naturalist 106: 283-292.

Nei, M. 1973. Analysis of gene diversity in subdivided populations. Proc. Natl. Acad. Sci. USA. 70: 3321-3323.

Patil, G.V., Kumar, S., Apoorva, D., Thejeswari, Sharif, J., Sheshgiri, C. and Sushant, N. K. 2014. Study on nasal index in South Indian population. International Journal of Current Research 6: 8163- 8164.

Patro, S., Sahu, R. and Rath, S. 2014. Study of Cephalic Index in South Odisha population. Journal of Dental and Medical Sciences 13 (1): 41-44.

Ray, K.S., Saha, k., Kumar, A. and Banjare, S. 2016. Anthropometric study of Nasal Index among the population of Western Uttar Pradesh region. International Journal of Scientific Study 4(2): 65-70.

Saini, J. S., Kumar, A., Matharoo, K., Sokhi, J., Badaruddoza and Bhanwer, A. J. S. 2012. Genomic diversity and affinities in populations of North West India: An analysis of Alu insertion and a single nucleotide polymorphism. Gene 511: 293-299. Saraswathy, K.N., Sachdeva, M.P., Mukhopadhyay, R., Shukla, D., Devi, N.K., Rawat, S., Rao, A.P. and Kalla, A.K. 2008. Diversified genomic contribution among south Indian populations - a study on four endogamous groups of Andhra Pradesh. Annals of Human Biology 35: 499-508. Saraswathy, K. N., Naorem, K., Murry, B., Sinha, E., Saksena, D., Kaur, H., Sachdeva, M. P. and Kalla, A. K. 2009. A genomic insight into diversity among tribal and non tribal population groups of Manipur, India. Biochem. Genet. 47: 694-706. Seema and Verma P. 2016. The study of cephalic index in north Indian popuation. Int. J. Morphol. 34: 660-664. Shah, G.V. and Jadav, H.R. 2004. The study of CI in students of Gujarat. J Anat. Soc. India 53: 25-26. Sidhu, L. S., Singal, P. and Kaur, S. 1982. Physique and body composition of Jat-Sikh and Bania girl students of Punjab. Z. Morph. Anthrop. 73: 51-58. Sidhu, S. 2003. Distribution of ABO blood groups and Rh (D) factor among the Scheduled Caste populations of Punjab. Anthropologist 5: 203-204. Singh, I. P. and Bhasin, M. K. 1989. Anthropometry. Kamla Raj Enterprises, Delhi. Singh, S.P., Sidhu, L. S. and Malhotra, P. 1988. Body measurements and somatotypes of young adult Jat Sikh men of Punjab. Anthropologischer Anzeiger 46 (3): 261-267. Singh, P. and Pukrait, R. 2006. A Cephalometric study among sub caste groups of Dangi and Ahirwar of Khurai block of Madhya Pradesh. Anthropologist 8: 215-217. Singh, A., Chahal, S. M. S. and Kaur, M. I. 2013. The distribution of A1A2BO blood groups in the Buksa – A primitive tribe of Uttarakhand, North India. Anthropologist 15(2): 241- 243. Singla, M. 2005. Facial anthropometry in adult Jat-Sikh and Bania males of Punjab, India. Thesis, Government Medical College, Patiala. Sneath, P.H. and Sokal, R.R. 1973. Numerical Taxonomy. W.H. Freeman and Company, San Francisco. Uttekar, K., Gupta, D.S., Andani, R.,Kubavat, D.M., Nagar, S.K., Varlekar, P. 2013. Study of cephalic index in South Gujarat. International journal of recent trends in science and technology 8: 87-89. Yadav, A.S. and Arora, P. 2011. Genomic diversities and affinities among eight endogamous groups of Haryana (India): a study on insertion/deletion polymorphisms. Annals of Human Biology 38: 114-118.

Appendix-I

Consent Form and General Information Sheet

Study Title: "Anthropogenetic Profile of "denotified" Tribes (Vimukt Jatis) of Punjab (North- West India) and its Social Implication"

Participant: Name ______Caste ______Gender ______

Age _____ (in years) Place ______Marital Status ______

Please read the following before putting your signature below: [X]

 I have genuinely informed the investigator about my current health status that I am not under any serious medical condition which includes suffering from any [ ] genetic or psychological disorder.  I am free to participate or not to participate in this study. [ ]

 I have been given the opportunity to ask questions and reply was given for all [ ] the questions to my satisfaction.  I have been informed by the investigators about the process including the nature, objective and known and likely inconveniences related to this study and [ ] I have understood them.  By signing this form, I give my free and informed consent to take part in this [ ] study as outlined in the information sheet and this consent form.  I give permission for any blood that is left over after the tests to be stored and [ ] used for further laboratory tests for medical research.  By signing this form I have not given up my legal rights.

______Date: ___ / ___ /______

Signature/Thumb Impression of Participant (or Legal Representative)

______

Name and Signature of Investigator Name and Signature of the Witness