Page 1 of 46 Diabetes
The p300 and CBP transcriptional coactivators are required for beta cell and alpha cell
proliferation
Chi Kin Wong1,2, Adam K Wade Vallance2, Dan S Luciani2,3, Paul K Brindle4, Francis C
Lynn2,3,5, William T Gibson1,2
1. Department of Medical Genetics, University of British Columbia, Vancouver, BC,
Canada
2. BC Children’s Hospital Research Institute, Vancouver, BC, Canada
3. Department of Surgery, University of British Columbia, Vancouver, BC, Canada
4. St. Jude Children’s Research Hospital, Memphis, TN, USA
5. Departments of Cellular & Physiological Sciences, University of British Columbia,
Vancouver, BC, Canada
*Corresponding author: Chi Kin Wong, [email protected], (604) 875 2000 ext 6783
Running title: roles of p300/CBP in pancreatic islets
Word counts: 4000
Number of table: 0
Number of figure: 6
Diabetes Publish Ahead of Print, published online December 7, 2017 Diabetes Page 2 of 46
Abstract p300 (EP300) and CBP (CREBBP) are transcriptional coactivators with histone acetyltransferase activity. Various beta cell transcription factors can recruit p300/CBP, and thus the coactivators could be important for beta cell function and health in vivo. We hypothesized that p300/CBP contribute to the development and proper function of pancreatic islets. To test this, we bred and studied mice lacking p300/CBP in their islets. Mice lacking either p300 or CBP in islets developed glucose intolerance attributable to impaired insulin secretion, together with reduced alpha and beta cell area and islet insulin content. These phenotypes were exacerbated in mice with only a single copy of p300 or CBP expressed in islets. Removing p300 in pancreatic endocrine progenitors impaired proliferation of neonatal alpha and beta cells. Mice lacking all four copies of p300/CBP in pancreatic endocrine progenitors failed to establish alpha and beta cell mass postnatally. Transcriptomic analyses revealed significant overlaps between p300/CBP downregulated genes and genes downregulated in Hnf1α null islets and Nkx2.2 null islets, among others. Furthermore, p300/CBP are important for the acetylation of H3K27 at loci downregulated in Hnf1α null islets. We conclude that p300 and CBP are limiting cofactors for islet development, and hence for postnatal glucose homeostasis, with some functional redundancy.
Introduction
The expression of specific transcription factors both determines and maintains the identities of pancreatic endocrine cells through activation of endocrine genes. For example, Pdx1, MafA and
NeuroD1 form transcriptional complex at the insulin promoters and enhancers to activate insulin expression synergistically in beta cells (1). These transcription factors also recruit co regulators Page 3 of 46 Diabetes
to fine tune gene expression. p300 and CBP (p300/CBP) are transcription coactivators that share
more than 60% protein sequence identity and exhibit highly similar function. These coactivators
acetylate lysine residues on histones to modulate chromatin structure or function, and lysine
residues on non histone proteins to modulate their activities (2). While p300/CBP can acetylate
most histone proteins, they are absolutely essential for acetylating histone H3 lysine 27 (4). The
H3K27Ac mark tags tissue specific promoters and enhancers and signals transcription of the
tissue specific target genes (3,4).
p300/CBP appear to regulate important beta cell functions in vitro. For instance, p300/CBP
coactivate insulin gene expression in vitro by binding synergistically to Pdx1 and NeuroD1/E47
(5). siRNA knock down of p300/CBP in INS1 cells reduced glucose stimulated insulin gene
expression (6). In contrast, CRISPR Cas9 mediated deletion of p300 in INS1 832/13 cells
induced a subtle increase in glucose stimulated insulin secretion and reduced high glucose
mediated apoptosis (7). Mice with the S436A variant in both copies of CBP, a mutation which
render CBP unresponsive to insulin triggered phosphorylation, had increased islet mass but
relatively normal beta cell function (8). These data left unresolved whether p300/CBP expression
in pancreatic islets is necessary for establishing glucose homeostasis in vivo. We hypothesized
that removal of p300/CBP from pancreatic endocrine progenitors would lead to postnatal glucose
intolerance due to defects in islet mass and function. In this study, we generated and phenotyped
Neurog3 Cre driven pancreatic islet specific p300 and CBP knockout mice to study the roles of
these coactivators in pancreatic islets in vivo.
Research Design and Methods Diabetes Page 4 of 46
Animals
All procedures were approved by the University of British Columbia Animal Care Committee.
Mice housed at BC Children’s Hospital Research Institute were under 12 hour day night cycle
with ad libitum access to standard chow (Teklad 2918; Envigo, UK) and water. Neurog3 Cre mice were obtained from Dr. Francis Lynn (9). Ep300fl/fl mice were obtained from Dr. Paul
Brindle (10). Crebbpfl/fl mice were purchased from The Jackson Laboratory (ME, USA) (13). All
mice were kept on C57/BL6J background. Cre negative littermates from each breeding setup
were used as wildtype (WT) control. Timed matings were used to study embryonic day 15.5
(E15.5) and day 18.5 (E18.5), postnatal day 0 (P0) and day 7 (P7) mice; the morning when a
vaginal plug was found on the dams was designated as E0.5.
Metabolic phenotyping
For glucose tolerance test, mice were fasted for five hours and then injected intraperitoneally
with 2 g/kg glucose. For insulin tolerance test, mice were injected with 0.7 U/kg Humulin R (Eli
Lily, IN, USA). Blood was sampled from mouse tails and blood glucose levels were assessed
using a Onetouch UltraMini glucometer (Johnson & Johnson, NJ, USA). For plasma insulin
measurement, mice were fasted for five hours and blood was sampled from the saphenous veins
using heparinized capillary tubes before and after glucose injection. Heparinized blood was
centrifuged at 2,000 g for 15 minutes at 4oC to separate plasma. Body composition analysis and
metabolic cage experiments were performed as previously described (11).
Analyte measurement Page 5 of 46 Diabetes
Insulin was quantified using STELLUX Chemiluminescent Immunoassays (ALPCO, NH, USA).
Glucagon was quantified using Glucagon ELISA (Mercodia, Sweden). Somatostatin was
quantified using Somatostatin EIA Kit (Phoenix Pharmaceuticals, CA, USA). Total GLP1 was
quantified using Multi Species GLP 1 Total ELISA (Merck Millipore, MA, USA).
Ex vivo islet assays
Mouse pancreatic islets were isolated as described previously (12). For glucose stimulated
insulin secretion assay, overnight recovered islets were incubated in Krebs Ringer buffer (KRB)
containing 2.8 mM glucose for 1 hour at 37°C. After the pre incubation, 30 islets were incubated
in KRB containing either 2.8 mM glucose, 16.7 mM glucose or 2.8 mM glucose with 30 mM
KCl for 1 hour at 37°C. Supernatants were collected for insulin measurement. Fura 2 calcium
imaging was performed as described before (13). Perifusion assays were performed on a Biorep
Perifusion system per manufacturer’s instruction using 100 islets per chamber (Biorep, FL,
USA).
Immunofluorescence staining
Adult pancreata were fixed in 10% formalin for 24 hours at 4oC, dehydrated, embedded in
paraffin and 5 µm serial sections were made. A total of four to five sections each separated by
150 µm were obtained per adult pancreas. For E15.5 and E18.5, sections were obtained from the
entire pancreas and sections separated by 30 µm were stained. For P0 and P7, sections separated
by 60 µm were obtained. These sections were stained for insulin, glucagon, somatostatin,
ghrelin, chromogranin A and/or Ki67. Other proteins were stained using randomly chosen
sections. After blocking, the sections were incubated with primary antibodies overnight at 4oC Diabetes Page 6 of 46
followed by incubation with secondary antibodies. Primary antibodies used include rabbit anti p300 (N 15 + C 20 1:1, 1/50; Santa Cruz, TX, USA), rabbit anti CBP (1/200; CST, MA, USA),
guinea pig anti insulin (1/200; Abcam, UK), mouse anti glucagon (1/1000; Abcam), rabbit anti
somatostatin (1/400; Abcam), goat anti somatostatin (1/200; Santa Cruz), goat anti ghrelin
(1/100; Santa Cruz), rabbit anti Ki67 (1/200; CST), rabbit anti chromogranin A (1/200; Abcam),
goat anti chromogranin A (1/200; Santa Cruz), mouse anti Ngn3 (1/50; DSHB, IA, USA), rabbit
anti H3K27Ac (1/200; CST) and rabbit anti H3K27me3 (1/200; CST). The TUNEL assays were performed with the In Situ Cell Death Detection Kit (Sigma Aldrich, MO, USA). Representative
images of individual islets were taken on a SP5 confocal microscope (Leica, Germany). Images
of whole pancreas sections were tiled on a BX61 fluorescence microscope (Olympus, Japan) and
quantified using Fiji (14). Islet endocrine area were calculated by dividing the corresponding
stained area by the total pancreas area. For E15.5 studies, total number of cells per population
were counted and normalized to total DAPI count per section.
Transcriptomic analyses
Total RNA was extracted from islets using TRIzol (ThemoFisher, MA, USA) and RNeasy Micro
Kit (QIAgen, Germany). For RNA seq, six WT, three p300IsletKO, three CBPIsletKO and three
CBPHet; p300KO samples were sequenced in two batches at UBC Biomedical Research Centre
Sequencing Core. RNA samples with RIN higher than 8.5 as measured on Bioanalyzer 2100
(Agilent, CA, USA) were prepared into sequencing libraries on NeoPrep using TruSeq Stranded mRNA Library Prep kit (Illumina, CA, USA). Each library was sequenced to a depth of at least
20 million paired end reads on a NextSeq 500 (Illumina, CA, USA). Quality filtered reads were aligned to reference mouse genome mm10 with TopHat2 (15). Count tables for the aligned reads Page 7 of 46 Diabetes
were generated and batch effects were corrected using SVA (16), followed by calling of
differentially expressed genes using DESeq2 with default settings in R (17). Genes were defined
as differentially expressed based on adjusted p value < 0.05. The Venn diagram for overlapping
downregulated genes was generated using BioVenn (18). Downregulated gene lists were
uploaded to Webgestalt for gene ontology (GO) terms analysis and transcription factor target
prediction (19), using a reference list of 15,999 islet genes from the WT islet transcriptome for
accurate overrepresentation analyses. The lowest false discovery rate (FDR) from Webgestalt
was capped at 10 15. Manual gene set enrichment analyses (GSEA) were performed by applying
hypergeometric test with Bonferroni correction to the overlapped genes between different gene
sets. All RNA seq data were deposited in the Gene Expression Omnibus (GEO) database
(GSE101537).
For qPCR, RNAs were reverse transcribed using the iScript cDNA synthesis kit (Bio Rad, CA,
USA) and quantified by SYBR green based reaction using GoTaq qPCR Master Mix (Promega,
WI, USA) and primers (see Supplementary Table 1) on ABI 7500 Real Time PCR system
(ThermoFisher, MA, USA). Data were normalized to 18s rRNA and fold changes were
calculated with the ∆∆CT method (20).
Western blotting
Islet nuclear extracts were prepared using the NE PER Nuclear and Cytoplasmic Extraction Kit
(ThermoFisher). One µg of nuclear lysate was subject to Western blotting using rabbit anti p300
(N 15 + C 20 1:1, 1/1000; Santa Cruz), rabbit anti CBP (1/1000; Santa Cruz) and mouse anti
TBP (1/5000; Abcam) as described previously (21). Diabetes Page 8 of 46
Low input native chromatin immunoprecipitation (N ChIP)
The low input N ChIP protocol was carried out as previously described (22). 100 islets were
dispersed in 0.05% trypsin and flash frozen prior to lysis. Buffers were supplemented with 10
mM sodium butyrate to retain acetylation signals. Cells were lysed and digested with MNase for
5 minutes as validated using wildtype islet cells. Chromatin equivalent to 10 islets per sample
was subjected to ChIP using rabbit anti H3K27Ac or rabbit anti H3K27me3 (both 2 µL/ChIP;
CST). ChIP’d DNA was quantified by qPCR and expressed as percentage input.
Statistics
Data were shown as mean ± standard deviation. Statistical significance was tested using
Student’s t test, one way ANOVA or two way ANOVA, as appropriate, with p < 0.05 considered statistically significant.
Results
Mice lacking p300 in pancreatic islets develop glucose intolerance due to hypoinsulinemia
We first characterized Neurog3 Cre; Ep300fl/WT mice which did not develop glucose intolerance
up to 24 weeks old. They also appeared phenotypically identical to Cre negative Ep300fl/fl mice
and to mice bearing Neurog3 Cre transgene alone (not shown). We then made Neurog3 Cre;
Ep300fl/fl mice (p300IsletKO mice). At E15.5, p300 was effectively removed using Neurog3 Cre in up to 95% of chromogranin A positive cells, while Ngn3 positive progenitors remained p300 positive (Supplementary Figure 1). This is likely due to a time lag between the onset of Cre expression and the onset of recombination. Among the chromogranin A positive cells, recombination occurred in newly formed beta cells, alpha cells, delta cells and epsilon cells Page 9 of 46 Diabetes
(delta cells in Supplementary Figure 1; other cell types not shown). In p300IsletKO mouse
pancreata, p300 was absent in islet nuclei but expressed normally in the exocrine tissues (Figure
1A & 1B). The protein levels of CBP were similar between WT and p300 null islets, indicating
the absence of compensatory overexpression of CBP paralog.
p300IsletKO mice were glucose intolerant at eight weeks of age but display normal insulin
tolerance (Figure 1C & 1D). Plasma insulin levels of p300IsletKO mice were 60% lower than that
of WT both before and after glucose injection (Figure 1E). Theoretically, defective glucose
metabolism in p300IsletKO mice could be in part due to the Neurog3 Cre mediated recombination
outside of islets such as in ventromedial hypothalamus and enteroendocrine cells (9,23). We
found that WT and p300IsletKO mice had similar body composition, energy expenditure,
locomotor activity and food intake (Supplementary Figure 2A to 2D). Also, plasma total GLP1
levels were normal in p300IsletKO mice (Supplementary Figure 2E). In the absence of observable
extra pancreatic phenotypes, the glucose intolerance and hypoinsulinemia can be attributed to the
recombination within pancreatic islets rather than other Neurog3 expressing tissues.
p300IsletKO mice have reduced islet area and islet insulin content
To examine how p300IsletKO mice developed glucose intolerance and hypoinsulinemia, we first
quantified islet cell area in adult mice. While the weights of p300IsletKO mouse pancreata were
comparable to WT mice (Supplementary Figure 3A), they showed a 25% reduction in alpha cell
and beta cell area (Figure 2A). Delta cell area was unaffected. The reduced alpha cell and beta
cell area was attributable to reduced number of islets rather than islet size (Figure 2B &
Supplementary Figure 3B). Beta to alpha cell ratios were similar between WT and p300IsletKO Diabetes Page 10 of 46
mouse pancreata (Supplementary Figure 3C). Insulin content of p300 null islets was reduced by
19%, while glucagon content was unchanged (Figure 2C). The somatostatin content was elevated by nearly two fold. Fasting plasma glucagon levels of p300IsletKO mice were unaffected
(Supplementary Figure 3D). To assess the function of p300 null islet explants, we stimulated the
islets with low glucose, high glucose or KCl and measured their insulin release. While both WT
and p300 null islets responded similarly to low or high glucose, p300 null islets had increased
insulin secretion and calcium response upon KCl stimulation (Figure 2D & 2E). Glucagon
secretion from p300 null islets under low glucose condition was not significantly different from
the WT islets (Supplementary Figure 3E). Thus, the combined defects in islet mass and islet
insulin content result in deficient glucose stimulated insulin secretion in p300IsletKO mice.
CBPIsletKO mice share similar beta cell phenotypes to p300IsletKO mice
To understand whether p300 and CBP function similarly in pancreatic islets, we generated
Neurog3 Cre; Crebbpfl/fl (CBPIsletKO) mice. The deletion of CBP in islets was not compensated for by the overexpression of p300 (Figure 3A). CBPIsletKO mice developed glucose phenotypes similar to p300IsletKO mice, including glucose intolerance at eight weeks of age without insulin resistance, and defective insulin release upon glucose injection (Figure 3B, 3C & 3D). Unlike p300IsletKO mice, fasting plasma insulin levels of CBPIsletKO mice did not differ from controls
(Figure 3D). The pancreata of CBPIsletKO mice had 40% less alpha cell area and 30% less beta cell area, with delta cell area unaffected (Figure 3E). In contrast to p300 null islets, CBP null islets had reduced glucagon content but normal somatostatin content as compared to control
(Figure 3F). Similar to p300 null islets, CBP null islets had reduced insulin content but their beta cell secretory function appeared normal (Figure 3F & 3G). Overall, both p300IsletKO and Page 11 of 46 Diabetes
CBPIsletKO mice exhibited reduced beta cell area and islet insulin contents, features that explain
their glucose intolerance.
Mice with only a single copy of p300 or CBP in islets develop more severe glucose and islet
phenotypes than mice lacking p300 or CBP alone in islets
Since mice lacking p300 or CBP had similar phenotypes, we hypothesized that p300IsletKO or
CBPIsletKO mice lacking an additional copy of p300 or CBP would develop more severe glucose
phenotypes. To test this, we generated Neurog3 Cre; Crebbpfl/WT; Ep300fl/fl mice and Neurog3
Cre; Crebbpfl/fl; Ep300fl/WT mice (CBPHet; p300KO and CBPKO; p300Het mice, respectively). These
triallelic mice developed severe glucose intolerance by eight weeks of age with no defects in
insulin tolerance (Figure 4A & 4B; CBPKO; p300Het mice data in Supplementary Figure 4).
Unlike the biallelic mice, triallelic p300/CBP mice of either genotype failed to mount an insulin
response to glucose challenge (Figure 4C). In addition, CBPHet; p300KO mice had 58% less alpha
cell area and 45% less beta cell area (Figure 4D). Their islets contained 72% less insulin than
WT islets (Figure 4E). These phenotypes recapitulated those seen in p300IsletKO or CBPIsletKO
mice despite being more severe.
Expression of p300/CBP is necessary for neonatal beta cell and alpha cell proliferation
Since reduced alpha cell and beta cell area could be caused by defects in differentiation,
proliferation and/or apoptosis, we examined these processes throughout pancreas development in
WT and p300IsletKO mice. We first excluded apoptosis as a possible cause of islet cell loss by
performing TUNEL assays on pancreata from E18.5 and adult p300IsletKO mice; apoptotic events
in p300 null islets were as rare as in WT islets (not shown). Next, the number of newly Diabetes Page 12 of 46
differentiated endocrine cells and Ngn3 positive endocrine progenitors were unaffected in E15.5 p300IsletKO mouse pancreata (Supplementary Figure 5A). At E18.5, alpha cell, beta cell and pan
endocrine cell area were normal in p300IsletKO mouse pancreata (Supplementary Figure 5B). At
P7, the alpha cell and beta cell area were reduced in p300IsletKO mouse pancreata (Figure 5A).
The percentages of Ki67+ alpha and beta cells in these pancreata were lower than that of WT;
however, the overall percentage of Ki67+ cells in the pancreata was unchanged (Figure 5B &
5C). This indicated that the proliferation of neonatal alpha cells and beta cells was reduced in p300 null islets. Hence, the reduced alpha cell and beta cell mass in the adult p300IsletKO mouse pancreata originated after E18.5 and is attributable to impaired proliferation.
We attempted to breed for Neurog3 Cre; Crebbpfl/fl; Ep300fl/fl mice (p300/CBP double knockout mice) but we did not observe any of the double knockout mice in a cohort of 59 pups at the weaning age, in contrast to the triallelic p300/CBP mice which were observed at the expected
Mendelian ratio (Supplementary Table 2). We speculated that these p300/CBP double knockout mice might die shortly after birth due to failure to establish sufficient beta cell mass. At P0, some double KO pups survived but their pancreata lacked alpha cells and beta cells completely (Figure
5E & 5F). Surprisingly, their delta cell and epsilon cell populations were unaffected (Figure 5E).
Immunostaining showed that a few epsilon cells, which are normally absent in adult mouse pancreata, persist in the biallelic and triallelic mouse pancreata (Supplementary Figure 6A).
Thus, at least one allele of p300 or CBP is necessary for normal development of alpha cells and beta cells, but not for delta cells nor epsilon cells.
Page 13 of 46 Diabetes
Loss of p300/CBP impairs genes associated with multiple islet/beta cell transcription
factors and impairs the coactivation of Hnf1α associated genes in vivo
As p300/CBP are transcriptional coactivators, loss of p300/CBP may reduce the expression of
genes important for islet function or development. We examined gene expression by performing
RNA seq on islet mRNAs from WT, p300IsletKO, CBPIsletKO and CBPHet; p300KO mice. We
identified 761 (477 down, 284 up), 923 (513 down, 410 up) and 5,589 (2,411 down, 3,178 up)
differentially expressed genes in p300 null, CBP null and triallelic islets relative to WT islets,
respectively (Supplementary Table 3).
We focused our analyses on the down regulated genes. Aggregation of the downregulated gene
sets revealed 230 downregulated genes overlapped between p300 null islets (48.2%) and CBP
null islets (44.8%) (Figure 6A). The genes downregulated in CBPHet; p300KO islets overlapped
with 436 (91.4%) and 437 (85.2%) of the downregulated genes from p300 null and CBP null
islets, respectively. Enrichment analyses of the Biological Process GO terms on all three sets
suggested three common themes of genes downregulated by loss of p300/CBP: lipid metabolic
process, regulation of hormone levels, and ion transport (Figure 6B and Supplementary Table 4).
Transcription factor target prediction from Webgestalt showed that all three gene sets were
significantly enriched for the predicted transcription factor Hnf1α (Figure 6C and Supplementary
Table 5). We also performed GSEA by comparing our gene sets to published downregulated
genes in mouse islets lacking factors important for beta cell development and function, including
Pdx1, NeuroD1, Hnf1α, Pax6, MafA, Nkx6.1 and Nkx2.2 (24 30). Our gene sets overlapped
more significantly with the gene sets of Hnf1α and Nkx2.2, followed by MafA, Nkx6.1, Pdx1
and NeuroD1 (Figure 6D; Supplementary Table 6 and 7). Diabetes Page 14 of 46
Since Hnf1α could recruit p300/CBP for coactivation (31), we further examined the genes that
overlap between the Hnf1α gene set and the gene sets we had defined as downregulated genes in p300 null islets, CBP null islets and CBPHet; p300KO islets. Tmem27, a known Hnf1α mediated
regulator of beta cell proliferation (32), was reduced in all three models. Other loci
downregulated in Hnf1α null islets including Pklr, Slc2a2 and G6pc2, were also downregulated
in triallelic islets as validated by qPCR (Figure 6E) (24). Beta cell transcription factors were not
specifically downregulated in either p300 null or CBP null islets, whereas Hnf4a, Hnf1b and
NeuroD1 were downregulated in triallelic islets (Supplementary Table 8). Insulin processing
genes were not altered in the biallelic mouse islets. Ins1 and Ins2 mRNAs were normally
expressed in in the biallelic mouse islets, although both were downregulated by more than 50%
in the triallelic islets.
Since p300/CBP coactivate transcription factors in part by acetylating H3K27 at target promoters
and enhancers, we hypothesized that the loss of p300/CBP would reduce H3K27 acetylation at
the loci downregulated in Hnf1α null islets. We assessed the acetylation and methylation statuses
of H3K27 at various loci using low input native ChIP, and found that there were significantly
less H3K27Ac at the promoters of G6pc2, Hnf4a, Pklr and Tmem27 in the triallelic islets (Figure
6F; negative loci in Supplementary Figure 6B). Pdx1 associated genes also showed reduced
H3K27Ac at their promoters and enhancers in the triallelic islets (Figure 6G). The H3K27Ac
levels at these loci were reduced in CBP null islets, although the reduction did not reach
statistical significance. These loci specific H3K27Ac levels clearly correlated with the total
dosages of p300/CBP in the cells. We confirmed an approximately 60% reduction of H3K27Ac
globally in the triallelic islet nuclei (Figure 6H). Total and loci specific H3K27me3 levels were Page 15 of 46 Diabetes
unaffected in triallelic islets (Figure 6H & Supplementary Figure 6B). Overall, the reduced
dosages of p300/CBP impaired coactivation of downregulated genes in Hnf1α null islets, which
we attribute to reductions in global and loci specific H3K27Ac levels.
Discussion
In this study, the loss of either p300 or CBP alone in the pancreatic islets was sufficient to
perturb whole body glucose homeostasis. Mice lacking p300 or CBP in islets developed similar
beta cell phenotypes including reduced beta cell area and insulin content. Mechanistically,
p300/CBP are known to coactivate Pdx1, NeuroD1, Hnf4α and Hnf1α/β in vitro (33 35). Our
RNA seq data suggested that genes downregulated in Hnf1α null islets became down regulated
once the dosages of either p300 or CBP were reduced in the islets. Hnf1α/β are homeobox
transcription factors that are critical for pancreas and beta cell development (36,37). In particular,
impaired Hnf1α coactivation in our mouse models could attenuate beta cell proliferation through
genes such as Tmem27 (32). The role of Hnf1α in alpha cells remains unclear, although high
levels of HNF1α were found in FACS sorted human alpha cells, thereby implying p300/CBP
might also regulate aspects of alpha cell biology, such as proliferation, through HNF1α (38).
p300/CBP bind to Hnf1α/β through their transactivation domains, and coactivate their
downstream targets by acetylating the histones bound to regulatory elements affiliated with these
targets (39). The observed loss of H3K27Ac in triallelic islets at loci downregulated in Hnf1α
null islets appears to be in line with such a mechanism.
While Hnf1α might be one of the targets in p300 null/CBP null islets, coactivation of other
transcription factors could also account for the phenotypes of p300/CBP null islets. Our data Diabetes Page 16 of 46
suggest that p300/CBP do not appear to have major importance in the development of delta cells
or epsilon cells. The lack of effect on delta cells and epsilon cells in the double KO mice shows
striking similarity to the phenotypes of Nkx2.2 null mice (40,41). Although Nkx2.2 is not known
to interact with p300/CBP, the significant overlapping between the gene set of Nkx2.2 and our p300/CBP gene sets suggested that Nkx2.2 might mediate some of the phenotypes seen in the p300/CBP mutant mice. Intriguingly, Nkx2.2 is mainly known for its repressor function, so p300/CBP might be recruited by Nkx2.2 to initiate its activator function instead (30,42). In the future, it will be interesting to explore whether p300/CBP interact physically with Nkx2.2 and acetylate the H3K27 residues at Nkx2.2 associated loci, and whether the genomic occupancy of
Nkx2.2 or Hnf1α in islets is affected by p300 deletion.
Both Ins1 and Ins2 mRNAs were reduced in the triallelic p300/CBP islets but not in p300 null islets or CBP null islets. Reduced transcriptional activities of MafA and Nkx6.1, which are not known to recruit p300/CBP previously, might contribute indirectly to the reduced insulin gene expression seen in triallelic mice. Alternatively, p300/CBP might regulate insulin gene expression by binding to Pdx1 and NeuroD1 (6,35). The acetylation of H3K27 at the Ins1 promoter correlated with the dosages of p300/CBP present in the islets. The reduced insulin gene expression in triallelic islets could be a consequence of less p300/CBP available to beta cell transcription factors, which in turns impairs the acetylation of H3K27 at insulin promoters.
Taken together, p300/CBP may coordinate transcriptional networks in beta cells by coactivating various beta cell transcription factors, perhaps through Hnf1α/β and/or Nkx2.2. Mutations in many of these transcription factors are known to cause monogenic diabetes, including HNF1A, Page 17 of 46 Diabetes
HNF1B, PDX1 and NEUROD1 (43), suggesting that p300/CBP could have relevancy to the
underlying pathophysiology.
Overall, mice lacking p300 or CBP alone in islets developed glucose intolerance and
hypoinsulinemia associated with reduced islet area and insulin content. Mice lacking three copies
of p300/CBP in islets developed similar yet exacerbated phenotypes. Mice lacking all copies of
p300/CBP died postnatally due to their failure to establish beta cell mass. Islet genes mediated by
p300/CBP overlapped significantly with genes downregulated in islets lacking transcription
factors such as Hnf1α and Nkx2.2. p300/CBP expression was required to acetylate H3K27 at the
loci downregulated in Hnf1α null islets including Slc2a2, Pklr, Hnf4a, and particularly Tmem27,
which could regulate beta cell proliferation. Thus, the expression of p300/CBP family of
coactivators in islets is critical to drive beta cell genesis and to maintain beta cell proliferation
and insulin content. In the pancreatic endocrine lineage, p300 and CBP serve as functionally
similar yet limiting cofactors to coordinate various islet transcription factors and maintain whole
body glucose homeostasis.
Acknowledgements
CKW and WTG conceived the study and designed the experiments. CKW wrote the manuscript.
CKW and AKW generated and analyzed the data. DSL helped with calcium imaging experiment.
All authors contributed to the study design and revised the article’s intellectual content. All
authors revised the manuscript and approved the final version. CKW and WTG are the
guarantors of this work and, as such, have full access to all the data in the study and take
responsibility for the integrity of the data and the accuracy of the data analysis. Diabetes Page 18 of 46
We are grateful for the institutional support from the The Canucks for Kids Childhood Diabetes
Laboratories at BCCHR and Dr. Jingsong Wang (BCCHR) for technical assistance at Imaging
Core. We would also like to thank Ryan Vander Werff and the UBC BRC Sequencing Core for
their support on RNA seq experiments, Dr. Julie Brind’Amour and Dr. Matthew Lorincz (UBC)
for their advice on low input ChIP, and Dr. Lawryn Kasper (St. Jude Children’s Research
Hospital) for advice on p300 western blotting.
CKW’s salary is supported by a BCCH Research Institute graduate studentship, and WTG’s
investigator salary is supported by BCCHRI Intramural IGAP award. This study was supported by grants to WTG from NSERC (RGPIN 402576 11) and CIHR (MOP 119595 and PJT
148695).
The authors declare that there is no duality of interest associated with this manuscript.
References
1. Melloul D, Marshak S, Cerasi E. Regulation of insulin gene transcription. Diabetologia. Springer Verlag; 2002 Mar;45(3):309–26.
2. Bedford DC, Brindle PK. Is histone acetylation the most important physiological function for CBP and p300? Aging (Albany NY). 2012 Apr;4(4):247–55.
3. Heinz S, Romanoski CE, Benner C, Glass CK. The selection and function of cell type specific enhancers. Nat Rev Mol Cell Biol. 2015 Feb 4;16(3):144–54.
4. Bose DA, Donahue G, Reinberg D, Shiekhattar R, Bonasio R, Berger SL. RNA Binding to CBP Stimulates Histone Acetylation and Transcription. Cell. 2017 Jan 12;168(1 2):135– 149.e22.
5. Qiu Y, Guo M, Huang S, Stein R. Acetylation of the BETA2 transcription factor by p300 associated factor is important in insulin gene expression. J Biol Chem. 2004 Mar Page 19 of 46 Diabetes
12;279(11):9796–802.
6. Sampley ML, Ozcan S. Regulation of insulin gene transcription by multiple histone acetyltransferases. DNA Cell Biol. 2012 Jan;31(1):8–14.
7. Bompada P, Atac D, Luan C, Andersson R, Omella JD, Laakso EO, et al. Histone acetylation of glucose induced thioredoxin interacting protein gene expression in pancreatic islets. Int J Biochem Cell Biol. 2016 Oct 29;81:82–91.
8. Hussain MA, Porras DL, Rowe MH, West JR, Song W J, Schreiber WE, et al. Increased pancreatic beta cell proliferation mediated by CREB binding protein gene activation. Mol Cell Biol. American Society for Microbiology; 2006 Oct;26(20):7747–59.
9. Schonhoff SE, Giel Moloney M, Leiter AB. Neurogenin 3 expressing progenitor cells in the gastrointestinal tract differentiate into both endocrine and non endocrine cell types. Dev Biol. 2004 Jun 15;270(2):443–54.
10. Kasper LH, Fukuyama T, Biesen MA, Boussouar F, Tong C, de Pauw A, et al. Conditional knockout mice reveal distinct functions for the global transcriptional coactivators CBP and p300 in T cell development. Mol Cell Biol. 2006 Feb;26(3):789– 809.
11. Wong CK, Botta A, Pither J, Dai C, Gibson WT, Ghosh S. A high fat diet rich in corn oil reduces spontaneous locomotor activity and induces insulin resistance in mice. J Nutr Biochem. 2015 Apr;26(4):319–26.
12. Li D S, Yuan Y H, Tu H J, Liang Q L, Dai L J. A protocol for islet isolation from mouse pancreas. Nat Protoc. 2009;4(11):1649–52.
13. Luciani DS, White SA, Widenmaier SB, Saran VV, Taghizadeh F, Hu X, et al. Bcl 2 and Bcl xL suppress glucose signaling in pancreatic β cells. Diabetes. American Diabetes Association; 2013 Jan;62(1):170–82.
14. Schindelin J, Arganda Carreras I, Frise E, Kaynig V, Longair M, Pietzsch T, et al. Fiji: an open source platform for biological image analysis. Nat Methods. 2012 Jun 28;9(7):676– 82.
15. Kim D, Pertea G, Trapnell C, Pimentel H, Kelley R, Salzberg SL. TopHat2: accurate alignment of transcriptomes in the presence of insertions, deletions and gene fusions. Genome Biol. BioMed Central; 2013 Apr 25;14(4):R36.
16. Leek JT, Johnson WE, Parker HS, Jaffe AE, Storey JD. The sva package for removing batch effects and other unwanted variation in high throughput experiments. Bioinformatics. 2012 Mar 15;28(6):882–3.
17. Love MI, Huber W, Anders S. Moderated estimation of fold change and dispersion for RNA seq data with DESeq2. Genome Biol. BioMed Central; 2014;15(12):550. Diabetes Page 20 of 46
18. Hulsen T, de Vlieg J, Alkema W. BioVenn a web application for the comparison and visualization of biological lists using area proportional Venn diagrams. BMC Genomics. BioMed Central; 2008 Oct 16;9(1):488.
19. Wang J, Duncan D, Shi Z, Zhang B. WEB based GEne SeT AnaLysis Toolkit (WebGestalt): update 2013. Nucleic Acids Research. 2013 Jul;41(Web Server issue):W77–83.
20. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real time quantitative PCR and the 2( Delta Delta C(T)) Method. Methods. 2001 Dec;25(4):402–8.
21. Kasper LH, Boussouar F, Ney PA, Jackson CW, Rehg J, van Deursen JM, et al. A transcription factor binding surface of coactivator p300 is required for haematopoiesis. Nature. 2002 Oct 17;419(6908):738–43.
22. Brind'Amour J, Liu S, Hudson M, Chen C, Karimi MM, Lorincz MC. An ultra low input native ChIP seq protocol for genome wide profiling of rare cell populations. Nat Commun. 2015 Jan 21;6:6033.
23. Song J, Xu Y, Hu X, Choi B, Tong Q. Brain expression of Cre recombinase driven by pancreas specific promoters. Genesis. 2010 Nov;48(11):628–34.
24. Servitja J M, Pignatelli M, Maestro MA, Cardalda C, Boj SF, Lozano J, et al. Hnf1alpha (MODY3) controls tissue specific transcriptional programs and exerts opposed effects on cell growth in pancreatic islets and liver. Mol Cell Biol. American Society for Microbiology; 2009 Jun;29(11):2945–59.
25. Gu C, Stein GH, Pan N, Goebbels S, Hornberg H, Nave K A, et al. Pancreatic beta cells require NeuroD to achieve and maintain functional maturity. Cell Metabolism. 2010 Apr 7;11(4):298–310.
26. Taylor BL, Liu F F, Sander M. Nkx6.1 is essential for maintaining the functional state of pancreatic beta cells. Cell Rep. 2013 Sep 26;4(6):1262–75.
27. Gao T, McKenna B, Li C, Reichert M, Nguyen J, Singh T, et al. Pdx1 maintains β cell identity and function by repressing an α cell program. Cell Metabolism. 2014 Feb 4;19(2):259–71.
28. Hang Y, Yamamoto T, Benninger RKP, Brissova M, Guo M, Bush W, et al. The MafA transcription factor becomes essential to islet β cells soon after birth. Diabetes. American Diabetes Association; 2014 Jun;63(6):1994–2005.
29. Swisa A, Avrahami D, Eden N, Zhang J, Feleke E, Dahan T, et al. PAX6 maintains β cell identity by repressing genes of alternative islet cell types. J Clin Invest. American Society for Clinical Investigation; 2017 Jan 3;127(1):230–43.
30. Gutiérrez GD, Bender AS, Cirulli V, Mastracci TL, Kelly SM, Tsirigos A, et al. Pancreatic β cell identity requires continual repression of non β cell programs. J Clin Page 21 of 46 Diabetes
Invest. American Society for Clinical Investigation; 2017 Jan 3;127(1):244–59.
31. Soutoglou E, Papafotiou G, Katrakili N, Talianidis I. Transcriptional activation by hepatocyte nuclear factor 1 requires synergism between multiple coactivator proteins. J Biol Chem. 2000 Apr 28;275(17):12515–20.
32. Akpinar P, Kuwajima S, Krützfeldt J, Stoffel M. Tmem27: a cleaved and shed plasma membrane protein that stimulates pancreatic beta cell proliferation. Cell Metabolism. 2005 Dec;2(6):385–97.
33. Dell H, Hadzopoulou Cladaras M. CREB binding protein is a transcriptional coactivator for hepatocyte nuclear factor 4 and enhances apolipoprotein gene expression. J Biol Chem. 1999 Mar 26;274(13):9013–21.
34. Ban N, Yamada Y, Someya Y, Miyawaki K, Ihara Y, Hosokawa M, et al. Hepatocyte nuclear factor 1alpha recruits the transcriptional co activator p300 on the GLUT2 gene promoter. Diabetes. 2002 May;51(5):1409–18.
35. Qiu Y, Guo M, Huang S, Stein R. Insulin gene transcription is mediated by interactions between the p300 coactivator and PDX 1, BETA2, and E47. Mol Cell Biol. 2002 Jan;22(2):412–20.
36. Pontoglio M, Sreenan S, Roe M, Pugh W, Ostrega D, Doyen A, et al. Defective insulin secretion in hepatocyte nuclear factor 1alpha deficient mice. J Clin Invest. American Society for Clinical Investigation; 1998 May 15;101(10):2215–22.
37. Haumaitre C, Barbacci E, Jenny M, Ott MO, Gradwohl G, Cereghini S. Lack of TCF2/vHNF1 in mice leads to pancreas agenesis. Proc Natl Acad Sci USA. 2005 Feb 1;102(5):1490–5.
38. Bramswig NC, Everett LJ, Schug J, Dorrell C, Liu C, Luo Y, et al. Epigenomic plasticity enables human pancreatic α to β cell reprogramming. J Clin Invest. 2013 Mar;123(3):1275–84.
39. Barbacci E, Chalkiadaki A, Masdeu C, Haumaitre C, Lokmane L, Loirat C, et al. HNF1beta/TCF2 mutations impair transactivation potential through altered co regulator recruitment. Hum Mol Genet. 2004 Dec 15;13(24):3139–49.
40. Prado CL, Pugh Bernard AE, Elghazi L, Sosa Pineda B, Sussel L. Ghrelin cells replace insulin producing beta cells in two mouse models of pancreas development. Proc Natl Acad Sci USA. 2004 Mar 2;101(9):2924–9.
41. Mastracci TL, Wilcox CL, Arnes L, Panea C, Golden JA, May CL, et al. Nkx2.2 and Arx genetically interact to regulate pancreatic endocrine cell development and endocrine hormone expression. Dev Biol. 2011 Nov 1;359(1):1–11.
42. Doyle MJ, Sussel L. Nkx2.2 regulates beta cell function in the mature islet. Diabetes. American Diabetes Association; 2007 Aug;56(8):1999–2007. Diabetes Page 22 of 46
43. Fajans SS, Bell GI, Polonsky KS. Molecular mechanisms and clinical pathophysiology of maturity onset diabetes of the young. N Engl J Med. 2001 Sep 27;345(13):971–80.
Figure Legends
Figure 1. Mice lacking p300 in pancreatic islets develop glucose intolerance due to
hypoinsulinemia. (A) Western blotting for p300 and CBP in isolated WT or p300 null islet
nuclear extracts. TBP was used as loading control. The experiment was replicated once. (B)
Representative immunofluorescence images of p300 and CBP in the pancreatic islets of WT and p300IsletKO mice. n = 3. Scale bar = 50 µm. (C) Glucose tolerance test of eight week old WT or p300IsletKO mice. n = 8 – 9. (D) Insulin tolerance test of nine week old WT and p300IsletKO mice. n
= 5 – 7. (E) Plasma insulin measurement before and 15 minutes after glucose injection. n = 4 – 5.
Two way ANOVA for Figure C, D and E. * p < 0.05, ** p < 0.01, *** p < 0.001
Figure 2. p300IsletKO mice display defects in islet mass and islet insulin content.
(A) Quantification of beta cell, alpha cell and delta cell area of adult WT and p300IsletKO mice pancreata. n = 8 for beta cells; n = 4 – 5 for alpha cells and delta cells. (B) Islet density of adult
WT and p300IsletKO mice pancreata. n = 5. (C) Insulin, glucagon and somatostatin content of WT and p300 null islets. n = 5 – 6. (D) Glucose stimulated insulin secretion assays on isolated WT and p300 null islets. n = 5 – 7. (E) Fura 2 calcium imaging on isolated WT and p300 null islets.
n = 3. Student’s t test for Figure A, B, C and D. Two way ANOVA for Figure E. * p < 0.05
Figure 3. CBPIsletKO mice share similar phenotypes with p300IsletKO mice. (A) Representative
immunofluorescence images of p300 and CBP in the pancreatic islets of WT and CBPIsletKO
mice. Scale bar = 50 µm. (B) Glucose tolerance test of eight week old WT and CBPIsletKO mice. Page 23 of 46 Diabetes
n = 4 – 11. (C) Insulin tolerance test of nine week old WT and CBPIsletKO mice. n = 5 – 8. (D)
Plasma insulin measurement of WT and CBPIsletKO mice before and 15 minutes after glucose
injection. n = 6 – 7. (E) Quantification of beta cell, alpha cell and delta cell area of adult WT and
CBPIsletKO mice pancreata as % of total pancreas area. n = 4 – 5 for alpha cells and beta cells; n =
5 – 6 for delta cells. (F) Islet insulin, glucagon and somatostatin content of WT and CBP null
islets as quantified by ELISA. n = 4. (G) Perifusion assay for insulin secretion of WT and CBP
null islets. n = 3. Two way ANOVA for Figure B, C and D. Student’s t test for Figure E and F. *
p < 0.05, ** p < 0.01, *** p < 0.001
Figure 4. Triallelic deletion of p300/CBP in islets leads to severe glucose intolerance. (A)
Intraperitoneal glucose tolerance test of eight week old WT and CBPHet; p300KO mice. n = 6. (B)
Insulin tolerance test of adult WT and CBPHet; p300KO mice. n = 6 – 7. (C) Plasma insulin
measurement of WT and CBPHet; p300KO mice before and 15 minutes after glucose injection. n =
7. (D) Quantification of beta cell, alpha cell and delta cell area of adult WT and CBPHet; p300KO
mouse pancreata as % of total pancreas area. n = 4 – 6 for alpha cells and beta cells; n = 4 for
delta cells. (E) Islet insulin content of WT and CBPHet; p300KO islets as quantified by ELISA. n
= 4. Two way ANOVA for Figure A, B and C. Student’s t test for Figure D and E. * p < 0.05,
** p < 0.01, *** p < 0.001
Figure 5. Expression of p300/CBP is necessary for beta cell and alpha cell development. (A)
Quantification of beta cell, alpha cell and delta cell area of P7 WT and p300IsletKO mouse
pancreata as % of total pancreas area. n = 4 – 6. (B) Representative immunofluorescence images
of insulin, glucagon and Ki67 in P7 WT and p300IsletKO mouse pancreata. Scale bar = 50 µm. (C) Diabetes Page 24 of 46
Quantification of Ki67+ beta cells, alpha cells and all pancreatic cells in P7 WT and p300IsletKO
mouse pancreata as % of total beta cells, alpha cells and total pancreatic cells. n = 8. (D)
Quantification of beta cell, alpha cell, delta cell, epsilon cell and chromogranin A positive pan
endocrine cell area of P0 WT and p300/CBP double knockout (dKO) mouse pancreata as % of
total pancreas area. n = 3. (E) Representative immunofluorescence images of insulin, glucagon, somatostatin, ghrelin, chromogranin A and DAPI in P0 WT and p300/CBP double knockout mouse pancreata. Scale bar = 50 µm. Student’s t test for Figure A, C and D. * p < 0.05, ** p <
0.01
Figure 6. Loss of p300/CBP impairs coactivation of Hnf1α through reduced H3K27 acetylation. (A) Venn diagram of overlapping downregulated genes of p300IsletKO, CBPIsletKO and
CBPHet; p300KO mouse islets as compared to WT islets. (B) The three Biological Processes GO
terms commonly overrepresented in the downregulated genes of p300IsletKO, CBPIsletKO and
CBPHet; p300KO mouse islets. All significantly overrepresented GO terms and their associated genes can be found in Supplementary Table 4. (C) Transcription factor target analysis by
Webgestalt on the downregulated genes of p300IsletKO, CBPIsletKO and CBPHet; p300KO mouse
islets. Hnf1α was commonly overrepresented in all three gene sets. (D) Gene set enrichment
analysis on downregulated gene sets derived from microarray or RNA seq data of mice lacking beta cell transcription factors in islets or beta cells. Random 1 and 2 were control gene lists
generated randomly from the 15,999 genes in the WT reference list. (E) qPCR of islet Hnf1α
associated genes in WT and CBPHet; p300KO mouse islets. n = 5 – 6. (F) Low input native ChIP
for H3K27Ac at Hnf1α associated genes in WT, CBPIsletKO and CBPHet; p300KO mouse islets. n =
3 – 5. (G) Low input native ChIP for H3K27Ac at Pdx1 associated loci in in WT, CBPIsletKO and Page 25 of 46 Diabetes
CBPHet; p300KO mouse islets. n = 3 – 5. (H) Representative immunofluorescence images of
insulin, H3K27Ac and H3K27me3 in WT and CBPHet; p300KO mouse islets. Scale bar = 50 µm.
Student’s t test for Figure E. One way ANOVA for Figure F and G. * p < 0.05, ** p < 0.01, ***
p < 0.001 Diabetes Page 26 of 46
722x541mm (72 x 72 DPI)
Page 27 of 46 Diabetes
722x541mm (72 x 72 DPI)
Diabetes Page 28 of 46
722x541mm (72 x 72 DPI)
Page 29 of 46 Diabetes
722x541mm (72 x 72 DPI)
Diabetes Page 30 of 46
722x541mm (72 x 72 DPI)
Page 31 of 46 Diabetes
Diabetes Page 32 of 46
Supplementary Table 1: Primer sequences for RT-qPCR and ChIP-qPCR.
Forward Primer Reverse Primer Tmem27 mRNA TACAGTCGGCCATAAGAAAG ATACAATAATCCAGACGGGC Pklr mRNA TCATTGTGCTGACAAAGACT TAGAGCAAGGGGAAGACTC Hnf4a mRNA GGCTGGCATGAAGAAGGAAG GGAGAGGTGATCTGCTGGG G6pc2 mRNA CTGGTCCTTTCTGTGGAGTGT TCCAAGAATGACCTGATGGGG Slc2a2 mRNA CAGTTTCTTTGAGATTGGGC GATGACAAAATTGCAGACCC Tmem27 Promoter AAGTGAAAGCCTACAAGCAA AAAGAGCTGACCTCATTTCA Pklr Promoter CAGGAAAAACGGATGACCTA CCCTAACTGCTGGTCTTATC Hnf4a Promoter TTAAGATTCCCCTAACCCCA TGGGTGGATACGTTAAACAG G6pc2 Promoter TTGTGACTATTAAGTTATGTGTTG ATGTTTTTCCTCATCACCTG Slc2a2 Promoter TGAAAATGGGTCTGTCTCTG AGAAGCTGAGTATTGATGGT Iapp Promoter AAA CTC TAA ACG CCT ACG G GGC CAT CAA CAC ATT AAC AC Ins1 Promoter TACCTTGCTGCCTGAGTTCTGC GCATTTTCCACATCATTCCCC Iapp Enhancer GGGGAGGAAGAGAAGCTCAC AAAACCAGCCTTTTGCAGAC Ins1 Enhancer CACACACACACACGTTCACC CCTGCCTCTTCCTCTGTAGTG Lep Promoter TAGAATGGAGCACTAGGTTG CTCTTATAACTGCCCCAGTG Chr 5 MER20 TTCCTTTCATAGCTTTCAGTACCA GGAAGGACCATCAAGAAGAGTT Chr 7 Ccdc179 -73 kb TGTAGGGAATATTTATTGGGCAGT CTGACTTTACTGTGGATCTGTAGGA
Page 33 of 46 Diabetes
Supplementary Table 2: Mendelian ratio of islet-specific p300/CBP double KO mice.
Expected Observed Number Observed
Fraction (Total = 59) Fraction
Neurog3-Cre; p300fl/fl 0.0625 4 0.0678
Neurog3-Cre; CBPfl/WT; p300fl/fl 0.25 16 0.27
Neurog3-Cre; CBPfl/fl; p300fl/fl 0.1875 0 0
p300fl/fl 0.0625 13 0.22
CBPfl/WT; p300fl/fl 0.25 21 0.356
CBPfl/fl; p300fl/fl 0.1875 5 0.085 chi squared = 40.684, p < 0.0001
Diabetes Page 34 of 46
Supplementary Table 3, 4 and 5 can be found at https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE101537
Supplementary Table 3: All differentially expressed genes in p300IsletKO, CBPIsletKO and
CBPHet; p300KO mouse islets with respect to WT islets
File name: GSE101537_all_de_gene_lists.xlsx
Supplementary Table 4: GO term analysis of downregulated genes in p300IsletKO, CBPIsletKO and CBPHet; p300KO mouse islets
File name: GSE101537_Neurog3_Cre_p300_CBP_mice_GO_analysis.xlsx
Supplementary Table 5: Transcription factor target analysis of downregulated genes in p300IsletKO, CBPIsletKO and CBPHet; p300KO mouse islets
File name: GSE101537_Neurog3_Cre_p300_CBP_mice_transcription_factor_targets.xlsx
Page 35 of 46 Diabetes
Supplementary Table 6: Gene set enrichment analyses between p300/CBP gene sets and
published beta cell transcription factor gene sets
Number of
downregulated Number of Percentage of
genes from the genes genes Adjusted p Enrichment
IsletKO p300 gene set overlapped overlapped value Score
Pdx1 47 9 19.1% 3.26 x 10 3 2.49
NeuroD1 31 8 25.8% 9.61 x 10 5 4.02
Hnf1a 115 41 35.7% 6.87 x 10 32 31.16
Pax6 45 3 6.7% 1 0
MafA 161 25 15.5% 4.64 x10 10 9.33
Nkx6.1 475 51 10.7% 5.97 x 10 14 13.22
Nkx2.2 552 83 15.0% 6.35 x 10 34 33.20
Random 1 100 3 3.0% 1 0
Random 2 500 10 2.0% 1 0
Diabetes Page 36 of 46
Number of
downregulated Percentage of
genes from the Number of genes genes Adjusted p Enrichment
IsletKO CBP gene set overlapped overlapped value Score
Pdx1 47 7 14.9% 0.026 1.58
NeuroD1 31 4 12.9% 0.627 0.20
Hnf1a 115 47 40.9% 1.77 x 10 38 37.75
Pax6 45 2 4.4% 1 0
MafA 161 25 15.5% 2.21 x 10 9 8.66
Nkx6.1 475 50 10.5% 4.45 x 10 12 11.35
Nkx2.2 552 76 13.8% 3.79 x 10 26 25.42
Random 1 100 4 4.0% 1 0
Random 2 500 12 2.4% 1 0
Number of Percentage
CBPHet; downregulated genes Number of genes of genes Adjusted p
KO p300 from the gene set overlapped overlapped value Enrichment Score
Pdx1 47 26 55.3% 6.99 x 10 9 8.16
NeuroD1 31 17 54.8% 1.22 x 10 5 4.91
Hnf1a 115 89 77.4% 5.09 x 10 49 48.29
Pax6 45 16 35.6% 0.0211 1.68
MafA 161 101 62.7% 5.21 x 10 42 41.28
Nkx6.1 475 192 40.4% 9.58 x 10 41 40.02
Nkx2.2 552 352 63.8% 2.88 x 10 155 154.54
Random 1 100 14 14.0% 1 0
Random 2 500 61 12.2% 1 0
Page 37 of 46 Diabetes
Supplementary Table 7: Overlapping genes between p300 or CBP gene sets and
downregulated genes from Hnf1a-null or Nkx2.2-null islets
Overlapping genes between p300 and downregulated gene sets from Hnf1a null islets (41)
Ddc, Tat, Glul, Vil1, Anks4b, Slco1a6, Trpm5, Ambp, Dpp4, Enpep, Cpb2, Rab37, Sult1d1,
Sult1c2, Hopx, Kdm2b, Adh1, Dct, Slc38a4, Gatm, Pigr, Cdh8, Cdhr2, Anxa4, Tmed6, Gc, Ttr,
Elovl2, Hpgds, Fxyd3, Atp7a, Serpina10, Serpina7, Pamr1, Ccl28, Sema4a, Rnase4, Tmem27,
Ugt2b34, Ugt2b35, Cyp4v3
Overlapping genes between p300 and downregulated gene sets from Nkx2.2 null islets (83)
Mlph, Cdh7, Th, Gm4791, Fam135b, Zfp541, Anks4b, Dpp4, Dlgap1, Kcnj12, Sult1c2, Nckap5,
Cib3, Ang, Inpp4b, Rnase4, Plcxd3, Lgi1, Npnt, Shisa2, Akr1c14, Adgrv1, Fxyd6, Nectin3,
Rab3b, Slc4a10, Defb1, Adora1, Rassf4, Adh1, Kdm2b, Trpm5, Esrrg, Aff2, Nrxn1, Ank2,
Dcaf12l1, Slitrk6, Slc8a1, Gad1, 4632428C04Rik, Elmod1, Piga, Zdhhc2, Svip, Dnajc24, Ust,
Reps2, Cyp4f39, Skap1, Plppr1, Tmem56, Hspa12a, Cdh8, Glul, Ctnnbip1, Chrm3, Pla2g2f,
Prune2, Ufm1, Ttll7, Nell1, Prps1, Rab37, Fpgt, A330076H08Rik, Elovl5, Slc35b4, Mospd2,
Kcnmb2, Glb1l2, Ddc, Lrrn1, Steap2, Zfp92, Insig1, 9330182L06Rik, Ndrg1, Kif5b, Cyb5b,
Prkaa1, Mboat2, Pip5k1b
Overlapping genes between CBP and downregulated gene sets from Hnf1a null islets (47)
Cbs, Glul, Muc4, Vil1, Anks4b, Slc2a2, Ppp1r1a, Pklr, Slco1a6, Ambp, Hgfac, Dpp4, Tmprss4,
Adam32, Enpep, Cpb2, Rab37, Sgk2, Sult1d1, Sult1c2, Msh5, Hopx, Kdm2b, Adh1, Dct, Cdhr2,
Anxa4, Tmed6, Gc, Ttr, Elovl2, Hpgds, Clic5, Fxyd3, Serpina7, Tmprss2, Ace2, Ccl28, Rnase4,
Tmem27, Grtp1, Rnf186, Ugt2b34, Akr1c19, Ugt2b35, Cyp4v3
Diabetes Page 38 of 46
Overlapping genes between CBP and downregulated gene sets from Nkx2.2 null islets (76)
Mlph, Tmprss4, Kcnj12, Anks4b, Zfp541, Th, Dpp4, Lgi1, Lingo3, Npnt, Gm4791, Muc4,
Adora1, Ang, Sult1c2, Rassf4, Dlgap1, Rnase4, Inpp4b, Akr1c14, Il17re, Cdh7, Msh5, Plut,
Hspa12a, Nckap5, Rab3b, Taar1, Pla2g2f, Negr1, Defb1, Cib3, Slitrk6, Fam135b, Enho,
6430573F11Rik, Cnnm1, Ptprr, 4632428C04Rik, Gad1, Fxyd6, Grtp1, Plppr1, Asic1, Ppp1r1a,
Skap1, Pgf, Adh1, Mat1a, Prkd1, Slc2a2, Adam32, Chic1, Slc8a1, Slc35b4, Ufm1, Spc25, Glul,
Dcaf12l1, Tmem56, Svip, Slc22a23, A330076H08Rik, Ctnnbip1, Inpp5j, Gjd2, Nectin3, Rhpn2,
Steap2, Kdm2b, Chrm3, Prkacb, Insig1, Cyb5b, Glb1l2, Rab37
Page 39 of 46 Diabetes
Supplementary Table 8: Expression levels of major islet genes in p300IsletKO, CBPIsletKO and
CBPHet; p300KO mouse islets
Beta cell transcription factors
Fold Fold Change
Change Fold Change CBPHet;
p300IsletKO CBPIsletKO p300KO
relative to relative to relative to
WT adjP WT adjP WT adjP
Pdx1 1.144 0.718 0.985 0.983 0.708 0.052
Neurod1 0.902 0.679 1.100 0.764 0.769 0.028
Mafa 1.801 0.016 1.328 0.428 1.152 0.566
Nkx6-1 1.517 0.128 1.158 0.780 0.907 0.712
Nkx2-2 1.120 0.766 1.255 0.473 0.841 0.371
Hnf4a 0.928 0.840 0.741 0.181 0.535 4.2 x 10-6
Hnf1a 1.243 0.304 1.234 0.777 0.991 0.966
Hnf1b 0.990 0.982 1.052 0.923 0.617 5.084 x 10-4
Diabetes Page 40 of 46
Endocrine genes
Fold Change Fold Change Fold Change
p300IsletKO CBPIsletKO CBPHet; p300KO
relative to WT adjP relative to WT adjP relative to WT adjP
Ins1 1.037 0.979 0.917 0.959 0.386 0.0353
Ins2 0.789 0.512 0.718 0.344 0.426 3.72 x 10-6
Gcg 0.474 0.391 0.553 0.599 0.262 8.312 x 10-3
Sst 1.750 1.783 x 10-3 1.394 0.145 2.702 5.36 x 10-13
Ppy 0.473 9.950 x 10-3 0.198 2.18 x 10-12 0.0310 2 x 10-66
Ghrl 6.396 3.374 x 10-4 2.399 0.236 6.083 2.89 x 10-5
Insulin processing genes
Fold Fold Change
Change Fold Change CBPHet;
p300IsletKO CBPIsletKO p300KO
relative to relative to relative to
WT adjP WT adjP WT adjP
Slc30a8 0.809 0.128 0.799 0.106 0.536 9.74 x 10-13
Cpe 0.903 0.499 0.957 0.867 0.663 5.48 x 10-8
Pcsk1 1.056 0.859 0.783 0.149 0.826 0.121
Pcsk2 0.878 0.409 0.911 0.671 0.660 8.30 x 10-7
Ero1lb 1.048 0.908 0.807 0.433 0.467 5.60 x 10-9
Page 41 of 46 Diabetes
Supplementary Figure 1. Neurog3-Cre drives recombination of p300 in newly
differentiated pancreatic endocrine cells. Top panel. p300 is expressed in neurogenin 3
positve cells in both WT and p300IsletKO mouse pancreata at E15.5. Bottom left panel. p300 is
effectively removed in chromogranin A positive cells in p300IsletKO mouse pancreata at E15.5.
Bottom right panel. p300 is effectively removed in delta cells in p300IsletKO mouse pancreata at
E15.5. Scale bar = 50 µm. Recombination rate was quantified by counting total chromogranin A
positive cells and total chromogranin A positive, p300 negative cells in E15.5 p300IsletKO
embryos. At least 200 chromogranin A positive cells were counted per embryo.
Diabetes Page 42 of 46
Supplementary Figure 2. p300IsletKO mice have normal metabolic phenotypes and plasma total GLP1 level. (A) Quantification of lean mass and fat mass of WT and p300IsletKO mice. n =
4 – 5. (B, C & D) Measurement of energy expenditure, locomotor activity and food intake of
WT and p300IsletKO mice. n = 7 – 8. (E) Measurement of plasma total GLP1 level in WT and p300IsletKO mice. n = 5 – 6.
Page 43 of 46 Diabetes
Supplementary Figure 3. p300IsletKO mice have normal glucagon secretion. (A) Weight of
WT and p300IsletKO mice pancreata. n = 4 – 5. (C) Mean islet size of adult WT and p300IsletKO
mice pancreata. n = 4 – 5. (C) Beta cell to alpha cell ratio of WT and p300IsletKO mice. n = 4 5.
(D) Plasma glucagon levels of WT and p300IsletKO mice after five hours of fasting. n = 6. (E) Islet
glucagon secretion after incubating in 2.8 mM glucose for one hour. n = 4.
Diabetes Page 44 of 46
Supplementary Figure 4. CBPKO; p300Het mice are phenocopies of CBPHet; p300KO mice
(A) Intraperitoneal glucose tolerance test of eight week old WT and CBPKO; p300Het mice. n = 5