Regulating Distinct Cell Lineages in the Pancreatic Islet Joshua a Levine

Regulating Distinct Cell Lineages in the Pancreatic Islet

Joshua A Levine

Submitted in partial fulfillment of the

Requirements for the degree

of Doctor of Philosophy

in the Graduate School of Arts and Sciences

COLUMBIA UNIVERSITY

2013

ABSTRACT

Regulating Distinct Cell Lineages in the Pancreatic Islet

Joshua A Levine

Type I and type II diabetes mellitus are associated with a loss of functioning insulin- producing β cells in the pancreas. Understanding the mechanism of normal islet and β cell development will be an important step in developing possible treatments for the disease. Nkx2.2 is essential for proper β cell differentiation. Nkx2.2-/- mice show a complete absence of insulin-producing β cells, a 90% reduction of glucagon-producing α cells, and an increase in ghrelin-producing cells. Nkx2.2 contains three conserved domains: the tinman domain (TN), homeodomain (HD), and NK2-specific domain (SD).

The SD domain is highly conserved among Nk2 family members and across species.

However, its function remains largely unknown. In order to further understand the molecular interactions involving Nkx2.2 in the developing mouse pancreas, we have generated a mouse line containing mutations in the NK2-SD domain. We show that SD mutant mice have a decrease in β cell numbers as well as a decrease in the β cell markers,

NeuroD, Nkx6.1, Ins1 and Ins2. However, there is no change in α cell numbers or the α cell markers, Glucagon and Irx2. Unlike the persistent upregulation of ghrelin in the

Nkx2.2-/- mice, Nkx2.2SD/SD mice display a transient increase in ghrelin expression, which normalizes by birth. Additionally, polyhormonal cells are seen as early as e12.5 and persist postnatally. Postnatally, the mice show morphological changes in islet size and the proximity of their islets to the ducts. Moreover, they show a continuing loss of β cells and the persistence of polyhormonal cells resulting in severe hyperglycemia. Mechanistically, Nkx2.2 has been shown to interact in a protein complex involving several methylation factors. We show that the SD domain is necessary for the interaction of Nkx2.2 and Dnmt1, the maintenance methyltransferase. We further show that there is a loss of methylation in the a cell gene Arx in sorted β cells of the Nkx2.2SD/SD mice as well as global hypomethylation in the Nkx2.2SD/SD mice. These data suggest that Nkx2.2 is responsible for proper methylation patters of islet specific genes in the developing pancreas, which is important for β cell development and the formation of normal islet cell identities.

Table of Contents

1. Introduction 1

The Pancreas 1

Diabetes Mellitus 1

Current Treatments 3

Islet Transplantation 4

Pancreatic Endocrine Cell Differentiation 7

Islet Specific Transcription Factors 8

Ngn3 11

Nkx2.2 12

Nkx2.2 Domains 14

Epigenetic Regulation 17

DNA Methyltransferase 18

DNA Methyltransferases in Islet Development 21

Methylation and Gene Regulation 22

2. Islet Cell Identity: The role of the Nkx2.2 NK2-SD Domain in Differentiating Endocrine

Cells 25

Introduction 25

Materials and Methods 29

Generation of Nkx2.2SD mice 29

Animal Maintenance 30

Immunohistochemistry 30

RNA Analysis 31 i

ChIP Analysis 32

In Vitro Pulldown, Coimmunoprecipitation and Western Blot 33

FACS 34

Methylation Sequencing Analysis 35

Results 35

Generation of Nkx2.2SD/SD mice 35

Nkx2.2SD/SD mice display a defect in β cell development 36

Nkx2.2SD/SD mice fail to form distinct mono-hormonal islet cells 42

SD domain interacts with Dnmt1 46

Mutation of the SD domain leads to gene specific hypomethylation 48

Nkx2.2SD/SD mice have global hypomethylation 50

Discussion 52

3. Conclusions and Perspectives 60

Nkx2.2 SD domain Function 61

In Vitro Differentiation of β Cells 65

Conclusions 67

References 68

A. Transcriptome Analysis of Nkx2.2SD/SD Mice 79

β-cell Specific Genes 79

Non-Annotated Genes 80

Gon-4-Like Pseudogene 80

Conclusions and Future Directions 81 ii

B. Proteomic Analysis of Nkx2.2 SD Domain Binding Partners 83

Histone Variants 83

Other SD Interacting Proteins 84

Gain of Function Proteins 84

Conclusions and Future Directions 85

iii

List of Figures and Tables

1. Introduction 1

Figure 1-1: Pancreatic Endocrine Development 9

Figure 1-2: Pancreatic Tip and Trunk Domains 10

Figure 1-3: Nkx2.2 Domains 16

Figure 1-4: DNA Methyltransferases 19

2. Islet Cell Identity: The role of the Nkx2.2 NK2-SD Domain in Differentiating Endocrine

Cells 25

Table 2-1: List of AOD and Primer/Probe Sets for qRT-PCR analysis 32

Figure 2-1: SD domain mutations 36

Figure 2-2: Insulin is decreased in Nkx2.2SD/SD mice 38

Figure 2-3: Ghrelin is transiently increased in Nkx2.2SD/SD mice 39

Figure 2-4: Insulin is decreased in Nkx2.2SD/SD mice at E18.5 40

Figure 2-5: Islet size and cell numbers are decreased in Nkx2.2SD/SD mice at E18.5 41

Figure 2-6: A small population of ε cells differentiate into δ cells of Nkx2.2SD/SD mice 43

Figure 2-7: Proliferation and apoptosis of ghrelin cells are relatively unchanged at E16.5 44

Figure 2-8: Nkx2.2SD/SD islets contain polyhormonal cells 46

Figure 2-9: Nkx2.2SD/SD islets contain polyhormonal cells postnatally 47

Figure 2-10: SD domain is required for the interaction between Nkx2.2 and Dnmt1 49

Figure 2-11: SD domain is required for proper methylation and gene expression in β cells 51

Figure 2-12: SD domain is required for proper methylation patterns 53

A: Transcriptome Analysis of Nkx2.2SD/SD mice 79

Figure A-1: Somatostatin is unchanged in Nkx2.2SD/SD mice at E16.5 82

B: Proteomic Analysis of Nkx2.2 SD Domain Binding Partners 83

Table B-1: List of proteins identified by mass spectrometry 87

Acknowledgements

I would like to thank all of those who have helped me throughout my graduate years.

First, I would like to thank my mentor, Lori Sussel, for her continual guidance and support. She has always maintained an open door policy allowing me to ask her any question at any point in the day. She has fostered my interest in development and has continued to push me to improve my scientific thought and writing, crucial steps towards become a successful scientist. Working with Lori has also given me ample opportunity to realize my true passion for the medical field of endocrinology and am fortunate that I will be able to bridge the gap between the basic science and clinical medicine that is needed to improve patient care. Our relationship will continue as our careers continue to evolve.

I am also indebted to the amazing colleagues in the Sussel lab. I look forward to the daily interactions that occur when I step foot into the lab everyday. You continue to ask interesting questions that have steered my research towards new and interesting avenues. I particularly want to thank Jonathon Hill who welcomed me into the lab during my rotation and who answered all of my questions no matter how trivial. I was also fortunate to be able to mentor a rotation student, Matt Borok, and an undergraduate Diana Garofalo. One learns the most from their students and I appreciate all that they have taught me over the years.

Finally I want to thank by family for all of their support during these last few years. My wife Rebecca has given me unconditional support throughout my research years. She has given me the greatest gift of all this past year with the birth of our son Jamie. I also want to thank my parents and in-laws for their support over the past few years. You have all encouraged me to strive for success as a physician scientist.

Dedication

I dedicate this work to my wife Rebecca and my son Jamie.

vii 1

Chapter 1

Introduction

The Pancreas

The mouse pancreas is a dual organ that lies between the stomach, spleen, and small intestine. 95% of the pancreas consists of exocrine tissue, which is responsible for the secretion of enzymes that are necessary for digestion. The other 5% of the pancreas consists of the endocrine compartment, which is responsible for glucose homeostasis and consists of clusters of cells called the Islets of Langerhans. The adult islet is composed of 4 cell types. 80% of the islet consists of a core of insulin-producing β cells. The remainder of the islet cells surround this core and consist of the glucagon-producing α cell, the somatostatin-producing δ cell, and the pancreatic polypeptide-producing PP cell. A fifth cell type, the ghrelin-producing ε cell, is found only in the embryonic pancreas. A portion of these ghrelin expressing cells co-express glucagon during development, but after birth ghrelin is turned off while glucagon expression remains. The remaining ghrelin-expressing cells differentiate into PP cells (Arnes et al., 2012, in press).

Diabetes Mellitus

25 million people in the United States are currently afflicted with Diabetes mellitus.

Moreover, 79 million others are considered to be prediabetic with a high likelihood of progressing to a full-fledged diabetic state. Diabetes is the seventh leading cause of death in the

United States and is the leading cause of kidney failure, nontraumatic lower limb amputation, and blindness. Diabetes is also a major cause of heart disease and stroke (CDC 2011). It is of great interest to understand the disease and the possible modes of treatment.

Diabetes mellitus consists of two main subgroups, Type 1 and Type II diabetes. Type I diabetes (T1DM) is caused by the autoimmune destruction of the insulin producing β cells in the pancreatic islet (Bottazzo et al., 1974; MacCuish et al., 1974). Type II diabetes (T2DM) is a multifactorial disease associated with insulin resistance in the periphery, predominantly in the liver, muscle, and adipose tissue. Prolonged insulin resistance can result in increasing hyperglycemia and eventually induce β cells to proliferate and/or produce increasing amounts of insulin. Over time, the β cells cannot support the increased insulin demand and begin to die or dedifferentiate, resulting in a lack of endogenous insulin and necessitating exogenous sources of insulin (Butler et al., 2003a; Butler et al., 2003b; Ritzel and Butler, 2003; Talchai et al., 2012;

Vaxillaire et al., 2009; Yoon et al., 2003). Although T1DM and T2DM have differing etiologies, both eventually result in the loss of healthy β cells causing hyperglycemia which, when left untreated, results in vascular complications and eventually leads to death. A third type of diabetes, mature onset diabetes of the young (MODY), which affects a relatively small percentage of overall diabetic cases, is a result of monogenic mutations. These mutations lead to a vastly different course of hyperglycemia and have allowed many interesting insights into the genes that are affected [reviewed in (Vaxillaire et al., 2009)]. For example, MODY 2 is caused by mutations in the GCK gene, a protein needed for proper β cell function. Because it is not needed for differentiation of the β cell, patients experience mild fasting hyperglycemia throughout life. MODY 4, on the other hand, is caused by mutations in PDX1, a transcription factor that is indispensible for pancreatic formation. Patients experience more severe hyperglycemic events and when mutations are homozygous, pancreatic agenesis occurs. By understanding the phenotypes associated with each case of MODY, one can begin to understand how the affected gene functions in β cell development and function.

Current Treatments

T1DM occurs when autoimmune destruction of the insulin producing β cells leads to a lack of endogenous insulin and consequent hyperglycemia. Therefore, the main method of glucose management is administration of exogenous insulin to maintain euglycemia. Although strict control is theoretically ideal, hypoglycemia is a warranted risk as administering too much insulin is possible. Therefore, a combination of medium length acting insulin to replace basal insulin levels and short-acting insulin to compensate for mealtime insulin has been in practice for many years (Murphy et al., 2003). More recently, other insulin regimens, such as the insulin pump, have replaced the long acting insulin for many patients (Phillip et al., 2007). While there are many options for administering exogenous insulin, each patient’s requirements are different and their insulin regimens must be titrated accordingly. The lack of consistent treatment options combined with the high risk for hypoglycemic attacks motivate the search for new treatments.

T2DM begins with insulin resistance in the periphery, which leads to additional β cell stress leading to β cell death and/or dedifferentiation. The first line of treatment consists of lifestyle changes such as diet and exercise. This has shown to be very successful in patients who are able to adhere to such a regimen. However, patients often are unable to maintain this course of treatment and medication becomes necessary. While several classes of T2DM drugs exist, patients are usually started with a course of metformin. Metformin has been shown to be a relatively safe drug and increases peripheral insulin sensitivity leading to a decreased demand on the pancreatic β cells. Many patients are able to maintain euglycemia on metformin alone, but in cases where patients are not able to contain their disease through metformin and diet alone, several other drug classes are available [reviewed in (Inzucchi et al., 2012; Ismail-Beigi, 2012)].

Unfortunately, none of these drugs are considered perfect and many pose significant risks, including hypoglycemia. In the case of thiazolidinediones, congestive heart failure and bone fractures are also risks. Thus, significant research is being done on other forms of treatments.

Islet Transplantation

While the current treatment of diabetes is focused on maintaining euglycemia, we have been unable to accurately restore the function of endogenous β cells. Islet transplantation has been proposed as a better treatment strategy than the current regimens. In this procedure, islets are isolated from donor pancreata and infused into the recipient’s portal vein. The portal vein is the site of transplantation because it is easy to access and the liver is a highly vascularized organ, which is ideal for endocrine cells. This protocol has been shown to be successful, and most of the patients are able to remain insulin independent for several years (Shapiro et al., 2000).

While this procedure is extremely promising, the lack of available donor tissue, as well as a continued reliance on immunosuppressive therapies, has led to a search for additional sources of pancreatic islets.

Several potential methods of procuring more pancreatic β cells have been proposed, such as transdifferentiation of other organs, the expansion of the current β cell population, and differentiation of human embryonic stem (hES) or induced pluripotent stem (iPS) cells into β cells. Many investigators have attempted to transdifferentiate liver cells into pancreatic β cells because both organs are derived from a common progenitor pool (Li, 2009; Nagaya et al., 2009;

Tang et al., 2006). Furthermore, the use of another organ from the same patient circumvents the need for immunosuppressive therapy. Although these protocols have produced cells expressing and secreting insulin, the cells do not secrete insulin in a glucose-dependent manner, do not

express all of the genetic markers of mature β cells, and often express hormones found in other islet cells. Although the liver seems to be an excellent candidate for creating a large pool of mature β cells, more work is needed to properly differentiate these cells.

Although other organs have been posited for the production of β cells, researchers have suggested that one might convert different pancreatic cell types into β cells. Zhou and others attempted to transdifferentiate pancreatic acinar cells into β cells by virally infecting 2 month old mice with a mixture of transcription factors known to be important for pancreatic islet cell development, including Ngn3, MafA, and Pdx1 (Zhou et al., 2008). They were able to convert approximately 20% of the infected exocrine cells into insulin producing cells. Although the cells resembled mature β cells structurally, the cells were unable to maintain euglycemia in a streptozotocin-induced model. Therefore, although this study shows promise towards transdifferentiation of the pancreatic exocrine tissue into endocrine tissue, additionaly experimentation is required to better understand the necessary factors required for this type transdifferentiation.

Others have suggested that existing β cells could be expanded in vivo. Mouse studies have shown that insulin resistance as well as pregnancy are associated with increases in β cell replication (Sachdeva and Stoffers, 2009). Non obese diabetic mice (NOD) have also shown an increase in β cell proliferation under increases in β cell inflammation (Sreenan et al., 1999).

Moreover, mouse studies of TIDM, where the mice are treated with anti-CD3 antibodies to limit the β cell autoimmunity, have shown that the increase in β cell mass arises from replication and not differentiation (Sherry et al., 2006). These studies have demonstrated that β cells have the

ability to proliferate but understanding the external cues that could be used to cause β cell replication have yet to be elucidated.

The greatest amount of work in the procurement of new β cells has gone into the differentiation of human embryonic stem cells into pancreatic β cells. The current protocol attempts to mimic normal pancreatic development by adding various factors known to be important in differentiation (D'Amour et al., 2006). ES cells can be differentiated into pancreatic progenitors at a relatively high success rate; however, the differentiation of the pancreatic progenitors into mature and functional β cells has proven more elusive. Currently, a small number non-glucose responsive insulin producing cells can be generated along with a large percentage of ghrelin and polyhormonal cells. Further understanding of normal β cell development is necessary to further refine this protocol.

Although development of in vitro produced β cells from human ES cells remains promising, ethical and political issues have restricted the availability of these cells for research and potential therapeutics. The differentiated cells would also not be derived from the patient’s own cells which could lead to rejection of the transplanted β cells. These issues have been addressed by the development of induced pluripotent stem cells (iPS) (Takahashi and Yamanaka,

2006). In this protocol, isolated adult fibroblasts are dedifferentiated into a pluripotent state by the addition of four pluripoteny genes. The iPS cell is then able to differentiate into all cell types. Thus, the use of hES cells may not be needed and the patient will theoretically not require immunosuppression for β cell transplantation. However, other concerns with iPS-derived islet transplantation exist. iPS cells are pluripotent and have the ability to form cancers such as teratomas (Leon-Quinto et al., 2004). Therefore, if the transplanted population contains even a

rare percentage of undifferentiated cells, the risk of teratoma development exists. Moreover, the differentiated cells might not be full committed to the β cell lineage and thus could revert to an undifferentiated state leading to the formation of other tissue and potentially tumors. The use of iPS cells is also problematic because the current protocols for differentiation employ the use of adenoviruses to infect the differentiating cells with the appropriate genetic factors necessary for differentiation although progress has been made with small molecules and RNA (Cho et al.,

2010; Okita et al., 2010; Warren et al., 2010). As a result, the cells being created for transplantation contain factors such as the SV40 promoter, which has the potential to be tumorigenic. Additionally, islet transplantation in T1DM patients presents a different limitation.

These patients are diabetic as a result of autoimmune destruction of the β cell. Transplantation could replace the lost β cells, but they would still be subject to the autoimmune destruction present in these patients. Thus, more work is needed to understand the pathophysiology of autoimmunity in T1DM in order to prevent the destruction of transplanted islets. However, the largest issue with using iPS cells as a treatment for diabetes is inefficient differentiation of iPS cells into β cells, once again underscoring the importance of studying how functional β cells form in the embryo.

Pancreatic Endocrine Cell Differentiation

In the mouse, pancreatic development begins with formation of the pancreatic progenitor cell from the foregut endoderm at around embryonic day (E) 8.5. Pancreatic progenitor is marked by the transcription factors Pdx1, Ptf1a, Sox9, Nkx6.1, Nkx6.2, and Hnf1β (Haumaitre et al.,

2005; Henseleit et al., 2005; Kawaguchi et al., 2002; Seymour et al., 2007). Knockout studies of

several of these factors including Pdx1 and Ptf1a have shown these transcription factors are indispensible for pancreatic formation. The formation of the pancreatic progenitor cell marks the beginning of the primary transition of pancreatic development. This stage is defined by extensive proliferation of the pancreatic progenitors. This is then followed by the formation of a protruding column like epithelium, consisting of a trunk and tip domain, which will eventually differentiate into the exocrine and endocrine pancreas, respectively (Figures 1-1, 1-2). The endocrine compartment begins with the expression of the transcription factor Ngn3. These Ngn3 expressing endocrine progenitor cells differentiation into the various endocrine cells of the pancreatic islet during the secondary transition from E12.5 through E16.5

Islet Specific Transcription Factors

The differentiating islet is controlled by many transcription factors. Some of these factors such as Ngn3, Isl1, and NeuroD affect the entire islet (Ahlgren et al., 1997; Gradwohl et al., 2000; Naya et al., 1997). Others, such as Nkx2.2, Pax6, and Pax4 affect the vast majority of the endocrine cells in the islet (Collombat et al., 2003; Heller et al., 2005; Sussel et al., 1998).

Additionally, some transcription factors such as Hlxb9 and Nkx6.1 affect a small percentage of the islet populations (Harrison et al., 1999; Sander et al., 2000). For the purpose of this study I will focus on two of these genes: Ngn3 and Nkx2.2.

Ngn3

At approximately E12.5, the pancreatic trunk-tip begins to differentiate and propagate in what is known as the secondary transition. The transcription factor Ngn3 is expressed in the endocrine progenitor population, which forms from the trunk epithelium (Afelik et al., 2012;

Gradwohl et al., 2000; Gu et al., 2002; Jensen et al., 2000; Schwitzgebel et al., 2000). Mice lacking Ngn3 fail to form pancreatic endocrine cells and die postnatally due to hyperglycemia

(Gradwohl et al., 2000). Moreover, precocious Ngn3 expression results in an overabundance of endocrine cells. In these experiments, overexpression of Ngn3 under the control of the Pdx1 promoter led to an increase in predominantly glucagon producing α cells (Apelqvist et al., 1999;

Schwitzgebel et al., 2000). These studies demonstrate the key role for Ngn3 in endocrine cell differentiation. However, some important questions remain. First, since only α cells were seen in these overexpression studies, how do the other endocrine cells differentiate? How does the timing of Ngn3 expression affect endocrine differentiation? In order to answer this question, a study was performed to re-express Ngn3 in a Ngn3 null background during development

(Johansson et al., 2007). Ngn3 was fused to a tamoxifen-inducible estrogen receptor to allow for induction at discrete time points depending on the time of tamoxifen administration, and the fusion protein was directed by the Pdx1 promoter to allow for pancreatic specification. When

Ngn3 is induced at E8.5, the vast majority of endocrine cells are α cells, whereas when Ngn3 is initiated at E10.5, approximately 80% of the endocrine cells are α cells, and the remaining cells are β and PP cells in equal amounts. Interestingly, as Ngn3 expression was induced at successively later stages of development, the proportions of endocrine cells continues to change, and the formation of non-α cells were formed at the expense of α cells (Johansson et al., 2007).

This study clearly demonstrates how the timing of Ngn3 expression is necessary for the appropriate formation of the correct proportions of different endocrine cells in the pancreatic islet and highlights the importance of transcription factor temporal regulation during development.

Another interesting question that arose from these studies, as well as others, is whether

Ngn3 cells are pluripotent or are they each already committed to a specific endocrine lineage?

Desgraz and Herrera (Desgraz and Herrera, 2009) attempted to answer this question by using clonal analysis and binomial distribution statistics. They used the mosaic analyses with double markers (MADM) technique to label a small percentage of Ngn3 cells and performed clonal analysis on this population. These studies demonstrated that statistically, it is likely that each

Ngn3 expressing cell is committed to a specific endocrine lineage (Desgraz and Herrera, 2009).

Thus, although the Ngn3 expressing cell is considered to be the endocrine progenitor cell, each

Ngn3 progenitor cell may already be committed to a specific endocrine lineage at or before the beginning of Ngn3 expression.

Nkx2.2

Nkx2.2 is a member of the NK2 family of homeodomain transcription factors first identified in Drosophila (Kim and Nirenberg, 1989). While originally implicated as a neuronal transcription factor (Price et al., 1992), it was later determined that Nkx2.2 is expressed in pancreatic cells in vitro (Rudnick et al., 1994). This was confirmed by an in vivo mouse model showing that Nkx2.2 is not only expressed in the developing pancreas, but is also required for proper organ development (Sussel et al., 1998). Sussel and others demonstrated that Nkx2.2 was

expressed in α, β, and PP cells starting at E9.5 but was excluded from δ cells. Furthermore, mice lacking Nkx2.2 died in early postnatal life with severe hyperglycemia and hypoinsulinemia.

Extensive analysis demonstrated that the Nkx2.2-/- lacked β cells, had a 90% reduction in α cell number, and a 50% reduction in PP cells. However, the number of islet cells remained constant, and the majority of endocrine cells expressed the hormone ghrelin (Prado et al., 2004). Ghrelin was known at the time to be expressed in the stomach and intestine where it played a role in hunger regulation (Kojima et al., 2001). Subsequently, it was discovered that ghrelin was normally expressed in a small number of cells in the developing pancreas, leading to the classification of a new endocrine cell type – the ghrelin producing ε cells. The Nkx2.2-/- mouse studies suggested that Nkx2.2 is required for the repression of the ε cell fate and for the activation of the α and β cell fates.

In order to better understand the mechanism behind the repression and activation states of

Nkx2.2, Doyle and others generated an in vivo model of Nkx2.2 activation and repression. They developed two transgenic lines by fusing the Nkx2.2 homeodomain to either the VP16 activator or the engrailed repressor domain under the control of the Pdx1 promoter for pancreas-specific expression. The constitutive repressor complex partially rescued the null phenotype. These mice had increased β and α cells and fewer ε cells relative to the null mice, but the β cells that did form lacked mature β cell markers such as MafA and Glut2. The activator complex, on the other hand, had a similar phenotype to the null mice (Doyle et al., 2007). These studies contributed to the hypothesis that Nkx2.2 acts a repressor early in β cell development and as an activator in β cell maturation.

Nkx2.2 Domains

Nkx2.2 is a 273 amino acid transcription factor with 3 regions of conserved homology: the tinman domain (TN), the homeodomain (HD), and the NK2 specific domain (SD) (Figure 1-

3A). The homeodomain is responsible for DNA binding and is sufficient to bind to the Nkx2.2 core-binding site, T(C/T)AAGT(G/A)(G/C)TT (Kim and Nirenberg, 1989). The other two regions are thought to modulate Nkx2.2 function through their interactions with other proteins.

The TN domain is analogous to the engrailed repressor domain of Drosophila and has been postulated to be responsible for gene repression through its interaction with corepressors such as

Grg3. In a recent study, it was determined that Nkx2.2 interacts with Dnmt3a, HDAC1, Nkx6.1, and Grg3, and that the TN domain was required for the direct interaction between Nkx2.2 and

Grg3 (Papizan et al., 2011). In the same study, analysis of mice lacking the TN domain

(Nkx2.2TN/TN mice) revealed that their pancreatic islets displayed decreased β cells, increased e cells and, surprisingly, increased α cells. Using lineage-tracing techniques it was discovered that the β cells were converting to α cells due to ectopic expression of Arx, a key α cell transcription factor. The TN domain is required to interact with Grg3 for repression of genes, such Arx in the

β cell population. The differences between the Nkx2.2-/- and the Nkx2.2TN/TN mice provide interesting insights into the mechanism of Nkx2.2 action. Because a dominant repressor derivative of Nkx2.2 partially rescues the loss of beta cells in the Nkx2.2-/- mice, Nkx2.2 was thought to act as a repressor for the formation of the β cell. However, loss of Nkx2.2 TN- mediated repressor activity did not result in a complete loss of β cells. Therefore, either the TN domain is not the only Nkx2.2 repressor domain and/or repression is not the only pathway

necessary for β cell formation. Studies involving the SD domain, as well as other portions of the

Nkx2.2 protein, will be important to understand the nuances behind Nkx2.2 action.

The SD domain is also highly conserved amongst species and family members, but its function is relatively unknown and is the subject of this thesis (Figure 1-3B). A few studies have been published concerning the SD domain, although they contain several limitations and do not fully reveal the function of the SD domain. One particular study used an in vitro approach to test the ability of Nkx2.2 deletion constructs to regulate an artificial promoter containing tandem

Nkx2.2 binding sites (Watada et al., 2000). Removal of the SD domain led to an increase in promoter activation, whereas the SD domain alone was unable to repress luciferase activity.

Furthermore, deletion of the acidic rich carboxy terminus (CT) led to a reduction in activation.

Thus, it was suggested that the SD domain forms intramolecular interactions with the CT to reduce Nkx2.2 activation abilities. Although this study posits some interesting roles for the SD domain, there are several limitations with the experiments, including the use of an artificial promoter element and the caveats normally associated with immortalized cell lines, which may lack necessary cofactors for correct SD domain function. Thus, it is necessary to assess the regulation of bona fide Nkx2.2 targets and to perform in vivo functional studies to fully address the role of the SD domain.

Additional studies investigated the SD domain in the Drosophila homolog to Nkx2.2, ventral nervous system defective (vnd) (Uhler et al., 2007) using ectopically expressed WT

Nkx2.2 or Nkx2.2 with the SD domain deleted (ΔSD). Flies containing vnd ΔSD had a decrease in downstream repression of intermediate neuroblasts defective (ind) and a decrease in activation of achaete. This regulation was confirmed using in vitro luciferase assays demonstrate decreased repression of vnd downstream genes in the ΔSD flies. Additional studies have demonstrated that an activating region is located towards the amino terminus of the protein and that removal of the SD domain reduces the activation potential. This would suggest that the SD domain hinders the activation domain of Nkx2.2 through intramolecular interactions

(Stepchenko and Nirenberg, 2004). These studies demonstrate the intricacies of the SD domain and highlight the need for a more detailed in vivo study, which will be discussed in this thesis.

Epigenetic Regulation

Epigenetics involves the cellular conditions that affect mitotic heritable gene expression without altering the DNA sequence (Holliday, 2006). One of the first epigenetic marks to be discovered was DNA methylation (Holliday and Pugh, 1975) and was determined to play a critical role in gene expression through its role in cancer. Feinberg and others first noted that tumor cells can lose DNA methylation marks while others have demonstrated that tumor suppressor genes can become hypermethylated leading to tumorigenesis (Feinberg and

Vogelstein, 1983), [reviewed in (Feinberg, 2007)]. DNA methylation involves the covalent addition of a methyl group to the 5’ carbon site of cytosine, predominantly when the cytosine is followed by a guanine, termed a CpG. Most CpGs in the mammalian genome are methylated.

However, there are regions of the genome that contain clusters of CpGs, and they were termed

CpG islands (Gardiner-Garden and Frommer, 1987). CpG islands are usually located in gene promoters or regulatory elements. Furthermore, although most CpG islands are unmethylated, there are several cases where they are methylated, and this correlates with gene repression. It is currently unclear whether methylation leads to gene repression or gene repression leads to methylation. Another theory is that in order to maintain gene repression through cellular replication, the CpG island must be methylated to prevent gene de-repression. Although the order of gene repression and methylation is up for debate, it is clear that DNA methylation is an important aspect of epigenetic regulation.

DNA Methyltransferase

DNA methyltransferases (Dnmts) are enzymes that transfer the methyl group from S- adenosylmethionine to the cytosine residue in CpGs. There are five Dnmt family members:

Dnmt1, Dnmt2, and Dnmt3a, Dnmt3b, and Dnmt3L (Figure 1-4). Dnmt2 was recently identified as a member of a large family of proteins that are conserved from yeast to humans (Jeltsch et al.,

2006). Goll and others further showed that Dnmt2 has methylation activity in mice on the tRNA of aspartic acid (Goll et al., 2006). However, because Dnmt2 knockout mice have no obvious phenotype, this methyltransferase has not been thoroughly researched.

In contrast to Dnmt2, the other Dnmt proteins have been extensively studied. Dnmt proteins in mammalian cells consist of two major segments: an amino terminal region of variable length that contains several domains and a carboxy terminal region that is responsible for the catalytic activity of the methyltransferase. The carboxy terminus is conserved from prokaryotes to eukaryotes and contains ten motifs that are required to be part of the Dnmt family. The

Dnmt3 family is considered to be one made up of de novo methyltransferases (Gowher and

Jeltsch, 2001; Okano et al., 1998). This family of proteins is responsible for the creation of methylation marks in the early stages of embryonic development and in the germ cells. The

Dnmt3 family consists of three genes: Dnmt3a, Dnmt3b, and Dnmt3L. Unlike the other family members, Dnmt3L does not contain a catalytic domain and is thought to modulate the function of

Dnmt3a and Dnmt3b. Dnmt3a and Dnmt3b essential genes: Dnmt3a-/- mice die shortly after birth while Dnmt3b-/- mice are not viable past E9.5 (Okano et al., 1999). Moreover, human mutations in DNMT3b lead to Immunodeficiency, Centromere instability, and Facial abnormalities (ICF) syndrome (Hansen et al., 1999; Okano et al., 1999; Xu et al., 1999). These abnormalities result from the hypomethylation of the pericentromeric regions, which causes chromosomal rearrangements. In contrast to Dnmt3a and Dnmt3b, Dnmt3L-/- mice are viable

(Hata et al., 2002). However, male mice are sterile as Dnmt3L is required for spermatogenesis, and female mice fail to deliver live pups because the embryos die from neural tube defects

(Bourc'his and Bestor, 2004; Bourc'his et al., 2001; Hata et al., 2002; Webster et al., 2005).

These mouse and human studies demonstrate the biological significance of de novo methylation.

While the Dnmt3 family is responsible for the initial methylation patterns, Dnmt1 is necessary to maintain and modulate methylation through its role as the maintenance methyltransferase. Dnmt1 has been shown to preferentially bind hemimethylated DNA over

non-methylated DNA, and it is localized to the replication fork (Fatemi et al., 2001; Goyal et al.,

2006; Leonhardt et al., 1992). Dnmt1-/- mice are embryonic lethal, dying by E10.5, suggesting that maintaining methylation patterns is necessary for viability (Li et al., 1992). Moreover, embryonic stem cells lacking Dnmt1 are viable, but the cells die when a differentiation program is induced.

While it is clear that Dnmt1 is responsible for the maintenance of methylation patterns, significant effort is underway to understand the modulation and specificity of Dnmt1 function. It is currently believed that other proteins are needed for Dnmt1 regulation. Dmap1, a transcriptional corepressor, is necessary for the binding of Dnmt1 near the replication fork during

S phase (Rountree et al., 2000). Dnmt1 also binds to Uhrf1, a protein that specifically binds to hemimethylated DNA, leading to proper recruitment of Dnmt1 (Bostick et al., 2007; Sharif et al.,

2007). While there is good data showing that Dnmt1 is necessary for maintaining methylation patterns, little is known about its role in pancreatic development. For example, how is Dnmt1 recruited to specific promoters? Do transcription factors recruit Dnmt1 or does Dnmt1 recruit the transcription factors? Is methylation via Dnmt1 always associated with repression? In this thesis I will demonstrate how Dnmt1 and Nkx2.2 interact in pancreatic development.

DNA Methyltransferases in Islet Development

As discussed above, Dnmt proteins are important for normal development, and the early embryonic lethality associated with the null alleles preclude assessing their function in pancreatic development. To understand the role of DNA methylation in the pancreatic β cell, Dhawan et al. used the Cre-lox system to remove Dnmt1 specifically from the β cells (Ins:Cre; Dnmt1fl/fl)

(Dhawan et al., 2011). Islets disrupted for Dnmt1 displayed aberrant expression of glucagon in the core of the islets as well as decreased insulin expression. Moreover, the islets also contained cells co-positive for insulin and glucagon. Subsequent lineage tracing revealed that the co- positive cells were derived from β cells, suggesting that Dnmt1 is required to maintain the identity of the β cell by promoting Insulin expression and inhibiting Glucagon expression.

Interestingly, there was an upregulation of the α cell transcription factors Arx and MafB in the

Dnmt1 mutant mice leading to the hypothesis that Dnmt1 is required to inhibit α cell gene expression in the β cell via DNA methylation. Consistently, there was a reduction in the methylation of a CpG island in the promoter of Arx in the Dnmt1 deficient β cells and siRNA- mediated reduction of Dnmt1 in a β cell line also caused a decrease in the methylation of the Arx promoter. Subsequently Papizan and others demonstrated that Dnmt3a is in a complex with

Nkx2.2 on the Arx promoter (Papizan et al., 2011), suggesting that Dnmt3a may also be necessary for methylation of the Arx promoter and its repression in β cells. Taken together, these studies demonstrate the importance of the Dnmt proteins and DNA methylation in the maintenance of proper islet cell identity.

Methylation and Gene Regulation

Regulating gene transcription is of utmost importance during development. Activating and repressing specific genes is necessary for the differentiation of cell types. One major mechanism of gene regulation is DNA methylation (Suzuki and Bird, 2008). Although most documented cases involve gene repression, it is possible that removal of DNA methylation would cause gene activation. It is currently unclear how DNA methylation is regulated and what

mediates its cell and promoter specific regulatory activities. What are the cofactors needed to direct DNA methylation towards specific genetic regions? How are certain genes methylated in one cell type but not another? In my thesis project I have begun to address some of these questions by studying the role of the Nkx2.2 SD domain and its interaction with Dnmt1.

Characterizing the functional ramifications of this interaction, as well as determining how the SD domain is responsible for proper islet cell identity and fidelity will be extremely important for progressing the β cell field towards a full understanding of β cell development and the ability to differentiate β cell in vitro from iPS cells, a key goal towards the next major treatment of diabetes.

Previous studies have suggested that the SD domain is involved in intramolecular control of Nkx2.2 activation. Other studies have found that the SD domain can modulate intermolecular interactions. Interestingly, my analysis has identified an important role for the SD domain in the specification and maintenance of the β cell fate, possibly through its interaction with Dnmt1 and the maintenance of appropriate DNA methylation. I have found that mutation of the SD domain in mice causes a failure of proper β cell development leading to hyperglycemia at birth. More interestingly, many of the remaining islet cells are polyhormonal, expressing multiple hormones and transcription factors not normally seen in a single pancreatic endocrine cell. The polyhormonal cell type persists throughout the life of the mouse suggesting that this phenomenon is not a transient developmental phenomenon as seen in human development. The polyhormonal phenotype can be attributed to the loss of interaction between Dnmt1 and Nkx2.2 with mutation of the SD domain. I hypothesized that this interaction is necessary for the proper methylation of islet specific genes. I show that β cells from Nkx2.2SD/SD mice display decreased

methylation in non β cell genes, as well as an increase in non-β cell gene transcripts. Thus, loss of Nkx2.2 regulated DNA methylation in the Nkx2.2SD/SD mice leads to the misexpression of hormones and transcription factors resulting in polyhormonal cells.

Chapter 2

Islet Cell Identity: The role of the Nkx2.2 NK2-SD Domain in Differentiating

Endocrine Cells

Joshua A Levine generated all data presented in this chapter except for the data included in

Figure 1 (Jessica Shrunk created the mouse construct, Mark Magnusson’s lab made the mouse)

Figure 6,7,10-11 (Assisted by Diana Garofalo), Figure 12 (Library Preparation assisted by Diana

Garofalo, analysis performed by Tiziana Sanavia in the lab of Chris Stoeckert)

Introduction

The mouse pancreas is composed of two distinct compartments: the exocrine pancreas which secretes digestive enzymes into the duodenum via the pancreatic ductal network and the endocrine pancreas, composed of the islets of Langerhans which are necessary for glucose homeostasis. The embryonic pancreatic islet consists of 5 cell types: the insulin-producing β cell, the glucagon-producing α cell, the pancreatic polypeptide-producing PP cell, the somatostatin-producing δ cell, and the ghrelin-producing ε cell. Defects in β cell development and function are associated with diabetes mellitus, a burgeoning disease affecting nearly 25 million people in the United States. Currently, the ideal treatment for diabetes would be replacement of the failing β cells. However, a high quality source of replacement β cells has yet to be developed. In an effort to generate new β cells, many studies have focused on understanding the complex genetic and epigenetic network involved in β cell development, a necessary step towards a successful β cell in vitro differentiation protocol.

Recent attempts to differentiate ES cells into glucose-responsive mature β cells have remained unsuccessful. Current protocols attempt to recapitulate β cell development in vitro by treating cells with transcription factors and signaling molecules at successive stages of the differentiation process to sequentially induce pancreas stage-specific transcription factors

(D'Amour et al., 2006). Differentiation of ES cells towards pancreatic progenitors has been successful but differentiating these progenitors towards mature β cells has not yet been achieved.

Current protocols result in a small number of non-glucose-responsive insulin-positive cells, α cells, and a large number of ε cells. Furthermore, the vast majority of the cells produced in these protocols express multiple hormones, a phenomenon rarely seen in wild type organisms.

Understanding pancreatic islet development will be crucial to overcome the failures of current in vitro β cell differentiation protocols.

Nkx2.2 is an important transcription factor involved in pancreatic islet cell development.

Nkx2.2 is expressed in the early pancreatic progenitor cell at embryonic day (E) 9.5. Nkx2.2-/- mice fail to form β cells, resulting in hyperglycemia at birth and death shortly thereafter (Sussel et al., 1998). These mice also have a 90% reduction in α cells, a 50% reduction in PP cells and a significant increase in ε cells (Prado et al., 2004). Nkx2.2 is involved in the differentiation of many cell types in the CNS and pancreas through the activation or repression of cell type- specific genes. Prior studies in the pancreas have shown that Nkx2.2 acts as a repressor early in

β cell development and potentially as an activator during β cell maturation (Doyle et al., 2007;

Doyle and Sussel, 2007). These functions may be mediated by distinct protein regions and/or cell-specific protein-protein interactions. Nkx2.2 has 3 conserved regions: an amino-terminal TN domain, a homeodomain (HD), and a carboxy-terminal NK2 specific domain (SD). The TN

domain has been shown to be important for transcriptional repression by Nkx2.2 through its recruitment of the Grg co-repressor proteins and a large repressor complex to silenced promoters

(Muhr et al., 2001; Papizan et al., 2011). Nkx2.2TN/TN mice have decreased β cells and increased

α and ε cells at birth. Furthermore, mutation of the TN domain also causes a β-to-α cell transdifferentiation (Papizan et al., 2011). The HD domain is responsible for sequence specific

DNA interactions and is sufficient for the binding of Nkx2.2 to DNA, in vitro (Watada et al.,

2000). The function of the SD domain is not fully understood, however, it is over 95% conserved amongst species and Nkx2 family members (Uhler et al., 2007). Prior in vitro studies have presented conflicting theories on the SD domain’s function. An in vitro study of mouse

Nkx2.2 suggested that the SD domain is important for inhibiting Nkx2.2 activation through intramolecular interactions (Watada et al., 2000), whereas studies in Drosophila demonstrated that the SD domain was necessary for maintaining the interaction between the co-repressor protein groucho and the Nkx2.2 Drosophila homolog, vnd (Uhler et al., 2007). However, caveats are associated with the experimental design of both studies and neither tested the functional activity of the SD domain in an endogenous setting. Therefore, additional in vivo analysis of this domain in mice should help to clarify its function.

During normal pancreatic development in the mouse, endocrine progenitor cells expressing Ngn3 differentiate into 5 distinct cell types. Currently, there are many genetic models where endocrine cell ratios are altered; however, in each case the ability to specify and maintain distinct mono-hormonal cell populations is not affected. For example, Nkx2.2-/- mice fail to form

β cells but do form a small number of α cells, as well as a large number of PP cells and normal amount of δ cells. They also contain a large number of ε cells. However, all of these cell types are distinct and do not express multiple hormones (Prado et al., 2004). Similar to Nkx2.2-/- mice,

Pax6-/- mice fail to form appropriate numbers of β, α, and PP cells and compensate for the loss of certain endocrine cell types with an increase in the ε cell population (Heller et al., 2005;

Sander et al., 1997). Nkx6.1-/- mice, on the other hand, fail to form appropriate numbers of β cells during the secondary transition, while none of the other endocrine cells are affected (Sander et al., 2000). Arx-/- mice at birth are missing α cells which are replaced by increased amounts of

β and δ cells (Collombat et al., 2003). Although much knowledge about the regulation of islet cell type specification has been gained from these mouse models, no explanation currently exists for the presence of polyhormonal cells in current in vitro β cell differentiation protocols.

In this study we developed a mouse model containing a mutation of the SD domain at the endogenous Nkx2.2 locus. These mice are hyperglycemic at birth resulting from a decrease in β cell formation beginning at E14.5. Similar to current in vitro β cell differentiation protocols, these mice also contain polyhormonal cells (D'Amour et al., 2006). Furthermore, we show that the SD domain is required for the interaction between Nkx2.2 and the maintenance DNA methyltransferase, Dnmt1. The loss of this interaction leads to widespread DNA hypomethylation and ectopic expression of cell-type specific genes, such as the α cell gene Arx in the insulin producing cells of Nkx2.2SD/SD mice. There also appears to be a downregulation of

β cell genes. These data demonstrate the importance of SD domain function in the appropriate specification and maintenance of islet cell-specific methylation patterns and endocrine cell identities during pancreas development.

Materials and Methods

Generation of Nkx2.2SD mice

The Nkx2.2SD mice contain a mutation of the NK2-SD domain of Nkx2.2 in the endogenous locus. The mice were created using the two-step recombination-mediated cassette exchange (RMCE) technology (Chen et al., 2011). To create the Nkx2.2SD allele, overlap extension PCR was used to introduce a 99 bp synthetic peptide encoding the mutated SD domain and a unique SacII digestion site

(GCCCGCACCGGCAGCCGCGGCAGCACCGGCAGCCGCAGCAGCAGGCGCCCCGGCA

CACGCGCTCAAAGCCCAGGACCTGGCAGCCGCCACCTTCCAGGCA) into the Nkx2.2 locus. Correct incorporation of the mutations in the Nkx2.2SD targeting vector were verified by

DNA sequencing. The Nkx2.2SD targeting vector was then electroporated into ES cells containing the Nkx2.2LCA allele (Arnes et al., 2012). A two-step positive-negative selection was used to identify embryonic stem (ES) cell clones that had undergone successful cassette exchange (Chen et al., 2011). Positive clones were verified by PCR and southern blot analysis after digestion with SacII (data not shown). Nkx2.2SD/+ ES cells were injected into C57Bl/6 blastocysts and transferred to pseudopregnant C57Bl/6 mice. Male chimeras were bred with female C57Bl/6 mice. Agouti offspring were genotyped using PCR primers specific to the WT or Nkx2.2SD alleles (Figure 2-1B): oDB90 (WT 5’) GTGTGGCAGTGCCGGTCTG; oDB91

(Nkx2.2SD 5’) GCGGCAGCACCGGCAGCCGCA; oDB 92 (WT and Nkx2.2SD 3’)

GACAACGTTAACGTTGGGATG. The FRT-flanked hygromycin cassette was removed by breeding to FlpE mice (Rodriguez et al., 2000). All methodologies used in the production of the

Nkx2.2SD mice were approved by the Vanderbilt University Animal Care and Use Committee.

Animal Maintenance

All mice were maintained on a mixed strain background of Swiss Black (Taconic) and

C57Bl/6 (Jackson). Mice were housed and treated according to the Columbia University

Institutional Animal Care and Use Committee approval protocol. Genotyping of the Nkx2.2SD allele was performed using the primers ODB90-92. Genotyping for the Nkx2.2+/-, Nkx2.2lacz/+,

Ins:Cre, Ghr:Cre, and R26:Tom were described previously (Arnes et al., 2012; Herrera, 2000;

Papizan et al., 2011).

Immunohistochemistry

Frozen tissue: tissue was fixed in 4% paraformaldehyde (PFA) in phosphate buffered solution (PBS) for 4 hours or overnight at 4°C, washed in cold PBS, incubated in 30% sucrose overnight, and cryopreserved. Paraffin embedded tissue: tissue was fixed in 10% neutral buffered formalin (Sigma) overnight at 4°C, rinsed in PBS, dehydrated with 30%, 50%, 70%,

95%, and 100% ethanol, incubated in xylene, and embedded in paraplast. 7 µm sections were used for immunofluorescence. Paraffin slides were rehydrated in xylene, 100%, 95%, 70%, and

50% ethanol. Slides were then treated with 10 mM sodium citrate (pH 6.0) in the microwave to perform antigen retrieval. Frozen and paraffin slides were then washed in PBS, blocked in 5% serum in PBS + 0.3% Tween (PBST), and stained overnight at 4°C in the appropriate antibody.

The primary antibodies used were: anti cleaved-caspase 3 (rabbit, 1:500, Cell Signaling), anti

Chromogranin A (rabbit, 1:500, Millipore), anti Cpa1 (1:500, rabbit, R&D Systems) anti-

Glucagon (guinea pig, 1:1000, Millipore; rabbit, 1:1000, Pheonix), anti-Ghrelin (goat, 1:800,

Santa Cruz Biotechnologies; rabbit, 1:200, Pheonix), anti-Insulin (guinea pig, 1:1000, Millipore; rabbit, 1:1000, Cell Signaling Technologies), anti MafA (rabbit, 1:500, Bethyl), anti Nkx6.1

(rabbit, 1:500 BCBC), anti-Pancreatic Polypeptide (rabbit, 1:200, Zymed), anti-Pdx1 (rabbit,

1:1000, Millipore), anti-Phospho-histone-H3 (rabbit, 1:500, Millipore), anti-Somatostatin (rabbit,

1:200, Pheonix; rat, 1:200 Abcam). Sections were incubated with appropriate secondary antibodies for 2 hours at room temperature (Jackson Immunoresearch). DAPI (1:5000,

Invitrogen) was applied for 10 minutes after secondary antibody incubation. Fluorescent images were obtained on a Leica DM5500 microscope and processed with LAF software. Confocal images were acquired on Zeiss LSM710 and processed with Zen software. For quantification, immunostained pancreata were counted manually on every fifth section (E12.5 and E14.5), or every tenth section (E18.5), throughout the entire pancreas (N=3). The number of cells was normalized to total pancreas area (quantified in Adobe Photoshop). All values are expressed as mean ± SEM. Statistical analysis was performed using a two-tailed student’s unpaired t-test.

Significance was achieved when P<0.05.

RNA Analysis

Total RNA was isolated from whole pancreatic tissue (RNeasy, Qiagen) and CDNA was prepared using the Superscript III kit (Invitrogen) and random hexamer primers. Quantitative

PCR was performed using 200 ng of cDNA, PCR master mix (Eurogenetec) and Taqman probes

(ABI Assays on Demand). See Table 2-1 for a list of primers used. All genes were normalized to Cyclophilin B and were quantified using ABI prism software. An n ≥ 3 was used for all ages.

All values are expressed as mean ± SEM. Statistical analysis was performed using a two-tailed student’s unpaired t-test. Significance was achieved when P<0.05.

ChIP Analysis

α-TC1 and Min6 cells were grown to ~ 75% confluence in a 15 cm culture dish and were formaldehyde-cross-linked according to the ChIP-IT Express kit (Active Motif). Cross-linked chromatin was fragmented by sonication using a Diagnode BioRupter (20 min, 30 sec on/off). 2

µg of mouse α-Dnmt1 (Abcam) was added to 20 µg of sheared DNA. The antibody/chromatin complex was rotated overnight at 4°C. Complexes were pulled down using protein G Dynabeads

(Invitrogen). Chromatin was washed, eluted, reverse-cross-linked, and treated with a protease.

Chromatin was analyzed by quantitative real time PCR using SYBR Green fluorescence with the following primers: Arx (FWD): TCCTCCACCATTTGAGGGTA and (REV):

GCAACTTGAGGGGGTACAGA. All values are expressed as mean ± SEM. Statistical analysis was performed using a two-tailed student’s unpaired t-test. Significance was achieved when P<0.05.

In Vitro Pulldown, Coimmunoprecipitation and Western Blot

In vitro translated protein was made using the TNT kit (Promega). Protein was isolated from P0 mouse pancreata or Min6 cells transfected with myc tagged Nkx2.2 (WT or SD mutant) using the Nuclear Extract kit (Active Motif). Protein complexes were added to 5 µg of mouse anti-Myc (Sigma), mouse anti-Dnmt1 (Abcam) or mouse anti-FLAG (Sigma, 1804).

Protein/antibody complexes were pulled down using protein G DynaBeads (Invitrogen), washed, eluted, and run on a NuPAGE Novex 4-12 % Bis-Tris gel (Invitrogen). Proteins were transferred onto a nitrocellulose membrane (GE Healthcare) and probed using mouse anti-Nkx2.2

(Hybridoma), mouse anti-Myc (Sigma), mouse anti-FLAG (Sigma), mouse anti-Dnmt1

(Abcam), rabbit anti-LaminB1 (Santa Cruz Biotechnology), mouse anti-Dnmt3a (Abcam), or mouse anti-Dnmt3b (Imgenex).

FACS

Pancreata were dissected from P0 Ins:Cre, R26 Tom or Ins:Cre, R26 Tom, Nkx2.2SD/SD mice and dissociated in Accumax (Invitrogen) supplemented with 25 µg of DNAse1 at 37°C for

30 minutes. Accumax treatment was stopped by addition of RPMI 1640 + 2% FBS supplemented with 25 µg of DNAse1. Cells were resuspended in 350 µL of DPBS without ions supplemented with 1 µL of DAPI. Sorted cells were collected in 500 µL of PBS for DNA or 750

µL of Trizol (Qiagen) for RNA isolation. For DNA isolation, cells were centrifuged, resuspended in lysis buffer supplemented with protease K and incubated at 55°C for 1 hour and phenol chloroform extracted. DNA underwent bisulfite conversion using the Epitect Bisuflite conversion kit (Qiagen). The Arx UR2 region of the promoter was amplified from the bisulfite converted DNA using the following primers: TCCTCCACCATTTGAGGGTA and

GCAACTTGAGGGGGTACAG (Dhawan et al., 2011). The PCR product was gel purified and cloned in to Topo 2.1 (Invitrogen). At least 12 positive colonies were sequenced for bisulfite conversion. Analysis was performed using QUMA (http://quma.cdb.riken.jp/). For RNA isolation, cells were brought to 1 mL of liquid with addition of water. 200 uL of chloroform was added to the trizol mixture and the sample was vortexed. Solution was separated using phase lock columns. The aqueous layer was then purified using the RNeasy Micro Kit (Qiagen). RNA was processed and analyzed using the protocol described above.

Methylation Sequencing Analysis

Whole pancreata were dissected from E15.5 mice and dissociated in lysis buffer supplemented with proteinase K for 1 hour at 55°C. DNA was purified using phenol- chloroform. Sequencing libraries were prepared according to the reduced representation bisulfite sequencing preparation (Gu et al., 2011). Sequencing was performed on a Genome Analyzer II

(Illumina) using single reads and 36 cycles. Analysis was done in collaboration with the

University of Pennsylvania.

Results

Generation of Nkx2.2SD/SD mice

To understand the function of the Nkx2.2 NK-2 specific domain (SD), we generated mice containing alanine substitutions of the majority of the conserved amino acids within the SD domain, while leaving structural amino acids intact (Figure 2-1A-B). We confirmed that neonatal Nkx2.2SD/SD mice expressed Nkx2.2 mRNA and protein at levels similar to their wild type littermates, suggesting that the mutation did not affect Nkx2.2SD protein expression or stability (Figure 2-1C-D). Similar to the Nkx2.2-/- mice, the Nkx2.2SD/SD mice were born at normal Mendelian ratios and there was no apparent phenotype associated with the heterozygous

Nkx2.2SD/+ mice at all ages tested (data not shown). At birth, Nkx2.2SD/SD mice were significantly hyperglycemic and their fasting blood glucose levels continued to increase postnatally (Figure 2-

1E). Unlike the Nkx2.2-/- mice, which die shortly after birth, the Nkx2.2SD/SD mice survived into adulthood, however these mice were infertile and died by approximately 6 months of age (data not shown).

Nkx2.2SD/SD mice display a defect in β cell development

To determine the developmental defects that resulted in severe hyperglycemia at birth, we assessed pancreatic development in the Nkx2.2SD/SD mice during embryogenesis. Although the Nkx2.2-/- mice display a developmental phenotype as early as E9.5 and insulin-expressing β cells are never formed (Sussel et al., 1998), the Nkx2.2SD/SD mice do not exhibit a loss in β cell numbers until E14.5 (Figure 2-2A-D,H). Beginning at E14.5, however, there is a 50% reduction in the number of insulin positive cells and 90% reduction in Insulin 2 mRNA transcript levels relative to wild type littermates. These reductions were maintained at E18.5 (Figure 2-2E-H), suggesting that the SD domain is required for proper β cell formation as well as insulin expression. Unlike the Nkx2.2-/- mice that have a 90% reduction in α cells and a 50% reduction in PP cells, Nkx2.2SD/SD mice only have a reduction in b cell numbers and do not display any apparent α or PP cell phenotypes: α and PP cell numbers and Glucagon and Pancreatic

Polypeptide mRNA transcript levels are equivalent to wild type levels (Figure 2-2A-F,I-J, 2-4A).

The loss of endocrine cell populations in the Nkx2.2-/- mice is accompanied by a corresponding large increase in the ghrelin-expressing ε population, which persists until the mice die postnatally (Prado et al., 2004). However, the Nkx2.2SD/SD mice display only a small and transient increase in ε cells. The elevation in ghrelin cell numbers persists through the secondary transition, but returns to normal levels by E18.5 (Figure 2-3). Consistent with a phenotype that is restricted to the β cell population, without a maintained increase in other endocrine cell types, the Nkx2.2SD/SD mice display a reduction in the total numbers of endocrine cells by the end of gestation, as evidenced by the significant decrease in expression of the pan-endocrine marker

Chromogranin A (Figure 2-4,2-5).

The transient elevation in ghrelin-expressing cells was surprising given their perdurance in the Nkx2.2-/- mice. However, in wild type mice, ε cells are normally transient and give rise to

PP and α cell populations (Arnes et al., 2012 in press). To determine the fate of the expanded ε cell population present in the Nkx2.2SD/SD mice, we initiated genetic lineage analysis using

Nkx2.2SD/SD; Ghrelin:Cre; R26:Tom mice to permanently mark the ε lineage (n=1). This preliminary analysis suggested that similar to wild type mice, the ghrelin positive cells gave rise to subsets of the PP and α cell lineages (Figure 2-6C-F). However, unlike the wild type situation, a rare number of ghrelin cells gave rise to δ cells (Figure 2-6A-B), but this event was not large enough to account for the disappearance of the increased ghrelin cell population. We did not identify β cells derived from the ghrelin lineage, although since only one embryo was analyzed we cannot make any final conclusions (Figure 2-6G-H). It was also possible that the increase and subsequent decrease of ghrelin cells was due to transient changes in ε cell proliferation followed by apoptosis. However, at E16.5, ghrelin cells display only a slight increase in apoptosis and no change in proliferation rates (Figure 2-7). Taken together, these data suggest that ghrelin is turned off in the developing pancreas of the Nkx2.2SD/SD mice, similar to late stages of normal pancreatic development. Further quantification analysis will be required to determine whether the ghrelin cells contribute to a greater ratio of PP and α cell lineages.

Nkx2.2SD/SD mice fail to form distinct mono-hormonal islet cells

In the wild type mouse pancreas, five distinct mono-hormonal cell types with characteristic transcription factor profiles are formed from the Ngn3-expressing endocrine progenitor cells. The exception is a small population of glucagon-ghrelin coexpressing cells that

is formed early, but resolved by birth when ghrelin expression is turned off (Heller et al., 2005).

Notably, unlike other pancreatic mutant mouse models, the Nkx2.2SD/SD mice fail to form distinct monohormonal endocrine cell types. Polyhormonal cells can be detected as early as e12.5, with

30% of the insulin-producing cells expressing other hormones (Figures 2-8A-B’,I). Furthermore, these polyhormonal cells are present throughout development, with 25% of all insulin-positive cells expressing the other pancreatic hormones at E18.5 (Figures 2-8C-D’,I); furthermore, all possible combinations of hormones could be detected in a single cell (data not shown). In addition to hormone misexpression, many of the cell specific transcription factors were ectopically activated in incorrect cell types or polyhormonal cells. For example, Pdx1, which normally marks β and δ cells at P0, was expressed in glucagon-producing cells (Figure 2-8E-’) and Nkx6.1, a β cell factor can be detected in glucagon-producing cells (Figure2-8G-H’). There are several studies in human and mice to suggest that polyhormonal exist during the earliest stages of pancreatic development, and may represent precursor cells that resolve over time

(Heller et al., 2005; Riedel et al., 2012). To determine whether the polyhormonal cells observed in Nkx2.2SD/SD mice persisted postnatally, we assessed hormone expression in the islets of 2-3 week-old Nkx2.2SD/SD mice. All possible combinations of polyhormonal cells were seen postnatally, including triple positive and double positive cell populations (Figure 2-9A-D).

Furthermore, these polyhormonal cells retained the misexpression of the islet transcription factors. For example, MafA, which is exclusive to postnatal β cells, was expressed in a glucagon/somatostatin-coexpressing cell (Figure2-9E-F). Therefore, the SD domain is required for the development and maintenance of distinct single hormone-expressing cells in the mouse pancreatic islet.

SD domain interacts with Dnmt1

Nkx2.2 is known to exist in a repressor complex that includes Grg3, HDAC1, and

Dnmt3a and disruption of this complex in the Nkx2.2TN/TN mice leads to ectopic non-β cell gene expression in the β cell (Papizan et al., 2011). These studies also demonstrated that the TN domain mediated a direct physical interaction with Grg proteins, but not HDAC1 or Dnmt3a. To begin to understand the molecular mechanisms underlying SD domain function, we investigated the interaction between the SD domain and the proteins present in the repressor complex with

Nkx2.2. We generated myc-tagged wild type and SD mutant proteins (mycNkx2.2 and mycNkx2.2SD) to perform in vitro pull down assays. These studies confirmed that Nkx2.2 interacted directly with Dnmt3a, Dnmt3b, HDAC1, and Grg3; however, mutation of the SD domain did not affect these interactions (Figure 2-10A and data not shown). On the other hand, these studies demonstrated that the interaction between the maintenance methyltransferase,

Dnmt1 and Nkx2.2 was dependent on the presence of the SD domain (Figure 2-10A,B). The

SD-dependent interaction between Nkx2.2 and Dnmt1 was also confirmed using coimmunoprecipitation assays in transfected Min6 cells (Figure 2-10C). Future studies will verify the SD-dependent interaction between endogenous Dnmt1 and Nkx2.2.

Mutation of the SD domain leads to gene specific hypomethylation

The formation of polyhormonal endocrine cell populations in the Nkx2.2SD/SD mice coupled with the possibility that the Nkx2.2 SD mutation disrupts an interaction with Dnmt1, suggests that widespread loss of DNA methylation may be the cause of the dysregulated endocrine gene expression observed in the Nkx2.2SD/SD mice. Consistent with this hypothesis, ablation of Dnmt1 in β cells caused hypomethylation of the α cell gene, Arx, and the subsequent

upregulation of the α cell genes Arx and MafB. These α cell gene changes were accompanied by a downregulation of the β cell genes Pax4 and Pdx1 (Dhawan et al., 2011). We first confirmed that Dnmt1 is recruited to the hypermethylated Arx promoter in β cell lines, but not to the hypomethylated promoter in α cell lines (Figure 2-11D). To determine whether disruption of the

SD domain, and presumably the interaction with Dnmt1 affected the methylation state of the Arx promoter in β cells, we performed bisulfite sequencing of the Arx promoter in β cells FAC sorted from Nkx2.2SD/SD Ins:Cre; R26:Tom mice. Strikingly, demethylation of the Arx promoter was significantly increased in the Nkx2.2SD/SD versus the wild type beta cells (Figure 2-11A,B).

Furthermore, the hypomethylation was associated with an upregulation of Arx mRNA expression in the β cell (Figure 2-11C). Similar to the β cell specific knockout of Dnmt1, β cells in the

Nkx2.2SD/SD mice also show a decrease in the β cell genes Insulin 2, Nkx6.1 and Pdx1. Taken together these data suggest that the SD domain is required for establishing and/or maintaining the appropriate methylation patterns in the developing endocrine cell to repress non-β cell-specific genes.

Nkx2.2SD/SD mice have global hypomethylation

Although we demonstrated that the mutation in the SD domain resulted in demethylation of the α cell specific gene Arx in the β cells, a general disruption of the interaction between

Nkx2.2 and Dnmt1 would be expected to result in a global change in DNA methylation patterns.

Furthermore, we hypothesized that the disruption of methylation patters would occur in the Ngn3 endocrine population since we observed the presence of polyhormonal cells at their earliest stage of endocrine cell differentiation. We performed reduced representation bisulfite sequencing on

whole pancreata at E15.5, a stage with the highest ratio of Ngn3 cells to total pancreas area to determine the global DNA methylation status of the Nkx2.2SD/SD mice. Relative to wild type mice, Nkx2.2SD/SD mice had 4 times as many hypomethylated versus hypermethylated CpG’s

(Figure 2-12). Thus, disruption of the interaction between Nkx2.2 and Dnmt1 not only causes methylation changes at the Arx promoter, but also altered the methylation status of much of the genome. This mass deregulation of the proper methylation marks in the developing endocrine cells likely contributes to cells ectopically expressing multiple hormones and non-canonical transcription factors.

Discussion

The Nkx2.2 SD domain defines the Nkx2 family and is thought to be functionally important due to its conservation amongst species and Nkx2 family members; however, its function remains elusive. Prior studies have mainly focused on its molecular activity using in vitro models and regulation of artificial promoters (Stepchenko and Nirenberg, 2004; Uhler et al., 2007; Watada et al., 2000). In this study we attempted to understand the role of the SD domain in the developing mouse pancreas by creating a mutation of the domain in the endogenous Nkx2.2 locus. These studies demonstrated that the SD domain has two main functions in pancreas development: β cell formation and the correct specification of monohormonal endocrine cells.

Nkx2.2SD/SD mice fail to form the proper number of β cells during development.

Beginning at E14.5, and continuing throughout development, only 50% of the normal number of

β cells are formed. Furthermore, there is an even greater reduction in insulin expression with

10% of the normal Insulin 2 mRNA being present. Similar to the Nkx2.2-/- mice, the reduction in insulin-producing cells in the Nkx2.2SD/SD mice was associated with increased ghrelin cell numbers. Surprisingly, however, ghrelin, which is persistently upregulated in the Nkx2.2-/- mice

(Prado et al., 2004), was only transiently upregulated in the Nkx2.2SD/SD mice and ghrelin levels normalized by birth. The fate of these excess ghrelin cells has yet to be determined. In wild type mice, ghrelin-expressing ε cells normally differentiate into subsets of PP and α cells, but not into

δ or β cells (Arnes et al., 2012, in press). Shortly after birth, ghrelin expression is diminished and ε cells are rare in the adult islet. Although early ε cell numbers are increased in the

Nkx2.2SD/SD mice, wild type numbers of PP and α cells are derived from the ε cell lineage. It remains possible that increased numbers of ε cells in the Nkx2.2SD/SD mice contribute to modestly larger subsets of PP or α cells, but this contribution is not sufficient to cause statistically significant increases in these total endocrine cell populations. Interestingly, unlike wild type mice, a small percentage of δ cells arise from the ε cells; however, this contribution is also too small to account for the fate of the excess ghrelin-expressing cells and may simply reflect the presence of ghrelin+/somatostatin+ polyhormonal cells during development. We did not identify any β cells deriving from the ghrelin cell lineage. Similar to the ε-derived δ cells, it would be expected that some β cells would also result from the ghrelin+/insulin+ polyhormonal cell populations present in the Nkx2.2SD/SD mice during development. We will have to analyze additional mice to make any final conclusions. Furthermore, it may be difficult to definitively determine the fate of the excess ghrelin population since the lineage tracing studies are confounded by the presence of these polyhormonal cells, where ghrelin and other hormones are erroneously co-expressed in the same cells.

These studies have also demonstrated that the SD domain is required for the creation of mono-hormonal endocrine cells. During normal pancreatic development, Ngn3 endocrine progenitor cells differentiate into distinct islet cell types, each expressing a single hormone and a distinct set of transcription factors. Furthermore, recent data have suggested that each Ngn3- expressing cell is primed to form a single endocrine cell type (Desgraz and Herrera, 2009).

Nkx2.2SD/SD mice contain polyhormonal cells as early as e12.5, when endocrine cells are beginning to differentiate, suggesting that the Ngn3-expressing endocrine progenitor cells are defective in the initial specification of single hormone expressing cells. The identification of the

SD-dependent interaction between Nkx2.2 and Dnmt1, the maintenance methyltransferase, also suggests that the formation of polyhormonal cells may be caused by a defect in DNA methylation. Prior studies have suggested that cell-specific DNA methylation patterns are important for maintaining cellular identity. For example, deletion of the methyltransferases

Dnmt1 or Dnmt3a specifically in the β cells leads to an upregulation of α cell genes and the conversion of β cells into α cells (Dhawan et al., 2011; Papizan et al., 2011). Surprisingly, neither of these genetic manipulations of demethyltransferases resulted in polyhormonal cells. A possible explanation for the lack of polyhormonal cells in these models is that the methyltransferases were deleted from β cells after they had differentiated. It is possible that once

β cell differentiation has occurred, these cells are already restricted in their differentiation/transdifferentiation potential; reversion to immature β cells or transdifferentiation into α cells may be the only developmental option. In contrast, disruption of the DNMT1 interaction in the Nkx2.2SD/SD mice occurs much earlier in development and within the undifferentiated progenitor cell populations. It is likely that because these endocrine precursors

possess wider differentiation potentials, they are inherently more plastic in their differentiation potential and retain the ability to misexpress β cell and non-β cell genes, which would lead to the formation of polyhormonal cells. This would predict that if one were to remove either Dnmt1 or

Dnmt3a from the Ngn3 expressing endocrine progenitor population, polyhormonal cells would be generated. However in the absence of this data, we can still conclude from the existing studies that maintenance of the correct DNA methylation patterns is necessary for the appropriate specification and maintenance of pancreatic islet cells.

The interaction between the Nkx2.2 SD domain and Dnmt1 detailed in this study is consistent with prior experiments showing that the SD domain is important for groucho and intramolecular interactions (Stepchenko and Nirenberg, 2004; Uhler et al., 2007; Watada et al.,

2000). Although our data suggests that the SD domain does not directly interact with Grg3, it is possible that the interaction between the SD domain and DNMT1 helps form or stabilize the interaction between the TN domain and Grg3 to form a large multi-protein repressor complex.

We can test this model by investigating complex formation with the different Nkx2.2 mutant proteins in vitro and in vivo. Additional studies suggested there was an intramolecular interaction between the SD domain and an activator domain, which was postulated to mask the protein’s activation functions, it is possible that the SD-dependent interaction between Nkx2.2 and Dnmt1 may compete with the binding of a putative co-activator protein to Nkx2.2 or may induce a conformational change in the protein structure to mask the activator domain. Therefore, our data suggesting that the SD domain mediates the interaction between Nkx2.2 and Dnmt1 complements prior functional and biochemical SD domain studies.

Based upon our in vitro data, we expect that the interaction between Nkx2.2 and Dnmt1 would be disrupted in the Nkx2.2SD/SD mice, which should ultimately have consequences on DNA

methylation states and gene expression. The Arx promoter, a key α cell gene, was chosen as a candidate gene to test this hypothesis because it is regulated by cell-specific DNA methylation.

The Arx promoter has been shown to be hypermethylated in β cells as opposed to α cells, which results in the repression of Arx in β and not in α cells (Papizan et al., 2011). This differential methylation pattern was also associated with β cell-specific binding of the de novo methyltransferase, Dnmt3a, to the Arx promoter. Furthermore, removal of Dnmt1 in the β cells in an in vivo mouse model resulted in hypomethylation of a CpG island in the Arx promoter specifically in the β cells (Dhawan et al., 2011). In Nkx2.2SD/SD mice, we determined that the Arx promoter was hypomethylated and Arx was correspondingly upregulated in the β cells, suggesting that methylation changes have led to ectopic gene expression and polyhormonal cells.

We further show that this methylation pattern is associated with the binding of Dnmt1 to the Arx promoter in β cell lines as opposed to α cell lines. However, we have yet to determine whether mutations in the SD domain prevent the recruitment of DNMT1 to the Arx promoter or impairs it function. Future studies will use ChIP assays on FAC sorted β cells to test whether the SD domain is necessary for the recruitment of Dnmt1 to the Arx promoter in vivo. In addition, since ectopic Arx can only account for the erroneous upregulation of alpha cell genes, additional genes must be dysregulated in the polyhormonal cells. In an initial attempt to identify additional hypomethylated promoters, we assayed the mice for global methylation changes in whole pancreata at E15.5. While these studies demonstrated that the Nkx2.2SD/SD mice contain relatively increased levels of hypomethylated CpGs compared to wild type animals, the use of a mixed population of cells precludes our ability to identify cell-specific DNA methylation

changes. Future studies will focus on cell specific genome wide methylation pattern, which would be useful in understanding the role of the SD domain in a cell specific context.

Although the interaction between Nkx2.2 and DNMT1 provides a plausible mechanism for the presence of polyhormonal cells in the Nkx2.2SD/SD mice, it is still unclear why these mice fail to form normal numbers of β cells. It is possible that defective DNA methylation also contributes to this phenotype, which can be addressed by deleting DNMT1 from the Ngn3 progenitor population. Interestingly, unlike the Nkx2.2-/- mice, which do not form any β cells, the Nkx2.2SD/SD and Nkx2.2TN/TN mice form some β cells, albeit at lower levels. It is possible that the SD and TN domains are redundant in their functions to develop early β cell populations, and therefore simultaneous removal of both domains could recapitulate the complete β cell phenotype associated with the Nkx2.2-/- mice. Alternatively, the function of the non-conserved regions of Nkx2.2 could be important in Nkx2.2 regulatory activities. Future studies will address the loss of β cells in the Nkx2.2SD/SD mice.

In conclusion, these data suggest that the SD domain plays a dual role in pancreatic development: β cell differentiation and the formation of mono-hormonal endocrine cells. The mechanism for SD function in β cell differentiation remains to be elucidated. Mutation of the

SD domain in mice leads to the formation of polyhormonal cells through the destabilization of the interaction between Nkx2.2 and the maintenance methyltransferase Dnmt1. This results in global hypomethylation as well as cell specific demethylation and upregulation of non-canonical genes such as Arx in the wrong cell type, in the case the β cell. These studies have led to an important mechanism behind the inhibition of creating polyhormonal cells, a key factor that will be necessary to inhibit the formation of polyhormonal cells using in vitro differentiation

protocols, an elusive step in the creation of β cells for transplant into diabetic patients (D'Amour et al., 2006).

Chapter 3 Conclusions and Perspectives

Diabetes mellitus, a multifactorial metabolic disorder, is a burgeoning disease affecting

25 million people in the United States. Diabetes can be associated with autoimmunity, insulin resistance, and defects in the pancreatic β cells. My study predominantly addresses issues associated with β cell development and function. One possible treatment for diabetes is replacement of the defective β cells; transplantation of donor islet cells has been achieved with relative success (Shapiro et al., 2000). However, a paucity of available donor cells has led others to develop techniques to differentiate β cells in vitro from embryonic (ES) or induced pluripotent stem cells (iPS). While these efforts attempt to mimic in vivo pancreatic development, they have been unsuccessful in differentiating mature, glucose-responsive, insulin- producing β cells. The failure to form functional β cells highlights the need for a more complete understanding of islet cell development in order to further disease treatment.

Nkx2.2 is a transcription factor that is indispensible for the developing islet. Nkx2.2-/- mice completely lack β cells, have a vast reduction of α cells, a 50% reduction in PP cells, and display a corresponding increase in ε cells (Prado et al., 2004; Sussel et al., 1998). Because

Nkx2.2 affects multiple cell lineages and because its function within each cell are variable, it is possible that different regions of Nkx2.2 are responsible for the different spatial-temporal

Nkx2.2 functions. Understanding these different Nkx2.2 domains will be important for elucidating the intricacies of Nkx2.2 regulation. In addition to the DNA binding homeodomain of Nkx2.2, two other conserved regions exist: the tinman domain (TN) and the NK2 specific domain (SD). Analysis of Nkx2.2TN/TN mice demonstrated that the TN domain mediates the

formation of a repressor protein complex (Papizan et al., 2011). Nkx2.2TN/TN mice also show a decrease in β cell formation and an increase in α and ε cell numbers. Moreover, the Nkx2.2TN/TN mice display a β to α cell transdifferentiation resulting from the lack of repression of α cell genes in the β cells. However, these mice do not phenocopy the Nkx2.2-/- mice suggesting that the TN domain is not the only domain of Nkx2.2 responsible for proper endocrine cell development and other regions of Nkx2.2 must be necessary for proper pancreatic formation. In this study I showed that the highly conserved SD domain is required for β cell development and for the formation of monohormonal pancreatic endocrine cells, potentially through the regulation of cell and locus specific DNA methylation.

Nkx2.2 SD domain Function

To understand the role of the SD domain in vivo, I studied mice containing a mutation of the endogenous SD domain (Nkx2.2SD/SD). Analysis of these mice revealed two striking phenotypes: the presence of polyhormonal cells that are not normally seen in the adult mouse islet and a great reduction in the overall numbers of insulin-producing β cells.

While a fully differentiated islet normally consists of five different cell types that each express a unique hormone, the islets of the Nkx2.2SD/SD mice exhibit populations of cells that express combinations of several hormones and transcription factors normally only associated with a distinct hormonal subclass. The occurrence of these polyhormonal cells indicates that key genetic networks necessary for cell-fate specification and differentiation are misregulated within the Nkx2.2SD/SD islet. Furthermore, the identification of Dnmt1 as an Nkx2.2 SD domain binding

partner implicates this domain as a crucial modulator of pancreatic development through methylation patterning.

Methylation patterning is necessary for the consolidation of cellular identity. Indeed, loss of the DNA methyltransferases Dnmt3a or Dnmt1 in the β cell results in the hypomethylation of the α-cell specific Arx promoter and consequent β to α cell transdifferentiation (Dhawan et al.,

2011; Papizan et al., 2011). Furthermore, I have shown that mutation of the SD domain results in a decoupling of the interaction between Nkx2.2 and Dnmt1 leading to global and site-specific hypomethylation. This disruption of proper methylation patterning, most probably within the

Ngn3 expressing endocrine progenitor, leads to the formation of polyhormonal cells. These studies highlight the importance of maintaining islet specific methylation patterning during endocrine development. However, many questions regarding how epigenetics regulate islet differentiation remain. Classically, distinct roles have been ascribed to the major DNA methyltransferase family members: the Dnmt3 family is required for de novo methylation, during early embryogenesis, while Dnmt1 is needed to maintain this methylation patterning during cellular replication. Dnmt1 is ubiquitously expressed while Dnmt3a/b are expressed highly in progenitor cells and at lower levels in somatic cells (Jones and Liang, 2009). It is thought that

DNA methylation patterns are required to maintain gene repression after cellular replication.

However, recent data have suggested DNA methylation is more complex. While the classical definition of de novo methylation suggests that Dnmt3a would only be expressed during early embryogenesis, Dnmt3a has been shown to be present in pancreatic cell lines, as well as is P0 pancreatic extracts (Papizan et al., 2011) suggesting additional functions beyond de novo methylation. Moreover, removal of Dnmt3a and Dntm3b from ES cell lines result in progressive hypomethylation during successive cell passages, suggesting that the Dnmt3 family is needed for

maintenance of methylation patterning (Chen et al., 2003). Other studies have suggested that

Dnmt1 has de novo methylation properties. Demethylation in Dnmt3a-/-, Dnmt3b-/- cell lines, treated with varying amounts of 5-AZA, a demethylase compound, showed remethylation of the genome after treatment suggesting that, in addition to maintenance methylation activity, Dnmt1 has de novo methylation activity (Liang et al., 2002). The varying functions of DNA methyltransferases add a level of complexity to the Dnmt1-Nkx2.2 interaction in the Nkx2.2SD/SD mice. Does Dnmt1 act as a maintenance or de novo methyltransferase in different cell types during endocrine differentiation? Is Nkx2.2 required to regulate Dnmt1 active type? These questions will be addressed in future studies.

In addition to DNA methylation patterning, gene repression is associated with other epigenetic changes such as histone modifications. For example, trimethylation of lysine residue

27 of Histone H3 (H3K27me3) has been associated with gene repression (Barski et al., 2007;

Boyer et al., 2006; Lee et al., 2006; Roh et al., 2006). Recent data in the lab has confirmed that

H3K37me3 is bound to the hypermethylated Arx promoter in β cell lines as opposed to α cell lines (Papizan and Sussel, unpublished data) suggesting that histone modifications are also associated with repression of non-canonical genes in a cell specific context. Moreover, studies have suggested that while histone modifications are associated with repression, DNA methylation is needed to maintain this repression through successive generations (Barski et al.,

2007; Jones and Liang, 2009). These studies demonstrate the importance of the interplay between histone modification, gene regulation, and DNA methylation. These data suggest there are potentially more complex methods of gene repression beyond the role of Dnmt1 in the formation of monohormonal pancreatic endocrine cells. Future studies will begin to address these mechanisms.

In addition to the formation of polyhormonal cells, Nkx2.2SD/SD mice also display a reduction in the total number of β cells. Candidate analysis of whole pancreata at multiple ages of gestation, as well as microarray analysis at E16.5, directly after the Ngn3 endocrine progenitors have differentiated, demonstrated that β cell associated genes were downregulated in the Nkx2.2SD/SD mice but that other pathways remained unchanged. This phenotype is not observed in the Nkx2.2-/- animals, which do not form β cells throughout development. While the persistence of a small β cell population in the Nkx2.2SD/SD mice implies that other Nkx2.2 protein domains may also help establish the β cell fate, the function of the other Nkx2.2 domains in the initiation of β cell differentiation is still under investigation. To address this issue, transcriptome analysis could be performed on sorted Ngn3 endocrine progenitor cells from the Nkx2.2SD/SD mice to understand the genetic changes that lead to a reduction in β cell formation. However, using isolated cell populations from the Nkx2.2SD/SD mice has its own limitations because these cellular populations are being studied in the context of a ubiquitous SD domain mutation. To begin to understand the role of the SD domain within specific cell types, the Cre-LoxP system can be used to mutate the SD domain within a specific cell population. In this experiment, the

Nkx2.2flox allele would be used in conjunction with the Nkx2.2SD allele. Because the Nkx2.2SD/- mice are phenotypically indistinguishable form the Nkx2.2SD/SD mice, and because the Nkx2.2SD/+ mice have no apparent phenotype, we can use an Nkx2.2SD/flox mouse to mutate the SD domain within a specific domain. To determine the role of the SD domain within the Ngn3 endocrine progenitor pool, where I hypothesize that the polyhormonal cell fate is specified, a Ngn3:Cre allele would be used. Mutating the SD domain only in β cells using the Ins:Cre allele could also elucidate the role of the SD domain in the consolidation and maintenance of β cell identity.

However, this experiment would only detail the role of the SD domain in β cell function and not in β cell formation. Alternatively the Pdx1:CreER allele could be used to induce SD domain mutation at the onset of β cell differentiation, in the pre-β cell. Appropriate timing of the tamoxifen treatment will be challenging, as early induction could lead to widespread pancreatic

SD mutation and late induction could result in SD mutation in the already differentiation β cells.

Despite these caveats, this experiment could provide important insight into the spatial and temporal requirements SD function in the development of the β cell.

One potential limitation associated with our studies is the use of a ubiquitous mutation;

SD function is disrupted in all Nkx2.2-expressing tissues, including the nervous and intestinal systems. It is unclear whether the function of Nkx2.2 in these other systems influences Nkx2.2 function in the pancreas. Although the tissue specific experiments described above, partially alleviate this issue, the Cre inducers are not pancreas specific. For example, the Ngn3:Cre allele is also expressed in the nervous and intestinal systems. If warranted, future studies employing a pancreas specific SD mutational analysis may be informative.

In Vitro Differentiation of β Cells

Understanding the details of pancreatic development has allowed investigators attempting to differentiate β cells in vitro by mimicking in vivo development. Current protocols have focused on the differentiation of embryonic (ES) or induced pluripotent (IPS) stem cells into mature, glucose responsive β cells (D'Amour et al., 2006). These protocols focus on a wide variety of extracellular signaling molecules to differentiate the stem cells towards a β cell fate, including Activin, Wnt, Fgf, Retinoic Acid, and others. However, these differentiation protocols fail to produce functional β cells and the majority of the cells found at the end of the

differentiation protocol are polyhormonal. Analysis of Nkx2.2SD/SD mice has demonstrated that non β cell genes are repressed in a methylation specific manner during the differentiation of the

β cell. Lack of this directed methylation patterning results in the formation of polyhormonal cells. Because both of these systems produce polyhormonal cells, it is possible that non-β cell genes are not being methylated and subsequently repressed during the in vitro differentiation protocol.

Investigators have been aware of the possibility of methylation patterning being important for the in vitro differentiation protocol. However, most studies have focused on global methylation changes using molecules such as HDAC inhibitors (Christensen et al., 2011).

However, my studies have demonstrated the need to locally alter methylation patterning.

Because methylation is often associated with gene repression, site directed gene repression might lead to similar results as local methylation changes. Currently, it is unclear how to alter methylation patterning in a directed fashion, but future technologies will allow us to attempt these experiments. It is also possible that modulating the extracellular signaling pathways that influence DNA methylation and/or gene repression could help in the differentiation protocol. In addition, we currently do not know the signaling pathways that are affected in the Nkx2.2SD/SD mice that lead to a failure to develop appropriate numbers of β cells, as well as the formation of mono-hormonal cells. The potential signaling pathways altered in the Nkx2.2SD/SD mice may be altered in the Ngn3 endocrine progenitor population, and understanding the genetic changes specifically within this population will elucidate pathways that could be more easily modulated in the in vitro differentiation process. Therefore, the mechanisms associated with the phenotypic

changes in the Nkx2.2SD/SD mice will lead to potential avenues for improvements in in vitro β cell differentiation.

Conclusions

Diabetes remains an escalating disease in the United States. Its association with β cell failure has led investigators to attempt to differentiate β cells in vitro for transplantation into diabetic patients. However, current differentiation protocols have failed to create glucose responsive, mature, β cells. Understanding the intricacies of in vivo pancreatic development is of utmost importance for the improvement of these differentiation protocols. In the study of the SD domain of Nkx2.2, I have uncovered the role of methylation in the developing islet. While many investigators have focused on gene activation and which genes are necessary for proper β cell differentiation, the appropriate repression of genes during development has often been overlooked. The failure of the Nkx2.2SD/SD mice to form single hormone expressing pancreatic endocrine cells have highlighted the importance of proper methylation patterning in the repression of genes that need to be inactivated to promote appropriate cell specification.

Therefore, these studies have highlighted the role of gene methylation and repression in the developing islet. These data will enable refinement of the in vitro β cell differentiation protocol, a key step to β cell replacement in diabetic patients.

References

Afelik, S., Qu, X., Hasrouni, E., Bukys, M.A., Deering, T., Nieuwoudt, S., Rogers, W., Macdonald, R.J., and Jensen, J. (2012). Notch-mediated patterning and cell fate allocation of pancreatic progenitor cells. Development 139, 1744-1753.

Ahlgren, U., Pfaff, S.L., Jessell, T.M., Edlund, T., and Edlund, H. (1997). Independent requirement for ISL1 in formation of pancreatic mesenchyme and islet cells. Nature 385, 257- 260.

Apelqvist, A., Li, H., Sommer, L., Beatus, P., Anderson, D.J., Honjo, T., Hrabe de Angelis, M., Lendahl, U., and Edlund, H. (1999). Notch signalling controls pancreatic cell differentiation. Nature 400, 877-881.

Arnes, L., Leclerc, K., Friel, J.M., Hipkens, S.B., Magnuson, M.A., and Sussel, L. (2012). Generation of Nkx2.2:lacZ mice using recombination-mediated cassette exchange technology. Genesis 50, 612-624.

Barski, A., Cuddapah, S., Cui, K., Roh, T.Y., Schones, D.E., Wang, Z., Wei, G., Chepelev, I., and Zhao, K. (2007). High-resolution profiling of histone methylations in the human genome. Cell 129, 823-837.

Bostick, M., Kim, J.K., Esteve, P.O., Clark, A., Pradhan, S., and Jacobsen, S.E. (2007). UHRF1 plays a role in maintaining DNA methylation in mammalian cells. Science 317, 1760-1764.

Bottazzo, G.F., Florin-Christensen, A., and Doniach, D. (1974). Islet-cell antibodies in diabetes mellitus with autoimmune polyendocrine deficiencies. Lancet 2, 1279-1283.

Bourc'his, D., and Bestor, T.H. (2004). Meiotic catastrophe and retrotransposon reactivation in male germ cells lacking Dnmt3L. Nature 431, 96-99.

Bourc'his, D., Xu, G.L., Lin, C.S., Bollman, B., and Bestor, T.H. (2001). Dnmt3L and the establishment of maternal genomic imprints. Science 294, 2536-2539.

Boyer, L.A., Plath, K., Zeitlinger, J., Brambrink, T., Medeiros, L.A., Lee, T.I., Levine, S.S., Wernig, M., Tajonar, A., Ray, M.K., et al. (2006). Polycomb complexes repress developmental regulators in murine embryonic stem cells. Nature 441, 349-353.

Brown, D.T. (2003). Histone H1 and the dynamic regulation of chromatin function. Biochemistry and cell biology = Biochimie et biologie cellulaire 81, 221-227.

Bustin, M., Catez, F., and Lim, J.H. (2005). The dynamics of histone H1 function in chromatin. Mol Cell 17, 617-620.

Butler, A.E., Janson, J., Bonner-Weir, S., Ritzel, R., Rizza, R.A., and Butler, P.C. (2003a). Beta- cell deficit and increased beta-cell apoptosis in humans with type 2 diabetes. Diabetes 52, 102- 110.

Butler, A.E., Janson, J., Soeller, W.C., and Butler, P.C. (2003b). Increased beta-cell apoptosis prevents adaptive increase in beta-cell mass in mouse model of type 2 diabetes: evidence for role of islet amyloid formation rather than direct action of amyloid. Diabetes 52, 2304-2314.

Chen, S.X., Osipovich, A.B., Ustione, A., Potter, L.A., Hipkens, S., Gangula, R., Yuan, W., Piston, D.W., and Magnuson, M.A. (2011). Quantification of factors influencing fluorescent protein expression using RMCE to generate an allelic series in the ROSA26 locus in mice. Disease models & mechanisms 4, 537-547.

Chen, T., Ueda, Y., Dodge, J.E., Wang, Z., and Li, E. (2003). Establishment and maintenance of genomic methylation patterns in mouse embryonic stem cells by Dnmt3a and Dnmt3b. Mol Cell Biol 23, 5594-5605.

Cho, H.J., Lee, C.S., Kwon, Y.W., Paek, J.S., Lee, S.H., Hur, J., Lee, E.J., Roh, T.Y., Chu, I.S., Leem, S.H., et al. (2010). Induction of pluripotent stem cells from adult somatic cells by protein- based reprogramming without genetic manipulation. Blood 116, 386-395.

Christensen, D.P., Dahllof, M., Lundh, M., Rasmussen, D.N., Nielsen, M.D., Billestrup, N., Grunnet, L.G., and Mandrup-Poulsen, T. (2011). Histone deacetylase (HDAC) inhibition as a novel treatment for diabetes mellitus. Molecular medicine 17, 378-390.

Collombat, P., Mansouri, A., Hecksher-Sorensen, J., Serup, P., Krull, J., Gradwohl, G., and Gruss, P. (2003). Opposing actions of Arx and Pax4 in endocrine pancreas development. Genes Dev 17, 2591-2603.

D'Amour, K.A., Bang, A.G., Eliazer, S., Kelly, O.G., Agulnick, A.D., Smart, N.G., Moorman, M.A., Kroon, E., Carpenter, M.K., and Baetge, E.E. (2006). Production of pancreatic hormone- expressing endocrine cells from human embryonic stem cells. Nat Biotechnol 24, 1392-1401.

Desgraz, R., and Herrera, P.L. (2009). Pancreatic neurogenin 3-expressing cells are unipotent islet precursors. Development 136, 3567-3574.

Dhawan, S., Georgia, S., Tschen, S.I., Fan, G., and Bhushan, A. (2011). Pancreatic beta cell identity is maintained by DNA methylation-mediated repression of Arx. Developmental cell 20, 419-429.

Doyle, M.J., Loomis, Z.L., and Sussel, L. (2007). Nkx2.2-repressor activity is sufficient to specify alpha-cells and a small number of beta-cells in the pancreatic islet. Development 134, 515-523.

Doyle, M.J., and Sussel, L. (2007). Nkx2.2 regulates beta-cell function in the mature islet. Diabetes 56, 1999-2007.

Fatemi, M., Hermann, A., Pradhan, S., and Jeltsch, A. (2001). The activity of the murine DNA methyltransferase Dnmt1 is controlled by interaction of the catalytic domain with the N-terminal part of the enzyme leading to an allosteric activation of the enzyme after binding to methylated DNA. J Mol Biol 309, 1189-1199.

Feinberg, A.P. (2007). Phenotypic plasticity and the epigenetics of human disease. Nature 447, 433-440.

Feinberg, A.P., and Vogelstein, B. (1983). Hypomethylation distinguishes genes of some human cancers from their normal counterparts. Nature 301, 89-92.

Franklin, S., Chen, H., Mitchell-Jordan, S., Ren, S., Wang, Y., and Vondriska, T.M. (2012). Quantitative analysis of the chromatin proteome in disease reveals remodeling principles and identifies high mobility group protein B2 as a regulator of hypertrophic growth. Molecular & cellular proteomics : MCP 11, M111 014258.

Gardiner-Garden, M., and Frommer, M. (1987). CpG islands in vertebrate genomes. J Mol Biol 196, 261-282.

Goll, M.G., Kirpekar, F., Maggert, K.A., Yoder, J.A., Hsieh, C.L., Zhang, X., Golic, K.G., Jacobsen, S.E., and Bestor, T.H. (2006). Methylation of tRNAAsp by the DNA methyltransferase homolog Dnmt2. Science 311, 395-398.

Gowher, H., and Jeltsch, A. (2001). Enzymatic properties of recombinant Dnmt3a DNA methyltransferase from mouse: the enzyme modifies DNA in a non-processive manner and also methylates non-CpG [correction of non-CpA] sites. J Mol Biol 309, 1201-1208.

Goyal, R., Reinhardt, R., and Jeltsch, A. (2006). Accuracy of DNA methylation pattern preservation by the Dnmt1 methyltransferase. Nucleic Acids Res 34, 1182-1188.

Gradwohl, G., Dierich, A., LeMeur, M., and Guillemot, F. (2000). neurogenin3 is required for the development of the four endocrine cell lineages of the pancreas. Proc Natl Acad Sci U S A 97, 1607-1611.

Gu, G., Dubauskaite, J., and Melton, D.A. (2002). Direct evidence for the pancreatic lineage: NGN3+ cells are islet progenitors and are distinct from duct progenitors. Development 129, 2447-2457.

Gu, H., Smith, Z.D., Bock, C., Boyle, P., Gnirke, A., and Meissner, A. (2011). Preparation of reduced representation bisulfite sequencing libraries for genome-scale DNA methylation profiling. Nature protocols 6, 468-481.

Hansen, R.S., Wijmenga, C., Luo, P., Stanek, A.M., Canfield, T.K., Weemaes, C.M., and Gartler, S.M. (1999). The DNMT3B DNA methyltransferase gene is mutated in the ICF immunodeficiency syndrome. Proc Natl Acad Sci U S A 96, 14412-14417.

Harrison, K.A., Thaler, J., Pfaff, S.L., Gu, H., and Kehrl, J.H. (1999). Pancreas dorsal lobe agenesis and abnormal islets of Langerhans in Hlxb9-deficient mice. Nat Genet 23, 71-75.

Hata, K., Okano, M., Lei, H., and Li, E. (2002). Dnmt3L cooperates with the Dnmt3 family of de novo DNA methyltransferases to establish maternal imprints in mice. Development 129, 1983- 1993.

Haumaitre, C., Barbacci, E., Jenny, M., Ott, M.O., Gradwohl, G., and Cereghini, S. (2005). Lack of TCF2/vHNF1 in mice leads to pancreas agenesis. Proc Natl Acad Sci U S A 102, 1490-1495.

Heller, R.S., Jenny, M., Collombat, P., Mansouri, A., Tomasetto, C., Madsen, O.D., Mellitzer, G., Gradwohl, G., and Serup, P. (2005). Genetic determinants of pancreatic epsilon-cell development. Dev Biol 286, 217-224.

Henseleit, K.D., Nelson, S.B., Kuhlbrodt, K., Hennings, J.C., Ericson, J., and Sander, M. (2005). NKX6 transcription factor activity is required for alpha- and beta-cell development in the pancreas. Development 132, 3139-3149.

Herrera, P.L. (2000). Adult insulin- and glucagon-producing cells differentiate from two independent cell lineages. Development 127, 2317-2322.

Holliday, R. (2006). Epigenetics: a historical overview. Epigenetics : official journal of the DNA Methylation Society 1, 76-80.

Holliday, R., and Pugh, J.E. (1975). DNA modification mechanisms and gene activity during development. Science 187, 226-232.

Inzucchi, S.E., Bergenstal, R.M., Buse, J.B., Diamant, M., Ferrannini, E., Nauck, M., Peters, A.L., Tsapas, A., Wender, R., and Matthews, D.R. (2012). Management of hyperglycemia in type 2 diabetes: a patient-centered approach: position statement of the American Diabetes Association (ADA) and the European Association for the Study of Diabetes (EASD). Diabetes care 35, 1364-1379.

Ismail-Beigi, F. (2012). Clinical practice. Glycemic management of type 2 diabetes mellitus. N Engl J Med 366, 1319-1327.

Jeltsch, A., Nellen, W., and Lyko, F. (2006). Two substrates are better than one: dual specificities for Dnmt2 methyltransferases. Trends in biochemical sciences 31, 306-308.

Jensen, J., Heller, R.S., Funder-Nielsen, T., Pedersen, E.E., Lindsell, C., Weinmaster, G., Madsen, O.D., and Serup, P. (2000). Independent development of pancreatic alpha- and beta- cells from neurogenin3-expressing precursors: a role for the notch pathway in repression of premature differentiation. Diabetes 49, 163-176.

Johansson, K.A., Dursun, U., Jordan, N., Gu, G., Beermann, F., Gradwohl, G., and Grapin- Botton, A. (2007). Temporal control of neurogenin3 activity in pancreas progenitors reveals competence windows for the generation of different endocrine cell types. Developmental cell 12, 457-465.

Jones, P.A., and Liang, G. (2009). Rethinking how DNA methylation patterns are maintained. Nature reviews Genetics 10, 805-811.

Kawaguchi, Y., Cooper, B., Gannon, M., Ray, M., MacDonald, R.J., and Wright, C.V. (2002). The role of the transcriptional regulator Ptf1a in converting intestinal to pancreatic progenitors. Nat Genet 32, 128-134.

Kim, Y., and Nirenberg, M. (1989). Drosophila NK-homeobox genes. Proc Natl Acad Sci U S A 86, 7716-7720.

Kojima, M., Hosoda, H., and Kangawa, K. (2001). Purification and distribution of ghrelin: the natural endogenous ligand for the growth hormone secretagogue receptor. Horm Res 56 Suppl 1, 93-97.

Kratzmeier, M., Albig, W., Meergans, T., and Doenecke, D. (1999). Changes in the protein pattern of H1 histones associated with apoptotic DNA fragmentation. The Biochemical journal 337 ( Pt 2), 319-327.

Lee, T.I., Jenner, R.G., Boyer, L.A., Guenther, M.G., Levine, S.S., Kumar, R.M., Chevalier, B., Johnstone, S.E., Cole, M.F., Isono, K., et al. (2006). Control of developmental regulators by Polycomb in human embryonic stem cells. Cell 125, 301-313.

Leon-Quinto, T., Jones, J., Skoudy, A., Burcin, M., and Soria, B. (2004). In vitro directed differentiation of mouse embryonic stem cells into insulin-producing cells. Diabetologia 47, 1442-1451.

Leonhardt, H., Page, A.W., Weier, H.U., and Bestor, T.H. (1992). A targeting sequence directs DNA methyltransferase to sites of DNA replication in mammalian nuclei. Cell 71, 865-873.

Li, E., Bestor, T.H., and Jaenisch, R. (1992). Targeted mutation of the DNA methyltransferase gene results in embryonic lethality. Cell 69, 915-926.

Li, W.C. (2009). In vitro transdifferentiation of human hepatoma cells into pancreatic-like cells. Methods Mol Biol 560, 99-110.

Liang, G., Chan, M.F., Tomigahara, Y., Tsai, Y.C., Gonzales, F.A., Li, E., Laird, P.W., and Jones, P.A. (2002). Cooperativity between DNA methyltransferases in the maintenance methylation of repetitive elements. Mol Cell Biol 22, 480-491.

Lu, P., Hankel, I.L., Hostager, B.S., Swartzendruber, J.A., Friedman, A.D., Brenton, J.L., Rothman, P.B., and Colgan, J.D. (2011). The developmental regulator protein Gon4l associates

with protein YY1, co-repressor Sin3a, and histone deacetylase 1 and mediates transcriptional repression. J Biol Chem 286, 18311-18319.

MacCuish, A.C., Irvine, W.J., Barnes, E.W., and Duncan, L.J. (1974). Antibodies to pancreatic islet cells in insulin-dependent diabetics with coexistent autoimmune disease. Lancet 2, 1529- 1531.

Meergans, T., Albig, W., and Doenecke, D. (1997). Varied expression patterns of human H1 histone genes in different cell lines. DNA and cell biology 16, 1041-1049.

Metukuri, M.R., Zhang, P., Basantani, M.K., Chin, C., Stamateris, R.E., Alonso, L.C., Takane, K.K., Gramignoli, R., Strom, S.C., O'Doherty, R.M., et al. (2012). ChREBP mediates glucose- stimulated pancreatic beta-cell proliferation. Diabetes 61, 2004-2015.

Muhr, J., Andersson, E., Persson, M., Jessell, T.M., and Ericson, J. (2001). Groucho-mediated transcriptional repression establishes progenitor cell pattern and neuronal fate in the ventral neural tube. Cell 104, 861-873.

Murphy, N.P., Keane, S.M., Ong, K.K., Ford-Adams, M., Edge, J.A., Acerini, C.L., and Dunger, D.B. (2003). Randomized cross-over trial of insulin glargine plus lispro or NPH insulin plus regular human insulin in adolescents with type 1 diabetes on intensive insulin regimens. Diabetes care 26, 799-804.

Nagaya, M., Katsuta, H., Kaneto, H., Bonner-Weir, S., and Weir, G.C. (2009). Adult mouse intrahepatic biliary epithelial cells induced in vitro to become insulin-producing cells. The Journal of endocrinology 201, 37-47.

Naya, F.J., Huang, H.P., Qiu, Y., Mutoh, H., DeMayo, F.J., Leiter, A.B., and Tsai, M.J. (1997). Diabetes, defective pancreatic morphogenesis, and abnormal enteroendocrine differentiation in BETA2/neuroD-deficient mice. Genes Dev 11, 2323-2334.

Okano, M., Bell, D.W., Haber, D.A., and Li, E. (1999). DNA methyltransferases Dnmt3a and Dnmt3b are essential for de novo methylation and mammalian development. Cell 99, 247-257.

Okano, M., Xie, S., and Li, E. (1998). Cloning and characterization of a family of novel mammalian DNA (cytosine-5) methyltransferases. Nat Genet 19, 219-220.

Okita, K., Hong, H., Takahashi, K., and Yamanaka, S. (2010). Generation of mouse-induced pluripotent stem cells with plasmid vectors. Nature protocols 5, 418-428.

Papizan, J.B., Singer, R.A., Tschen, S.I., Dhawan, S., Friel, J.M., Hipkens, S.B., Magnuson, M.A., Bhushan, A., and Sussel, L. (2011). Nkx2.2 repressor complex regulates islet beta-cell specification and prevents beta-to-alpha-cell reprogramming. Genes Dev 25, 2291-2305.

Phillip, M., Battelino, T., Rodriguez, H., Danne, T., and Kaufman, F. (2007). Use of insulin pump therapy in the pediatric age-group: consensus statement from the European Society for Paediatric Endocrinology, the Lawson Wilkins Pediatric Endocrine Society, and the International Society for Pediatric and Adolescent Diabetes, endorsed by the American Diabetes Association and the European Association for the Study of Diabetes. Diabetes care 30, 1653-1662.

Prado, C.L., Pugh-Bernard, A.E., Elghazi, L., Sosa-Pineda, B., and Sussel, L. (2004). Ghrelin cells replace insulin-producing beta cells in two mouse models of pancreas development. Proc Natl Acad Sci U S A 101, 2924-2929.

Price, M., Lazzaro, D., Pohl, T., Mattei, M.G., Ruther, U., Olivo, J.C., Duboule, D., and Di Lauro, R. (1992). Regional expression of the homeobox gene Nkx-2.2 in the developing mammalian forebrain. Neuron 8, 241-255.

Riedel, M.J., Asadi, A., Wang, R., Ao, Z., Warnock, G.L., and Kieffer, T.J. (2012). Immunohistochemical characterisation of cells co-producing insulin and glucagon in the developing human pancreas. Diabetologia 55, 372-381.

Ritzel, R.A., and Butler, P.C. (2003). Replication increases beta-cell vulnerability to human islet amyloid polypeptide-induced apoptosis. Diabetes 52, 1701-1708.

Rodriguez, C.I., Buchholz, F., Galloway, J., Sequerra, R., Kasper, J., Ayala, R., Stewart, A.F., and Dymecki, S.M. (2000). High-efficiency deleter mice show that FLPe is an alternative to Cre- loxP [letter]. Nat Genet 25, 139-140.

Roh, T.Y., Cuddapah, S., Cui, K., and Zhao, K. (2006). The genomic landscape of histone modifications in human T cells. Proc Natl Acad Sci U S A 103, 15782-15787.

Rountree, M.R., Bachman, K.E., and Baylin, S.B. (2000). DNMT1 binds HDAC2 and a new co- repressor, DMAP1, to form a complex at replication foci. Nat Genet 25, 269-277.

Rudnick, A., Ling, T.Y., Odagiri, H., Rutter, W.J., and German, M.S. (1994). Pancreatic beta cells express a diverse set of homeobox genes. Proc Natl Acad Sci U S A 91, 12203-12207.

Sachdeva, M.M., and Stoffers, D.A. (2009). Minireview: Meeting the demand for insulin: molecular mechanisms of adaptive postnatal beta-cell mass expansion. Mol Endocrinol 23, 747- 758.

Sander, M., Neubuser, A., Kalamaras, J., Ee, H.C., Martin, G.R., and German, M.S. (1997). Genetic analysis reveals that PAX6 is required for normal transcription of pancreatic hormone genes and islet development. Genes Dev 11, 1662-1673.

Sander, M., Sussel, L., Conners, J., Scheel, D., Kalamaras, J., Dela Cruz, F., Schwitzgebel, V., Hayes-Jordan, A., and German, M. (2000). Homeobox gene Nkx6.1 lies downstream of Nkx2.2 in the major pathway of beta-cell formation in the pancreas. Development 127, 5533-5540.

Schwitzgebel, V.M., Scheel, D.W., Conners, J.R., Kalamaras, J., Lee, J.E., Anderson, D.J., Sussel, L., Johnson, J.D., and German, M.S. (2000). Expression of neurogenin3 reveals an islet cell precursor population in the pancreas. Development 127, 3533-3542.

Seymour, P.A., Freude, K.K., Tran, M.N., Mayes, E.E., Jensen, J., Kist, R., Scherer, G., and Sander, M. (2007). SOX9 is required for maintenance of the pancreatic progenitor cell pool. Proc Natl Acad Sci U S A 104, 1865-1870.

Shapiro, A.M., Lakey, J.R., Ryan, E.A., Korbutt, G.S., Toth, E., Warnock, G.L., Kneteman, N.M., and Rajotte, R.V. (2000). Islet transplantation in seven patients with type 1 diabetes mellitus using a glucocorticoid-free immunosuppressive regimen. N Engl J Med 343, 230-238.

Sharif, J., Muto, M., Takebayashi, S., Suetake, I., Iwamatsu, A., Endo, T.A., Shinga, J., Mizutani-Koseki, Y., Toyoda, T., Okamura, K., et al. (2007). The SRA protein Np95 mediates epigenetic inheritance by recruiting Dnmt1 to methylated DNA. Nature 450, 908-912.

Sherry, N.A., Kushner, J.A., Glandt, M., Kitamura, T., Brillantes, A.M., and Herold, K.C. (2006). Effects of autoimmunity and immune therapy on beta-cell turnover in type 1 diabetes. Diabetes 55, 3238-3245.

Sreenan, S., Pick, A.J., Levisetti, M., Baldwin, A.C., Pugh, W., and Polonsky, K.S. (1999). Increased beta-cell proliferation and reduced mass before diabetes onset in the nonobese diabetic mouse. Diabetes 48, 989-996.

Stepchenko, A., and Nirenberg, M. (2004). Mapping activation and repression domains of the vnd/NK-2 homeodomain protein. Proc Natl Acad Sci U S A 101, 13180-13185.

Sussel, L., Kalamaras, J., Hartigan-O'Connor, D.J., Meneses, J.J., Pedersen, R.A., Rubenstein, J.L., and German, M.S. (1998). Mice lacking the homeodomain transcription factor Nkx2.2 have diabetes due to arrested differentiation of pancreatic beta cells. Development 125, 2213-2221.

Suzuki, M.M., and Bird, A. (2008). DNA methylation landscapes: provocative insights from epigenomics. Nature reviews Genetics 9, 465-476.

Takahashi, K., and Yamanaka, S. (2006). Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 126, 663-676.

Talchai, C., Xuan, S., Lin, H.V., Sussel, L., and Accili, D. (2012). Pancreatic beta Cell Dedifferentiation as a Mechanism of Diabetic beta Cell Failure. Cell 150, 1223-1234.

Tang, D.Q., Cao, L.Z., Chou, W., Shun, L., Farag, C., Atkinson, M.A., Li, S.W., Chang, L.J., and Yang, L.J. (2006). Role of Pax4 in Pdx1-VP16-mediated liver-to-endocrine pancreas transdifferentiation. Laboratory investigation; a journal of technical methods and pathology 86, 829-841.

Terme, J.M., Sese, B., Millan-Arino, L., Mayor, R., Izpisua Belmonte, J.C., Barrero, M.J., and Jordan, A. (2011). Histone H1 variants are differentially expressed and incorporated into chromatin during differentiation and reprogramming to pluripotency. J Biol Chem 286, 35347- 35357.

Uhler, J., Zhang, H., Syu, L.J., and Mellerick, D.M. (2007). The Nk-2 box of the Drosophila homeodomain protein, Vnd, contributes to its repression activity in a Groucho-dependent manner. Mech Dev 124, 1-10.

Vaxillaire, M., D, P., Bonnefond, A., and Froguel, P. (2009). Breakthroughs in monogenic diabetes genetics: from pediatric forms to young adulthood diabetes. Pediatric endocrinology reviews : PER 6, 405-417.

Warren, L., Manos, P.D., Ahfeldt, T., Loh, Y.H., Li, H., Lau, F., Ebina, W., Mandal, P.K., Smith, Z.D., Meissner, A., et al. (2010). Highly efficient reprogramming to pluripotency and directed differentiation of human cells with synthetic modified mRNA. Cell stem cell 7, 618- 630.

Watada, H., Mirmira, R.G., Kalamaras, J., and German, M.S. (2000). Intramolecular control of transcriptional activity by the NK2-specific domain in NK-2 homeodomain proteins. Proc Natl Acad Sci U S A 97, 9443-9448.

Webster, K.E., O'Bryan, M.K., Fletcher, S., Crewther, P.E., Aapola, U., Craig, J., Harrison, D.K., Aung, H., Phutikanit, N., Lyle, R., et al. (2005). Meiotic and epigenetic defects in Dnmt3L-knockout mouse spermatogenesis. Proc Natl Acad Sci U S A 102, 4068-4073.

Xu, G.L., Bestor, T.H., Bourc'his, D., Hsieh, C.L., Tommerup, N., Bugge, M., Hulten, M., Qu, X., Russo, J.J., and Viegas-Pequignot, E. (1999). Chromosome instability and immunodeficiency syndrome caused by mutations in a DNA methyltransferase gene. Nature 402, 187-191.

Yoon, K.H., Ko, S.H., Cho, J.H., Lee, J.M., Ahn, Y.B., Song, K.H., Yoo, S.J., Kang, M.I., Cha, B.Y., Lee, K.W., et al. (2003). Selective beta-cell loss and alpha-cell expansion in patients with type 2 diabetes mellitus in Korea. The Journal of clinical endocrinology and metabolism 88, 2300-2308.

Zhou, Q., Brown, J., Kanarek, A., Rajagopal, J., and Melton, D.A. (2008). In vivo reprogramming of adult pancreatic exocrine cells to beta-cells. Nature 455, 627-632.

Appendix A

Transcriptome Analysis of Nkx2.2SD/SD Mice

Joshua Levine generated all data except for the microarray analysis, which was performed by

the University of Pennsylvania School of Medicine’s IDOM-DRC Functional Genomics

Core.

Phenotypic analysis of Nkx2.2SD/SD mice discussed in chapter 2 detailed a candidate gene analysis that demonstrated there was a reduction in the expression of β cell genes, such as Insulin

2 and Nkx6.1. The gene expression changes were associated with a 50% reduction in insulin- expressing cell numbers and a 90% reduction in Ins2 mRNA levels. To begin to fully understand the phenotypic profile of the Nkx2.2SD/SD mice, we performed whole genome expression analysis. We chose to analyze whole pancreata at E16.5, a stage where many of the

Ngn3 expressing endocrine progenitor cells have begun to differentiate, but exocrine differentiation has yet to occur. Pancreatic tissue was dissected Nkx2.2+/+ and Nkx2.2SD/SD mice

(N=3). RNA was prepared and hybridized to an Agilent Whole Mouse Genome Microarray

4x44K [G4122F]. The analysis was performed by the University of Pennsylvania School of

Medicine’s IDOM-DRC Functional Genomics Core. The microarray dataset can be found at: http://www.betacell.org/resources/data/studies/view/study_id/4258.

β-cell Specific Genes

Consistent with candidate mRNA analysis (chapter 2), the microarray revealed several β cell genes were downregulated in the Nkx2.2SD/SD mice. Insulin 2 was decreased in 11 probes

confirming the β cell defect. Insulin 1 and NeuroD1, other β cell genes were also found to be downregulated in the Nkx2.2SD/SD mice. Surprisingly, Nkx6.1 and Pdx1, two additional β cell genes were not significantly altered in Nkx2.2SD/SD mice. Ghrelin, Glucagon, and Pancreatic

Polypeptide levels did not differ from wild type mice. Somatostatin was increased in the

Nkx2.2SD/SD mice but we were unable to confirm this result with qRT-PCR analysis (Figure A-

1). Taken together, these data add supporting evidence for the role of the SD domain in β cell development, but not the other endocrine cell types.

Non-Annotated Genes

The largest proportion of gene changes in the Nkx2.2SD/SD mice were unannotated including many non-coding RNAs, suggesting that the SD domain is responsible for the regulation of non-coding RNAs. Several forms of non-coding RNA exist including shRNA and miRNA. These various RNA’s are thought to play a role in genetic regulation either by binding to the mRNA itself or to the various locations on the DNA genome, in a similar fashion to transcription factors. Others have postulated that these RNAs can bind to other proteins affecting their function. While it is unclear what specific non-coding RNAs are affected by the

SD mutation, these data suggest that the SD domain is necessary for proper regulation of non- coding RNAs.

Gon-4-Like Pseudogene

The highest and third highest downregulated RNA found in the array was a pseudogene located upstream of the coding region for Gon-4-Like (Gon4L). In the hematopoietic system,

Gon4L has recently been shown to be associated with HDAC1, a known Nkx2.2 cofactor ((Lu et

al., 2011; Papizan et al., 2011). HDAC1 is known to be involved in epigenetic regulation, the same pathway that was shown to be implicated in the Nkx2.2SD/SD mice through the SD dependent interaction of Nkx2.2 and Dnmt1. Taken together, these data suggest another potential mechanism for the epigenetic regulation of pancreatic endocrine cell development by the SD domain.

Conclusions and Future Directions

The microarray results have confirmed our prior candidate analysis showing a decrease in several β cell genes in the Nkx2.2SD/SD mice. Two β cells genes, Nkx6.1 and Pdx1 remain unchanged suggesting that only a portion of β cell differentiation is affected. However, these data do not fully address the polyhormonal phenotype. For example, one would expect non β cell genes to be upregulated since the insulin+ cells express other hormones and transcription factors not normally seen in the β cell. However, these same genes may be downregulated in their own cell type, which is also becoming polyhormonal. In order to address this issue, whole genome transcription analysis would have to be performed on individual cell populations. For example, understanding the transcriptional differences within the Ngn3 expressing progenitor cell population could elucidate some of the pathways that have been altered which results in the production of polyhormonal cells. As a result, although the microarray has confirmed our earlier

β cell phenotype, analysis of individual cell populations is needed to fully understand the complex phenotype associated with the Nkx2.2SD/SD mice.

Somatostatin 1.5

1.0

0.5 Relative mRNA

0.0

+/+ SD/SD

Nkx2.2 Nkx2.2

Figure A-1: Somatostatin is unchanged in Nkx2.2SD/SD mice at E16.5. qRT-PCR of mRNA extracted from whole pancreata at E16.5 showing equivalent amounts of Somatostatin transcript between wild type and Nkx2.2SD/SD mice. (n=4-5)

Appendix B

Proteomic Analysis of Nkx2.2 SD Domain Binding Partners

The Nkx2.2 NK2-SD (SD) domain is highly conserved amongst species and Nkx2 family members (Figure 2-1A). Prior studies have suggested that the SD domain regulates cofactor binding. However, these cofactors have yet to be elucidated. Understanding the Nkx2.2 binding partners that are regulated by the SD domain will lead to a better understanding of the function of the SD domain.

To investigate the SD domain interacting factors, in vitro pulldown assays followed by mass spectrometry were utilized. mycNkx2.2, mycNkx2.2SD, or Myc was in vitro translated

(Promega TNT). The protein was mixed with nuclear extract from 16 150 mm confluent plates of Min6 cells. The mixture was immunoprecipitated using 25 ug of mouse-α-myc antibody

(Sigma) and exposed to SDS-PAGE analysis followed by coomassie staining. SDS-PAGE samples were digested and analyzed by mass spectrometry at the Columbia University Medical

Center Protein Core Facility (Table B-1).

Histone Variants

One of the more interesting cluster of proteins identified in this study was the Histone H1 variant group. Mutation of the SD domain caused a loss of interaction between Nkx2.2 and either Histone H1.1 or Histone H1.2 and a gain of interaction with Histone H1.4. Histone H1 proteins have been known to play a role in chromatin packaging but more recently different variants have been shown to affect differential gene regulation (Brown, 2003; Bustin et al., 2005;

Terme et al., 2011). Histone H1.1 was recently shown to be differentially expressed in

pluripotent cells as opposed to somatic cells suggesting that it is important for maintenance of pluripotency (Terme et al., 2011). On the other hand, histone H1.2 and H1.4 were found to be expressed in both somatic and pluripotent cells suggesting that they are necessary for cellular maintenance. Expression levels of these various histone variants also changes amongst cell types and thus, they are needed at various points in cellular development (Kratzmeier et al., 1999;

Meergans et al., 1997). The polyhormonal cells seen in the Nkx2.2SD/SD mice could partially result from the misregulation of appropriate Histone H1 variants. Therefore, the ability of the

Ngn3 endocrine progenitor cell to differentiate into single hormonal expressing cells requires the expression of specific Histone H1 variants and the SD domain is necessary for this process.

Other SD Interacting Proteins

Mutation of the SD domain of Nkx2.2 led to some other potential interacting factors.

These include proteins involved in RNA processing and binding such as Elavl1, Eif2s1, Hnrnpu,

Dhx9, and Ddx21. Furthermore, Hmgb2, a protein involved in controlling cell growth and proliferation was also bound to Nkx2.2 in an SD dependent manner (Franklin et al., 2012).

Nop58, a factor involved in snoRNA binding was also found to be a potential SD interacting factor. These potential binding factors could account for the phenotype associated with the

Nkx2.2SD/SD mice.

Gain of Function Proteins

Mutation of the SD domain also caused a gain of protein binding suggesting that the SD domain is also necessary to inhibit Nkx2.2 cofactor interactions. For example, Mlxipl, a factor involved in regulation β cell proliferation potentially binds Nkx2.2SD, suggesting a potential

mechansism for the dysregulation of β cell development in Nkx2.2SD/SD mice (Metukuri et al.,

2012). Moreover, Top2b, a protein involved DNA replication, also bound to Nkx2.2SD further implicating the SD domain in the dysregulation of β cell proliferation during development.

Thus, mutation of the SD domain could recruit additional cofactors to Nkx2.2 that would cause an imbalance of necessary proliferation factors in the development of the β cell.

Conclusions and Future Directions

This study demonstrates some of the potential binding factors of Nkx2.2 that are dependent on the SD domain. While the candidate approach detailed in Chapter 2 demonstrated that the SD domain is responsible for the interaction between Nkx2.2 and Dnmt1, all aspects of the Nkx2.2SD/SD phenotype are not fully explained. As a result, we performed this non-candidate cofactor binding experiment. However, several caveats still exist with this experiment. First,

Nkx2.2 was found in the pull down only in the wild type situation and not in the Nkx2.2SD pull down. As a result, it is possible that some of the potential SD dependent Nkx2.2 cofactors are false positives. Furthermore, the largest percentage of the proteins that resulted from these experiments were IgG associated proteins which inhibits the ability of the mass spectrometer to discern less concentrated proteins. In future experiments, IgG bands on the SDS-PAGE gel can be physically removed, but this would also eliminate any potential Nkx2.2 cofactor of the same molecular weights. Another caveat of these studies is that the experiment was only performed once. Thus, any potential SD dependent interactions would have to be confirmed either in a candidate approach or by repeating the mass spectrometry experiment. Although limitations

exist with this study, potentially interesting SD dependent interacting proteins have been identified.

Lost with SD mutation Sequence Name ELAV-like protein 1 OS=Mus musculus GN=Elavl1 PE=1 SV=2 Eukaryotic translation initiation factor 2 subunit 1 OS=Mus musculus GN=Eif2s1 PE=1 SV=3 Heterogeneous nuclear ribonucleoprotein U OS=Mus musculus GN=Hnrnpu PE=1 SV=1 High mobility group protein B2 OS=Mus musculus GN=Hmgb2 PE=1 SV=3 Histone H1.1 OS=Mus musculus GN=Hist1h1a PE=2 SV=2 Histone H1.2 OS=Mus musculus GN=Hist1h1c PE=1 SV=2 Isoform 2 of ATP-dependent RNA helicase A OS=Mus musculus GN=Dhx9 Nucleolar protein 58 OS=Mus musculus GN=Nop58 PE=1 SV=1 Nucleolar RNA helicase 2 OS=Mus musculus GN=Ddx21 PE=1 SV=3

Gained with SD mutation Sequence Name DNA topoisomerase 2-beta OS=Mus musculus GN=Top2b PE=1 SV=2 Histone H1.4 OS=Mus musculus GN=Hist1h1e PE=1 SV=2 Isoform 2 of Carbohydrate-responsive element-binding protein OS=Mus musculus GN=Mlxipl Isoform 2 of Zinc finger protein castor homolog 1 OS=Mus musculus GN=Casz1

Table B-1: List of proteins identified by mass spectrometry.