Role of Islet Endothelial Cells in Β-Cell Function and Growth

Digital Comprehensive Summaries of Uppsala Dissertations from the Faculty of Medicine 141

Role of Islet Endothelial Cells in β-cell Function and Growth

MAGNUS JOHANSSON

ACTA UNIVERSITATIS UPSALIENSIS ISSN 1651-6206 UPPSALA ISBN 91-554-6536-6 2006 urn:nbn:se:uu:diva-6801 ! " # $ $%%& "' ( ) ! ( ( *) ) +, ( -. /) 0 1 !).

# ) . $%%&. ( 2 1 ) 34 , 5 0 ). 6 . . '7 . . 289 :4''4&'"&4&.

/) ( ) !) ) . 2 0 ) ) )!) ( . / ) ) ) ) ( . ( ! ) ) ) 0 ) 34 . /) ( ) ) 0 ! ( 0) 34 ) 0 ) ). /) ) ) 0 ! ! ) ! ! 0 ) ( ( 0 ! . ; ) ) ( ) 0 ! ! . 2 ! 34 ( < 0 ) ) ! ) ) 0 0 . /) ! ) ( ) ) ) ! 34 ( . ; ( ) ! ( . , ) ( . * ( 0 ) < ! ! ( ) ! ( . 2 ) ( ! !! ) ) 0 ) ) ! ! 0 ) ( . /) ( ) ( ! < ( ( .

!"# $%"!#&' (

= ! # ) $%%&

2889 &'4&$%& 289 :4''4&'"&4& 4&>% +) ?? .@.? A B 4&>%- in vivo veritas

List of Papers

This thesis is based on the following papers, which will be referred to in the text by their Roman numerals.

I Perinatal development of the vasculature in the islets of Langerhans in rats. Magnus Johansson, Arne Andersson, Per-Ola Carlsson and Leif Jansson. J Anat. 2006;208(2):191-196

II Islet endothelial cells and pancreatic ȕ-cell proliferation: studies in vitro and during pregnancy in adult rats. Magnus Johansson, Göran Mattsson, Arne Andersson, Leif Jansson and Per-Ola Carlsson. In press, Endocrinology

III Prolactin pretreatment improves islet transplantation outcome. Mag- nus Johansson, Johan Olerud, Leif Jansson and Per-Ola Carlsson. Manuscript

IV Improved vascular engraftment and function of autotransplanted pancreatic islets: positive effects induced by partial pancreatectomy. Magnus Johansson, Leif Jansson and Per-Ola Carlsson. Manuscript

All reprints have been made with permission of the copyright holders.

Contents

Introduction...... 11 Islet anatomy ...... 11 Cellular composition of pancreatic islets...... 11 ȕ-cell proliferation...... 13 Islet microvasculature ...... 14 Islet vasculature and blood perfusion ...... 14 Endothelial cells ...... 15 Pericytes...... 17 Lymphatic vessels...... 17 Angiogenesis ...... 17 Interactions between endothelial and endocrine cells in the pancreas .....19 Early fetal development...... 19 Late fetal development ...... 19 Interactions in adult tissues...... 20 Interactions after transplantation...... 20 Aims...... 22 Methods ...... 23 Animals...... 23 Fetal and newborn rats (Paper I)...... 23 Pregnant rats (Paper II)...... 23 Chemicals...... 24 In vivo protocols...... 24 3H-Thymidine treatment (I-II) ...... 24 Partial pancreatectomy (IV)...... 24 Islet isolation (II-IV)...... 24 Human islets (Paper IV) ...... 25 Islet transplantation (III-IV) ...... 25 Isolation of islet endothelial cells (II)...... 26 Oxygen tension measurements (III-IV) ...... 26 Blood flow measurements (III-IV) ...... 27 Measurements of blood parameters (III-IV)...... 27 Perfusion of graft bearing kidneys (IV)...... 27 Minimal islet mass model (III) ...... 28 Histological protocols ...... 28 Visualization of endothelial cells (I-IV) ...... 28 Insulin staining (I-IV)...... 29 Cell proliferation...... 29 Thrombospondin-1 staining (II) ...... 29 Double fluorescence staining for HGF and endothelium (II) ...... 30 Morphological evaluations...... 30 Islet endothelial, ȕ-cell and endocrine cell proliferation (I-II, IV) ...... 30 Islet mass and islet fraction (I-II)...... 31 Endocrine graft volume (III-IV) ...... 31 Islet vascular density (I-IV)...... 31 Tsp-1 expression in endocrine cells (II) ...... 32 Distance from endocrine cells to islet capillaries (I) ...... 32 In vitro studies...... 33 In vitro stimulation with ovine PRL (II-III)...... 33 Islet-conditioned medium (II)...... 33 Endothelium-conditioned medium (II) ...... 33 Islet incubation in conditioned medium (II) ...... 34 Semi-quantitative real time RT- PCR (III) ...... 34 Statistical analysis ...... 34 Results and Discussion ...... 36 Aim 1 – is physiological islet growth associated with endothelial cell replication?...... 36 Perinatal growth (I)...... 36 Growth during pregnancy (II)...... 37 Aim 2 – do native pancreatic islets become more pro-angiogenic when ȕ- cell growth is stimulated?...... 37 Aim 3 – can islet endothelial cells stimulate ȕ-cell growth and function through paracrine interactions? (II)...... 38 Aim 4 – does ȕ-cell growth result in improved revascularization and function of transplanted pancreatic islets? ...... 39 Endocrine graft volume (III-IV) ...... 39 Islet revascularization (III-IV)...... 40 Evaluation of graft function (III-IV)...... 41 Conclusions...... 43 Swedish summary ...... 44 Acknowledgements...... 46 References...... 48 Abbreviations

BS-1 Bandeiraea (Griffonia) simplicifolia BSA bovine serum albumin CM culture medium ECCM endothelium conditioned CM EcM endothelial cell culture medium FCS fetal calf serum FGF fibroblast growth factor HBSS Hanks’ balanced salt solution HGF hepatocyte growth factor ICCM islet conditioned CM IECCM islet and endothelium conditioned CM LI labeling index PRL prolactin PBS phosphate buffered saline TBS Tris-buffered saline tsp-1 thrombospondin-1 UE Ulex europaeus VEGF-A vascular endothelial growth factor-A

Introduction

Insulin, a hormone produced by E-cells in the pancreatic islets, is the key regulator of carbohydrate metabolism. Diabetes mellitus, characterized by hyperglycemia, ensues when an insufficient amount of insulin is produced. Type 1-diabetes results from an autoimmune destruction of the E-cells, and a total lack of insulin. Type 2-diabetes, on the other hand, is associated with an increased insulin resistance in the liver, skeletal muscles and adipose tissue. When the ȕ-cells cannot compensate for the increasing demand for insulin, type 2-diabetes develops.

Islet anatomy The pancreas is an organ which is essential both for digestion and regulation of metabolism. The exocrine tissue secretes digestive enzymes and bicar- bonate into the intestine. The endocrine cells, constituting 1-2% of the pancreas, are aggregated into the islets of Langerhans, where cell cords surround a dense microvascular network. These cell clusters produce several hormones that jointly participate in the regulation of metabolism (1).

Cellular composition of pancreatic islets The pancreatic islets are composed of several cell types. The endocrine cells comprise the majority of the cells and have so far attracted most attention. The endocrine cells are, however, crucially dependent on stromal cells for optimal function.

Endocrine cells E-cell The E-cells are the most prominent cell type in the pancreatic islets, and usually comprise 50-75% of all islet cells, depending on the species studied. In rodents they occupy the central regions of the islets and communicate with one another through gap junctions. They are polarized with their insulin-containing granula closely associated with capillaries (2). Thus, in view of their close association with capillaries they are uniquely adapted to rapidly respond to changes in nutrients in the blood by the release of insulin into

11 the circulation, thereby enabling them to continuously keep blood glucose concentrations within strict limits. In addition to insulin, the E-cells also contain other peptides although in smaller quantities, e.g. islet-like amyloid polypeptide (IAPP) and different chromogranins, all of which are secreted in conjunction with insulin. Their exact physiological roles have not yet been clarified.

Į-cells In rodents D-cells occupy a more peripheral position in the islets, but in e.g. humans the endocrine cells are more scattered throughout individual islets. They make up some 10% of the islet cells, and are preferentially found in the caudal regions of the gland. Their major secretory product is glucagon, which mainly affects the liver to stimulate glycogenolysis and gluconeo- genesis to increase blood glucose concentrations. In especially type 1 diabetes their secretion can be increased.

G-cells Also these cells are situated peripherally in rodent islets and usually constitute a few per cent of the islet cells. Their main product somatostatin has an inhibitory effect on both insulin and glucagon secretion, presumably mainly through paracrine interactions. These cells have a branched cytoplasm where their extensions communicate both with other endocrine cells, and capillaries (3).

PP-cells and H-cells PP-cells cells are dispersed throughout the exocrine and endocrine pancreas, especially in the caput region, and produce the hormone pancreatic polypeptide. This hormone is under strong vagal control and a likely function is to serve as a brake on exocrine pancreas secretions (4). The presence of a fifth endocrine islet cell, H-cells has recently been suggested. They secrete ghrelin, are rare and their functional role is as yet not clear (5, 6).

Nerves Neurons The pancreatic islets are richly innervated by the autonomic nervous system. Even neurons themselves can be found in some islets, constituting so called neuro-insular complexes (7). Sympathetic, parasympathetic and enteric neurons are found in the islets and influence the regulation of hormonal secretion. Parasympathetic nerves release mainly acetylcholine and vasoactive intestinal polypeptide in response to vagal stimulation. This stimulates both islet blood perfusion as well as insulin and glucagon secretion through ac- tions on M3 receptors. Noradrenaline, galanin and neuropeptide Y are re-

12 leased form sympathetic nerves and inhibit both basal and stimulated insulin secretion, mainly through Į1-adrenoceptors (8). Also a rich sensory innervetion of the islets, especially with neurons containing substance P and calcitonin-gene related polypeptide, occur. The roles of these neurons are more difficult to study, but it has been suggested that they exert a tonic inhibition on insulin secretion (8), as well as participating in islet blood flow regulation (9, 10).

Schwann cells Schwann cells are the supportive cells of the peripheral nervous system. The pancreatic islets have been suggested to be enveloped by Schwann cell pro- jections (11). It should be noted that peri-islet Schwann cells become activated following islet injury during autoimmune diabetes in non-obese diabetic (NOD) mice and after streptozotocin treatment (12). Autoimmune destruction of peri-islet Schwann cells also occurs early during islet autoim- munity in NOD mice (13). The role of these cells is normal islet physiology has not been fully elucidated and awaits further studies.

Resident immune cells Like other tissues also the islets normally contain both macrophages and dendritic cells. These cells are part of the immunologic surveillance of the body, and probably interfere little with normal islet function. During the development of insulitis preceding type 1 diabetes and after allogeneic transplantations they are key players (14)

ȕ-cell proliferation The regulation of islet ȕ-cell number is still incompletely understood, but it is a subject of crucial importance for understanding normal islet physiology, as well as the progression of diabetes (15, 16). The number of E-cells always reflects a balance between cell replication and cell death, and changes in any of these can influence the number of endocrine cells. Islet mass is relatively constant during adult life and the pancreatic ȕ-cells exhibit a very low degree of mitogenic activity. ȕ-cell proliferation can, however, be augmented in response to an increased demand for insulin, resulting from e.g. obesity, pregnancy or insulin resistance (16). Several substances are known to stimulate E-cell replication. Glucose is in itself is a very potent ȕ-cell mitogen that can induce a 50% increase in E-cell number within 24 hours (17). The gastrointestinal incretin hormone glucagon-like peptide-1 (GLP-1) exerts a multitude of beneficial effects on ȕ- cells, including increased proliferation and neogenesis, decreased apoptosis and improved ȕ-cell response to glucose (18, 19). Placental lactogens and prolactin (PRL) mediate the increased islet mass and ȕ-cell proliferation seen

13 during pregnancy (20-23), and is known to increases insulin secretion in vitro and in vivo (24, 25). The factors mentioned above are of major importance for the regulation of ȕ-cell mass in vivo. Several other growth factors have been reported to stimulate ȕ-cell proliferation (for a review see (26)). One ȕ-cell mitogen of interest in the context of this thesis is hepatocyte growth factor (HGF). Rat islets express both HGF and its receptor c-met (27), and HGF can stimulate ȕ-cell proliferation, insulin content, and to increase insulin release and islet mass in rodent tissues (28). Furthermore, transgenic mice expressing HGF under the insulin promoter have increased ȕ-cell proliferation and an increased ȕ-cell mass (29). Recently, two independent groups investigated the effects of ȕ-cell specific ablation of c-met expression (30, 31). They con- firmed that HGF has an important role in normal glucose homeostasis, at least in rodents.

Islet microvasculature Islet vasculature and blood perfusion The microvasculature of the islets has been described as glomerular-like, since its initial description by Paul Langerhans in 1869 (32). All mammals, i.e. also humans, have a direct and separate arteriolar flow to the islets. The islet vasculature is otherwise dependent on the size of the islets. Aggregates of a few endocrine cells are incorporated into the capillary system of the exocrine parenchyma. Otherwise, small islets receive their blood supply from 1 arteriole, and drain through numerous efferent capillaries into a bas- ket-like network around the islets, which subsequently drains into intralobular venules. According to some investigators (see (33)), these efferent capillaries communicate with those around exocrine acini and/or ducts, thereby forming a so called insulo-acinar portal system. Large islets, on the other hand, possess 1-3 arterioles, and the efferent capillaries drain into postcapil- lary venules at the edge of the islets, which then empty into intralobular veins. Previously it has been debated to what extent the above arrangements are species-dependent, and if all blood in the pancreas passes through the insulo-acinar network (33, 34). The microvasculature is of importance to provide oxygen and nutrients, allow for an accurate and continuous glucose sensing and disperse hormones to the systemic circulation. Thus, the capillary blood flow is essential for optimal islet function. In the pancreas, the islets have five to ten times higher blood perfusion than the surrounding exocrine tissue (35). Islet blood flow is regulated inde- pendently from that in the exocrine pancreas (36). A large number of substances have been shown to be of importance in this context, including lo-

14 cally produced substances such as nitric oxide, angiotensin II and endothelin (36, 37). The order in which islet endocrine cells become perfused is debated. One hypothesis is the so called “B-A-D hypothesis” that states that ȕ-cells are perfused first, followed by Į-cells and G-cells (33). This would provide an explanation for some of the known hormonal interactions within islets.

Endothelial cells Endothelial cells line all blood and lymphatic vessels of the body and form a continuous monolayer between the blood and the interstitial fluid. The typi- cal endothelial cell is elongated (approximately 30 µm long, 12 µm wide and 0.3 µm deep) and carries a negatively charged glycosaminoglycan layer on their surface. Endothelial cells have important functions in the regulation of tissue homeostasis. Thus, quiescent endothelial cells generate an antithrombotic and participate in the regulation of local blood flow through production of vasoactive substances. Endothelial cells have membrane-bound receptors for a multitude of molecules, including proteins (e.g. coagulant and anti-coagulant proteins, growth factors), lipid transporting particles (e.g. low density lipoprotein), paracrine substances (e.g. nitric oxide, serotonin) and hormones (e.g. endo- thelins, insulin) as well as adhesion molecules for cell-cell and cell-matrix interactions (38).

Endothelial cell heterogeneity The endothelial cell population is very heterogeneous. Endothelial cells from different species, small and large blood vessels and from different microvascular beds exhibit different phenotypes and can react very differently to the same stimuli (38). Heterogeneity can also be found in different vascular beds within the same organ. The kidneys contain discontinuous endothelial cells in the glomeruli, fenestrated endothelium in the peritubular region and continuous microvasculature in the other regions. The differences have been reported to be due to both genetic predisposi- tion and microenvironmental influences.

Differences in phenotype There are several phenotypically distinct endothelial cells in the body. Con- tinuous endothelium can be thick (>2µm thick) or thin (<1µm thick). The former phenotype can be found in cardiac muscle and bone, whereas thin continuous capillaries are seen in the dermis and brain. Discontinuous endothelium can be found in the liver, spleen and bone marrow. These gaps between the endothelial cells allow for cells to pass between the interstitium and the blood stream (39, 40).

15 A third form of microvessels is found in the kidney and the endocrine glands, namely the fenestrated endothelium. The endothelial cells have dia- phragm-covered pores, that allows for a high permeability for smaller molecules (39, 40).

Plasticity of endothelial cells in vitro Endothelial cells can be isolated and subsequently cultured in vitro. The phenotype of these cells is, however, unstable and likely to change when the cells are removed from their microenvironment. Isolated and cultured endothelial cells have been shown to loose tissue-specific characteristics, such as fenestrations (41, 42). The functional heterogeneity can, however, persist also during identical culture conditions. With few exceptions, the expression most endothelial cell-specific surface markers are unevenly distributed throughout the vascular system (39). The expression pattern is so diverse and so specific for different vascular beds that it has been used to target drugs to specific sites (43). Early studies showed that the endothelial cell marker von Willebrand factor (vWF) is more expressed in venous than arterial endothelial cells, and these differences are maintained when the endothelial cells are cultured (44). A later study examined endothelial cells derived from 14 different locations, but cultured under identical conditions for 10-16 generations. Microarray techniques revealed that these cells still exhibit differences in the expression of more than 3 000 genes (45). To what extent also protein expression is maintained is not known. Endothelial cell responsiveness to various stimuli is also dependent on the degree of confluence, e.g. confluent cultures have a decreased proliferative capacity (46) and a decreased responsiveness to VEGF (47).

Islet endothelial cells Functionally, pancreatic capillaries are very permeable (48), and particularly so those within the islets. Thus, the vasculature is unlikely to pose any re- strictions to the diffusion of the islet hormones. Islet capillaries are wider than those in the exocrine tissue (8-10 µm vs. 4- 6 µm. Islet endothelial cells are very thin (approximately 0.18 µm) and about 5% of their surface are constitutes fenestrations (49, 50), i.e. almost 10 times as many fenestrae as capillaries in the exocrine and ductular compartments (49). The transition in morphology is very abrupt, and microvessels located to the edge of the islets have four times as many fenestrations on the side facing the endocrine cells. It is likely that vascular endothelial growth factor (VEGF), locally produced within the islets, is responsible for the formation of these fenestrations (49, 51, 52).

16 Pericytes Pericytes are elongated multibranched cells that surround microvascular endothelial cells. They are embedded within the same basement membrane as the endothelium and have been shown to produce a multitude of matrix components (53). Different microvascular beds exhibit a great heterogeneity in pericyte coverage (53), and they are rare in pancreatic islets (54-56).

Lymphatic vessels The lymphatic system is composed of a network of capillaries that drain protein-rich lymph from the extracellular space. These capillaries lack a continuous basement membrane and are highly permeable. The lymph is returned to the systemic circulation through the larger lymphatic vessels. Lymphatic vessels can be found in the exocrine pancreas among the acini and along the ductal system. There are, however, marked species differences in their extent and distribution (57). We have previously found that the blood pressure in the islet microvasculature is very low, when compared to the exocrine pancreas (58). The capillary pressure and interstitial pressure is similar, which suggests that islet interstitial fluid is not drained though lymphatic vessels (59). In line with this, lymphatic vessels are not normally found in the pancreatic islets (57). Instead, the hormones diffuse into the blood stream where they are rapidly distributed throughout the body. Overexpression of VEGF-C, a stimulator of lymphangiogenesis, in the pancreatic islets results in a marked increase in the number of lymphatic vessels surrounding the islets. Interestingly, the lymphatic vessels still remain outside the islets (60). Similarly, after islet transplantation lymphatic capillaries are found in high numbers surrounding the implanted islets (61).

Angiogenesis The formation of new blood vessels is regulated through vasculogenesis or angiogenesis. Vasculogenesis is the formation of new blood vessels from angioblasts, mainly in embryos, while angiogenesis is the predominant way of blood vessel formation in the adult (62). Angiogenic sprouting from pre-existing vessels is not the only mechanism of blood vessel formation in the adult, but the one most extensively studied. It is a complex process and the regulation has been shown to be redundant and organ specific (63, 64). Nevertheless, some common features have been identified. Angiogenesis is initiated when the pro-angiogenic stimuli dominate over the anti-angiogenic. This process is usually referred to as the “angiogenic switch”. The first step is characterized by vasodilation and increased blood

17 vessel permeability. This is part of the destabilization process that is necessary for angiogenic sprouting. This process is regulated by growth factors (e.g. VEGF and angiopoietin 2) and proteinases (65). Blood vessel destabilization is followed by endothelial cell proliferation and migration. Endothe- lial cells migrate toward a gradient of chemotactic substances, mediated mainly through members of the VEGF-family. Angiopoietin 1 is chemotactic, but does not stimulate endothelial cell proliferation. Interactions with the extracellular matrix and negative regulation by various angiogenesis inhibitors (e.g. tsp-1 and -2, endostatin and angiostatin) are also important (62). Initially, endothelial cells form a network of solid cords that subsequently acquires a lumen. This process can be regulated by different isoforms of VEGF-A, angiopoietin 1 and various integrins. Tsp-1 is an endogenous inhibitor of lumen formation (65). Newly formed blood vessels are vulnerable and require survival signals to avoid regression. When blood vessel have been assembled, endothelial cells produce platelet-derived growth factor (PDGF), and isoforms of this factor, predominantly PDGF-BB, attract supportive mesenchymal cells. Upon contact with endothelial cells, transforming growth factor-ȕ and angiopoietin 1 stabilizes the blood vessel, and the mesenchymal cells differentiate into pericytes. This process stabilizes of the endothelial cells and downregulates VEGF receptor 2 (VEGFR2), after which the vessel can persist for years without survival factors (66).

Islet angiogenesis The pancreatic islets constitutively express several growth factors that are known to induce angiogenesis. These include VEGF-A, which is a potent endothelial cell mitogen chemoattractant and survival factor. Other known members of the VEGF-family, such as placental growth factor, VEGF-B, -C and -D are also expressed (67). Furthermore, islet endothelial cells express receptors for VEGF, namely VEGFR1, VEGFR2 and VEGFR3 (51, 68-70). Hepatocyte growth factor (HGF) and several isoforms of fibroblast growth factor (FGF) are also expressed in adult rodent islets (27, 67, 71). Of major importance in this context is VEGF-A, which is a very potent stimulator of endothelial cell proliferation and chemotaxis, and also increases endothelial permeability (72). VEGF-A is constitutively expressed in pancreatic islet ȕ-cells in human rat and mice (27, 50, 67). In line with this, animals lacking islet VEGF-A expression have continuous, instead of fenestrated, capillaries (52, 67). This indicates that locally expressed VEGF-A is necessary for the formation of fenestrations in islets, as has been shown previously in other tissues (56, 73). Islet endothelial cells remain quiescent in adult animals, despite the constitutive expression of angiogenic growth factors. Normally this is counter- acted by several negative regulators of angiogenesis, e.g. tissue inhibitor of

18 metalloproteinase 1 and 2 (74) and endostatin (75), to help to maintain islet vasculature quiescent. The large glycoprotein thrombospondin-1 (tsp-1) is of interest in this context. It is present in pancreatic islets (76, 77) and tsp-1 (-/-) mice have increased islet vascular density and develop islet hyperplasia (76). The anti- angiogenic effect is partially mediated by the CD36-receptor, but also through activation of latent TGF-ȕ1 (76). TGF-ȕ inhibits proliferation of both endothelial cells and ȕ-cells (78, 79) and is upregulated in islets postpartum, coinciding with the rapid involution of the islet at this time (80). Thus, the islets contain numerous factors which may either stimulate or inhibit angiogenesis, but normally, as in most organs in the body, the negative effects prevail, thereby preventing uncontrolled growth of the endothelial cells.

Interactions between endothelial and endocrine cells in the pancreas Recent studies have suggested multiple interactions between islet endothelial cells and ȕ-cells besides those involved in the regulation of blood perfusion and transport processes over the capillary wall, see below. Many of these studies show a close correlation between increased islet vascularization and islet mass (76, 81, 82), but if endocrine cell growth affects angogenesis, or whether growth of islet vasculature stimulates the endocrine cells to proliferate is more difficult to evaluate.

Early fetal development The microvasculature seems to play an important role for the organisation of the islets during early pancreatic development, since endothelial cells and pancreatic endoderm co-operate to induce the formation of insulin-producing cells (83). Indeed, the first insulin-positive cells are formed close to blood vessels (1, 83). It has been shown that overexpression of VEGF-A results not only in a hypervascularized pancreas, but also in hyperplasia of the pancreatic islet tissue per se (83).

Late fetal development The morphology and density of the vasculature in developing pancreatic islets vary during fetal life. After the initial formation of ȕ-cells close to endothelial cells, the vascular density of islets has been reported to be low during fetal development, e.g. in humans and Mongolian gerbils (1, 84). In humans, islets with low vascular density are found from the third month of

19 fetal development. Referred to as ‘Mantelinseln’ (i.e. mantle islets) they disappear gradually during the first postnatal year (1). In Mongolian gerbils, islet vascularization has been shown to occur almost exclusively after birth (84). The mechanism responsible for the perinatal increase in blood vessel density has recently been investigated. In transgenic animals it has been shown that when endocrine cell expression of VEGF-A in the islets is repressed, islet vascularization is perturbed, the endothelial cells become less fenestrated and the animals develop glucose intolerance (52, 67). This suggests an important role for mediators produced by the ȕ-cell in the formation of the vasculature in developing pancreatic islets.

Interactions in adult tissues The importance of endocrine-endothelial interactions in adult pancreatic islets can be illustrated by a recent article (51). In this study, adult mice were treated with different VEGF-neutralizing agents and the effects on different tissues were studied. Of the 17 tissues studied, the most profound effects were observed in the thyroid and in pancreatic islets. Neutralization of VEGF activity resulted in, not only a thickening of the endothelial cells and loss of fenestrations, but also a 45-70% decrease in islet blood vessel density (51). Thus, continuous secretion of VEGF throughout adult life seems to be necessary for maintaining the high islet blood vessel density. Interactions between endocrine cells and endothelial cells seem to be important also for ȕ-cell function. Two independent reports have shown that islet endothelial cell basement membrane stimulate insulin secretion (85, 86) and ȕ-cell proliferation (86).

Interactions after transplantation Revascularization of transplanted islets Since the introduction of the “Edmonton protocol” in 2000 (87), transplantation of pancreatic islets has become a treatment of choice for selected patients with type 1 diabetes. This protocol achieved a 1-year insulin- independence rate comparable to that for whole pancreas transplantation (88). However, in contrast to whole-organ transplantation (89, 90) there seems to be a continuous decline in function of islet transplants and very few patients remain insulin-independent beyond 4 years post-transplantation (91, 92). Since the histocompatibility barrier, the underlying autoimmune disease, and the immunosuppressive agents used are the same for both procedures, it is most likely that also issues related to the adaptation of the implanted islets to their new microenvironment play an important role in this context.

20 One difference between the two modes of transplantation is that whole- pancreas transplants have an intact endogenous vascular system, which is directly anastomosed to the recipient’s circulatory system, thereby achieving an immediate establishment of blood perfusion. The islets, on the other hand, become disconnected from their vascular supply when they are isolated by collagenase digestion prior to transplantation. Experimental studies have shown that transplanted islets stimulate an angiogenic response from the implantation organ (93), which is concluded within 7-14 days (94, 95). Soluble factors released from the hypoxic islets are likely to be of major importance in this context. The ingrowing blood vessels do, however, rarely enter the clusters of endocrine cells in the grafts, but remain located in the graft stroma (93). As a result of this, the transplanted islets have low oxygen levels (96). The blood vessels are presumably prevented from entering the islets by matrix-bound angiogenesis inhibitors, even though this notion remains to be proven. During the early phase after transplantation, activation of recipient endothelial cells can have detrimental effects on transplanted islets through production of inflammatory mediators (97-99). During the first days posttransplantation, substantial apoptosis and necrosis occurs in the transplanted islets, resulting in tissue remodelling and decreased insulin synthesis (100).

21 Aims

The general aim of the thesis was to investigate the hypothesis that ȕ-cell growth and angiogenesis is interconnected in the pancreatic islets. This hypothesis was investigated by investigating the following questions:

1. is physiological islet growth associated with endothelial cell replication?

2. do native pancreatic islets become more pro-angiogenic when ȕ- cell growth is stimulated?

3. can islet endothelial cells stimulate ȕ-cell growth and function through paracrine interactions?

4. does ȕ-cell growth result in improved revascularization and function of transplanted pancreatic islets?

22 Methods

Animals Male C57BL/6 and C57BL/6 (nu/nu) mice weighing approximately 25 g were purchased from Bomholtgaard Research and Breeding Center (Ry, Denmark). Adult inbred male Wistar-Furth rats and virgin or pregnant, Wis- tar rats were purchased from Scanbur AB (Sollentuna, Sweden). All animals had free access to tap water and pelleted food throughout the course of the study and were housed in a room with a 12-hr light/dark cycle, a humidity of 70%. All experiments were approved by the animal ethics committee at Uppsala University.

Fetal and newborn rats (Paper I) Fetuses of Wistar rats at day 20 of gestation (referred to as day -1) were investigated. Day 0 of pregnancy (gestational length 21-22 days) was defined as the day on which spermatozoa were found in the vaginal smear. In addition, some pregnant rats were allowed to give birth, after which the newborn rats were studied on days 2 or 7 postpartum, respectively. For pups studied at day -1 the mothers were injected through the tail vein with 3H-thymidine, whilst those studied day 2 or 7 after birth were injected i.p. with 3H- thymidine, and killed 2 h later. The pancreatic glands were then carefully dissected, weighed, and prepared for histological examination.

Pregnant rats (Paper II) Pregnant Wistar rats were investigated at days 5, 10, 15, 18, or 20 of gestation with 12-week-old virgin female rats serving as controls. In addition, some animals were allowed to give birth before being studied on days 2 or 7 postpartum. Blood glucose concentrations were measured at 8 A.M. on the day of the experiment. The pancreatic glands were carefully dissected and prepared for histological examination.

23 Chemicals All chemicals were purchased from Sigma-Aldrich (Irvine, UK) if nothing else is mentioned.

In vivo protocols 3H-Thymidine treatment (I-II) The animals were injected intravenously with approximately 100 µl of 3H- thymidine (0.5 µCi/g body weight; Amersham Biosciences, Little Chalfont, Buckinghamshire, UK) and killed 2 h later. The organs were then processed as outlined in detail below.

Partial pancreatectomy (IV) Wistar-Furth rats were anesthetized with sodium pentobarbital (Mebumal®; Apoteket, Göteborg, Sweden; 60 mg/kg i.p.), whereas athymic C57BL76 (nu/nu) were anesthetized with avertin (0.02 ml/g i.p. of a 2.5 % [vol/vol] solution of 10g 97% [vol/vol] 2,2,2-tribromoethanol in 10 ml 2-methyl-2- butanol (Kemila, Stockholm, Sweden)). The animals were then placed on a heated operating table to maintain body temperature at 38°C. The tail region of the pancreas was gently dissected with cotton tip applicators through a midline abdominal incision. All parts of the pancreas not attached to the stomach or duodenum, hereafter referred to as the splenic part of the gland, were then removed and the bleeding was controlled by diathermy. The detached splenic part of the pancreas has in our previous experiments been shown to constitute approximately 60% of the whole gland (101, 102). Sepa- rate animals were sham-operated. In this case, the splenic portion was mobi- lized, but otherwise not treated. Following partial pancreatectomy or sham- operation, the surgical wound in the abdominal wall was closed by sutures.

Islet isolation (II-IV) Pancreatic islets from male C57BL/6 mice or Wistar-Furth rats were isolated as previously described (103, 104). Groups of 100-150 islets were maintained free-floating in RPMI 1640 supplemented with 11.1 mmol/l D- glucose, 2 mmol/l L-glutamine and benzylpenicillin (100 U/ml; Roche Di- agnostics, Bromma, Sweden), streptomycin (0.1 mg/ml), and 10% vol/vol fetal calf serum (FCS) in 95% air/5%CO2 at 37°C; hereafter denoted as islet culture medium (CM). Culture medium was changed every 48h. In paper III, autotransplantations were performed using islets isolated from the extirpated splenic part of the pancreas of the partially pancreatec-

24 tomized Wistar-Furth rats. Other rats received syngeneic islets from control Wistar-Furth rats. In some additional control animals, the islets from the splenic and duodenal parts of the pancreas were isolated and transplanted separately.

Human islets (Paper IV) Human islets from 9 heart-beating donors (age 51±4 years, 4 males/5 fe- males) were isolated at the Human Islet Isolation Core Facility for the Nor- dic Countries located at the Department of Clinical Immunology, Uppsala University, Uppsala, Sweden, and kindly provided by Professor Olle Kors- gren. The ȕ-cell function in islet preparations were investigated prior to delivery by islet perifusion giving a mean glucose stimulation index of 11.1±1.6 (n=9) when changing from low (1.67 mmol/l) to high glucose concentration (16.7 mmol/l) in the perifusion medium. The human islets were kept in culture for 4-7 days in RPMI 1640 medium (Sigma-Aldrich) supplemented with 5.6 mmol/l D-glucose, 2 mmol/l L-glutamine (Sigma-Aldrich) and 10% (vol/vol) fetal calf serum prior to transplantation (105, 106). In order to avoid influence of variable exocrine contamination on the revascularization process (cf. (107), apparently clean islets were manually selected for transplantation. All experiments involving human islets were approved by the local human ethics committee for Uppsala University.

Islet transplantation (III-IV) Mouse islets (III) Groups of 250 C57BL/6 islets were packed in a braking pipette after 4-5 days of culture, and implanted beneath the left renal capsule, of syngeneic C57BL/6 mice anesthetized with an intraperitoneal injection of avertin . Some of the islets were treated with ovine PRL (oPRL; 500 ng/ml; ProSpec-Tany Technogene, Rehovot, Israel) added to the culture medium during the last 24 h before transplantation. Controls were cultured in normal culture medium with the corresponding volume saline. The transplanted animals in another group were injected intraperitoneally with oPRL (50 µg dissolved in 0.1 ml saline and 0.1% bovine serum albumin (BSA)) from the day before transplantation, until day 7 post- transplantation. Controls were injected with the corresponding volume saline. Weight matched non-transplanted controls were used for determination of oxygen tension and blood vessel density in endogenous islets.

25 Rat & human islets (IV) Groups of 250 Wistar-Furth islets, or 200 human islets, were packed in a braking pipette and implanted beneath the left renal capsule, of syngeneic pentobarbital-anesthetized Wistar-Furth rats or athymic avertin-anesthetized C57BL/6 (nu/nu) mice, respectively. Some of the islet recipients (rats) had been partially pancreatectomized or sham-operated (see above) 4 days before transplantation. In one experimental group, islets obtained from the extirpated splenic portion of the pancreas following partial pancreatectomy were autotransplanted into these rats. Some C57BL/6 mice were given an intravenous injection of alloxan (75 mg/kg; Sigma-Aldrich) 5 days before transplantation and were considered to be diabetic if their non-fasting blood glucose concentrations ex- ceeded 16.7 mmol/l at this time.

Isolation of islet endothelial cells (II) Outgrowth of islet stromal cells on a collagen matrix was stimulated using a modification of a previously described protocol (108). Briefly, 20 handpicked apparently clean islets were transferred onto a collagen matrix (1.8 mg collagen type 1/ml; Collagen GmbH, Nutacon, Leimuden, Netherlands) in each well in a 24-well culture dish. Islets were cultured at 37°C (air/CO2 95:5) in 1 ml CM but supplemented with 20% (vol/vol) fetal calf serum and 100 µg endothelial cell growth supplement; hereafter denoted as EcM. Vas- cular sprouts grew out from the islets and the islets were removed before expanding cells reached confluence. Cells were detached with 0.25% (wt/vol) trypsin (Gibco, Gaithersburg, MD, USA) for <5 min at 37ºC. The suspension was washed twice in CM. and the endothelial cells were extracted from the cell suspension by BS-1 coated Dynabeads as previously described (75, 109). After incubation, the BS-1-coated Dynabeads with bound endothelial cells were separated using the magnetic particle concentrator for 2 min. The cells were reseeded in collagen-coated plastic culture dishes in EcM. By the use of Bandeiraea (Grif- fonia) simplicifolia (BS-1) coated Dynabeads endothelial cells were separated from contaminating cells, and a purity of >90% was achieved; this characterization has been described in detail elsewhere (75).

Oxygen tension measurements (III-IV) Mice were anesthetized with avertin, and rats with thiobutabarbital (Inactin®; Research Biochemicals, Natick, MA; 120 mg/kg body weight i.p.), and subsequently placed on an operating table maintained at body temperature (38°C), and tracheostomized. Polyethylene catheters were inserted into the right carotid artery and left jugular vein. The former catheter was connected

26 to a Statham P23dB pressure transducer (Statham Laboratories, Los Angeles, CA, USA) to monitor mean arterial blood pressure, whereas the latter catheter was used for continuous infusion of Ringer solution (5 ml/kg-1·h-1) to substitute for loss of body fluids. A left subcostal flank incision was performed, and the graft-bearing left kidney was immobilized in a plastic cup. Oxygen tension was measured in the islet graft and adjacent renal parenchyma with modified Clark microelec- trodes (Unisense, Arhus, Denmark) as previously described (110, 111). The electrodes (outer tip diameter, 2–6 µm) were inserted into the tissues by the use of a micromanipulator under a stereo microscope. At least 10 measurements were performed in both the islet graft and the renal cortex. For oxygen tension measurements in endogenous pancreatic islets, the pancreas was exposed and immobilized, and its islets were visualized in a similar manner (58, 112). Measurements of oxygen tension were performed in three or more superficial pancreatic islets and in the surrounding exocrine parenchyma of each animal.

Blood flow measurements (III-IV) The blood perfusion of the islet graft and the adjacent renal cortex was measured by laser-Doppler flowmetry (PF 4001-2, Perimed, Stockholm, Sweden) with a needle probe (411 mm tip; outer diameter, 0.45 mm; Pe- rimed) as previously described (112). Mice were anesthetized with avertin and rats with thiobutabarbital. The flow probe was positioned perpendicular to the immobilized tissue surface by the use of a micromanipulator, and care was taken to avoid compression of the tissue. Because it is difficult to cali- brate the instrument in physical units of blood flow, all such values are given as arbitrary tissue perfusion units. The blood perfusion of endogenous islets cannot be determined by laser-Doppler flowmetry due to their small size.

Measurements of blood parameters (III-IV) Blood glucose concentrations were determined with test reagent strips (Medisense, Baxter Travenol, Deerfield, IL, USA) from samples obtained from the cut tip of the tail. A blood sample was collected after performing the blood flow and oxygen tension measurements, and analyzed for hematocrit and blood gases. pH less than 7.30, pO2 less than 10 kPa, pCO2 more than 6.8 kPa, or hematocrit less than 40 were used as preset exclusion criteria from the study.

Perfusion of graft bearing kidneys (IV) Grafts from transplanted Wistar-Furth rats were investigated one month post-transplantation for glucose- and arginine-stimulated insulin secretion

27 using a perfusion protocol previously described in mice (113, 114). At different times during the perfusion, the medium contained 2.8 or 16.7 mmol/l D-glucose or 5.6 mmol/l D-glucose + 10 mmol/l L-arginine. Medium was administered at a rate of 3 ml/min without recycling for 60 min with a perfusion pressure of approximately 40 mmHg. The perfusion experiments started with a 15-min period using medium containing 2.8 mmol/l glucose, followed by 20 min using 16.7 mmol/l glucose and 15 min using 2.8 mmol/l glucose. Then medium containing 5.6 mmol/l glucose and 10 mmol/l arginine was given for 10 min, before the perfusions were concluded by a 15-min perfusion with medium containing 2.8 mmol/l glucose. A 3.0 ml sample of the effluent medium was collected and the insulin concentrations of the samples were measured by ELISA (Mercodia, Uppsala, Sweden). The rate of insulin secretion was calculated by multiplying the insulin concentration in the sample by the flow rate, giving values of insulin expressed as ng/min. The area under the curve (AUC) was then determined from these values.

Minimal islet mass model (III) Alloxan-diabetic C57BL/6 mice were used as recipients. The number of transplanted islets (200) was chosen on the basis of our previous studies in this strain, e.g. (115, 116), and aimed to implant an islet mass insufficient for full reversal of hyperglycemia in most of the diabetic recipients. Cure from diabetes was defined as non-fasting blood glucose concentrations lower than 11.1 mmol/l. The graft-bearing kidneys were removed on all cured animals 1 month post-transplantation to ascertain that they would subsequently become hyperglycemic (blood glucose >16.7 mmol/l).

Histological protocols All samples, i.e. pancreas, islet grafts, isolated endothelial cells, were fixed in 10% (vol/vol) formaldehyde, dehydrated and embedded in paraffin before further processing. Sections, 5 µm thick and randomly chosen from all parts of the samples, were prepared, mounted on poly-L-lysine glass slides and stained for vascular endothelium, insulin, tsp-1 and HGF.

Visualization of endothelial cells (I-IV) Blood vessel endothelium was visualized with the lectins Bandeiraea (Grif- fonia) simplicifolia (BS-1) or Ulex europaeus (UE), as described in detail previously (117). The slides were counterstained with hematoxylin. Positive control slides comprised paraffin-embedded rat intestine for BS-1 and paraffin-embedded human intestine for UE. We have previously shown that BS-1

28 produces consistent staining of all blood vessels in rat, mouse and human islets, whereas UE only stains blood vessels of human origin (110, 117). As an additional control of endothelial cell purity (II), samples of endothelial cells were trypsinized, spun onto poly-L-lysine glass slides, fixed in 4% (vol/vol) paraformaldehyde for 2 h and subsequently dehydrated. The slides were stained to detect endothelium with a monoclonal rat anti-CD31 antibody (clone MEC7.46; HyCult Biotechnology., Uden, The Netherlands), using EnVision+ System (Dako, Glostrup, Denmark). Antigen retrieval was performed by boiling for 20 min with Target Retrieval Solution (pH 9.0; Dako) in a microwave oven (750 W).The slides were counterstained with hematoxylin.

Insulin staining (I-IV) Islet ȕ-cells were stained with a monoclonal guinea-pig anti-insulin antibody (ICN Biomedicals, Aurora, OH, USA), as previously described in detail (117). These slides were then used, as outlined below, to autoradiographi- cally estimate islet endothelial and ȕ-cell proliferation as well as to measure islet vascular density and pancreatic islet volume.

Cell proliferation Autoradiography (I-II) Wet slides with sections from the pancreas stained with either BS-1 or for insulin were dipped in 50% film-emulsion (Autoradiography emulsion, Kodak, Rochester, NY, USA), in 0.75 mmol/l ammonium-acetate, and kept in a light-proof chamber to dry overnight. The films were then exposed for 3 weeks at 4°C, before being developed, fixed and counterstained with hematoxylin.

Ki67 staining (IV) Consecutive sections (5 µm) of graft-bearing kidneys from partially pancreatectomized or sham-operated recipients were stained for the cell proliferation marker Ki 67 according to the manufacturer’s instructions (Lab Vision Corporation, Fremont, CA, USA) after antigen retrieval The slides were fi- nally developed with 3,3´-diaminobenzidinetetrahydrochloride (DAB).

Thrombospondin-1 staining (II) The slides were incubated for 10 min with 8% (wt/vol) hydrogen peroxide in tris-buffered saline (TBS), and washed. Antigen retrieval was performed by boiling with citrate buffer (Lab Vision) in a microwave oven (750 W) for 20 min. The sections were washed in TBS and thereafter incubated with normal

29 rabbit serum (Dakopatts, Glostrup, Denmark) diluted 1:20 with TBS containing 0.1% (wt/vol) bovine serum albumin (ICN Biomedicals) for 1 h. Primary antibodies against tsp-1 (A6.1; Lab Vision), diluted 1:50 in TBS, were applied to the slides overnight at 4ºC. The slides were washed (TBS; 3 X 5 min) and incubated for 30 min with a secondary rabbit anti-mouse antibody (Dakopatts) diluted 1:100 in TBS. The slides were then washed again. Mouse peroxidase anti-peroxidase antibody (Dakopatts), diluted 1:100 in TBS, was applied to the slides for 30 min. The slides were washed and developed with DAB for approximately 8 min before being counterstained with hematoxylin. Negative control slides were incubated with normal rabbit serum instead of primary antibodies.

Double fluorescence staining for HGF and endothelium (II) Deparaffinized slides were incubated with neuroaminidase type X in TBS for 2 hours at 37ºC. The sections were washed in TBS and thereafter incubated with normal goat serum (Dakopatts) diluted 1:20 with TBS containing 0.1% (wt/vol) BSA for 1 h. Primary antibodies against HGF (1:20; clone Hyp- T6942; Institute of Immunology, Tokyo, Jopan) and Fluorescein isothiocy- anate-labeled BS-1 (1:5) diluted in TBS, were applied to the slides over night at 4ºC. The slides were washed (TBS; 3 X 5 min) and incubated for 1 h with a secondary Texas Red conjugated goat anti-rabbit antibody (clone: 111-075-144; Jackson Immunoresearch, West Grove, PA, USA) diluted 1:50 in TBS. The slides were then washed again and mounted with a mounting medium containing 4',6-Diamidino-2-phenylindole (Vectashield + DAPI; Vector Laboratories, Burlingame, CA, USA).

Morphological evaluations Islet endothelial, ȕ-cell and endocrine cell proliferation (I-II, IV) Tissue sections were evaluated in a light microscope (400X) by an observer unaware of the origin of the samples. All investigated islets were digitally photographed and stored as computer files. Cells with 10 black silver grains over their nuclei were considered to be in the S-phase of the cell cycle (118). Background thymidine incorporation was, in general, less than 3 grains/nucleus. The fraction of endothelial cells, insulin-positive and other endocrine cells with 3H-thymidine incorporation in their nuclei was counted. In Paper II, 44±2.4 islets, corresponding to 3370±223 ȕ-cells, (n=53) were counted in each pancreas, as determined by using a computerized system for morphometry (Scion Image, Scion Incorporation, MD, USA).

30 In order to determine whether the proliferation of endothelial cells was associated with endocrine cell replication we performed a linear regression analysis of the labelling index (LI) of endocrine and endothelial cells for each animal. We also wanted to investigate whether endocrine LI was higher in islets where 3H-thymidine labelled endothelial cell nuclei were found. To achieve this, we divided the islets from each animal into two groups. The first group contained islets where at least one labelled endothelial cell nucleus was identified in the sections, while islets without detectable endothelial cell proliferation were referred to the second group. The means for the LI of endocrine cells in the two groups were calculated for each animal and considered as one observation in the subsequent statistical analysis.

Islet mass and islet fraction (I-II) Total islet volume was measured by a direct point-counting technique (119) at a magnification of 200X. In Paper I, a total of 10 different fields were viewed in each pancreas (corresponding to ~1200 points). The islet mass was estimated by multiplying the pancreatic weight with the islet volume fraction of the whole pancreas assuming similar densities of the tissues. Indeed, the densities of the exocrine and endocrine pancreas differ by less than 1% (120). In paper I, the fetal pancreata were not weighed and therefore islet mass was not possible to estimate. The volume fraction of islets in the pancreas was estimated by the direct point-counting technique in the same histological sections. The number of intersections overlapping islets was counted in a light microscope (200X). A total of 10 different fields were counted in each pancreas (corresponding to 1023 ± 14 points; n=5-6 animals in each group).

Endocrine graft volume (III-IV) Tissue sections of the islet grafts were stained according to van Gieson. The total graft volumes and the fractions constituting endocrine cells were estimated from these sections by using a computerized system for morphometry (Scion Image). In order to estimate the transplanted islet volume, the area of 250 cultured islets was measured by computerized morphometry (ScionI- mage). The islets were not aggregated, but measured singly.

Islet vascular density (I-IV) The blood vessel density in the pancreatic islets was determined by a direct point-counting method on the histological sections stained with BS-1 at a magnification of 400X (119). In paper I, 20 islets (corresponding to 624 ± 23 intersections) were evaluated in each animal. In paper II, 657±25 intersections were evaluated in each pancreas (n=5-7 animals in each group).

31 In paper IV, tissue sections stained for BS-1 from all parts of the rat and human pancreata, or rat or human islet transplants, were chosen for the evaluation of islet vascular density. Separate tissue sections of the human islets transplants were stained for UE and used to estimate the proportion of new blood vessels in the islets derived from the donor. The rationale for this is that if all new blood vessels were derived from the host (mouse), all blood vessels in the human islet grafts would be UE-negative. Vice versa, if all new blood vessels arose through the expansion of the remnant donor endothelium, the number of blood vessels quantified following BS-1 and UE staining would be expected to be similar. We have previously observed that the estimated vascular density of endogenous human islets is identical following quantification of BS-1 and UE-positive blood vessels (110). The blood vessel density in pancreatic islets (both endocrine tissue and stroma, respectively) was determined by a direct point-counting method at a magnification of 400X (119). A total of 5 sections, corresponding to approximately 600 intersection points were counted in each transplant or pancreas. The total graft volumes and the fractions constituting endocrine cells in the grafts were estimated using a computerized system for morphometry as given above (Scion Image).

Tsp-1 expression in endocrine cells (II) Tsp-1 stained sections were examined in a blinded fashion in a light microscope at a magnification of 400X. The presence of tsp-1 staining was ranked by a dichotomic arbitrary scale: 0 indicated islets with very weak or uniden- tifiable tsp-1 staining in the cytoplasm of endocrine cells, whereas + denoted clearly tsp-1 positive islets. Tsp-1 positive islets exhibited a uniform cyto- plasmic staining pattern in endocrine cells. A total of 29.2±2.5 islets were examined in each animal (n = 3-7 in each group).

Distance from endocrine cells to islet capillaries (I) BS-1 stained pancreatic slides from day 2 postpartum were evaluated. The distance from the centre of endocrine cell nuclei to the closest intra-islet capillary was measured. This distance was determined for every nucleus in the islet sections and the cells were divided into two groups, depending on whether they had incorporated 3H-thymidine or not. A total of 47.8 ± 13 thymidine incorporated and 344 ± 100 non-incorporated endocrine nuclei were evaluated per animal (n=4-5 in each group).

32 In vitro studies In vitro stimulation with ovine PRL (II-III) Duplicate groups of 20 freshly isolated islets from adult animals were transferred to a 24-well plate with 1 ml CM per well (Ø 16 mm). Recombinant ovine prolactin (oPRL; 250-500 ng/ml; ProSpec-Tany Technogene, Rehovot, Israel) was added to some of the wells. Control wells only contained CM and islets. Control wells only contained CM and islets. The medium was removed and frozen after 24 h of culture. The VEGF-A contents in the medium were determined with ELISA (R&D Systems, Minneapolis, MN, USA) according to the manufacturer’s instructions.

Islet-conditioned medium (II) Islets were isolated, handpicked and cultured in groups of 150 islets in 5 ml CM for 4 days as given above to minimize contamination of exocrine tissue and passenger leukocytes. Groups of 150 islets were thereafter cultured in 5 ml fresh CM for 24 h. The medium was then centrifuged for 2 min at 2 000 rpm to remove cells. The supernatant was collected and is hereafter denoted ICCM.

Endothelium-conditioned medium (II) Dynabead-purified endothelial cells were cultured for 4 days in EcM as given above. At this time-point the endothelial cells were in exponential growth, but had not reached confluence. The wells were washed with CM to remove all EcM. Fresh CM was then added to some of the wells with endothelial cells, whereas ICCM was added to others. Additional wells without endothelial cells were used as controls. Some of the wells containing endothelial cells exposed to ICCM were supplemented with neutralizing VEGF-A antibody (1 µg/ml; NeoMarkers, Fremont, CA, USA) or neutralizing HGF antibody (1 µg/ml; R&D Systems), whereas some of the wells containing endothelial cells exposed to CM were supplemented with recombinant rat VEGF-164 (3-40 ng/ml; R&D Systems). After 12 h the medium was collected after centrifugation for 2 min at 2 000 rpm to remove the cells. The samples were used either for analysis of HGF concentration (Enzyme Im- munoassay; Institute of Immunology, Tokyo, Japan) according to the manufacturer’s instructions, or for the incubation experiments described below. Culture medium obtained from wells with endothelial cells+CM and endothelial cells+ICCM, without addition of VEGF or VEGF antibody, was denoted endothelium conditioned medium (ECCM) and endothelium conditioned ICCM (IECCM), respectively.

33 Islet incubation in conditioned medium (II) A total of 1 ml CM, ECCM or IECCM was put into wells in 24-well plates. Neutralizing goat anti HGF-antibody (1 µg/ml; R&D Systems) or rabbit anti- mouse antibody as a control antibody (1 µg/ml; Dakopatts) were added to wells with ECCM or IECCM. Thereafter, 20 islets cultured for 5 days in CM were placed in each well. After 6 h of exposure to a conditioned medium, 3H-thymidine (10 µCi/ml) was added for an additional 60 min. The islets were then washed repeatedly in ice-cold PBS, fixed in 4% (vol/vol) paraformaldehyde for 2 h and subsequently dehydrated in alcohol. The islets were embedded in paraffin, sectioned and stained for insulin. The ȕ-cell proliferation rate was then determined by autoradiography as described above.

Semi-quantitative real time RT- PCR (III) The effect of oPRL on tsp-1 levels was analyzed by semi-quantitative realtime RT-PCR. A total of 200 islets from male C57BL/6 mice were handpicked and cultured for 4 days, as described above. During the last 24 h, half of the islets were incubated with oPRL, as described above, whereas the remaining half served as untreated controls. Total RNA was extracted using Ultraspec® (Biotecx Laboratories, Houston, TX, USA), and first strand cDNA was synthesized as previously described (121). PCR reactions were carried out with the Lightcycler realtime PCR instrument (Roche Molecular Biochemical, Mannheim, Germany), using the DyNAmo SYBR Green q PCR kit (Finnzymes, Espoo, Finland). The primers used for amplification were: tsp-1 forward: 5ƍ- GGAACGGAAAGACAACACTG, tsp-1 reverse: 5ƍ- AGTTGAGCCCGGTCCTCTTG, beta-actin forward: 5ƍ- GCTCTGGCTCCTAGCACC, beta-actin reverse: 5ƍ- CCACCGATCCACACAGAGTACTTG. VEGF-A forward: 5ƍ- ACTTGCAGATGTGACAAGCC VEGF-A reverse: 5ƍ- GTGGTGACATGGTTAATCGG Samples were run in duplicates. Tsp-1 mRNA levels were normalized against beta-actin mRNA expression and given as a fraction of the value obtained in islets cultured for 4 days under normal islet culture conditions.

Statistical analysis All values are given as means±SEM. All statistical comparisons were made with SigmaStat® (SPSS Science Software, Erfart, Germany). Comparisons between two groups were performed with Student’s unpaired t-test. Multiple comparisons of parametric values with control values were performed by ANOVA with Dunnett’s post-hoc test. Multiple comparisons of non-

34 parametric values (such as fractions) were performed by non-parametric ANOVA and Dunn’s post-hoc test. For comparisons of morphology score, or when only two groups were compared, Wilcoxon signed rank test was used. Coefficients of correlation were obtained by simple linear regression followed by evaluation of statistical significances of correlation by ANOVA. For all comparisons, a probability of chance differences <0.05 was considered to be statistically significant.

35 Results and Discussion

Aim 1 – is physiological islet growth associated with endothelial cell replication? To address this question we studied perinatal (I) and pregnancy-induced (II) growth of the endocrine pancreas, both of which are limited in time and morphologically well characterized (21, 122-124).

Perinatal growth (I) The ȕ-cell labelling index was much higher perinatally than in adult animals, with a maximal value being observed on day 2 postpartum. Insulin-positive cells were also more frequently found in fetal ductal epithelium than in adult rats, suggesting that E-cell neogenesis also occurred. These findings are in line with previous studies showing that postnatal islet growth reflects a balance between endocrine cell proliferation, neogenesis and apoptosis (80, 125, 126). The fraction of the pancreas comprising islets was also higher in all perinatal animals when compared to adult rats, which also confirms previous findings (127). Islet vascular density the day before birth was only 40% of that seen in adult animals. Furthermore, most of the blood vessels were found in the pe- riphery of the islets, whereas the central insulin-positive islet core contained much fewer capillaries. The low vascular density may reflect the fact that fetal islets do not need to monitor blood glucose levels, nor deliver insulin rapidly to the systemic circulation to the same degree as in adults (128). Microvascular density increased by 50% from the day before birth to the second postnatal day and reached adult levels at day 7 postpartum. The pro- liferating endocrine cells were closer to islet capillaries than quiescent cells. One explanation for this may be that these endocrine cells are exposed to higher concentrations of nutrients, oxygen and growth factors and therefore will be more prone to proliferate. This does not exclude the possibility that growth factors are produced locally by stromal or endothelial cells as well. Recently, the endothelial cell basement membrane has been found to be a niche that is beneficial for ȕ-cell proliferation (86). The endothelial cells may also directly stimulate proliferation through production of substances directly stimulating ȕ-cell replication. One such candidate is HGF, which is a potent mitogen for both ȕ-cells and endothelial cells, and is released from

36 fetal pancreatic fibroblasts (129-131) and from islet capillary cells during pregnancy (Paper II). It may be that before birth, the high local HGF- production by fibroblasts dominate over that produced by endothelial cells, whereas the latter becomes more important later in life.

Growth during pregnancy (II) Both islet ȕ-cell and total endocrine cell proliferation were significantly increased at day 15 of pregnancy. At all other time points, ȕ-cell LI was similar to control animals. This confirms results from previous studies (21, 123). In parallel to increased cell proliferation, there was an increased islet mass at day 15 of pregnancy, which then normalized during late pregnancy and the early lactation period. Islet endothelial cell proliferation rates, on the other hand, were increased at days 10, 15, 18 and 20 of pregnancy when compared to that of virgin rats, but returned to normal immediately after delivery. Endothelial cell proliferation was associated with an increased blood vessel density at days 15 and 18 of pregnancy. Total endothelial cell LI correlated to the degree of endocrine cell LI when individual animals were compared. Furthermore, when individual islets were investigated we found that islets with established endothelial cell proliferation had a higher endocrine cell proliferation than other islets.

In conclusion, physiological growth of the pancreatic islets seems to be associated with an increased endothelial cell replication, at least after birth. During pregnancy, ȕ-cell replication preferentially occurs in islets with ac- tive replication of endothelial cells.

Aim 2 – do native pancreatic islets become more pro- angiogenic when ȕ-cell growth is stimulated? In order to address this question, we studied expression of growth factors with angiogenic activity during physiological growth and after stimulation with PRL in vitro (II-III). We focussed our interest on tsp-1, a potent angiogenesis inhibitor, which has been reported to be expressed in pancreatic islets (76, 77). The islet vascular density increases when tsp-1 is deleted (76), which suggests a role for tsp-1 as an important negative regulator of islet angiogenesis. In line with this, we found that approximately 90% of the islets in virgin rats were tsp-1 positive. The tsp-1 staining was restricted to the cytoplasm of endocrine and endothelial cells. The fraction of tsp-1 positive islets tran- siently decreased to between 40 and 55% at days 10 and 15 of pregnancy,

37 coinciding with the increase in endothelial and E-cell proliferation. It should be noted that the endothelial cell LI remained high at day 18 and 20 of pregnancy, that is, at a time point when the fraction of tsp-1 positive islets had increased again. Tsp-1 expression alone does, therefore, not seem to be enough to prevent endothelial cell proliferation. It should, however, be noted that blood vessel mass did not increase at day 18 and 20 of pregnancy.Tsp-1 induces apoptosis in activated endothelial cells (132) and one possible explanation is that tsp-1 counteracts endothelial cell replication during late pregnancy to prepare for the post-partum involution of the islets. The majority of the effects on islets caused by pregnancy, including ȕ-cell proliferation, has been shown to be mediated by PRL (24, 133). Therefore, we aimed to further investigate the effects of PRL on islets. Addition of ovine PRL to CM increased ȕ-cell proliferation in rat islets in vitro approximately 2.5-fold, confirming previous reports (133). Incubation of rat islets for 24 h with oPRL increased the VEGF-A release to the culture medium with approximately 50%. Confirmatory results were obtained in mouse islets, where PRL increased VEGF-A mRNA expression by approximately 35%. PRL-induced VEGF-A production has previously been reported in mammary glands and macrophages (134, 135). PRL treatment also decreased islet tsp-1 mRNA expression by 40% in mouse islets.

In conclusion, the findings suggest that PRL may contribute to an angiogenic switch in islets, favoring endothelial cell replication and, as a consequence of this, E-cell growth.

Aim 3 – can islet endothelial cells stimulate ȕ-cell growth and function through paracrine interactions? (II) In preliminary experiments, we found that co-culture of islets and islet- derived endothelial cells induced ȕ-cell proliferation (data not shown). In order to elucidate the mechanisms behind this, we exposed E-cells to conditioned culture media in different combinations. Fresh culture medium, culture medium conditioned with islets or culture medium conditioned with endothelial cells did not induce ȕ-cell proliferation. However, when the culture medium was first conditioned with islets and after that conditioned with endothelial cells, ȕ-cell proliferation increased. HGF was shown to be present in the latter medium in higher concentrations than in the others, and the mitogenic response decreased when a neutralizing HGF antibody was added. The next goal was to try to determine the islet-derived stimulus responsible for the induction of HGF expression. HGF expression in liver endothelial cells has previously been shown to be VEGF-dependent (136). In line with this, we could inhibit the expression of HGF by addition of a VEGF-

38 neutralizing antibody to the islet conditioned culture medium. However, addition of VEGF-A alone to the islet-derived endothelial cells did not induce HGF expression, but we found that a combination of insulin and VEGF-A could induce HGF expression in islet derived endothelial cells. We developed a fluorescence staining to evaluate whether endothelial cells expressed HGF during pregnancy. We found a co-localization of HGF and our endothelial cell marker BS-1 in a subpopulation of islets at day 15 of pregnancy. This opens the possibility that endothelium-derived HGF stimulates ȕ-cells through paracrine effects during growth. In virgin rats, such a co-localization was very rare (data not shown).

In conclusion, islet derived endothelial cells can be stimulated to secrete the ȕ-cell mitogen HGF after combined stimulation with insulin and VEGF-A.

Aim 4 – does ȕ-cell growth result in improved revascularization and function of transplanted pancreatic islets? During culture, the endothelial cells dedifferentiate and disappear rapidly from the pancreatic islets (137). This means that islets need to stimulate ingrowth of new endothelial cells and microvessels to ascertain an adequate blood perfusion. Alternatively, dedifferentiated intra-islet endothelial cells may be stimulated to participate in angiogenesis. The interventions chosen to evaluate if E-cell growth per se affects islet grafts, namely partial pancreatectomy and PRL treatment, have previously been shown to be associated with islet growth (21, 133, 138, 139). We also used syngeneic, normoglycemic recipients in order to isolate the effects of the intervention from those evoked by changed carbohydrate metabolism and rejection.

Endocrine graft volume (III-IV) The endocrine volumes of one-month-old grafts were increased by approximately 50% in the transplants preincubated with PRL, and almost doubled when the animals were injected with PRL. In the latter group it was actually similar to the estimated transplanted endocrine volume. Thus, the usual decline in graft volume seen post-transplantation could to a large extent be prevented by PRL. At present it is unclear if this reflects a decreased death of E-cells after implantation or an increased replication. PRL has also been reported to have immunomodulatory effects and these may also contribute to the favorable effects on endocrine graft volume, by affecting to non-specific inflammatory response seen after islet implantation (140, 141).

39 The endocrine volume of one-month-old grafts was higher also in rats that were pancreatectomized before transplantation when compared to control recipients receiving syngeneic rat islets, with or without previous sham- surgery. A difference in graft volume was found already at day 5 after transplantation, indicating that the beneficial effects of pancreatectomy occur during the first days after transplantation. The ȕ-cell proliferation in two- and five-day-old grafts were paradoxically decreased in partially pancreatectomized compared to sham-operated rat recipients. The increased endocrine mass in grafts in partially pancreatectomized recipients can therefore not be explained by growth induced by signals from the surgically manipulated pancreas. A better vascular support is an alternative reason for the increased islet cell survival. Our current findings are not supported by a previous study that reported increased ȕ-cell replication in islets transplanted to a pancreatectomized recipient (142). The main difference between the two studies is that we used a model of partial pancreatectomy where the pancreatectomized control group remained normoglycemic at all time-points. This is in contrast to the work by Montaña and co-workers, who used a model of 95% pancreatectomy where the pancreatectomized control group became hyperglycemic (142). We believe that the differences in ȕ-cell replications can be explained by the different meta- bolic demand in the two models.

Islet revascularization (III-IV) In paper III, the oxygen tension was shown to be approximately 30 mmHg in endogenous mouse pancreatic islets, but less than 10 mmHg in one-month- old syngeneic control transplants. However, there was a threefold increase in oxygen tension in the transplanted islets derived from pretreated with PRL. In paper IV, the oxygen tension of native rat islets was found to be 40-45 mmHg, but only 4-7 mmHg in one-month-old syngeneic control rat islet transplants. However, the oxygen tension in the islet transplants was increased three- to fourfold in autotransplanted recipients. Partially pancreatectomized recipients of syngenic islets had a graft oxygen tension similar to that of autotransplanted recipients, whereas sham-operated recipients of syngeneic islets had low graft oxygen tension values. Furthermore, when human islets were implanted to partially pancreatectomized C57BL/6 (nu/nu) mice, the graft oxygen tension was markedly increased, as compared to sham- operated controls. Thus, the improved oxygen tension seemed to be directly related to the pancreatectomy procedure. In line with the findings on graft oxygen tension, also the blood perfusion of one-month-old mouse islet grafts was increased by approximately 40% when PRL was used and by approximately 60% when rats were pancreatectomized before islet transplantation.

40 Blood vessels constituted approximately 11% of the volume in endogenous mouse islets and 12% in endogenous rat islets, but only 5-6% in one- month-old syngeneic control transplants in both species. The vascular density in transplanted islets of PRL-treated mice was increased by approximately 50% when compared to their respective controls. The graft vascular density after partially pancreatectomized in rats was, however, completely restored one month post-transplantation, and was thus markedly higher than in the control grafts. Sham-operated rats receiving syngeneic islets had values similar to those of control animals. Approximately 8% of the islet volume in endogenous human islets was blood vessels, and this was similar when evaluated as BS-1 or UE positive structures. In contrast, blood vessels only constituted 4-5% of human islet transplants in sham-operated recipients. However, human islets implanted into partially pancreatectomized recipients had a vascular density similar to that of native islets. This increase was due to a combination of increased ingrowth of recipient blood vessels and an expansion of donor endothelial cells. This notion is supported by previous experimental studies (137, 143). Thus it has been demonstrated that, in addition to inducing an increased graft volume, PRL treatment and partial pancreatectomy in the recipient also stimulates the revascularization, blood perfusion and oxygen tension in transplanted islets. The mechanism for this improvement caused by PRL is likely to reflect the stimulation og VEGF-A and HGF refferd to above. How partial pancreatectomy exerts its effects remains more elusive, but the procedure has been shown to increase the systemic concentration of VEGF (144), which may stimulate islet angiogenesis (52, 67, 145). Alternatively VEGF can mobilize endothelial progenitor cells from the bone marrow (146), which has previously been shown to increase revascularization of transplanted pancreatic islets (147). However, further studies are warranted to clarify this issue.

Evaluation of graft function (III-IV) To investigate to what extent the improved graft volume and revascularization affected also transplant function we performed additional experiments encompassing a minimal islet mass model and perfusions of graft-bearing kidneys. We found in the former model that all alloxan-diabetic animals that were transplanted with islets preincubated with oPRL were normoglycemic 15 days after implantation, which should be compared to only 43% in the control group. All these mice reverted to hyperglycemia after nephrectomy, confirming that no regeneration of the endogenous islets had occured. The partially pancreatectomized rats were normoglycemic and a minimal islet mass model could therefore not be used. Instead, we chose to perfuse the graft bearing kidneys. Distinct first- and second-phase insulin release in response to high glucose stimulation was observed from one-month-old rat

41 islet grafts of sham-operated control recipients. These grafts also responded with an even more pronounced insulin release upon stimulation with arginine. However, corresponding rat islet grafts implanted to partially pancreatectomized recipients released much more insulin in response to both these stimuli. Especially the first phase of insulin release during high glucose was markedly improved with peak values more than doubled when compared to those in control grafts.

In conclusion, islet revascularization and function can be improved by PRL administration or the performance of a partial pancreatectomy. This improvement is probably due to the increased revascularization. Understanding the mechanisms behind this improvement would provide an opportunity to develop interventions that increase vascular engraftment and clinical transplantation success rate.

42 Conclusions

Physiological ȕ-cell growth was associated with an increased endothelial cell replication in the immediate postnatal period and during pregnancy.

The pancreatic islets increase their production of the angiogenesis stimulator VEGF-A and decrease the synthesis of the angiogenesis inhibitor tsp-1 during ȕ-cell growth.

Islet endothelial cells can produce ȕ-cell mitogens in response to stimuli from islets. The functional importance of this remains to be elucidated.

Transplantation of islets to recipients subjected to partial pancreatectomy or treated with PRL is associated with improved graft revascularization and function and an increased islet transplant volume.

43 Swedish summary

De Langerhanska öarna i bukspottkörteln är nödvändiga för regleringen av kroppens kolhydratmetabolism. Sjukdomen diabetes mellitus beror på en absolut eller relativ brist på insulin, ett hormon som produceras i öarnas ȕ- celler. De Langerhanska öarnas blodkärl är mycket viktiga för att den hor- monproducerande vävnaden ska fungera korrekt. De är nödvändiga för att förse cellerna med syre och näring, för avkänningen av närings- ämnesnivåerna i blodet, samt för en snabb transport av hormonerna ut i blodet. I det första delarbetet valde vi att studera utvecklingen av kärlsystemet i öar hos nyfödda råttungar. Innan födseln hade öarna en relativt låg kärltäthet. Detta var inte väntat eftersom vuxna öar har en mycket hög kärltäthet. Under den första veckan efter födseln växer djuren kraftigt och deras vikt fördubb- lades. Under samma tidsperiod sker en mognad av de Langerhanska öarna och var kopplad till en snabb utveckling även av öarnas kärlträd. En vecka efter födseln hade öarna samma kärltäthet som hos vuxna råttor. I det andra delarbetet studerade vi celldelningen av ȕ-celler och endotelceller under graviditeten, samt under den första veckan efter födseln. Vi fann att tillväxten av kärlträdet föregick tillväxten av den endokrina vävnaden, vilket var oväntat. Vi såg också att ȕ-cellerna delade sig oftare i de öar där vi fann prolifererande endotelceller. När vi studerade eventuella interaktioner mellan öarna och endotelceller in vitro, fann vi en ökad celldelning hos ȕ-celler som samodlades med endotelceller. Ytterligare studier med olika odlingsmedier, samt tillägg och neut- ralisering av olika tillväxtfaktorer hjälpte oss att nysta ut interaktionerna mellan cellerna. Graviditetshormonet prolaktin stimulerar frisättning av insulin och vascular endothelial growth factor (VEGF) från ȕ-cellerna. Dessa tillväxtfaktorer stimulerar tillsammans endotelcellerna att producera hepatocyte growth factor (HGF), som sedan i sin tur stimulerar ȕ-celler att dela sig. Transplantation av insulinproducerande vävnad är en metod som i speci- ellt utvalda fall kan användas för att behandla typ-1 diabetes. Tyvärr kräver detta stora mängder insulinproducerande vävnad, och en patient behöver vanligen öar från flera donatorer. Det finns flera orsaker till detta; avstötning av transplantatet, autoimmun attack av immunförsvaret och skadliga effekter av avstötningsmedicinerna. Dessutom har man funnit att en stor mängd av den transplanterade vävnaden dör kort tid efter transplantation på grund av ospecifik inflammation, samt brist på syrgas och näringsämnen. Vår grupp

44 har tidigare funnit att återinväxten av blodkärl i de isolerade Langerhanska öarna är störd efter transplantation. Detta resulterar i låga syrgasnivåer och en defekt insulinsekretion. I det tredje delarbetet byggde vi vidare på fynden i delarbete II och stimulerade öarna med graviditetshormonet prolaktin före transplantation. Genom detta ökades uttrycket av det blodkärlsstimulerande ämnet VEGF och uttrycket av hämmaren thrombospondin-1 sänktes. Där- med kunde vi öka inväxten av blodkärl i de Langerhanska öarna, öka de lokala syrgasnivåerna och minska det antal öar som behövdes för att bota försöksdjur från experimentell diabetes. Kliniskt har man funnit att patienter som genomgår en pankreatektomi (Px; borttagande av bukspottkörteln) med efterföljande ötransplantation kla- rar sig bättre än de som transplanteras på vanligt sätt. I det fjärde delarbetet fann vi att Px inverkar positivt på transplantationsresultatet. Transplantaten hade en ökad blodkärlsdensitet, ökad genomblödning, samt högre syrgasni- våer. Transplantatet frisatte även mer insulin när det stimulerades med glu- kos. Transplantaten innehöll också en ökad mängd insulinproducerande väv- nad, antagligen tack vare en ökad överlevnad under de första dagarna efter transplantationen. Vi kunde dessutom konfirmera våra resultat med humana öar transplanterade till möss. Sammanfattningsvis har vi kunnat visa att blodkärlen är viktiga för att de Langerhanska öarna ska fungera optimalt. En ökad mängd blodkärl är asso- cierad med en förbättrad funktion och dessutom verkar kommunikationen mellan endotelcellerna och den insulinproducerande vävnaden vara viktig för att de Langerhanska öarna ska fungera optimalt.

45 Acknowledgements

The thesis was supported by grants from the Juvenile Diabetes Research Foundation, the Swedish Research Council (72XD-15043, 72X-109), the EFSD/Novo Nordisk Research Program, the Swedish Diabetes Foundation, the Swedish Juvenile Diabetes Fund, Novo Nordisk Insulin Fund, the Åke Wiberg Foundation, the Anér Foundation and the Family Ernfors Fund. I would also like to acknowledge Keystone Symposia Travel Grant, the Swed- ish Society of Medicine, Scandinavian Society for the Study of Diabetes, the Swedish Academy of Pharmaceutical Sciences, International Pancreas and Islet Transplantation Association, Svenska Diabetesförbundet, Svensk Förening för Diabetologi, Rektors Wallenbergmedel, Upsala Läkareförening and Sven Brolin Travel Grant for giving me the opportunity to attend international meetings and courses.

I would also like to express my sincere gratitude to: Leif Jansson My scientific mentor and omniscient discussion partner. For giving me giving me freedom, advice and inspiration.

P-O Carlsson For being an excellent supervisor and for thinking outside the box. You keep me alert, focused and enthusiastic at all times.

Arne Andersson for feedback and critical assessment of my work. Claes Hellerström for advice when elucidating the mechanisms behind my obser- vations. Michael Welsh and Lena Claesson-Welsh for giving me the opportunity to meet excellent researchers in the field of angiogenesis research. Stellan Sandler for support and interesting discussions. Nils Welsh for fruitful feedback. Lena Holm for all the help with the intravital microscopy. Carina for valuable advice on the preparation of the fetal pancreata. Olle Korsgren (Nordic Network for Clinical Islet Transplantation) and Per Westermark for generously providing isolated human islets and control human pancreas samples, respectively. Håkan Borg, Peter Bergsten, Ulf Eriksson, Eva Grapengiesser, Erik Gylfe, Peter Hansell, Bo Hellman, Örjan Källskog, Godfried Roomans, Mats Sjöquist, Anders Tengholm,

46 Parri Wentzel and Mats Wolgast for critical questions and creative sugges- tions. I have learned a lot by our discussions.

Astrid Nordin for taking care of the lab and always exceeding my expecta- tions. Birgitta Bodin for always being helpful and for possessing amazing surgical skills. Eva Törnelius for impressing knowledge and skill in the field of histology. Agneta Bäfwe for solving all my administrative problems with a smile. Göran Ståhl for swift and competent assistance. Ing-Marie Mörsare and Lisbeth Sagulin for their skilled technical assistance and for practical advice. Gun-Britt Lind and Karin Öberg for your administrative skills.

The members of my group. Göran for teaching me everything about histology and how to prepare for the life after the dissertation. Joey for creating a joyful atmosphere. Johan for helping me understand molecular biology and being the ideal roommate. Johanna for bringing good ideas into reality. Richard for good companionship on travels. Sara for keeping an eye on my preparation of bufferts. Åsa for great help with endothelial cell isolation and culture.

Robban and Dariush for fascinating discussions at lunch time. Björn for introducing me to board games. Enyin for teaching me about Chinese medicine. All students, former and present PhD students, senior researchers and everyone else at the Department of Medical Cell Biology for creating a good atmosphere, and for good times both inside and outside of the lab.

My friends. Leif, Erik and Andreas for discovering Uppsala and the rest of the world together with me, it has been ten great years! Lina for long-lasting friendship and for understanding me better than I do. Åsa, Maja, Johanna and Isabelle for reminding me that there is a life outside the lab. Helena for being a wonderful and caring person. Linda, always happy and fit for fight. Ulrick, Fredrik and Thomas my oldest friends and whom I always can rely on.

My family and relatives, especially Karl-Ivar, Asta, Ingrid and Tore for your unconditional support and love. And last but not least my sister Maria, a wonderful person and friend.

47 References

1. Ferner H 1952 Das Inselsystem des Pankreas. Stuttgart: Thieme 2. Bonner-Weir S 1988 Morphological evidence for pancreatic polarity of beta-cell within islets of Langerhans. Diabetes 37:616-621 3. Legg PG 1967 The fine structure and innervation of the beta and delta cells in the islet of Langerhans of the cat. Zeitschrift fiir Zellforschung 80:307- 321 4. Schwartz TW 1983 Pancreatic polypeptide: a hormone under vagal control. Gastroenterology 85:1411-1425 5. Wierup N, Svensson H, Mulder H, Sundler F 2002 The ghrelin cell: a novel developmentally regulated islet cell in the human pancreas. Regul Pept 107:63-69 6. Heller RS, Jenny M, Collombat P, Mansouri A, Tomasetto C, Madsen OD, Mellitzer G, Gradwohl G, Serup P 2005 Genetic determinants of pancreatic epsilon-cell development. Dev Biol 286:217-224 7. Fujita T 1959 Histological studies on the neuro.insular complex in the pancreas of some mammals. Zeitschrift für Zellforschung 50:94-109 8. Ahren B 2000 Autonomic regulation of islet hormone secretion-- implications for health and disease. Diabetologia 43:393-410 9. Carlsson PO, Sandler S, Jansson L 1996 Influence of the neurotoxin capsaicin on rat pancreatic islets in culture, and on the pancreatic islet blood flow of rats. Eur J Pharmacol 312:75-81 10. Carlsson PO, Berne C, Östenson CG, Andersson A, Jansson L 2003 Hypoglycaemia induces decreased islet blood perfusion mediated by the central nervous system in normal and Type 2 diabetic GK rats. Diabetolo- gia 46:1124-1130 11. Sunami E, Kanazawa H, Hashizume H, Takeda M, Hatakeyama K, Ushiki T 2001 Morphological characteristics of Schwann cells in the islets of Langerhans of the murine pancreas. Arch Histol Cytol 64:191-201 12. Teitelman G, Guz Y, Ivkovic S, Ehrlich M 1998 Islet injury induces neurotrophin expression in pancreatic cells and reactive gliosis of peri-islet Schwann cells. J Neurobiol 34:304-318 13. Winer S, Tsui H, Lau A, Song A, Li X, Cheung RK, Sampson A, Afi- fiyan F, Elford A, Jackowski G, Becker DJ, Santamaria P, Ohashi P, Dosch HM 2003 Autoimmune islet destruction in spontaneous type 1 diabetes is not beta-cell exclusive. Nat Med 9:198-205 14. Arnush M, Scarim AL, Heitmeier MR, Kelly CB, Corbett JA 1998 Potential role of resident islet macrophage activation in the initiation of autoimmune diabetes. J Immunol 160:2684-2691

48 15. Hellerström C, Swenne I, Andersson A 1988 Islet cell replication and diabetes. In: Lefébvre PJ, Pipeleers DG eds. The pathology of the endocrine pancreas in diabete. Berlin: Springer Verlag; 141-170 16. Bonner-Weir S 2000 Perspective: Postnatal pancreatic beta cell growth. Endocrinology 141:1926-1929 17. Bernard C, Berthault MF, Saulnier C, Ktorza A 1999 Neogenesis vs. apoptosis As main components of pancreatic beta cell ass changes in glucose-infused normal and mildly diabetic adult rats. Faseb J 13:1195-1205 18. Bulotta A, Farilla L, Hui H, Perfetti R 2004 The Role of GLP-1 in the Regulation of Islet Cell Mass. Cell Biochem Biophys 40:65-78 19. Stoffers DA, Kieffer TJ, Hussain MA, Drucker DJ, Bonner-Weir S, Habener JF, Egan JM 2000 Insulinotropic glucagon-like peptide 1 ago- nists stimulate expression of homeodomain protein IDX-1 and increase islet size in mouse pancreas. Diabetes 49:741-748 20. Brelje TC, Scharp DW, Lacy PE, Ogren L, Talamantes F, Robertson M, Friesen HG, Sorenson RL 1993 Effect of homologous placental lactogens, prolactins, and growth hormones on islet B-cell division and insulin secretion in rat, mouse, and human islets: implication for placental lactogen regulation of islet function during pregnancy. Endocrinology 132:879-887 21. Sorenson RL, Brelje TC 1997 Adaptation of islets of Langerhans to pregnancy: beta-cell growth, enhanced insulin secretion and the role of lac- togenic hormones. Horm Metab Res 29:301-307 22. Vasavada RC, Garcia-Ocana A, Zawalich WS, Sorenson RL, Dann P, Syed M, Ogren L, Talamantes F, Stewart AF 2000 Targeted expression of placental lactogen in the beta cells of transgenic mice results in beta cell proliferation, islet mass augmentation, and hypoglycemia. J Biol Chem 275:15399-15406 23. Stout LE, Svensson AM, Sorenson RL 1997 Prolactin regulation of islet- derived INS-1 cells: characteristics and immunocytochemical analysis of STAT5 translocation. Endocrinology 138:1592-1603 24. Sorenson RL, Johnson MG, Parsons JA, Sheridan JD 1987 Decreased glucose stimulation threshold, enhanced insulin secretion, and increased beta cell coupling in islets of prolactin-treated rats. Pancreas 2:283-288 25. Sorenson RL, Brelje TC, Hegre OD, Marshall S, Anaya P, Sheridan JD 1987 Prolactin (in vitro) decreases the glucose stimulation threshold, enhances insulin secretion, and increases dye coupling among islet B cells. Endocrinology 121:1447-1453 26. Bouwens L, Rooman I 2005 Regulation of pancreatic beta-cell mass. Phy- siol Rev 85:1255-1270 27. Vasir B, Reitz P, Xu G, Sharma A, Bonner-Weir S, Weir GC 2000 Effects of diabetes and hypoxia on gene markers of angiogenesis (HGF, cMET, uPA and uPAR, TGF-alpha, TGF-beta, bFGF and Vimentin) in cultured and transplanted rat islets. Diabetologia 43:763-772 28. Garcia-Ocana A, Vasavada RC, Cebrian A, Reddy V, Takane KK, Lopez-Talavera JC, Stewart AF 2001 Transgenic overexpression of hepatocyte growth factor in the beta-cell markedly improves islet function and islet transplant outcomes in mice. Diabetes 50:2752-2762 29. Garcia-Ocana A, Takane KK, Syed MA, Philbrick WM, Vasavada RC, Stewart AF 2000 Hepatocyte growth factor overexpression in the islet of

49 transgenic mice increases beta cell proliferation, enhances islet mass, and induces mild hypoglycemia. J Biol Chem 275:1226-1232 30. Dai C, Huh CG, Thorgeirsson SS, Liu Y 2005 {beta}-Cell-Specific Abla- tion of the Hepatocyte Growth Factor Receptor Results in Reduced Islet Si- ze, Impaired Insulin Secretion, and Glucose Intolerance. Am J Pathol 167:429-436 31. Roccisana J, Reddy V, Vasavada RC, Gonzalez-Pertusa JA, Magnuson MA, Garcia-Ocana A 2005 Targeted Inactivation of Hepatocyte Growth Factor Receptor c-met in {beta}-Cells Leads to Defective Insulin Secretion and GLUT-2 Downregulation Without Alteration of {beta}-Cell Mass. Di- abetes 54:2090-2102 32. Langerhans P 1869 Beiträge zur mikroskopischen anatomie der bauch- speicheldrüse. In: Medizinische Fakultät. Berlin: Friedrich Wilhelm Uni- versität 33. Brunicardi FC, Stagner J, Bonner-Weir S, Wayland H, Kleinman R, Livingston E, Guth P, Menger M, McCuskey R, Intaglietta M, Charles A, Ashley S, Cheung A, Ipp E, Gilman S, Howard T, Passaro E, Jr. 1996 Microcirculation of the islets of Langerhans. Long Beach Veterans Administration Regional Medical Education Center Symposium. Diabetes 45:385-392 34. Bonner-Weir S 1993 The microvasculature of the pancreas, with emphasis on that of the islets of Langerhans. In: Liang VW, DiMagno EP, Gardner JD, Lebenthal E, Reber HA, Scheele GS eds. The pancreas: biology, patho- biology and disease. Second ed. New York: Raven Press Ltd.; 759-768 35. Jansson L 1994 The regulation of pancreatic islet blood flow. Diabetes Metab Rev 10:407-416 36. Jansson L, Andersson A, Källskog Ö, Carlsson PO 2006 Pancreatic microcirculation in health and disease. In: Encyclopedia of Microcirculati- on: Elsevier Science; 547-550 37. Moldovan S, Livingston E, Zhang RS, Kleinman R, Guth P, Brunicar- di FC 1996 Glucose-induced islet hyperemia is mediated by nitric oxide. Am J Surg 171:16-20 38. Ribatti D, Nico B, Vacca A, Roncali L, Dammacco F 2002 Endothelial cell heterogeneity and organ specificity. J Hematother Stem Cell Res 11:81-90 39. Aird WC 2003 Endothelial cell heterogeneity. Crit Care Med 31:S221-230 40. Gerritsen ME 1987 Functional heterogeneity of vascular endothelial cells. Biochem Pharmacol 36:2701-2711 41. Milici AJ, Furie MB, Carley WW 1985 The formation of fenestrations and channels by capillary endothelium in vitro. Proc Natl Acad Sci U S A 82:6181-6185 42. Borsum T, Hagen I, Henriksen T, Carlander B 1982 Alterations in the protein composition and surface structure of human endothelial cells during growth in primary culture. Atherosclerosis 44:367-378 43. Arap W, Kolonin MG, Trepel M, Lahdenranta J, Cardo-Vila M, Gior- dano RJ, Mintz PJ, Ardelt PU, Yao VJ, Vidal CI, Chen L, Flamm A, Valtanen H, Weavind LM, Hicks ME, Pollock RE, Botz GH, Bucana CD, Koivunen E, Cahill D, Troncoso P, Baggerly KA, Pentz RD, Do

50 KA, Logothetis CJ, Pasqualini R 2002 Steps toward mapping the human vasculature by phage display. Nat Med 8:121-127 44. Smith JM, Meinkoth JH, Hochstatter T, Meyers KM 1996 Differential distribution of von Willebrand factor in canine vascular endothelium. Am J Vet Res 57:750-755 45. Chi JT, Chang HY, Haraldsen G, Jahnsen FL, Troyanskaya OG, Chang DS, Wang Z, Rockson SG, van de Rijn M, Botstein D, Brown PO 2003 Endothelial cell diversity revealed by global expression profiling. Proc Natl Acad Sci U S A 100:10623-10628 46. Vinals F, Pouyssegur J 1999 Confluence of vascular endothelial cells induces cell cycle exit by inhibiting p42/p44 mitogen-activated protein kinase activity. Mol Cell Biol 19:2763-2772 47. Grazia Lampugnani M, Zanetti A, Corada M, Takahashi T, Balconi G, Breviario F, Orsenigo F, Cattelino A, Kemler R, Daniel TO, Dejana E 2003 Contact inhibition of VEGF-induced proliferation requires vascular endothelial cadherin, beta-catenin, and the phosphatase DEP-1/CD148. J Cell Biol 161:793-804 48. Kvietys PR, Perry MA, Granger DN 1983 Permeability of pancreatic capillaries to small molecules. Am J Physiol 245:G519-524 49. Henderson JR, Moss MC 1985 A morphometric study of the endocrine and exocrine capillaries of the pancreas. Q J Exp Physiol 70:347-356 50. Kuroda M, Oka T, Oka Y, Yamochi T, Ohtsubo K, Mori S, Watanabe T, Machinami R, Ohnishi S 1995 Colocalization of vascular endothelial growth factor (vascular permeability factor) and insulin in pancreatic islet cells. J Clin Endocrinol Metab 80:3196-3200 51. Kamba T, Tam BY, Hashizume H, Haskell A, Sennino B, Mancuso MR, Norberg SM, O'Brien SM, Davis RB, Gowen LC, Anderson KD, Thurston G, Joho S, Springer ML, Kuo CJ, McDonald DM 2006 VEGF-dependent plasticity of fenestrated capillaries in the normal adult microvasculature. Am J Physiol Heart Circ Physiol 290:H560-576 52. Lammert E, Gu G, McLaughlin M, Brown D, Brekken R, Murtaugh LC, Gerber HP, Ferrara N, Melton DA 2003 Role of VEGF-A in vascularization of pancreatic islets. Curr Biol 13:1070-1074 53. Shepro D, Morel NM 1993 Pericyte physiology. Faseb J 7:1031-1038 54. Westermark P 1973 Ultrastructure of capillaries and interstitial cells in human pancreatic islets. Ups J Med Sci 78:22-32 55. Morikawa S, Baluk P, Kaidoh T, Haskell A, Jain RK, McDonald DM 2002 Abnormalities in pericytes on blood vessels and endothelial sprouts in tumors. Am J Pathol 160:985-1000 56. Lukinius A, Jansson L, Korsgren O 1995 Ultrastructural evidence for blood microvessels devoid of an endothelial cell lining in transplanted pancreatic islets. Am J Pathol 146:429-435 57. Regoli M, Bertelli E, Orazioli D, Fonzi L, Bastianini A 2001 Pancreatic lymphatic system in rodents. Anat Rec 263:155-160 58. Carlsson PO, Jansson L, Östenson CG, Källskog Ö 1997 Islet capillary blood pressure increase mediated by hyperglycemia in NIDDM GK rats. Diabetes 46:947-952 59. Regoli M, Bertelli E, Orazioli D, Fonzi L, Bastianini A, P. O. 20011998 Pancreatic lymphatic systemMicrocirculation in rodentsnative and

51 transplanted rodent pancreatic islets with special reference to the influence of diabetes mellitus. Anat RecMedical Cell Biology 263:155-160 60. Mandriota SJ, Jussila L, Jeltsch M, Compagni A, Baetens D, Prevo R, Banerji S, Huarte J, Montesano R, Jackson DG, Orci L, Alitalo K, Christofori G, Pepper MS 2001 Vascular endothelial growth factor-C- mediated lymphangiogenesis promotes tumour metastasis. Embo J 20:672- 682 61. Källskog Ö, Kampf C, Andersson A, Carlsson PO, Hansell P, Johans- son M, Jansson L 2006 Lymphatic vessels in pancreatic islets implanted under the renal capsule of rats. Am J Transplant 6:680-686 62. Carmeliet P 2003 Angiogenesis in health and disease. Nat Med 9:653-660 63. LeCouter J, Lin R, Ferrara N 2002 Endocrine gland-derived VEGF and the emerging hypothesis of organ-specific regulation of angiogenesis. Nat Med 8:913-917 64. Pettersson A, Nagy JA, Brown LF, Sundberg C, Morgan E, Jungles S, Carter R, Krieger JE, Manseau EJ, Harvey VS, Eckelhoefer IA, Feng D, Dvorak AM, Mulligan RC, Dvorak HF 2000 Heterogeneity of the angiogenic response induced in different normal adult tissues by vascular permeability factor/vascular endothelial growth factor. Lab Invest 80:99- 115 65. Carmeliet P 2000 Mechanisms of angiogenesis and arteriogenesis. Nat Med 6:389-395 66. Ramsauer M, D'Amore PA 2002 Getting Tie(2)d up in angiogenesis. J Clin Invest 110:1615-1617 67. Inoue M, Hager JH, Ferrara N, Gerber HP, Hanahan D 2002 VEGF-A has a critical, nonredundant role in angiogenic switching and pancreatic beta cell carcinogenesis. Cancer Cell 1:193-202 68. Christofori G, Naik P, Hanahan D 1995 Vascular endothelial growth factor and its receptors, flt-1 and flk-1, are expressed in normal pancreatic islets and throughout islet cell tumorigenesis. Mol Endocrinol 9:1760-1770 69. Gorden DL, Mandriota SJ, Montesano R, Orci L, Pepper MS 1997 Vascular endothelial growth factor is increased in devascularized rat islets of Langerhans in vitro. Transplantation 63:436-443 70. Vasir B, Aiello LP, Yoon KH, Quickel RR, Bonner-Weir S, Weir GC 1998 Hypoxia induces vascular endothelial growth factor gene and protein expression in cultured rat islet cells. Diabetes 47:1894-1903 71. Hart AW, Baeza N, Apelqvist A, Edlund H 2000 Attenuation of FGF signalling in mouse beta-cells leads to diabetes. Nature 408:864-868 72. Leung DW, Cachianes G, Kuang WJ, Goeddel DV, Ferrara N 1989 Vascular endothelial growth factor is a secreted angiogenic mitogen. Scien- ce 246:1306-1309 73. Roberts WG, Palade GE 1995 Increased microvascular permeability and endothelial fenestration induced by vascular endothelial growth factor. J Cell Sci 108 ( Pt 6):2369-2379 74. Barro C, Zaoui P, Morel F, Benhamou PY 1998 Matrix metalloproteinase expression in rat pancreatic islets. Pancreas 17:378-382 75. Mattsson G 2003 Experimental Studies on the Vasculature of Endogenous and Transplanted Islets of Langerhans. Uppsala: Comprehensive Summa-

52 ries of Uppsala dissertations from the Faculty of Medicine, Acta Universi- tatis Upsaliensis 76. Crawford SE, Stellmach V, Murphy-Ullrich JE, Ribeiro SM, Lawler J, Hynes RO, Boivin GP, Bouck N 1998 Thrombospondin-1 is a major acti- vator of TGF-beta1 in vivo. Cell 93:1159-1170 77. Tillmar L, Welsh N 2004 In vitro cultured rat islets express genes that both prevent and promote angiogenesis. J Pancreas 2:3001-3011 78. Sjöholm A, Hellerström C 1991 TGF-beta stimulates insulin secretion and blocks mitogenic response of pancreatic beta-cells to glucose. Am J Physiol 260:C1046-1051 79. Muller G, Behrens J, Nussbaumer U, Bohlen P, Birchmeier W 1987 Inhibitory action of transforming growth factor beta on endothelial cells. Proc Natl Acad Sci U S A 84:5600-5604 80. Scaglia L, Smith FE, Bonner-Weir S 1995 Apoptosis contributes to the involution of beta cell mass in the post partum rat pancreas. Endocrinology 136:5461-5468 81. Duvillie B, Cordonnier N, Deltour L, Dandoy-Dron F, Itier JM, Monthioux E, Jami J, Joshi RL, Bucchini D 1997 Phenotypic alterations in insulin-deficient mutant mice. Proc Natl Acad Sci U S A 94:5137-5140 82. Pelengaris S, Khan M, Evan GI 2002 Suppression of Myc-induced apoptosis in beta cells exposes multiple oncogenic properties of Myc and trig- gers carcinogenic progression. Cell 109:321-334 83. Lammert E, Cleaver O, Melton D 2001 Induction of pancreatic differentiation by signals from blood vessels. Science 294:564-567 84. Chilvers ER, Thomas NW 1983 The blood supply of the islets of Langer- hans in the Mongolian gerbil. J Anat 136:339-347 85. Kaido T, Yebra M, Cirulli V, Montgomery AM 2004 Regulation of human beta-cell adhesion, motility, and insulin secretion by collagen IV and its receptor alpha1beta1. J Biol Chem 279:53762-53769 86. Nikolova G, Jabs N, Konstantinova I, Domogatskaya A, Tryggvason K, Sorokin L, Fassler R, Gu G, Gerber HP, Ferrara N, Melton DA, Lam- mert E 2006 The vascular basement membrane: a niche for insulin gene expression and Beta cell proliferation. Dev Cell 10:397-405 87. Shapiro AM, Lakey JR, Ryan EA, Korbutt GS, Toth E, Warnock GL, Kneteman NM, Rajotte RV 2000 Islet transplantation in seven patients with type 1 diabetes mellitus using a glucocorticoid-free immunosuppressive regimen. N Engl J Med 343:230-238 88. Ryan EA, Lakey JR, Paty BW, Imes S, Korbutt GS, Kneteman NM, Bigam D, Rajotte RV, Shapiro AM 2002 Successful islet transplantation: continued insulin reserve provides long-term glycemic control. Diabetes 51:2148-2157 89. Sutherland DE 1997 Pancreas transplantation as a treatment for diabetes: indications and outcome. Curr Ther Endocrinol Metab 6:496-499 90. Humar A, Kandaswamy R, Granger D, Gruessner RW, Gruessner AC, Sutherland DE 2000 Decreased surgical risks of pancreas transplantation in the modern era. Ann Surg 231:269-275 91. Ryan EA, Paty BW, Senior PA, Bigam D, Alfadhli E, Kneteman NM, Lakey JR, Shapiro AM 2005 Five-year follow-up after clinical islet transplantation. Diabetes 54:2060-2069

53 92. Rother KI, Harlan DM 2004 Challenges facing islet transplantation for the treatment of type 1 diabetes mellitus. J Clin Invest 114:877-883 93. Mattsson G, Jansson L, Carlsson PO 2002 Decreased vascular density in mouse pancreatic islets after transplantation. Diabetes 51:1362-1366 94. Menger MD, Jaeger S, Walter P, Feifel G, Hammersen F, Messmer K 1989 Angiogenesis and hemodynamics of microvasculature of transplanted islets of Langerhans. Diabetes 38 Suppl 1:199-201 95. Jansson L, Carlsson PO 2002 Graft vascular function after transplantation of pancreatic islets. Diabetologia 45:749-763 96. Carlsson PO, Palm F, Andersson A, Liss P 2000 Chronically decreased oxygen tension in rat pancreatic islets transplanted under the kidney capsule. Transplantation 69:761-766 97. Contreras JL, Eckstein C, Smyth CA, Bilbao G, Vilatoba M, Ringland SE, Young C, Thompson JA, Fernandez JA, Griffin JH, Eckhoff DE 2004 Activated protein C preserves functional islet mass after intraportal transplantation: a novel link between endothelial cell activation, thrombo- sis, inflammation, and islet cell death. Diabetes 53:2804-2814 98. Steiner L, Kroncke K, Fehsel K, Kolb-Bachofen V 1997 Endothelial cells as cytotoxic effector cells: cytokine-activated rat islet endothelial cells lyse syngeneic islet cells via nitric oxide. Diabetologia 40:150-155 99. Fontaine MJ, Blanchard J, Rastellini C, Lazda V, Herold KC, Pollak R 2002 Pancreatic islets activate portal vein endothelial cells in vitro. Ann Clin Lab Sci 32:352-361 100. Davalli AM, Scaglia L, Zangen DH, Hollister J, Bonner-Weir S, Weir GC 1996 Vulnerability of islets in the immediate posttransplantation period. Dynamic changes in structure and function. Diabetes 45:1161-1167 101. Jansson L, Sandler S 1989 Pancreatic and islet blood flow in the regenera- ting pancreas after a partial pancreatectomy in adult rats. Surgery 106:861- 866 102. Annerén C 2002 Dual role of the tyrosine kinase GTK and the adaptor protein SHB in beta-cell growth: enhanced beta-cell replication after 60% pancreatectomy and increased sensitivity to streptozotocin. J Endocrinol 172:145-153 103. Sandler S, Andersson A, Hellerström C 1987 Inhibitory effects of inter- leukin 1 on insulin secretion, insulin biosynthesis, and oxidative metabolism of isolated rat pancreatic islets. Endocrinology 121:1424-1431 104. Andersson A 1978 Isolated mouse pancreatic islets in culture: effects of serum and different culture media on the insulin production of the islets. Diabetologia 14:397-404 105. Sandler S, Eizirik D 1996 Culture of human pancreatic islet cells. In: G J ed. Methods in molecular medicine: human cell culture protocols. Totowa: Humana Press; 391-407 106. Eizirik DL, Korbutt GS, Hellerström C 1992 Prolonged exposure of human pancreatic islets to high glucose concentrations in vitro impairs the beta-cell function. J Clin Invest 90:1263-1268 107. Heuser M, Wolf B, Vollmar B, Menger MD 2000 Exocrine contamination of isolated islets of Langerhans deteriorates the process of revascularization after free transplantation. Transplantation 69:756-761

54 108. Suschek C, Fehsel K, Kroncke KD, Sommer A, Kolb-Bachofen V 1994 Primary cultures of rat islet capillary endothelial cells. Constitutive and cytokine-inducible macrophagelike nitric oxide synthases are expressed and activities regulated by glucose concentration. Am J Pathol 145:685-695 109. Jackson CJ, Garbett PK, Nissen B, Schrieber L 1990 Binding of human endothelium to Ulex europaeus I-coated Dynabeads: application to the isolation of microvascular endothelium. J Cell Sci 96 ( Pt 2):257-262 110. Carlsson PO, Palm F, Mattsson G 2002 Low revascularization of expe- rimentally transplanted human pancreatic islets. J Clin Endocrinol Metab 87:5418-5423 111. Revsabech N 1989 An oxygen microsensor with a guard cathode. Limno- logy and Oceanography 34:474-478 112. Carlsson PO, Liss P, Andersson A, Jansson L 1998 Measurements of oxygen tension in native and transplanted rat pancreatic islets. Diabetes 47:1027-1032 113. Korsgren O, Jansson L, Andersson A 1989 Effects of hyperglycemia on function of isolated mouse pancreatic islets transplanted under kidney capsule. Diabetes 38:510-515 114. Jansson L, Eizirik DL, Pipeleers DG, Borg LA, Hellerstrom C, Anders- son A 1995 Impairment of glucose-induced insulin secretion in human pancreatic islets transplanted to diabetic nude mice. J Clin Invest 96:721- 726 115. Olsson R, Carlsson PO 2005 Better vascular engraftment and function in pancreatic islets transplanted without prior culture. Diabetologia 48:469- 476 116. Mattsson G, Jansson L, Nordin A, Carlsson PO 2003 Impaired revascularization of transplanted mouse pancreatic islets is chronic and glucose- independent. Transplantation 75:736-739 117. Mattsson G, Carlsson PO, Olausson K, Jansson L 2002 Histological markers for endothelial cells in endogenous and transplanted rodent pancreatic islets. Pancreatology 2:155-162 118. Swenne I, Andersson A 1984 Effect of genetic background on the capacity for islet cell replication in mice. Diabetologia 27:464-467 119. Weibel ER 1979 Practical methods for biological morphometry. London: Academic Press 120. Chadwick DR, Robertson GS, Toomey P, Contractor H, Rose S, James RF, Bell PR, London NJ 1993 Pancreatic islet purification using bovine serum albumin: the importance of density gradient temperature and osmola- lity. Cell Transplant 2:355-361 121. Tillmar L, Carlsson C, Welsh N 2002 Control of insulin mRNA stability in rat pancreatic islets. Regulatory role of a 3'-untranslated region pyrimi- dine-rich sequence. J Biol Chem 277:1099-1106 122. Hellerström C, Swenne I 1991 Functional maturation and proliferation of fetal pancreatic beta-cells. Diabetes 40 Suppl 2:89-93 123. Parsons JA, Brelje TC, Sorenson RL 1992 Adaptation of islets of Lan- gerhans to pregnancy: increased islet cell proliferation and insulin secretion correlates with the onset of placental lactogen secretion. Endocrinology 130:1459-1466

55 124. Kaung HL 1994 Growth dynamics of pancreatic islet cell populations during fetal and neonatal development of the rat. Dev Dyn 200:163-175 125. Bouwens L, Wang RN, De Blay E, Pipeleers DG, Kloppel G 1994 Cyto- keratins as markers of ductal cell differentiation and islet neogenesis in the neonatal rat pancreas. Diabetes 43:1279-1283 126. Scaglia L, Cahill CJ, Finegood DT, Bonner-Weir S 1997 Apoptosis participates in the remodeling of the endocrine pancreas in the neonatal rat. Endocrinology 138:1736-1741 127. McEvoy RC 1981 Changes in the volumes of the A-, B-, and D-cell populations in the pancreatic islets during the postnatal development of the rat. Diabetes 30:813-817 128. Shields AF, Larson SM, Grunbaum Z, Graham MM 1984 Short-term thymidine uptake in normal and neoplastic tissues: studies for PET. J Nucl Med 25:759-764 129. Hsueh WA, Lyon CJ, Quinones MJ 2004 Insulin resistance and the endothelium. Am J Med 117:109-117 130. Yki-Järvinen H 2003 Insulin resistance and endothelial dysfunction. Best Pract Res Clin Endocrinol Metab 17:411-430 131. Meigs JB, Hu FB, Rifai N, Manson JE 2004 Biomarkers of endothelial dysfunction and risk of type 2 diabetes mellitus. Jama 291:1978-1986 132. Jimenez B, Volpert OV, Crawford SE, Febbraio M, Silverstein RL, Bouck N 2000 Signals leading to apoptosis-dependent inhibition of neo- vascularization by thrombospondin-1. Nat Med 6:41-48 133. Brelje TC, Parsons JA, Sorenson RL 1994 Regulation of islet beta-cell proliferation by prolactin in rat islets. Diabetes 43:263-273 134. Malaguarnera L, Imbesi RM, Scuto A, D'Amico F, Licata F, Messina A, Sanfilippo S 2004 Prolactin increases HO-1 expression and induces VEGF production in human macrophages. J Cell Biochem 93:197-206 135. Goldhar AS, Vonderhaar BK, Trott JF, Hovey RC 2005 Prolactin- induced expression of vascular endothelial growth factor via Egr-1. Mol Cell Endocrinol 232:9-19 136. LeCouter J, Moritz DR, Li B, Phillips GL, Liang XH, Gerber HP, Hil- lan KJ, Ferrara N 2003 Angiogenesis-independent endothelial protection of liver: role of VEGFR-1. Science 299:890-893 137. Nyqvist D, Köhler M, Wahlstedt H, Berggren PO 2005 Donor islet endothelial cells participate in formation of functional vessels within pancreatic islet grafts. Diabetes 54:2287-2293 138. Bonner-Weir S, Trent DF, Weir GC 1983 Partial pancreatectomy in the rat and subsequent defect in glucose-induced insulin release. J Clin Invest 71:1544-1553 139. Sharma A, Zangen DH, Reitz P, Taneja M, Lissauer ME, Miller CP, Weir GC, Habener JF, Bonner-Weir S 1999 The homeodomain protein IDX-1 increases after an early burst of proliferation during pancreatic regeneration. Diabetes 48:507-513 140. Lau J, Börjesson A, Holstad M, Sandler S 2006 Prolactin regulation of the expression of TNF-alpha, IFN-gamma and IL-10 by splenocytes in murine multiple low dose streptozotocin diabetes. Immunol Lett 102:25-30 141. Davalli AM, Scaglia L, Brevi M, Sanvito F, Freschi M, Cavallaro U, Parlow AF, Pontiroli AE 1999 Pituitary cotransplantation significantly

56 improves the performance, insulin content, and vascularization of renal subcapsular islet grafts. Diabetes 48:59-65 142. Montaña E, Bonner-Weir S, Weir GC 1993 Beta cell mass and growth after syngeneic islet cell transplantation in normal and streptozocin diabetic C57BL/6 mice. J Clin Invest 91:780-787 143. Brissova M, Fowler M, Wiebe P, Shostak A, Shiota M, Radhika A, Lin PC, Gannon M, Powers AC 2004 Intraislet endothelial cells contribute to revascularization of transplanted pancreatic islets. Diabetes 53:1318-1325 144. Öberg-Welsh C, Sandler S, Andersson A, Welsh M 1997 Effects of vascular endothelial growth factor on pancreatic duct cell replication and the insulin production of fetal islet-like cell clusters in vitro. Mol Cell En- docrinol 126:125-132 145. Vasir B, Jonas JC, Steil GM, Hollister-Lock J, Hasenkamp W, Sharma A, Bonner-Weir S, Weir GC 2001 Gene expression of VEGF and its receptors Flk-1/KDR and Flt-1 in cultured and transplanted rat islets. Trans- plantation 71:924-935 146. Asahara T, Takahashi T, Masuda H, Kalka C, Chen D, Iwaguro H, Inai Y, Silver M, Isner JM 1999 VEGF contributes to postnatal neovascu- larization by mobilizing bone marrow-derived endothelial progenitor cells. Embo J 18:3964-3972 147. Contreras JL, Smyth CA, Eckstein C, Bilbao G, Thompson JA, Young CJ, Eckhoff DE 2003 Peripheral mobilization of recipient bone marrow- derived endothelial progenitor cells enhances pancreatic islet revascularization and engraftment after intraportal transplantation. Surgery 134:390-398

57 Acta Universitatis Upsaliensis Digital Comprehensive Summaries of Uppsala Dissertations from the Faculty of Medicine 141

Editor: The Dean of the Faculty of Medicine

A doctoral dissertation from the Faculty of Medicine, Uppsala University, is usually a summary of a number of papers. A few copies of the complete dissertation are kept at major Swedish research libraries, while the summary alone is distributed internationally through the series Digital Comprehensive Summaries of Uppsala Dissertations from the Faculty of Medicine. (Prior to January, 2005, the series was published under the title “Comprehensive Summaries of Uppsala Dissertations from the Faculty of Medicine”.)

ACTA UNIVERSITATIS UPSALIENSIS Distribution: publications.uu.se UPPSALA urn:nbn:se:uu:diva-6801 2006