DOCSLIB.ORG

(12) United States Patent (10) Patent No.: US 8,105,811 B2 Jeffries Et Al

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
(12) United States Patent (10) Patent No.: US 8,105,811 B2 Jeffries Et Al USOO8105811 B2 (12) United States Patent (10) Patent No.: US 8,105,811 B2 Jeffries et al. (45) Date of Patent: Jan. 31, 2012 (54) SUGAR TRANSPORTSEQUENCES, YEAST OTHER PUBLICATIONS STRANS HAVING IMPROVED SUGAR Nature Biotechnology 25: 319-326 (Mar. 4, 2007, published on UPTAKE, AND METHODS OF USE line).* Nature Biotechnology 25: 319-326 (Mar. 4, 2007, published on (75) Inventors: Thomas William Jeffries, Madison, WI line)—Supplementary Fig.1. (US); JuYun Bae, Madison, WI (US); With by i. al., St. and charactic "G Bernice Chin-yun Lin, Cupertino, CA E.CS Molecular- SECOC9 SUCOS 1999,aSOOCS s OleF. WeaS Blackwell Cla (US); Jennifer Rebecca Headman Van Science Ltd, Dusseldorf, Germany. Vleet, Visalen, CA (US) Hamacher, Tanja, et al., Characterization of the xylose-transporting properties of yeast hexose transporters and their influence on xylose (73) Assignees: Wisconsin Alumni Research utilization, Microbiology, 2002, 2783-2788, 148, SGM, Great Brit Foundation, Madison, WI (US); The ain. United States of America as R . instNR P3 st site R. 2. 19 represented by the Secretary of Wirginipotis,retrieved Aug. 25, Vailable on thein Internet:=65. : p : Agriculture, Washington, DC (US) Jeffries, Thomas W. et al., “Pichia stipitis genomics, transcriptomics, (*) Notice: Subject to any disclaimer, the term of this Jeffries,and gene Thomas clusters'; W. 2009, et al.; FEMSYeast UniProtKB/TrEMBL, Res., vol.9, No. A3GIFO 6,pp. 793-807. online patent is extended or adjusted under 35 Mar. 2, 2010 (retrieved Aug. 25, 2011). Available on the internet: U.S.C. 154(b) by 235 days. <URL: http://www.uniprot.org/uniprot/A3GIFO.txt?version=24. Jeffries, Thomas W. et al.; UniProtKB/TrEMBL. A3MOD0 online (21) Appl. No.: 12/484,714 Mar. 2, 2010 (retrieved Aug. 25, 2011). Available on the internet: <URL: http://www.uniprot.org/uniprot/A3MOD0.txt?version=28. (22) Filed: Jun. 15, 2009 Jeffries, Thomas W. et al.; UniProtKB/TrEMBL. A3GF74 online Mar. 2, 2010 (retrieved Aug. 25, 2011). Available on the internet: O O <URL: http://www.uniprot.org/uniprot/A3GF74.txt?version=22. (65) Prior Publication Data Koetter y E. online Mar. 2, 2010 US 2009/0325241 A1 Dec. 31, 2009 (retrieved Aug. 25, 2011). Available on the internet: <URL: http:// www.uniprot.org/uniprot/P22144.txt?version=69. Related U.S. Application Data * cited by examiner (60) Provisional application No. 61/061,417, filed on Jun. 13, 2008. Primary Examiner — Tekchand Saidha (74) Attorney, Agent, or Firm — Kilpatrick Townsend & (51) Int. Cl. Stockton LLP CI2P 7/06 (2006.01) CI2N L/4 (2006.01) (57) ABSTRACT CI2N IS/00 (2006.01) Disclosed are nucleic acid constructs comprising coding C7H 2L/02 (2006.01) sequences operably linked to a promoter not natively associ (52) U.S. Cl. .................... 435/161; 435/69. 1; 435/320.1; ated with the coding sequence. The coding sequences encode 435/255.1; 435/255.5; 536/23.1 Pichia stipitis proteins that allow recombinant strains of Sac (58) Field of Classification Search .................. 435/105, charomyces cerevisiae expressing the protein tO grow on 435/252.3,320.1, 161,255.1, 255.5; 536/23.1 xylose, and allow or increase uptake of xylose by Pichia See application file for complete search history. stipitis or Saccharomyces cerevisiae expressing the coding sequences. Expression of the coding sequences enhances (56) References Cited uptake of xylose and/or glucose, allowing increased ethanol or xylitol production. U.S. PATENT DOCUMENTS 4,701.414 A 10/1987 Van Dijken et al. 19 Claims, 8 Drawing Sheets U.S. Patent Jan. 31, 2012 Sheet 1 of 8 US 8,105,811 B2 ClustalW (v1. 4) multiple sequence alignment 3 Sequences Aligned Alignment Score = 34227 Gaps Inserted = 0 Conserved Identities = 1606 Pairwise Alignment Mode: Slow Pairwise Alignment Parameters: Open Gap Penalty = 10. O Extend Gap Penalty = 0.1 Multiple Alignment Parameters: Open Gap Penalty = 10.0 Extend Gap Penalty = 0.1 Delay Divergent = 40% Transitions: Weighted Processing time: 3.3 seconds SUT4 ORE 1 ATGTCCTCACAAGATTTACCCTCGGGTGCTCAAACCCCAATCGATGGC SO (SEQ ID NO : 3) SUT2nt mvr ATGTCCTCACAAGATTTACCCTCGGGTGCTCAAACCCCAATCGATGGTTC SO (SEQ ID NO: 12) slut3 AGTCCTCACAAGATTACCCTCGGGTGCTCAAACCCCAA CGATGGTC SO (SEQ ID NO: 13) k . SUT4 ORF 51 TTCCACCCGAAGAAAAGTTGAGCAAAGTTCGTCCCAAATAGCCAAA OO SUT2nt. nV 51 CCATCCTCGAAGATAAAGTTGAGCAAAGTTCGTCCT CAAATAGCCAAA OO Sut 3 51 CCATCCTCGAAGATAAAGTTGAGCAAAGTTCGTCCT CAAATAGCCAAA OO k . SUT4 ORF O 1 GTGATTTAGCTTCIATTCCAGCAACAGGTACAAAGCCTATCTCTTGGTT SO SUT2nt my 101 GTGATTTAGCTTCCATTCCAGCAACAGGTATCAAAGCCTATCTCTTGG 15 O Sut 3 O1 GTGATTTAGCTTCGATTCCACCAACAGGTATCAA AGCCTATCTCTTGG 50 ". .33: . SUT4 ORF 151. TGTTTCTTCTGCATGTTGGTTGCCTTCGGTGGGTTCGTATTCGGTTTCGA 200 S2 ... n. my 151. TGTTTCTTCTGCATGTTGGTTGCCTTEGGTGGATTCGTATTCGGTTTCGA 2 OO Slt3 151 TGTTTCTTCTGCATGTTGGTTGCCTTTGGTGGGTTCGTATTCGGTTTCGA 200 k . k. kšk. k. k: . SUT4 ORF 201 TACCGGTACTATTTCCGGTTTCCTTAATATGTCTGATTTCCTTTCCAGAT 250 SUT2 ... t. wr 2O1 TACCGGTACAATTTCCGGTTTCCTTAATATGTCTGATTTCCTTTCCAGAT 2 SO slut3 2O1 TACCGGTACAATTTCCGGTTTCCTTAATATGTCTGATTTCCTTTCCAGAT 25 O k kirk k ki krikk ke k l k k l k kk. k.k. k.k. k.k. k. k.k. k. k. k.k. k. k.k. k. k. k.k. k.k kk. k.k. k. SUT4 ORF 251 GGTCAAGATGGTTCTGAAGGAAAATATTTGTCTGATATCAGAGTCGG 3 OO SUT2. Ilt. Inv 251 TTGGTCAAGATGGTTCTGAAGGAAAATATTTGTCTGATATCAGAGTCGG 3 OO Sut3 251 TTGGTCAAGATGGTTCTGAAGGAAAATATTTGTCTGATATCAGAGTCGG 3 OO k . SUT4 ORF 3 O 1 TTGATTGTTTCCATTTTTAACATTGGTTGTGCAATTGGTGGTATTTTCC 35 O SUT2nt. nV 3 O1 GATTGTTTCCA TTAACATTGGTTGTGCAATTGGTGGTA ICC 350 slut 3 3 O 1 TTGATTGTTTCCA TTAACATTGGTTGTGCAATTGGTGGTATTTTCC 350 . SUT4 ORE 35 TTCTAAGATAGGAGAGTTTACGG TAGAAGAATTGGTATCATTCAGOA. A OO SUT2 intmvr 35 TTCTAAGATAGGAGAGTTTACGG TAGAAGAATTGGTATCATTCAGOA. A OO Sut 3 35 TTCTAAGATAGGAGATGTTTACGGTAGAAGAATTGGTATCATTCAGOA 4 OO . SUT4 ORF 401 TGGTTGTCTATGTCGTCGGTATAATCATCCAGATCTCGTCCCAAGAAAG 450 SUT2 ... it mvr 401 TGGTTGTCTACGTCGTCGGTATTATCATCCAGATCTCGTCCCAAGACAAG 450 suit 3 401 TGGTTGTATACGTCGTCGGTATTATCATCCAGATCTCGTCCCAAGACAAG 450 kk k k + k ki k k sk k + k l k k + k l k + k + k k k l k l k k + k l k k.k k + k l k kick k SUT4 ORF As TGGTACAACTTACAATTGGACGTGGAGTTACAGGATTAGCTGTTGGTAC 5 OO SUT2 ... t. IV 451. TGGTACCAACTTACAATTGGACGGGAGTTACAGGATTAGCGTTGGTACFIG. 1 (1 of 3) 5 OO U.S. Patent Jan. 31, 2012 Sheet 2 of 8 US 8,105,811 B2 Sut 3 451. TGGTACAACTTACAATTGGACGTGGAGTACAGGATTAGCGTGGTAC 5 OO k k.k k k ... k k k k k is k k k k k k k l k k.k. k. k. k.k. k.k. k. k.k. k. k. k. k.k. k.k. k. k. k.k kk. k. k. k.k SUT4 ORF 501 TGTTTCGGTTTTGTCTCCAATGTTCATTAGTGAAAGTGCTCCAAGCATT 550 SUT2 ...tv 501 TGTTTCAGTGTTGTCTCCAATGTTCATTAGTGAAAGTGCTCCAAAGCATT 550 Sut 3 5 O1. TGTTTCAGTGTTGTCTCCAATGTTCATTAGTGAAAGTGCTCCAAAGCATT 550 :: * : . : SUT4 ORF 551. TGAGAGGTACTTTGGTATACTGTTACCAATTATGEATCACCTTAGGTATT 6 OO SUT2 ... nt mV. E. 51. TGAGAGGTACTTTGGTATACTGTTACCAATTATGEATCACCTTAGGTATT 6 OO slut 3 SS1 TGAGAGGTACTTTCCTATACTGTTACCAATTATGTATCACCTTAGGTATT 6 OO k . ex: k . SUT4 ORF 6O1 CATGGTACTGTGTCACTATGGAACCAA AGATTTAAATGATTCAAG 65 O SUT2 int. nV 6 O TTCATTGGTTACTGGTCACTTATGGAACCAAAGATTTAAATGATTCAAG 65 O Sut3 6 O TCATTGGTTACTGGTCACTTATGGAACCAAAGATTAAATGATCAAG 650 k . k . SUT4 ORF 651 ACAATGGAGAGTTCCTTTGGGTTTATGTTTCCTTTGGGCTATTTTCTTAG 700 SUT2 intmvr 651 ACAATGGAGAGTTCCTTTGGGTTTATGTTTCCTTTGGGCTATTTTCTTAG 700 Sut 3 651 ACAATGGAGAGTTCCTTTGGGTTATGTTCCTTTGGGCTA CTTAG 7 OO sk k k k k l k k k k k k k k k k + k k k k . k + k k k.k. k. k. k.k. k. k. k. k. k. k. k. k. k. k. k. k. k.k. k. k. k. SUT4 ORF 701 TTGTGGTATGTTGGCTATGCCAGAATCCCCAAGATTCTTGATTGAAAAG 750 SUT2 ... nt inv 701 TTGTCGGTATGTTGGCTATGCCTGAATCCCCAAGATTCTTAATTGAAAAG 750 Sut 3 701 TTGTCGGTATGTTGGCTATGCCAGAATCCCCAAGATTCTTAATTGAAAAG 750 k k: ; k ki ki k ki ke k k is k is k Ek k k k k k k k k ki: ; k ki k k SUT4 ORF 751. AAGAGAATCGAAGAAGCCAAGAAGTCCCTTGCAAGATCCAACAAGTTGTC 8 OO SUT2 intmvr 75 AAGAGAATCGAAGAAGCCAAGAAGTCCCTTG-CAAGACCAACAAGTTATC 8 OO sult 3 75 AAGAGAATCGAAGAAGCCAAGAAGTCCCTTGCAAGATCCAACAAGTTATC 8 OO k k + k k k + k k + k k k k k k k k k k l k k k k k k k k k kk. k.k k k k k k k k k k k k + k SUT4 ORF 801 TCCAGAAGATCCAGGTGTCTACACTGAA CAATTGATTCAAGCTGGTA 850 SUT2 ...tv 801 TCCAGAAGATCCAGGTGTCTACACTGAA CAATTGATTCAGGCTGGTA 8 SO Sut 3 8 O TCCGAAGATCCAGGTGTCTACACTGAA CAATTGATTCACGCTGGTA 85 O k k . k is k.k k . k k k l k . k h k l k sk k . k 3: SUT4 ORF 851 TTGACAGAGAAGCTGCTGCAGGTTCTGCTTCGTGGATGGAATTGATTACC 900 SUT2 ..lt. nV 851 TTGACAGAGAAGCTGCTGCAGGTTCTGCTTCATGGATGGAATTGATCACT 900 Slut 3 851 TTGACAGAGAAGCTGCTGCAGGTTCTGCTTCGTGGATGGAATGATO ACT 9 OO sk k + k k k k k k + k k k + k k + k k + k k k + k k kk. k. k. k.k. k.k. k. k.k. k.k k + k k k kix k SUT4 ORF 901 GGTAAACCAGCTATTTTCAGAAGAGTTATCATGGGAATTATCTTACAGTC 950 SUT2 intmvr 901 GGTAAGCCAGCTATTTTCAGAAGAGTTATCATGGGAATTATCTTACAGTC 950 Sut3 9 O. GGTAAGCCAGCTATTTTCAGAAGAGTTATCATGGGAATTATCTTCAGTC 950 : . SUT4 ORF 951 TTTGCAGCAATTAACTGGTGTCAACTATTTCTTCTACTACGGAACTACAA 1000 SUT2 ... lt. nV 951 TTTGCAACAATTAACTGGTGTCAACTATTTCTTCTATTACGGAACTACAA 1000 Sut 3 951 TTTG-CAACAATTAACTGGTGTCAACTATTTCTTCTATTACGGAACTACAA 10 OO : . : . SUT4 ORF OOL TCTTCCAAGCTGTIGGTTTGCAAGATTCCTTCCAGACTTCCATCATCTTA, OSO SUT2nt nv 1 OO1 TCTTCCAAGCTGTTGGTTTGCAAGATTCCTTCCAGACTTCCATCATCTTA 1 O5 O Sut 3 OO, TCTCCAAGCTGITGGTTTGCAAGATTCCTTCCAGACTCCATCATCTA 1 OSO k . k . SUT4 ORF O 51 GGTACAGTCAACTTCTTTCTACATTTGTTGGTATTTGGGCCATTGAAAG 11 OO SUT2 . It nv OS, GGTACAGICAACTITCTTTCACATTTGITGGTATTIGGGCCATIGAAAG 11 OO Sut 3 O5, GGTACAGTCAACTTTCTTTCACATTTGTTGGTATTGGGCCATTGAAAG OO k . SUT4 ORF O 1 ATTTGGAAGAAGACAATGTTTCTTAGTCGGTTCTGCTGGTAGTTCGTTT 15 O SUT 2 int. myr 11 O ATTTGGAAGAAGACAATGTTTGTTAGTCGGTTCTGCTGGTATGTTCGTTT 115 O slut 3 O ATITGGAAGAAGACAATGTTTGITAGTCGGICIGCTGGIAGITCGTIT
Load more

Recommended publications
  • (TPD52) Are Highly Expressed in Colorectal Cancer and Correlated with Poor Prognosis
    RESEARCH ARTICLE The four-transmembrane protein MAL2 and tumor protein D52 (TPD52) are highly expressed in colorectal cancer and correlated with poor prognosis Jingwen Li☯, Yongmin Li☯, He Liu, Yanlong Liu*, Binbin Cui* Department of Colorectal Surgery, Harbin Medical University Cancer Hospital, Harbin, China a1111111111 ☯ These authors contributed equally to this work. a1111111111 * [email protected] (YLL); [email protected] (BBC) a1111111111 a1111111111 a1111111111 Abstract The four-transmembrane protein MAL2 and tumor protein D52 (TPD52) have been shown to be involved in tumorigenesis of various cancers. However, their roles in colorectal cancer OPEN ACCESS (CRC) remain unclear. In this study, we explored the expressions of MAL2 and TPD52 in Citation: Li J, Li Y, Liu H, Liu Y, Cui B (2017) The tumor specimens resected from 123 CRC patients and the prognostic values of the two pro- four-transmembrane protein MAL2 and tumor teins in CRC. Immunohistochemical analyses showed that MAL2 (P<0.001) and TPD52 protein D52 (TPD52) are highly expressed in (P<0.001) were significantly highly expressed in primary carcinoma tissues compared with colorectal cancer and correlated with poor prognosis. PLoS ONE 12(5): e0178515. https://doi. adjacent non-cancerous mucosa tissues. And TPD52 exhibited frequent overexpression in org/10.1371/journal.pone.0178515 liver metastasis tissues relative to primary carcinoma tissues (P = 0.042), while MAL2 in Editor: Aamir Ahmad, University of South Alabama lymphnode and liver metastasis tissues showed no significant elevation. Real-time quantita- Mitchell Cancer Institute, UNITED STATES tive PCR (RT-qPCR) showed the identical results. Correlation analyses by Pearson's chi- Received: April 1, 2017 square test demonstrated that MAL2 in tumors was positively correlated with tumor status (pathological assessment of regional lymph nodes (pN, P = 0.024)), and clinic stage (P = Accepted: May 15, 2017 0.017).
    [Show full text]
  • Mutations Suggests Both Loss-Of-Function and Gain-Of-Function Effects Morag A
    © 2021. Published by The Company of Biologists Ltd | Disease Models & Mechanisms (2021) 14, dmm047225. doi:10.1242/dmm.047225 RESEARCH ARTICLE Hearing impairment due to Mir183/96/182 mutations suggests both loss-of-function and gain-of-function effects Morag A. Lewis1,2,*, Francesca Di Domenico1, Neil J. Ingham1,2, Haydn M. Prosser2 and Karen P. Steel1,2 ABSTRACT birth. However, this is not the cause of the hearing loss; even before The microRNA miR-96 is important for hearing, as point mutations in the onset of normal hearing, homozygote hair cells fail to mature humans and mice result in dominant progressive hearing loss. Mir96 both morphologically and physiologically, remaining in their is expressed in sensory cells along with Mir182 and Mir183, but the immature state, and heterozygote hair cells show a developmental roles of these closely-linked microRNAs are as yet unknown. Here, delay. miR-96 is thus thought to be responsible for coordinating we analyse mice carrying null alleles of Mir182, and of Mir183 and hair cell maturation (Chen et al., 2014; Kuhn et al., 2011). Mir96 together to investigate their roles in hearing. We found that Overexpression of the three miRNAs also results in cochlear defects Mir183/96 heterozygous mice had normal hearing and homozygotes and hearing loss (Weston et al., 2018). The complete loss of all were completely deaf with abnormal hair cell stereocilia bundles and mature miRNAs from the inner ear results in early developmental reduced numbers of inner hair cell synapses at 4 weeks of age. defects including a severely truncated cochlear duct (Friedman Mir182 knockout mice developed normal hearing then exhibited et al., 2009; Soukup et al., 2009).
    [Show full text]
  • Nanopore Sequencing Enables Near-Complete De Novo Assembly of 2 Saccharomyces Cerevisiae Reference Strain CEN.PK113-7D
    bioRxiv preprint doi: https://doi.org/10.1101/175984; this version posted August 14, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 Nanopore sequencing enables near-complete de novo assembly of 2 Saccharomyces cerevisiae reference strain CEN.PK113-7D 3 #,1,3 #,2 2 4 Alex N. Salazar , Arthur R. Gorter de Vries , Marcel van den Broek , Melanie 2 2 2 2 5 Wijsman , Pilar de la Torre Cortés , Anja Brickwedde , Nick Brouwers , Jean-Marc 2 ,1,3 6 G. Daran and Thomas Abeel* # 7 These authors contributed equally to this publication and should be 8 considered co-first authors. 9 * Corresponding author 10 1. Delft Bioinformatics Lab, Delft University of Technology, Delft, The 11 Netherlands 12 2. Department of Biotechnology, Delft University of Technology, Delft, The 13 Netherlands 14 3. Broad Institute of MIT and Harvard, Boston, Massachusetts, USA 15 16 Alex N. Salazar [email protected] 17 Arthur R. Gorter de Vries [email protected] 18 Marcel van den Broek [email protected] 19 Melanie Wijsman [email protected] 20 Pilar de la Torre Cortés [email protected] 21 Anja Brickwedde [email protected] 22 Nick Brouwers [email protected] 23 Jean-Marc G. Daran [email protected] 24 Thomas Abeel [email protected] 25 Manuscript for publication in FEMS Yeast Research 1 bioRxiv preprint doi: https://doi.org/10.1101/175984; this version posted August 14, 2017.
    [Show full text]
  • MAL2 Drives Immune Evasion in Breast Cancer by Suppressing Tumor Antigen Presentation
    MAL2 drives immune evasion in breast cancer by suppressing tumor antigen presentation Yuanzhang Fang, … , Xiongbin Lu, Xinna Zhang J Clin Invest. 2020. https://doi.org/10.1172/JCI140837. Research In-Press Preview Immunology Oncology Graphical abstract Find the latest version: https://jci.me/140837/pdf MAL2 drives immune evasion in breast cancer by suppressing tumor antigen presentation Yuanzhang Fang1,*, Lifei Wang1,†,*, Changlin Wan1,*, Yifan Sun1, Kevin Van der Jeught1, Zhuolong Zhou1, Tianhan Dong2, Ka Man So1, Tao Yu1, Yujing Li1, Haniyeh Eyvani1, Austyn B Colter3, Edward Dong1, Sha Cao4, Jin Wang5, Bryan P Schneider1,6,7, George E. SandusKy3, Yunlong Liu1,8, Chi Zhang1,8,#, Xiongbin Lu1,6,8,#, Xinna Zhang1,6,# 1Department of Medical and Molecular Genetics, Indiana University School of Medicine, Indianapolis, IN 46202, USA 2Department of Pharmacology and Toxicology, Indiana University School of Medicine, Indianapolis, IN 46202, USA 3Department of Pathology and Laboratory Medicine, Indiana University School of Medicine, Indianapolis, IN, 46202, USA 4Department of Biostatistics, Indiana University, School of Medicine, Indianapolis, IN 46202, USA 5Department of Pharmacology and Chemical Biology, Baylor College of Medicine, Houston, TX 77030, USA 6Melvin and Bren Simon Cancer Center, Indiana University School of Medicine, Indianapolis, IN 46202, USA 7Division of Hematology/Oncology, Department of Medicine, Indiana University School of Medicine, Indianapolis, IN, 46202, USA 8Center for Computational Biology and Bioinformatics, Indiana University School of Medicine, Indianapolis, IN, 46202, USA *These authors contributed equally †Present address: Institute of Medicinal Biotechnology, Chinese Academy of Sciences & PeKing Union Medical College, Beijing 100050, China #Address correspondence to: Chi Zhang, 410 W. 10th Street, HS 5000, Indianapolis, Indiana 46202, USA.
    [Show full text]
  • Genomic and Transcriptome Analysis Revealing an Oncogenic Functional Module in Meningiomas
    Neurosurg Focus 35 (6):E3, 2013 ©AANS, 2013 Genomic and transcriptome analysis revealing an oncogenic functional module in meningiomas XIAO CHANG, PH.D.,1 LINGLING SHI, PH.D.,2 FAN GAO, PH.D.,1 JONATHAN RUssIN, M.D.,3 LIYUN ZENG, PH.D.,1 SHUHAN HE, B.S.,3 THOMAS C. CHEN, M.D.,3 STEVEN L. GIANNOTTA, M.D.,3 DANIEL J. WEISENBERGER, PH.D.,4 GAbrIEL ZADA, M.D.,3 KAI WANG, PH.D.,1,5,6 AND WIllIAM J. MAck, M.D.1,3 1Zilkha Neurogenetic Institute, Keck School of Medicine, University of Southern California, Los Angeles, California; 2GHM Institute of CNS Regeneration, Jinan University, Guangzhou, China; 3Department of Neurosurgery, Keck School of Medicine, University of Southern California, Los Angeles, California; 4USC Epigenome Center, Keck School of Medicine, University of Southern California, Los Angeles, California; 5Department of Psychiatry, Keck School of Medicine, University of Southern California, Los Angeles, California; and 6Division of Bioinformatics, Department of Preventive Medicine, Keck School of Medicine, University of Southern California, Los Angeles, California Object. Meningiomas are among the most common primary adult brain tumors. Although typically benign, roughly 2%–5% display malignant pathological features. The key molecular pathways involved in malignant trans- formation remain to be determined. Methods. Illumina expression microarrays were used to assess gene expression levels, and Illumina single- nucleotide polymorphism arrays were used to identify copy number variants in benign, atypical, and malignant me- ningiomas (19 tumors, including 4 malignant ones). The authors also reanalyzed 2 expression data sets generated on Affymetrix microarrays (n = 68, including 6 malignant ones; n = 56, including 3 malignant ones).
    [Show full text]
  • Identification of Key Genes and Pathways in Pancreatic Cancer
    G C A T T A C G G C A T genes Article Identification of Key Genes and Pathways in Pancreatic Cancer Gene Expression Profile by Integrative Analysis Wenzong Lu * , Ning Li and Fuyuan Liao Department of Biomedical Engineering, College of Electronic and Information Engineering, Xi’an Technological University, Xi’an 710021, China * Correspondence: [email protected]; Tel.: +86-29-86173358 Received: 6 July 2019; Accepted: 7 August 2019; Published: 13 August 2019 Abstract: Background: Pancreatic cancer is one of the malignant tumors that threaten human health. Methods: The gene expression profiles of GSE15471, GSE19650, GSE32676 and GSE71989 were downloaded from the gene expression omnibus database including pancreatic cancer and normal samples. The differentially expressed genes between the two types of samples were identified with the Limma package using R language. The gene ontology functional and pathway enrichment analyses of differentially-expressed genes were performed by the DAVID software followed by the construction of a protein–protein interaction network. Hub gene identification was performed by the plug-in cytoHubba in cytoscape software, and the reliability and survival analysis of hub genes was carried out in The Cancer Genome Atlas gene expression data. Results: The 138 differentially expressed genes were significantly enriched in biological processes including cell migration, cell adhesion and several pathways, mainly associated with extracellular matrix-receptor interaction and focal adhesion pathway in pancreatic cancer. The top hub genes, namely thrombospondin 1, DNA topoisomerase II alpha, syndecan 1, maternal embryonic leucine zipper kinase and proto-oncogene receptor tyrosine kinase Met were identified from the protein–protein interaction network.
    [Show full text]
  • Novel Prognostic Markers Revealed by a Proteomic Approach Separating
    Modern Pathology (2015) 28, 69–79 & 2015 USCAP, Inc. All rights reserved 0893-3952/15 $32.00 69 Novel prognostic markers revealed by a proteomic approach separating benign from malignant insulinomas Ibrahim Alkatout1,13, Juliane Friemel2,13, Barbara Sitek3, Martin Anlauf4, Patricia A Eisenach5, Kai Stu¨ hler6, Aldo Scarpa7, Aurel Perren8, Helmut E Meyer3,9, Wolfram T Knoefel10,Gu¨ nter Klo¨ppel11 and Bence Sipos12 1Clinic of Gynecology and Obstetrics, University Hospitals Schleswig-Holstein, Kiel, Germany; 2Institute of Pathology, University of Zurich, Zurich, Switzerland; 3Medizinisches Proteom-Center, Ruhr-University Bochum, Bochum,Germany; 4Section Neuroendocrine Neoplasms, Institute of Pathology, University of Du¨sseldorf, Du¨sseldorf, Germany; 5Department of Molecular Medicine, Max-Planck Institute of Biochemistry, Martinsried, Germany; 6Molecular Proteomics Laboratory, Biologisch-Medizinisches Forschungszentrum, Heinrich-Heine-Universita¨t, Du¨sseldorf, Germany; 7ARC-NET Research Center and Department of Pathology and Diagnostics, University and Hospital Trust of Verona, Verona, Italy; 8Institute of Pathology, University of Bern, Bern, Switzerland; 9Institute of Pathology, University of Tu¨bingen, Tu¨bingen, Germany; 10Department of General, Visceral and Pediatric Surgery, University Hospital, Du¨sseldorf, Germany; 11Institute of Pathology, Technical University of Munich, Munich, Germany and 12Leibniz-Institut fu¨r Analytische Wissenschaften—ISAS—e.V., Dortmund, Germany The prognosis of pancreatic neuroendocrine tumors is related to size, histology and proliferation rate. However, this stratification needs to be refined further. We conducted a proteome study on insulinomas, a well-defined pancreatic neuroendocrine tumor entity, in order to identify proteins that can be used as biomarkers for malignancy. Based on a long follow-up, insulinomas were divided into those with metastases (malignant) and those without (benign).
    [Show full text]
  • 52 and TPD54 on Oral Squamous Cell Carcinoma Cells
    1634 INTERNATIONAL JOURNAL OF ONCOLOGY 50: 1634-1646, 2017 Opposite effects of tumor protein D (TPD) 52 and TPD54 on oral squamous cell carcinoma cells KOSUKE KATO1, YOSHIKI MUKUDAI1, HIROMI MOTOHASHI1, CHIHIRO ITO1, SHINNOSUKE KAMOSHIDA1, TOSHIKAZU SHIMANE1, SEIJI KONDO1,2 and TATSUO SHIROTA1 1Department of Oral and Maxillofacial Surgery, School of Dentistry, Showa University, Ota-ku, Tokyo 145-8515; 2Department of Oral and Maxillofacial Surgery, Faculty of Medicine, Fukuoka University, Jonan-ku, Fukuoka 814-0180, Japan Received December 21, 2016; Accepted February 13, 2017 DOI: 10.3892/ijo.2017.3929 Abstract. The tumor protein D52 (TPD52) protein family Introduction includes TPD52, -53, -54 and -55. Several reports have shown important roles for TPD52 and TPD53, and have also suggested The tumor protein D52 (TPD52) protein family consists of the potential involvement of TPD54, in D52-family physi- TPD52 (1), -53 (1-4), -54 (2,4), and -55 (5). The first identified ological effects. Therefore, we performed detailed expression protein of this family, TPD52, was found to be overexpressed analysis of TPD52 family proteins in oral squamous cell in breast and lung cancers (6,7). Other family members have carcinoma (OSCC). Towards this end, TPD54-overexpressing also been reported to be highly expressed in colon (8,9), or knocked-down cells were constructed using OSCC-derived ovary (10-12), testis (5,13), prostate (14), and breast (15-17) SAS, HSC2 and HSC3 cells. tpd52 or tpd53 was expressed or cancers. Previous reports showed that overexpression of co-expressed in these cells by transfection. The cells were then tpd52 in non-malignant 3T3 fibroblasts induces malignant analyzed using cell viability (MTT), colony formation, migra- transformation and increases cell proliferation and anchorage- tion, and invasion assays.
    [Show full text]
  • Entrez ID Gene Name Fold Change Q-Value Description
    Entrez ID gene name fold change q-value description 4283 CXCL9 -7.25 5.28E-05 chemokine (C-X-C motif) ligand 9 3627 CXCL10 -6.88 6.58E-05 chemokine (C-X-C motif) ligand 10 6373 CXCL11 -5.65 3.69E-04 chemokine (C-X-C motif) ligand 11 405753 DUOXA2 -3.97 3.05E-06 dual oxidase maturation factor 2 4843 NOS2 -3.62 5.43E-03 nitric oxide synthase 2, inducible 50506 DUOX2 -3.24 5.01E-06 dual oxidase 2 6355 CCL8 -3.07 3.67E-03 chemokine (C-C motif) ligand 8 10964 IFI44L -3.06 4.43E-04 interferon-induced protein 44-like 115362 GBP5 -2.94 6.83E-04 guanylate binding protein 5 3620 IDO1 -2.91 5.65E-06 indoleamine 2,3-dioxygenase 1 8519 IFITM1 -2.67 5.65E-06 interferon induced transmembrane protein 1 3433 IFIT2 -2.61 2.28E-03 interferon-induced protein with tetratricopeptide repeats 2 54898 ELOVL2 -2.61 4.38E-07 ELOVL fatty acid elongase 2 2892 GRIA3 -2.60 3.06E-05 glutamate receptor, ionotropic, AMPA 3 6376 CX3CL1 -2.57 4.43E-04 chemokine (C-X3-C motif) ligand 1 7098 TLR3 -2.55 5.76E-06 toll-like receptor 3 79689 STEAP4 -2.50 8.35E-05 STEAP family member 4 3434 IFIT1 -2.48 2.64E-03 interferon-induced protein with tetratricopeptide repeats 1 4321 MMP12 -2.45 2.30E-04 matrix metallopeptidase 12 (macrophage elastase) 10826 FAXDC2 -2.42 5.01E-06 fatty acid hydroxylase domain containing 2 8626 TP63 -2.41 2.02E-05 tumor protein p63 64577 ALDH8A1 -2.41 6.05E-06 aldehyde dehydrogenase 8 family, member A1 8740 TNFSF14 -2.40 6.35E-05 tumor necrosis factor (ligand) superfamily, member 14 10417 SPON2 -2.39 2.46E-06 spondin 2, extracellular matrix protein 3437
    [Show full text]
  • Molecular Targeting and Enhancing Anticancer Efficacy of Oncolytic HSV-1 to Midkine Expressing Tumors
    University of Cincinnati Date: 12/20/2010 I, Arturo R Maldonado , hereby submit this original work as part of the requirements for the degree of Doctor of Philosophy in Developmental Biology. It is entitled: Molecular Targeting and Enhancing Anticancer Efficacy of Oncolytic HSV-1 to Midkine Expressing Tumors Student's name: Arturo R Maldonado This work and its defense approved by: Committee chair: Jeffrey Whitsett Committee member: Timothy Crombleholme, MD Committee member: Dan Wiginton, PhD Committee member: Rhonda Cardin, PhD Committee member: Tim Cripe 1297 Last Printed:1/11/2011 Document Of Defense Form Molecular Targeting and Enhancing Anticancer Efficacy of Oncolytic HSV-1 to Midkine Expressing Tumors A dissertation submitted to the Graduate School of the University of Cincinnati College of Medicine in partial fulfillment of the requirements for the degree of DOCTORATE OF PHILOSOPHY (PH.D.) in the Division of Molecular & Developmental Biology 2010 By Arturo Rafael Maldonado B.A., University of Miami, Coral Gables, Florida June 1993 M.D., New Jersey Medical School, Newark, New Jersey June 1999 Committee Chair: Jeffrey A. Whitsett, M.D. Advisor: Timothy M. Crombleholme, M.D. Timothy P. Cripe, M.D. Ph.D. Dan Wiginton, Ph.D. Rhonda D. Cardin, Ph.D. ABSTRACT Since 1999, cancer has surpassed heart disease as the number one cause of death in the US for people under the age of 85. Malignant Peripheral Nerve Sheath Tumor (MPNST), a common malignancy in patients with Neurofibromatosis, and colorectal cancer are midkine- producing tumors with high mortality rates. In vitro and preclinical xenograft models of MPNST were utilized in this dissertation to study the role of midkine (MDK), a tumor-specific gene over- expressed in these tumors and to test the efficacy of a MDK-transcriptionally targeted oncolytic HSV-1 (oHSV).
    [Show full text]
  • MAL2 and Tumor Protein D52 (TPD52) Are Frequently Overexpressed in Ovarian Carcinoma, but Differentially Associated with Histolo
    Byrne et al. BMC Cancer 2010, 10:497 http://www.biomedcentral.com/1471-2407/10/497 RESEARCH ARTICLE Open Access MAL2 and tumor protein D52 (TPD52) are frequently overexpressed in ovarian carcinoma, but differentially associated with histological subtype and patient outcome Jennifer A Byrne1,2*, Sanaz Maleki3, Jayne R Hardy1, Brian S Gloss3, Rajmohan Murali4,5, James P Scurry6, Susan Fanayan1,2, Catherine Emmanuel7,8, Neville F Hacker9,10, Robert L Sutherland3,11, Anna deFazio7,8, Philippa M O’Brien3,11 Abstract Background: The four-transmembrane MAL2 protein is frequently overexpressed in breast carcinoma, and MAL2 overexpression is associated with gain of the corresponding locus at chromosome 8q24.12. Independent expression microarray studies predict MAL2 overexpression in ovarian carcinoma, but these had remained unconfirmed. MAL2 binds tumor protein D52 (TPD52), which is frequently overexpressed in ovarian carcinoma, but the clinical significance of MAL2 and TPD52 overexpression was unknown. Methods: Immunohistochemical analyses of MAL2 and TPD52 expression were performed using tissue microarray sections including benign, borderline and malignant epithelial ovarian tumours. Inmmunohistochemical staining intensity and distribution was assessed both visually and digitally. Results: MAL2 and TPD52 were significantly overexpressed in high-grade serous carcinomas compared with serous borderline tumours. MAL2 expression was highest in serous carcinomas relative to other histological subtypes, whereas TPD52 expression was highest in clear cell carcinomas. MAL2 expression was not related to patient survival, however high-level TPD52 staining was significantly associated with improved overall survival in patients with stage III serous ovarian carcinoma (log-rank test, p < 0.001; n = 124) and was an independent predictor of survival in the overall carcinoma cohort (hazard ratio (HR), 0.498; 95% confidence interval (CI), 0.34-0.728; p < 0.001; n = 221), and in serous carcinomas (HR, 0.440; 95% CI, 0.294-0.658; p < 0.001; n = 182).
    [Show full text]
  • 393LN V 393P 344SQ V 393P Probe Set Entrez Gene
    393LN v 393P 344SQ v 393P Entrez fold fold probe set Gene Gene Symbol Gene cluster Gene Title p-value change p-value change chemokine (C-C motif) ligand 21b /// chemokine (C-C motif) ligand 21a /// chemokine (C-C motif) ligand 21c 1419426_s_at 18829 /// Ccl21b /// Ccl2 1 - up 393 LN only (leucine) 0.0047 9.199837 0.45212 6.847887 nuclear factor of activated T-cells, cytoplasmic, calcineurin- 1447085_s_at 18018 Nfatc1 1 - up 393 LN only dependent 1 0.009048 12.065 0.13718 4.81 RIKEN cDNA 1453647_at 78668 9530059J11Rik1 - up 393 LN only 9530059J11 gene 0.002208 5.482897 0.27642 3.45171 transient receptor potential cation channel, subfamily 1457164_at 277328 Trpa1 1 - up 393 LN only A, member 1 0.000111 9.180344 0.01771 3.048114 regulating synaptic membrane 1422809_at 116838 Rims2 1 - up 393 LN only exocytosis 2 0.001891 8.560424 0.13159 2.980501 glial cell line derived neurotrophic factor family receptor alpha 1433716_x_at 14586 Gfra2 1 - up 393 LN only 2 0.006868 30.88736 0.01066 2.811211 1446936_at --- --- 1 - up 393 LN only --- 0.007695 6.373955 0.11733 2.480287 zinc finger protein 1438742_at 320683 Zfp629 1 - up 393 LN only 629 0.002644 5.231855 0.38124 2.377016 phospholipase A2, 1426019_at 18786 Plaa 1 - up 393 LN only activating protein 0.008657 6.2364 0.12336 2.262117 1445314_at 14009 Etv1 1 - up 393 LN only ets variant gene 1 0.007224 3.643646 0.36434 2.01989 ciliary rootlet coiled- 1427338_at 230872 Crocc 1 - up 393 LN only coil, rootletin 0.002482 7.783242 0.49977 1.794171 expressed sequence 1436585_at 99463 BB182297 1 - up 393
    [Show full text]