Expression of C-Jun Is Not Mandatory for Mouse Hepatocyte Proliferation Induced by Two Nuclear Receptor Ligands: TCPOBOP and T3

AperTO - Archivio Istituzionale Open Access dell'Università di Torino

Expression of c-jun is not mandatory for mouse hepatocyte proliferation induced by two nuclear receptor ligands: TCPOBOP and T3

This is the author's manuscript Original Citation:

Availability: This version is available http://hdl.handle.net/2318/113530 since

Published version: DOI:10.1016/j.jhep.2011.02.016 Terms of use: Open Access Anyone can freely access the full text of works made available as "Open Access". Works made available under a Creative Commons license can be used according to the terms and conditions of said license. Use of all other works requires consent of the right holder (author or publisher) if not exempted from copyright protection by the applicable law.

(Article begins on next page)

09 October 2021

This Accepted Author Manuscript (AAM) is copyrighted and published by Elsevier. It is posted here by agreement between Elsevier and the University of Turin. Changes resulting from the publishing process - such as editing, corrections, structural formatting, and other quality control mechanisms - may not be reflected in this version of the text. The definitive version of the text was subsequently published in Expression of c-jun is not mandatory for mouse hepatocyte proliferation induced by two nuclear receptor ligands: TCPOBOP and T3, volume 55, issue 5, Nov 2011, http://www.sciencedirect.com/science/article/pii/S0168827811001991.

You may download, copy and otherwise use the AAM for non-commercial purposes provided that your license is limited by the following restrictions:

(1) You may use this AAM for non-commercial purposes only under the terms of the CC-BY-NC-ND license.

(2) The integrity of the work and identification of the author, copyright owner, and publisher must be preserved in any copy.

(3) You must attribute this AAM in the following format: Creative Commons BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/deed.en), [+http://www.sciencedirect.com/science/article/pii/S0168827811001991]

Expression of c-jun is not mandatory for mouse hepatocyte proliferation induced by two nuclear receptor ligands: TCPOBOP and T3

Vera P. Leoni1, Giovanna M. Ledda-Columbano1, Monica Pibiri1, Christian Saliba1, Andrea Perra1, Marta A. Kowalik1, Oli M.V. Grober2, Maria Ravo2, 3, Alessandro Weisz2, 3, Joseph Locker4, Elena Ghiso5, Silvia Giordano5, Amedeo Columbano1, ,

1 Department of Toxicology, University of Cagliari, Italy 2 Department of General Pathology, Second University of Naples, Italy 3 Laboratory of Molecular Medicine, University of Salerno, Italy 4 Department of Pathology, Albert Einstein College of Medicine, NY, USA 5 Institute for Cancer Research and Treatment, University of Turin Medical School, Italy

Background & Aims Mice lacking c-jun in the liver display impaired regeneration after partial hepatectomy (PH), and were reported to be more resistant to chemically-induced hepatocellular carcinoma (HCC). We investigated the role of c-jun in normal and preneoplastic hepatocyte proliferation induced by ligands of nuclear receptors, which cause liver hyperplasia in the absence of cell loss/death. Methods The effect of 1,4-bis[2-(3,5-dichloropyridyloxy)]benzene (TCPOBOP) on hepatocyte proliferation was determined in c-jun conditional knockout (c-junΔli) or in mouse liver where c-jun has been silenced. To study the role of c-jun in HCC development, c-junΔli and WT mice were given diethylnitrosamine (DENA) followed by repeated injections of TCPOBOP. Results Hepatocyte proliferation induced by TCPOBOP was associated with a stronger proliferative response and earlier S phase entry in c-junΔli mice, compared to WT animals. Moreover, silencing of c-jun in the liver of CD-1 mice caused increased hepatocyte proliferation. A stronger hepatocyte proliferative response of c-junΔli mice was observed also following treatment with a ligand of thyroid hormone receptor. Finally, loss ofc-jun did not inhibit the development of HCC induced by DENA and promoted by TCPOBOP. Conclusions (i) c-jun may, under certain conditions, negatively regulate proliferation of normal hepatocytes, (ii) c-jun is not an absolute requirement for DENA/TCPOBOP-induced HCC formation, suggesting that the therapeutic potential of c-jun/JNK inhibition in liver tumors might be impaired by an increased stimulation of cell growth due to blockade of the c-jun pathway.

Keywords Nuclear receptors; Hepatocellular carcinoma; Cell cycle; Liver hyperplasia

Abbreviations AP-1, activating protein-1; PH, partial hepatectomy; JNK, c-jun-N-terminal kinase; HCC, hepatocellular carcinoma; PPAR-α, peroxisome proliferator-activated receptor- alpha; TCPOBOP, 1,4-bis(2-(3,5-dichloropyridyloxy)benzene; TR, thyroid hormone receptor; T3, triiodothyronine; CAR, constitutive androstane receptor; NF-κB, nuclear factor- κB; STAT3, signal transducer activator of transcription-3; C/EBP, CCAAT/enhancer binding protein; TNF-α, tumor necrosis factor-alpha; TNFR, tumor necrosis factor receptor; IL- 6, interleukin-6; BrdU, 2-bromodeoxyuridine; DENA, diethylnitrosamine; PCNA,proliferating cell nuclear antigen; HGF, hepatocyte growth factor; TGF-α, transforming growth factor- alpha; PB, phenobarbital; SHRNA, short hairpin RNA; IEGs, immediate early genes; Gadd45β, growth-arrest and DNA damage-β; Cyp2b10, cytochrome 2b10

INTRODUCTION c-jun is a member of AP-1 (activating protein-1) transcription factor which binds DNA as heterodimers of Jun and Fos-like subunits. Jun is involved in the regulation of many different biological processes, including proliferation, differentiation, neoplastic transformation, and apoptosis [1]. In the foetal liver, c-jun is required for cell survival. Mature hepatocytes, in contrast, are viable in the absence of c-jun [2]. A critical role of c-jun in liver regeneration has been suggested by the finding that conditional deletion of c-jun in adult livers impaired liver regeneration after 2/3 partial hepatectomy (PH) [2]. Experiments performed in several double-knockout mouse models showed that inactivation of p53, p21, or p38 restored normal regeneration in c-jun conditional knockout mice (c-junΔli) [3]. Moreover, studies on chemically-induced hepatocellular carcinomas (HCCs) showed that the number and size of tumors were reduced when c-junwas inactivated shortly after initiation of the tumorigenic process. The impaired tumor development correlated with increased levels of p53 [4], suggesting that c-jun prevents apoptosis by antagonizing p53 activity. In recent years an increasing number of agents (primary mitogens) capable of inducing hepatocyte proliferation have been identified [5]. In contrast to liver regeneration after cell loss/injury, the proliferative process induced by primary mitogens is not preceded by cell death/loss, and thus leads to liver enlargement (direct hyperplasia). Among these mitogens, several are ligands of nuclear receptors of the steroid/thyroid hormone nuclear receptor superfamily [6]. Functioning as ligand-activated transcription factors, they regulate the expression of genes involved in lipid metabolism, adipogenesis, xenobiotic detoxification, differentiation, etc. [7], [8] and [9]. Notably, most of the changes observed after PH and considered essential for liver regeneration [10] do not occur in liver hyperplasia induced by ligands of nuclear receptors. Indeed, neither activation of transcription factors, such as NF-κB, STAT3, and C/EBP, nor a relevant role for cytokines, such as TNF-α and IL-6, could be observed in rats or mice after treatment with agonists of constitutive androstane receptor (CAR), peroxisome proliferators activated receptor-α (PPARα), and thyroid hormone receptor (TR) [11],[12] and [13]. Since activation of latent pre- existing transcription factors is thought to induce the expression of immediate early genes (IEGs), a relevant question that needs to be addressed is whether IEGs are really required for cell cycle progression. This study was aimed at investigating whether c-jun (i) is an absolute requirement for the entry into and progression of cell cycle in nuclear receptor-mediated liver hyperplasia, and, (ii) is required for the growth and progression of carcinogen-initiated cells to HCC.

MATERIALS AND METHODS

Animals c-jun conditional knockout female mice (c-junΔli) were generated by crossing transgenic mice carrying a floxed allele of c-jun (c-junf/f, control mice) with transgenic mice carrying floxed alleles of c-jun and Alfp-Cre allele [2], kindly donated by E.F. Wagner (CNIO, Madrid). Genotyping of all mice was determined by Southern blot and PCR analysis ( Supplementary Fig. 1). CD-1 mice were purchased from Charles River (Milano, Italy). All experimental procedures were in accordance with the Universities Federation for Animal Welfare Handbook on the Care and Management of Laboratory Animals and the guidelines of the animal ethics committee of the University of Cagliari.

Liver cell proliferation Hepatocyte proliferation was induced by a single gavage treatment with TCPOBOP (3 mg/kg body weight, a gift of Dr. B.A. Diwan, Frederick Cancer Center, MD). Mice were given 2- bromodeoxyuridine (BrdU, Sigma Chem Co., Milano) dissolved in drinking water (1 mg/ml) and sacrificed 96 h later. For kinetic studies, mice received a single intraperitoneal dose of BrdU (100 mg/kg) and were sacrificed 2 h later. For T3 experiments, mice were fed a T3-supplemented diet (4 mg/kg diet) for 5 days.

Lentivirus production, cell transduction, and mice injection Lentiviruses were produced as described elsewhere [14]. For detailed experimental description see Supporting material.

Chemically-induced liver carcinogenesis protocol A single intraperitoneal dose of DENA (90 mg/kg body weight, Sigma) was injected to 4- to 5- month-old c-junΔli and c-junf/f female mice. One week later, mice were given TCPOBOP (3 mg/kg) once a week and killed 20 and 27 weeks after DENA treatment. Histological typing of liver tumors was performed according to Stewart et al. [15]. ( Supplementary Fig. 2).

Microarray analysis Total RNA was isolated from livers using the RNeasy mini Kit (Qiagen, Valencia, CA). RNA concentration was determined with Nanodrop spectrophotometer (NanoDrop, Wilmington, Delaware, USA) and its quality was assessed with Agilent 2100 Bioanalyzer (Agilent Technologies, Milano, Italy). For a detailed explanation of this section see Supplementary material.

Real-time PCR Total RNA for reverse transcription (RT-PCR) was isolated as described in Microarray analysis. For a detailed explanation of this section and specific assays see Supplementary materials.

Histology and immunohistochemistry BrdU was stained with mouse antibody from Becton Dickinson (San Jose, CA), as previously described[12]. The labeling index (Li) was calculated as BrdU-positive hepatocyte nuclei/100 nuclei. The mitotic index (MI) was determined as the number of mitoses/1000 hepatocytes. Apoptosis was determined in H&E stained sections or by TUNEL assay (See Supplementary materials). Serum ALT and AST determinations were performed with commercially available Kits as specified in Supplementary materials.

Western blot analysis Total cell extracts were prepared from cultured cells or frozen livers as described previously [13]. For E2F, p107, and CAR nuclear extracts were prepared. Antibodies used in Western blot experiments are listed inSupplementary materials. Western blots were quantified using ImageJ software or Quantity-One.

DNA content Total hepatic DNA content was determined by the diphenylamine method as described [16].

Statistical analysis Comparison between treated and control group was performed by Student’s t test.

RESULTS

Proliferative activity and apoptosis of hepatocytes are similar in c-junΔli and c-junf/f mice Previous reports have shown that a reduction of body weight was present as early as 2 weeks after birth and persisted throughout adulthood, while a reduction of hepatocyte proliferation in c- junΔli occurred predominantly in very young animals [2]. Accordingly, while we observed a reduction in body and liver size in adult c-junΔli compared to c-junf/f mice, no significant difference in hepatocyte proliferation or in apoptotic incidence was observed between c-junΔli and c- junf/f following labelling of livers with BrdU for 4 days (Supplementary Table 1).

Hepatocytes of c-jun conditional knock-out mice show a strong proliferative response following administration of the CAR agonist TCPOBOP C-jun is required for mouse liver regeneration after 2/3 PH [2]. To determine whether c-jun is also essential for liver hyperplasia induced by nuclear receptor ligands, the CAR agonist TCPOBOP was administered toc-junΔli and c-junf/f mice. The results showed that c-jun deleted livers were smaller to begin with but that the increase in liver mass after TCPOBOP treatment was greater than that observed in c-junf/f mice (the percentage of the increase of relative liver weight was 116% in c-junΔli mice vs. 93% in wild type mice) ( Fig. 1A). BrdU-positive hepatocytes were more abundant in c-junΔli compared to c-junf/f mice; (Labelling index was 46% in c-junΔli mice vs. 31% in c-junf/f mice; p <0.05) ( Fig. 1B and C). The enhanced proliferative response observed in c- junΔli mice was not due to compensatory regeneration following liver damage induced by TCPOBOP as we did not observe apoptosis or necrosis (see Supplementary Fig. 3A and B). Finally, also the percentage of increase in DNA content was higher in c-junΔli mice (83% vs. 76% of c-junf/fmice) ( Fig. 1D) demonstrating that the hepatocyte proliferation observed in c-junΔli mice is due to a direct mitogenic stimulus, and it is not a regenerative response. c-jun deficient mice exhibit an accelerated entry into S phase after TCPOBOP treatment Kinetic studies showed an accelerated entry of hepatocytes into the S phase (Fig. 2A and B), and an increased number of mitotic figures (Fig. 2C) in livers of c-junΔli mice following TCPOBOP administration. Accordingly, Western blot analysis of cell cycle-associated proteins showed an earlier increase of several G1 and S phase markers in the livers of c-junΔli mice ( Fig. 2D). c-jun silencing in CD-1 normal adult mice leads to increased hepatocyte proliferation after TCPOBOP administration To determine whether also an acute deletion of c-jun could influence the hepatocyte proliferative response after TCPOBOP administration, we aimed at silencing c-jun in mouse livers. The efficacy of the identified silencing sequences was evaluated in vitro in NIH3T3 fibroblasts and in mouse liver oval cells (MLP29 cells). As shown in Supplementary Fig. 4A, c-jun was almost completely knocked down in cells infected with lentiviruses containing anti-c-jun shRNAs, but not in cells infected with scrambled shRNAs. Injection of CD-1 mice with shRNAs 72 h prior to TCPOBOP resulted in a 20% reduction of c-jun expression (Supplementary Fig. 4B, upper panel). In these mice, 24 h after mitogen administration, we observed a significant increase in hepatocyte BrdU incorporation and mitotic index compared to those mice receiving scrambled shRNAs ( Fig. 3A–C), which is compatible with the low percentage of infected hepatocytes (2-fold increase of BrdU incorporation in c-jun silenced animals, compared to a 9-fold increase observed, at the same time point, in c-junΔli animals). In the same experiments, other mice were injected with the viruses and treated 72 h later with CCl4, a strong c-jun inducer [12] and [17]. In vivo delivery of anti-c- jun shRNAs was able to counteract the strong increase of c-jun protein levels observed 2 h after

CCl4 ( Supplementary Fig. 4B, lower panel), thus confirming the efficacy of c-jun silencing.

Expression of immediate early genes, growth factor genes, and cytokines is similar between c-junΔli and c-junf/f mice soon after TCPOBOP treatment To correlate the accelerated S phase entry observed in c-junΔli mice with early changes in gene expression, we compared the expression of IEGs, growth factor genes, and cytokines in c- jun deficient mice with that in c-junf/f animals, soon after TCPOBOP administration. For time-course expression profiling, total liver RNA was hybridized on Illumina MouseRef-8 microarray (See Supplementary material). Of 7000 expressed transcripts, 458 showed reproducible up- or down-regulation in response to the stimulus ( Supplementary Table 2). Moreover, we applied Gene Set Enrichment Analysis (GSEA) to identify enriched pathways with genes regulated in the c- junΔli and c-junf/f liver after 3 h treatment. As reported in Supplementary Fig. 7, GSEA revealed that 4 key pathways were common between the two data-sets (highlighted in red), including, in particular, cell cycle; this further indicates that loss of c-jun does not hamper cell cycle progression in TCPOBOP-induced hepatocyte proliferation. Analysis of cell cycle genes identified by Gene Ontology (227 genes, Fig. 4A and Supplementary Table 3), revealed that only 20 genes were regulated by TCPOBOP in the two strains, with no significant differences between the two groups. We also examined regulation of early genes modulated in liver regeneration after PH. TCPOBOP-induced hepatocyte proliferation was associated with minimal or no increase in the expression of IEGs/transcription factors (c- fos, junB and junD, Stat3, RelA), growth factors (HGF, TGF-α), cyclins (cyclin D2, cyclin D3, cyclin E), and inhibitors of cell cycle (p16, p21, p53) ( Fig. 4B). Several other relevant genes were undetectable (i.e. c-myc, met, TNF-α, IL-6), and were not induced following treatment with TCPOBOP, supporting the notion that genes considered essential for compensatory liver regeneration are not required for direct hyperplasia [6]. Real Time-PCR analysis showed an essentially similar pattern of gene expression ( Supplementary Fig. 5). These results suggest that the accelerated entry into S phase is not the consequence of early events (G0–G1) occurring after treatment with TCPOBOP, but of indirect effects exerted later in G1.

Transcriptional activity of CAR following TCPOBOP is higher in c-junΔli hepatocytes Up-regulation of c-jun and activation of JNK have been associated to downregulation of several nuclear receptors, including CAR [18], suggesting a negative cross talk between c-jun/JNK and nuclear receptors. Accordingly, levels of nuclear CAR protein and CAR transcriptional activity (determined as the expression of its target genes GADD45β and Cyp3a11) following TCPOBOP were higher in c-junΔli ( Supplementary Fig. 6A and B). Moreover, while a strong increase in c- jun mRNA and JNK phosphorylation was observed in CD-1 mice after CCl4 - which causes liver damage and regeneration – ( Supplementary Fig. 6B and C), treatment with two CAR agonists, TCPOBOP and phenobarbital (PB), induced only a modest increase in c-jun and no JNK phosphorylation ( Supplementary Fig. 6B and C).

Loss of c-jun is associated with increased T3-induced hepatocyte proliferation The role of c-jun in hepatocyte proliferation was also assessed following treatment for 5 days with T3, a ligand of the nuclear receptor TR. BrdU staining revealed a higher proliferative response in c- junΔli mice (Fig. 5A–D); mitotic index was also increased, although it was not statistically significant. Western blot analysis demonstrated that a strong increase in cell cycle-related proteins was associated with the increased BrdU incorporation ( Fig. 5E).

C-jun is not mandatory for DENA–TCPOBOP-induced HCC development Since c-jun is not required for proliferation of normal hepatocytes induced by TCPOBOP, we determined the specific role of c-jun in the development of HCC using DENA as initiating and TCPOBOP as promoting agents (Supplementary Fig. 2). Eight/17 c-junΔli and 3/16 c-junf/f mice died during the experiment. At the time of sacrifice, 20 weeks after initiation, livers from c-junΔli and c- junf/f mice exposed to DENA + TCPOBOP exhibited multiple tumors and neoplastic nodules; at this time, no significant difference in total tumor area, tumor number, and mean tumor area was observed between c-junf/f and c-junΔli mice (Fig. 6A). In mice sacrificed after 27 weeks, macroscopic and microscopic analysis showed the presence of HCCs in 4/4 c-junΔli and 6/8 c- junf/f mice exposed to DENA + TCPOBOP ( Fig. 6B). Morphometric analysis of liver sections revealed that the total tumor area was significantly more elevated (p <0.001) in c-junΔli (Fig. 6A); the enhanced tumor mass accounted for the increased relative liver weight observed in c- junΔlicompared to c-junf/f mice (21% vs. 16% of c-junf/f mice; p <0.05). HCCs exhibited patterns of adeno and mixed trabecular and adenocarcinoma, but more often were trabecular carcinomas ( Fig. 6B). Most of these tumors (8/12, 67%) were classified as medium to high grade HCCs, and showed giant nuclei, nuclear atypia, aberrant mitoses, cellular pleomorphism, and increased trabecular size (>3 hepatocytes) ( Fig. 6C). On the opposite, only 40% of the HCCs in c-junf/f mice were medium to high grade, with 9/20 being early or low grade HCCs. All tumors showed a high proliferative rate and apoptosis ( Fig. 6C). Notably, the transcriptional activity of CAR measured by the expression of its target genes GADD45β and Cyp3a11 was higher in tumors from c- junΔli compared to wt mice ( Fig. 6D). p21 over-expression inhibits liver regeneration after PH in c- junΔli mice [2], and increased p21 levels are responsible for reduced proliferation of JNK1−/− cancer cells, which further leads to impaired liver carcinogenesis [19]. Therefore, we determined the levels of p21 in HCCs of c-junΔli and c-junf/ mice. No difference was found in mRNA levels of p21 in HCCs from c-junΔli and c-junf/f mice, suggesting that p21 does not play a major role in the accelerated tumor growth observed at late stages of DENA–TCPOBOP-induced HCC development ( Fig. 6D).

DISCUSSION The most relevant findings of this study are that, (i) c-jun is not mandatory for hepatocyte proliferation induced by ligands of the nuclear receptors CAR and TR; (ii) absence of c-jun is associated with an early S phase entry of hepatocytes; and iii) the expression of c-jun is not mandatory for DENA/TCPOBOP-induced HCC formation. Notably, the lack of differences in JunB and JunD gene expression between c-junΔli and c- junf/f mice after TCPOBOP administration ( Fig. 4B) rules out the possibility that these genes could have somewhat compensated for c-jun loss in c-junΔli animals. Moreover, no differences in the expression of cell cycle-related genes were detected between c-jun deficient and normal mice within the first 6 h from treatment; however, the finding of an increased and early expression of several cell cycle-related proteins, in the liver of c-junΔli mice 18 h after TCPOBOP administration, suggests that endogenous c-jun can play a negative role during middle G1 or that it can control activation of the G1/S checkpoint. Although the molecular mechanisms responsible for the increased hepatocyte proliferation observed in c-jun deficient mice during liver hyperplasia are unknown, a negative cross-talk between nuclear receptor- and membrane receptor-mediated signalling pathways exists; indeed, evidence was provided of an inverse correlation between pro-inflammatory cytokines activation and nuclear receptor expression and transcriptional activity [18] and [20]. An inhibitory effect on nuclear receptor expression and activity is also exerted by endogenous expression of pro- inflammatory cytokines following nuclear receptor ligand administration [21]. Indeed, (i) treatment of TNFR-double receptor KO mice with the CAR agonist PB is associated with an increased transcriptional activation of this nuclear receptor [21], and, (ii) hepatocyte proliferation after TCPOBOP occurs at a higher rate in TNFR1−/− or double TNFR1−/− TNFR2−/− mice [22]. A negative cross-talk between CAR and JNK pathway is also evident from recent studies showing that (i) CAR acts as a negative regulator of JNK by forming a complex with MEKK7 through its co-activator GADD45β [23] and (ii) loss of GADD45β is associated with selective overactivation of the MEKK/JNK pathway [24]. In agreement with these findings, we observed that (i) TCPOBOP and PB, two CAR agonists, did not cause JNK activation; (ii) following TCPOBOP treatment, CAR expression and its transcriptional activity were higher in the liver of c-jun deficient mice compared to c-junf/f animals, and, (iii) transcriptional activity of CAR was higher in tumors from c- junΔli compared with c-junf/f tumors. Another interesting aspect of the present work was the finding that c-jun is not required for the onset/progression of chemically-induced mouse HCC; indeed, no significant difference between c- junΔliand c-junf/f tumors was found 20 weeks after initiation; even more interesting, 27 weeks after initiation, the liver area occupied by HCCs was significantly higher in c-junΔli mice, and HCCs showed a more aggressive pattern. The increased transcriptional activity of CAR observed in c- junΔli tumors might explain their more aggressive growth in response to TCPOBOP. Many CAR activators are non-genotoxic carcinogens and CAR itself has been implicated as the determining factor for hepatocarcinogenesis in response to chronic xenobiotic treatment. By activating cell cycle progression and blocking apoptosis, CAR creates a tumorigenic environment that may contribute to early stages of hepatocarcinogenesis. As previously mentioned, CAR can form a protein complex with GADD45β through which it represses MKK7-mediated phosphorylation of JNK1 and death of hepatocytes. Whether CAR could drive a c-jun-independent role in tumor promotion by linking environmental stress and tumorigenesis while JNK/c-Jun might play a role in hepatitis/fibrosis-associated hepatocarcinogenesis is an open question requiring further studies. A more consistent involvement in the progression of HCC has been shown in the case of TR, which has been found frequently mutated in HCC [25] and whose activation controls genes promoting cancer cell invasiveness [26]. Our present results are apparently in contrast to a previous study [4] showing that loss of c-jun impairs tumor development during experimental liver carcinogenesis. However, two possible differences may explain the diverse results: (i) only female mice were used in our study while Eferl performed experiments in males; it is important to stress that females respond to CAR agonists more efficiently than males[27] and [28]; moreover, our unpublished data show that β-catenin conditional KO male mice exhibit a reduced proliferative response to TCPOBOP compared to their wild type counterpart, while the opposite is observed when the same dose of TCPOBOP is given to β-catenin KO female mice (data not shown). (ii) It is possible that the different promoting agents (TCPOBOP vs. PB) used in our and Eferl’s studies may be responsible for the observed discrepancies. Indeed, although both PB and TCPOBOP are CAR agonists[29] and [30], PB, but not TCPOBOP, binds and activates also the nuclear receptor pregnane X receptor (PXR) [30]; thus, it cannot be excluded that the inhibition of HCC formation observed in c-junΔli mice promoted with PB [4] could be fully or partially mediated by PXR activation. It is worth mentioning that the c-jun/JNK pathway is constitutively active in a great percentage of HCCs[31]. Through the phosphorylation of c-jun and several other substrates, JNK regulates a wide spectrum of cellular activities, such as proliferation and apoptosis; this has rendered this signalling pathway a potential target for the treatment of HCC. It was shown, in fact, that JNK inhibition results in a moderate increase of apoptotic death of HCC cells. However, the interplay between JNK and c-jun is much more complex than previously believed [19] and may depend on the tumor context. It is thus conceivable that in some HCCs, as in the experimental systems we studied, the therapeutic potential of JNK inhibition might be counteracted by an increased stimulation of cell growth due to inhibition of c-jun activity. Interestingly, a suppressive role of c-jun on tumor progression has been suggested also by a recent study showing how loss of c-jun occurs in 38% of human HCCs and c-jun expression is significantly lower in 70% of these tumors, compared with their normal tissue counterparts [32]. Moreover, comparative genomic hybridization and DNA microarray analyses in HCCs showed frequent deletions of 1p32–31, where also the c-jun locus resides, in HCCs [33] and [34]. In conclusion, our data clearly demonstrate not only that c-jun is not required for the growth of preneoplastic hepatocytes promoted by the CAR agonist TCPOBOP to HCC, but also that this gene may operate as a negative controller of normal hepatocyte proliferation induced by two ligands of nuclear receptors, TCPOBOP and T3.

Conflict of interest The authors who have taken part in this study do not have a relationship with the manufacturers of the drugs involved either in the past or present and did not receive funding from the manufacturers to carry out their research. The authors received support from Italian funding public agencies.

Acknowledgements Supported by Associazione Italiana Ricerca sul Cancro (AIRC, Grants IG-5925, IG-5984 and IG- 8586),Ministero Università e Ricerca Scientifica (PRIN, 2008CJ4SYW-001, 2008CJ4SYW-004, and2008N9N9KL-005), Fondazione Banco di Sardegna, Italy, UE (CRESCENDO I.P. LSHM- CT2005-018652), NIH (CA104292). M.A.K.: recipient of a FIRC fellowship; A.P.: recipient of a fellowship from Accademia Nazionale dei Lincei; M.R.: recipient of a fellowship from Fondazione per il Sud.

Fig. 1. Effect of TCPOBOP on liver weight, total DNA content, and hepatocyte proliferation. (A) Relative liver weight and (B) BrdU-positive hepatocytes in the liver of c-junΔli and c-junf/f mice sacrificed 4 days after a single dose of TCPOBOP (200×). (C) Labelling Index (Li). At least 5000 hepatocyte nuclei per liver were scored. (D) Hepatic DNA content. Results are expressed as means ± SE of 4–5 mice per group. ∗Statistically significant for p <0.001 from their respective controls; §statistically significant for p <0.05 from their respective controls.

Fig. 2. Kinetics of TCPOBOP-induced hepatocyte proliferation. (A) Li of c-junf/f and c-junΔli mice hepatocytes. Mice given TCPOBOP were sacrificed 18, 24, 30, and 36 h thereafter. Results are expressed as means ± SE of 4–5 mice per group. (B) BrdU-positive hepatocytes (200×) 24 h after TCPOBOP administration. (C) Mitotic Index (MI). Results are expressed as means ± SE of 4 mice per group. (D) Western blot analysis of cell cycle-related proteins in TCPOBOP-treated c- junΔli and c-junf/f mice. Numbers below the blots represent quantification of the bands normalized to actin or albumin. Each lane represents a pool of 3 samples.

Fig. 3. Effect ofc-junsilencing on TCPOBOP-induced hepatocyte proliferation. (A) BrdU-positive hepatocytes in the liver of CD-1 mice injected with lentiviruses (encoding shRNAs against c-jun or scrambled shRNAs) 3 days prior to TCPOBOP (200x). Mice were sacrificed 24 h after TCPOBOP. BrdU was given 2 h before sacrifice; shc (scrambled shRNA), shjun (shRNA anti-c-jun). (B) LI and (C) MI. Results are expressed as means ± SE of 4 mice per group.

Fig. 4. Gene expression profile following TCPOBOP administration. (A) Heat Map of cell cycle genes regulated in at least one time point, 1, 3 and 6 h after TCPOBOP (Top panel), and Table showing fold change values of the same genes (Lower panel). Cell cycle genes are listed that showed an elevation >2 times (red) or reduction >2 times (green) compared to the untreated liver, on three 1-, 3-, and 6-h arrays and were beyond these cut offs on at least 2 arrays. (B) Genes related to early changes after PH. Genes are listed that showed an elevation >2 times (red) or a reduction >2 times (green) compared to the untreated liver on three 1-, 3-, and 6-h arrays and were beyond these cut offs on at least 2 arrays.

Fig. 5. Effect of T3 on hepatocyte proliferation. (A and B) Representative microphotographies showing a higher number of BrdU-positive hepatocytes and mitoses (arrows) (200×) in c-junΔli compared with c-junf/f mice, 5 days after T3 treatment. (C) LI and (D) MI. BrdU was given continuously in drinking water. Results are expressed as means ± SE of 4 mice per group. Statistically significant forp <0.05 from c-junf/f mice. (E) Western blot analysis of cell cycle-related proteins in c-junΔli and c- junf/f mice treated with T3. Numbers below the blots represent quantification of the bands normalized to actin. Each lane represents an individual sample. PCNA and Cyclin A of c-junΔli were significantly different from c-junf/f mice for p <0.001 and p <0.05, respectively.

Fig. 6. Occurrence of HCC inc-junf/f andc-junΔli mice. (A) Percentage of relative liver weight, liver tissue occupied by tumors, number of tumors/cm2, and mean tumor area in c-junf/f and c-junΔli mice sacrificed 20 and 27 weeks after initiation. The results of tumor analyses represent mean values of 14 and 12 (20 and 27 weeks, respectively), c-junΔli tumors and 11 and 20 c-junf/f tumors. Total number of mice examined was 9 (5 + 4) for c-junΔli and 13 (5 + 8) for c-junf/f mice. (B) Livers of c- junf/f and c-junΔli mice 27 weeks after initiation with DENA and promotion with TCPOBOP. Tumors are shown by dotted circles. Adenocarcinoma showing neoplastic cells arranged in the liver of a c- junΔli mouse in a broad adenomatous pattern with dilated lumen and frequent papillary projections (H&E, 200×). The tumor shows irregularly arranged acinar and tubular patterns. (C) Immunostaining of BrdU of c-junf/fand c-junΔli tumors (200×); H&E staining showing aberrant mitosis and nuclear atypia in a HCC from c-junΔli mice (H&E, 400×) and apoptotic bodies in c- junf/f and c-junΔli tumors (arrows); TUNEL staining for apoptotic cells. Green fluorescence indicates apoptotic cells. (D) Real Time-PCR analysis of GADD45β, Cyp3a11, and p21 in tumors from c- junΔli and c-junf/f mice. Results are expressed as means ± SE of 5 HCCs per group.

REFERENCES

[1] E. Shaulian, M. Karin, AP-1 in cell proliferation and survival. Oncogene, 20 (2001), pp. 2390–2400

[2] A. Behrens, M. Sibilia, J.P. David, U. Möhle-Steinlein, F. Tronche, G. Schütz, et al. Impaired postnatal hepatocyte proliferation and liver regeneration in mice lacking c-jun in the liver. EMBO J, 21 (2002), pp. 1782–1790

[3] E. Stepniak, R. Ricci, R. Eferl, G. Sumara, I. Sumara, M. Rath, et al. C-Jun/AP-1 controls liver regeneration by repressing p53/p21 and p38 MAPK activity. Genes Dev, 20 (2006), pp. 2306– 2314

[4] R. Eferl, R. Ricci, L. Kenner, R. Zenz, J.P. David, M. Rath, et al. Tumor development: c-jun antagonizes the proapoptotic activity of p53. Cell, 112 (2003), pp. 181–192

[5] A. Columbano, H. Shinozuka. Liver regeneration versus direct hyperplasia. FASEB J, 10 (1996), pp. 1118–1128

[6] G.M. Ledda-Columbano, A. Columbano Mitogenesis by ligands of nuclear receptors: an attractive model for the study of the molecular mechanisms implicated in liver growth. Cell Death Differ, 10 (Suppl. 1) (2003), pp. S19–21

[7] S.S. Lee, T. Pineau, J. Drago, E.J. Lee, J.W. Owens, D.L. Kroetz, et al. Targeted disruption of the alpha isoform of the peroxisome proliferator-activated receptor gene in mice results in abolishment of the pleiotropic effects of peroxisome proliferators. Mol Cell Biol, 15 (1995), pp. 3012–3022

[8] P. Wei, J. Zhang, M. Egan-Hafley, S. Liang, D.D. Moore. The nuclear receptor CAR mediates specific xenobiotic induction of drug metabolism. Nature, 407 (2000), pp. 920–923

[9] S.A. Kliewer, K. Umesono, D.J. Mangelsdorf, R.M. Evans. Retinoid X receptor interacts with nuclear receptors in retinoic acid, thyroid hormone and vitamin D3 signalling Nature, 355 (1992), pp. 446–449

[10] G.K. Michalopoulos. Liver regeneration. J Cell Physiol, 213 (2007), pp. 286–300

[11] S. Skrtic, S. Ekberg, V. Wallenius, S. Enerbäck, L. Hedin, J.O. Jansson. Changes in expression of CCAAT/enhancer binding protein alpha (C/EBP alpha) and C/EBP beta in rat liver after partial hepatectomy but not after treatment with cyproterone acetate. J Hepatol, 27 (1997), pp. 903–911

[12] G.M. Ledda-Columbano, M. Curto, R. Piga, A.I. Zedda, M. Menegazzi, C. Sartori, et al. In vivo hepatocyte proliferation is inducible through a TNF and IL-6-independent pathway. Oncogene, 17 (1998), pp. 1039–1044

[13] M. Pibiri, G.M. Ledda-Columbano, C. Cossu, G. Simbula, M. Menegazzi, H. Shinozuka, et al. Cyclin D1 is an early target in hepatocyte proliferation induced by thyroid hormone (T3). FASEB J, 15 (2001), pp. 1006–1013 [14] E. Vigna, L. Naldini. Lentiviral vectors: excellent tools for experimental gene transfer and promising candidates for gene therapy. J Gene Med, 2 (2000), pp. 308–316

[15] H.L. Stewart, G. Williams, C.H. Keysser, L.S. Lombard, R.J. Montali Institute of laboratory animal resources: histological typing of liver tumors of the rat. J Natl Cancer Inst, 64 (1980), pp. 179–206

[16] K. Burton. A study of the conditions and mechanism of the diphenylamine reaction for the colorimetric estimation of deoxyribonucleic acid. Biochem J, 62 (1956), pp. 315–323

[17] H. Herbst, S. Milani, D. Schuppan, H. Stein. Temporal and spatial patterns of proto- oncogene expression at early stages of toxic liver injury in the rat. Lab Invest, 65 (1991), pp. 324–333

[18] C. Fang, S. Yoon, N. Tindberg, H.A. Järveläinen, K.O. Lindros, M. Ingelman-Sundberg. Hepatic expression of multiple acute phase proteins and down-regulation of nuclear receptors after acute endotoxin exposure. Biochem Pharmacol, 67 (2004), pp. 1389–1397

[19] L. Hui, K. Zatloukal, H. Scheuch, E. Stepniak, E.F. Wagner. Proliferation of human HCC cells and chemically induced mouse liver cancers requires JNK1-dependent p21 downregulation. J Clin Invest, 118 (2008), pp. 3943–3953

[20] T.A. Richardson, E.T. Morgan. Hepatic cytochrome P450 gene regulation during endotoxin-induced inflammation in nuclear receptor knockout mice. J Pharmacol Exp Ther, 314 (2005), pp. 703–709

[21] P.J. Van Ess, M.P. Mattson, R.A. Blouin. Enhanced induction of cytochrome P450 enzymes and CAR binding in TNF (p55(−/−)/p75(−/−)) double receptor knockout mice following phenobarbital treatment. J Pharmacol Exp Ther, 300 (2002), pp. 824–830

[22] A. Columbano, G.M. Ledda-Columbano, M. Pibiri, C. Cossu, M. Menegazzi, D.D. Moore, et al. Gadd45β is induced through a CAR-dependent, TNF-independent pathway in murine liver hyperplasia. Hepatology, 42 (2005), pp. 1118–1126

[23] Y. Yamamoto, R. Moore, R.A. Flavell, B. Lu, M. Negishi. Nuclear receptor CAR represses TNFalpha-induced cell death by interacting with the anti-apoptotic GADD45β. PLoS One, 5 (2010), p. e10121

[24] S. Papa, F. Zazzeroni, Y.X. Fu, C. Bubici, K. Alvarez, K. Dean, et al. Gadd45beta promotes hepatocyte survival during liver regeneration in mice by modulating JNK signaling. J Clin Invest, 118 (2006), pp. 1911–1923

[25] K.H. Lin, H.Y. Shieh, S.L. Chen, H.C. Hsu. Expression of mutant thyroid hormone nuclear receptors in human hepatocellular carcinoma cells. Mol Carcinogenesis, 26 (1999), pp. 53–61

[26] Wu SM, Huang YH, Yeh CT, Tsai MM, Liao CH, Cheng WL, Chen WJ, Lin KH. Cathepsin H regulated by the thyroid hormone receptors associate with tumor invasion in human hepatoma cells. Oncogene 2011:Jan 10 [Epub ahead of print).

[27] K. Yoshinari, T. Sueyoshi, R. Moore, M. Negishi. Nuclear receptor CAR as a regulatory factor for the sexually dimorphic induction of CYB2B1 gene by phenobarbital in rat livers. Mol Pharmacol, 59 (2001), pp. 278–284

[28] G.M. Ledda-Columbano, M. Pibiri, D. Concas, F. Molotzu, G. Simbula, C. Cossu, et al. Sex difference in the proliferative response of mouse hepatocytes to treatment with the CAR ligand, TCPOBOP. Carcinogenesis, 24 (2003), pp. 1059–1065

[29] I. Tzameli, P. Pissios, E.G. Schuetz, D.D. Moore. The xenobiotic compound 1,4-bis[2-(3,5- dichloropyridyloxy)]benzene is an agonist ligand for the nuclear receptor CAR. Mol Cell Biol, 20 (2000), pp. 2951–2958

[30] T. Sueyoshi, M. Negishi. Phenobarbital response elements of cytochrome P450 genes and nuclear receptors. Annu Rev Pharmacol Toxicol, 41 (2001), pp. 123–143

[31] F. Chen, K. Beezhold, V. Castranova. JNK1, a potential therapeutic target for hepatocellular carcinoma. Biochim Biophys Acta, 1796 (2009), pp. 242–251

[32] M. Endo, K. Yasui, T. Nakajima, Y. Gen, K. Tsuji, O. Dohi, et al. Infrequent Amplification of JUN in hepatocellular carcinoma. Anticancer Res, 29 (2009), pp. 4989–4994

[33] H. Okamoto, K. Yasui, C. Zhao, S. Arii, J. Inazawa. PTK2 and EIF3S3 genes may be amplification targets at 8q23–q24 and are associated with large hepatocellular carcinomas. Hepatology, 38 (2003), pp. 1242–1249

[34] H. Katoh, H. Ojima, A. Kokubu, S. Saito, T. Kondo, T. Kosuge, et al. Genetically distinct and clinically relevant classification of hepatocellular carcinoma: putative therapeutic targets. Gastroenterology, 133 (2007), pp. 1475–1486

Fig. S1

c-junf/f c-junΔli A f Δli

ff Δli M B

Δli f

Fig. S2

DENA KILL KILL 90mg/kg i.p.

TCPOBOP 3mg/kg i.g. once weekly

0 1 weeks 20 27 Fig. S3

A Jo2 c-junf/f control c-junΔli control

c-junf/f +TCP c-junΔli +TCP * 12

) 10 % (

e 8 i d o b

6 c i t o t 4 p o p

A 2

0 c-junf/f control c-junf/f+TCP Jo2 c-junΔli control c-junΔli+TCP

B 120 )

L 100 / U (

s e

s 80 a n i m

a 60 s ALT n

a AST r t

m 40 u r e

S 20

0 c-junf/f c-junΔli c-junf/f+TCP c-junΔli+TCP Suppl. Fig.4

A B shc shjun pool pool NIH 3T3 MLP29 shc shjun shc shjun c-jun vinculin ) 2 120 m m / T N

I 100 (

2% FBS 2% FBS 20% FBS 2% FBS 20% FBS 20% FBS 20% y t i s

n 80 e d

n i l 60 c-jun u c n i V 40 s u s r e

v 20

vinculin n u J 0 % shc pool shjun pool

) TCPO BO P 2

m 1,2 m / T

N 1 I (

y t i

s 0,8 n e D

i 0,6 l

u shc shjun c n i 0,4 V

s u s

r 0,2 e v

U 0

J c-jun shc 2% FBS shc 20% FBS shjun 2% FBS shjun 20% FBS

NIH 3T3 vinculin ) ) 2

2 0,8

m 1,2 m m / m / 0,7 T T N I

N 1 ( I

(

0,6 t y i t i s s n 0,8 n 0,5 e e D

n i n l

i 0,4

l 0,6 u u c c n i n

i 0,3 V

0,4 s s u u 0,2 s r s r e e v

0,2 v

0,1 N N U U J

J 0 e 0 g a shc 20% FBS shjun 20% FBS r

e shc shjun v M LP29 A CCl 4 Fig. S5

0 1 3 6 0 1 3 6 0 1 3 6 hours hours hours

0 1 3 6 hours Fig. S6

A B c-junf/f c-junΔli ) 80 ) n n 14 o o i i t t a 70 a c c i f/f Δli i f f 12 i c-jun | c-jun i t t n 60 n a CO | TCP 3h | CO | TCP 3h a u u 10 q q

50 e v v i i t CAR t 8 a a l 40 l e e r r ( (

0.80 0.66 1.09 0.89 0.91 0.85 1.18 1.27 1.81 1.53 6 A 30 A N N R R

m 4 m

Actin 20 β 1 5 1 4 A 2 D

10 3

D p A y

G 0 C 0 c-junf/f c-junΔli +TCP 18 hrs +TCP 24 hrs c-junf/f c-junΔli +TCP 18 hrs +TCP 24 hrs

C D CO │CCl4 │ PB │ TCP 70 Phospho-JNK ) 60 n o i t a c i 50 f i t n a u

q 40

e JNK v i t a l

e 30 r (

A N

R 20 m

n u j

- 10 Actin c

0 Control CCl4 TCP PB

Fig S7 Gene Sets Regulated by 3 hrs TCPOBOP treatment in c-junf/f NES* p-val q-val *NES: Normalized Enrichment Score Up-regulated P53 SIGNALING PATHWAY 2.23 0.00 0.07 OXIDATIVE PHOSPHORYLATION 2.09 0.00 0.11 Common Gene Sets between c- CELL CYCLE 2.07 0.00 0.08 junΔli and c-junf/f GLUTATHIONE METABOLISM 2.05 0.01 0.07 NON SMALL CELL LUNG CANCER 1.99 0.00 0.09 MTOR SIGNALING PATHWAY 1.97 0.00 0.08 ETHER LIPID METABOLISM 1.96 0.01 0.07 GLYCEROPHOSPHOLIPID METABOLISM 1.94 0.01 0.07 GLYCINE SERINE AND THREONINE METABOLISM 1.93 0.01 0.07 ALPHA LINOLENIC ACID METABOLISM 1.89 0.01 0.08 THYROID CANCER 1.83 0.01 0.12 ARACHIDONIC ACID METABOLISM 1.83 0.01 0.11 AMINOACYL TRNA BIOSYNTHESIS 1.81 0.01 0.12 SMALL CELL LUNG CANCER 1.79 0.01 0.11 SELENOAMINO ACID METABOLISM 1.79 0.02 0.11 NICOTINATE AND NICOTINAMIDE METABOLISM 1.73 0.03 0.14 LINOLEIC ACID METABOLISM 1.70 0.04 0.16 ALANINE AND ASPARTATE METABOLISM 1.69 0.03 0.16 ERBB SIGNALING PATHWAY 1.68 0.02 0.17 BASAL TRANSCRIPTION FACTORS 1.67 0.03 0.16 ENDOMETRIAL CANCER 1.65 0.04 0.18 PROSTATE CANCER 1.62 0.03 0.20 ACUTE MYELOID LEUKEMIA 1.58 0.04 0.23 INSULIN SIGNALING PATHWAY 1.57 0.04 0.23 PORPHYRIN AND CHLOROPHYLL METABOLISM 1.55 0.06 0.25 GLIOMA 1.54 0.07 0.24 BLADDER CANCER 1.53 0.08 0.25

Gene Sets Regulated by 3 hrs TCPOBOP treatment in c-junΔli NES* p-val q-val

Up-regulated RIBOSOME 3.13 0.00 0.00 OXIDATIVE PHOSPHORYLATION 2.74 0.00 0.00 PROTEASOME 2.68 0.00 0.00 P53 SIGNALING PATHWAY 2.55 0.00 0.00 PYRUVATE METABOLISM 2.00 0.01 0.13 GAP JUNCTION 1.93 0.01 0.17 CELL CYCLE 1.89 0.01 0.18 METABOLISM OF XENOBIOTICS BY CYTOCHROME P450 1.85 0.01 0.20 CHRONIC MYELOID LEUKEMIA 1.83 0.01 0.19 PORPHYRIN AND CHLOROPHYLL METABOLISM 1.77 0.03 0.24 RENAL CELL CARCINOMA 1.77 0.02 0.22

GLUTATHIONE METABOLISM 1.75 0.03 0.22 Down-regulated ABC TRANSPORTERS GENERAL -3.04 0.00 0.00 NEUROACTIVE LIGAND RECEPTOR INTERACTION -2.30 0.00 0.01 Supporting TABLE 3. Analysis of the Expression of Cell Cycle Genes 1, 3, and 6 Hours after TCPOBOP.

f/f f/f f/f ∆li ∆li ∆li ∆li f/f f/f f/f c-jun f/f c-jun f/f c-jun ∆li c-jun ∆li c-jun ∆li c-jun 3 ∆li c-jun c-jun c-jun basal c-jun c-jun c-jun c-jun c-jun c-jun c-jun 1 hour 3 hours 6 hours basal 1 hour hours 6 hours Gene basal (Detection 1 hour 3 hours 6 hours basal 1 hour 3 hours 6 hours (Detection (Detection (Detection (Detection (Detection (Detection (Detection (signal) Pval) (signal) (signal) (signal) (signal) (signal) (signal) (signal) Pval) Pval) Pval) Pval) Pval) Pval) Pval)

2010005J08Rik 425 0,0000 405 0,0000 529 0,0000 343 0,0000 416 0,0000 370 0,0000 391 0,0000 408 0,0000 2400003C14Rik 1668 0,0000 1760 0,0000 1162 0,0000 1782 0,0000 1773 0,0000 1656 0,0000 1791 0,0000 1652 0,0000 2610039C10Rik 440 0,0000 533 0,0000 313 0,0000 454 0,0000 572 0,0000 706 0,0000 590 0,0000 493 0,0000 2810021B07Rik 427 0,0000 427 0,0000 261 0,0000 420 0,0000 468 0,0000 394 0,0000 342 0,0000 401 0,0000 2810452K22Rik 582 0,0000 669 0,0000 652 0,0000 706 0,0000 613 0,0000 648 0,0000 686 0,0000 631 0,0000 4933424B01Rik 400 0,0000 401 0,0000 403 0,0000 461 0,0000 405 0,0000 391 0,0000 413 0,0000 397 0,0000 Adra1a 184 0,0003 195 0,0000 183 0,0000 164 0,0181 208 0,0034 203 0,0005 189 0,0000 210 0,0001 Adra1b 208 0,0000 189 0,0000 284 0,0000 194 0,0000 214 0,0000 194 0,0000 196 0,0000 216 0,0000 Als2 2149 0,0000 2357 0,0000 1900 0,0000 2039 0,0000 1893 0,0000 1791 0,0000 1608 0,0000 1468 0,0000 Anapc13 7149 0,0000 8135 0,0000 9382 0,0000 6830 0,0000 7034 0,0000 7458 0,0000 7026 0,0000 7262 0,0000 Anapc2 375 0,0000 422 0,0000 389 0,0000 319 0,0000 344 0,0000 358 0,0000 352 0,0000 306 0,0000 Anapc4 890 0,0000 1037 0,0000 821 0,0000 840 0,0000 923 0,0000 902 0,0000 846 0,0000 845 0,0000 Anapc5 1975 0,0000 2300 0,0000 1854 0,0000 1751 0,0000 2122 0,0000 1836 0,0000 1722 0,0000 1654 0,0000 Anapc7 1130 0,0000 1319 0,0000 1474 0,0000 979 0,0000 1165 0,0000 1004 0,0000 1039 0,0000 1109 0,0000 Ankrd54 258 0,0000 242 0,0000 270 0,0000 240 0,0000 247 0,0000 212 0,0000 226 0,0000 239 0,0000 Apbb2 490 0,0000 441 0,0000 435 0,0000 402 0,0000 499 0,0000 440 0,0000 415 0,0000 428 0,0000 Arl2 285 0,0000 280 0,0000 344 0,0000 262 0,0000 341 0,0000 275 0,0000 292 0,0000 358 0,0000 Arl3 762 0,0000 669 0,0000 870 0,0000 685 0,0000 636 0,0000 741 0,0000 722 0,0000 644 0,0000 Atm 205 0,0000 223 0,0000 169 0,0000 184 0,0000 233 0,0000 207 0,0000 191 0,0000 173 0,0029 Atp6ap1 7320 0,0000 7779 0,0000 6478 0,0000 7859 0,0000 6898 0,0000 6606 0,0000 7022 0,0000 7392 0,0000 Atp6v0e 4484 0,0000 3997 0,0000 4317 0,0000 4665 0,0000 3745 0,0000 4495 0,0000 4724 0,0000 4702 0,0000 Avpi1 1485 0,0000 1041 0,0000 1427 0,0000 1239 0,0000 1027 0,0000 1028 0,0000 949 0,0000 936 0,0000 Axin2 374 0,0000 387 0,0000 485 0,0000 373 0,0000 489 0,0000 363 0,0000 463 0,0000 533 0,0000 BC024139 447 0,0000 455 0,0000 537 0,0000 334 0,0000 510 0,0000 454 0,0000 481 0,0000 433 0,0000 Bccip 6065 0,0000 4558 0,0000 4860 0,0000 5794 0,0000 5234 0,0000 5125 0,0000 5686 0,0000 5424 0,0000 Bcl10 1228 0,0000 1392 0,0000 902 0,0000 1069 0,0000 1189 0,0000 1572 0,0000 1319 0,0000 1045 0,0000 Bin1 283 0,0478 ND 0,5212 ND 0,1464 ND 0,1487 ND 0,0625 ND 0,1543 ND 0,0981 ND 0,1061 Brms1 1765 0,0000 2115 0,0000 2228 0,0000 1819 0,0000 2114 0,0000 1884 0,0000 2018 0,0000 2330 0,0000 Cables2 207 0,0000 216 0,0000 280 0,0000 241 0,0000 225 0,0000 226 0,0000 222 0,0000 250 0,0000 Calm2 2213 0,0000 1655 0,0000 1733 0,0000 2039 0,0000 1769 0,0000 2473 0,0000 2286 0,0000 1831 0,0000 Calm3 4300 0,0000 4181 0,0000 3820 0,0000 3494 0,0000 3557 0,0000 3491 0,0000 3442 0,0000 3221 0,0000 Calr 1389 0,0000 1604 0,0000 2448 0,0000 2820 0,0000 1235 0,0000 2017 0,0000 2165 0,0000 2535 0,0000 Casp1 589 0,0000 570 0,0000 437 0,0000 563 0,0000 493 0,0000 542 0,0000 517 0,0000 519 0,0000 Ccar1 1036 0,0000 1015 0,0000 982 0,0000 1390 0,0000 1039 0,0000 1021 0,0000 1320 0,0000 1523 0,0000 Ccdc5 322 0,0000 334 0,0000 375 0,0000 323 0,0000 307 0,0000 342 0,0000 355 0,0000 355 0,0000 Ccnd1 2036 0,0000 3454 0,0000 6183 0,0000 11073 0,0000 5668 0,0000 3019 0,0000 5555 0,0000 11690 0,0000 Ccnd2 604 0,0000 641 0,0000 422 0,0000 829 0,0000 577 0,0000 742 0,0000 633 0,0000 742 0,0000 Ccnd3 739 0,0056 795 0,0005 1112 0,0000 797 0,0007 1020 0,0067 863 0,0000 871 0,0006 840 0,0006 Ccndbp1 508 0,0000 494 0,0000 629 0,0000 494 0,0000 520 0,0000 590 0,0000 646 0,0000 561 0,0000 Ccng1 839 0,0000 794 0,0000 558 0,0000 726 0,0000 883 0,0000 967 0,0000 885 0,0000 717 0,0000 Ccng2 364 0,0000 515 0,0000 263 0,0000 315 0,0000 452 0,0000 740 0,0000 549 0,0000 350 0,0000 Ccnt1 736 0,0000 764 0,0000 801 0,0000 576 0,0000 541 0,0000 609 0,0000 606 0,0000 709 0,0000 Ccrk 323 0,0034 337 0,0007 321 0,0003 278 0,0023 341 0,0019 324 0,0009 305 0,0009 247 0,0059 Cdc16 797 0,0000 643 0,0000 456 0,0000 768 0,0000 701 0,0000 738 0,0000 792 0,0000 701 0,0000 Cdc20 162 0,0005 146 0,0053 204 0,0003 179 0,0007 271 0,0020 153 0,0017 159 0,0006 178 0,0003 Cdc23 468 0,0000 488 0,0000 446 0,0000 406 0,0000 524 0,0000 510 0,0000 522 0,0000 503 0,0000 Cdc25a 204 0,0000 233 0,0000 181 0,0000 302 0,0000 224 0,0000 206 0,0000 198 0,0000 244 0,0000 Cdc27 210 0,0000 231 0,0000 247 0,0000 220 0,0000 190 0,0000 214 0,0000 217 0,0000 225 0,0000 Cdc5l 889 0,0005 950 0,0003 810 0,0003 891 0,0006 856 0,0004 948 0,0003 937 0,0003 817 0,0004 Cdca3 216 0,0116 206 0,0332 260 0,0000 210 0,0006 326 0,0000 201 0,0198 ND 0,0684 ND 0,0658 Cdca7 565 0,0000 395 0,0000 340 0,0000 572 0,0000 407 0,0000 250 0,0000 285 0,0000 432 0,0000 Cdk2 460 0,0009 499 0,0014 353 0,0004 447 0,0006 596 0,0004 498 0,0132 489 0,0005 420 0,0004 Cdk2ap1 7848 0,0000 9051 0,0000 6161 0,0000 10621 0,0000 7184 0,0000 7657 0,0000 8165 0,0000 8786 0,0000 Cdk5 336 0,0000 367 0,0000 327 0,0000 256 0,0000 353 0,0000 293 0,0000 290 0,0000 283 0,0000 Cdkn1a ND 0,1164 724 0,0000 371 0,0000 180 0,0437 191 0,0163 503 0,0000 632 0,0000 259 0,0012 Cdkn1c 734 0,0000 967 0,0000 1101 0,0000 708 0,0000 1155 0,0000 1273 0,0000 1084 0,0000 1063 0,0000 Cdkn2c 490 0,0000 436 0,0000 540 0,0000 349 0,0033 544 0,0000 557 0,0000 509 0,0000 461 0,0000 Cdkn2d 247 0,0000 191 0,0000 224 0,0000 194 0,0000 230 0,0000 196 0,0000 181 0,0000 175 0,0000 Cetn2 273 0,0000 208 0,0000 283 0,0000 251 0,0000 240 0,0000 289 0,0000 278 0,0000 228 0,0000 Cetn3 2784 0,0000 2808 0,0000 1330 0,0000 3224 0,0000 2710 0,0000 3309 0,0000 3079 0,0000 2677 0,0000 Chaf1a 177 0,0000 183 0,0000 189 0,0000 194 0,0000 210 0,0000 172 0,0000 164 0,0000 198 0,0000 Chaf1b 218 0,0000 224 0,0000 273 0,0000 407 0,0000 220 0,0000 207 0,0000 266 0,0000 365 0,0000 Chfr ND 0,0569 ND 0,1354 322 0,0451 ND 0,0545 ND 0,0556 ND 0,0573 437 0,0428 434 0,0204 Clu 39963 0,0000 35854 0,0000 43914 0,0000 36307 0,0000 38688 0,0000 34978 0,0000 35714 0,0000 41955 0,0000 Commd5 1035 0,0000 995 0,0000 1431 0,0000 1043 0,0000 1085 0,0000 974 0,0000 946 0,0000 1234 0,0000 Csrp2bp 861 0,0047 975 0,0103 703 0,0054 840 0,0193 879 0,0183 774 0,0005 751 0,0011 797 0,0015 Ctcf 550 0,0000 729 0,0000 670 0,0000 549 0,0000 588 0,0000 600 0,0000 559 0,0000 538 0,0000 Ctcfl 274 0,0000 190 0,0000 300 0,0000 367 0,0000 175 0,0000 223 0,0000 313 0,0000 250 0,0000 Cul7 468 0,0000 530 0,0000 539 0,0000 285 0,0000 527 0,0000 459 0,0000 449 0,0000 419 0,0000 Dab2ip 530 0,0000 551 0,0000 469 0,0000 431 0,0000 552 0,0000 520 0,0000 422 0,0000 350 0,0000 Dbf4 202 0,0000 209 0,0000 224 0,0000 231 0,0000 232 0,0000 226 0,0000 245 0,0000 205 0,0000 Dctn3 2104 0,0000 1916 0,0000 2571 0,0000 2096 0,0000 1962 0,0000 2088 0,0000 2114 0,0000 2403 0,0000 Ddb1 734 0,0000 788 0,0000 1072 0,0000 680 0,0000 696 0,0000 611 0,0000 636 0,0000 779 0,0000 Ddit3 282 0,0000 322 0,0000 492 0,0000 356 0,0000 358 0,0000 261 0,0000 314 0,0000 433 0,0000 Dmtf1 288 0,0173 331 0,0032 245 0,0325 323 0,0364 334 0,0196 320 0,0050 302 0,0229 325 0,0066 Dnaja3 4262 0,0002 4194 0,0013 3779 0,0000 6135 0,0000 4338 0,0012 4462 0,0009 5119 0,0000 5793 0,0000 Dusp1 1630 0,0000 3778 0,0000 2433 0,0000 1683 0,0000 1739 0,0000 5951 0,0000 3510 0,0000 2217 0,0000 E2f1 282 0,0000 235 0,0000 244 0,0000 305 0,0000 338 0,0000 296 0,0000 270 0,0000 256 0,0000 E2f2 188 0,0116 186 0,0320 387 0,0096 ND 0,0788 179 0,0325 184 0,0097 ND 0,1259 599 0,0257 E2f3 205 0,0000 214 0,0000 202 0,0000 248 0,0000 205 0,0000 245 0,0000 251 0,0000 259 0,0000 E2f4 394 0,0000 408 0,0000 384 0,0000 421 0,0000 348 0,0000 310 0,0000 318 0,0000 466 0,0000 E2f6 1251 0,0000 1344 0,0000 1251 0,0000 1680 0,0000 1368 0,0000 1292 0,0000 1383 0,0000 1449 0,0000 E4f1 243 0,0000 266 0,0000 274 0,0000 206 0,0000 293 0,0000 193 0,0000 226 0,0000 266 0,0000 Emp1 292 0,0000 447 0,0000 376 0,0000 425 0,0000 252 0,0000 582 0,0000 303 0,0000 341 0,0000 Emp2 948 0,0000 1086 0,0000 592 0,0000 434 0,0000 946 0,0000 753 0,0000 667 0,0000 387 0,0000 Emp3 356 0,0000 331 0,0000 437 0,0000 382 0,0000 269 0,0000 317 0,0000 304 0,0000 409 0,0000 Ercc3 1105 0,0000 1216 0,0000 795 0,0000 1472 0,0000 1109 0,0000 1103 0,0000 1155 0,0000 1246 0,0000 Erh 3717 0,0000 3689 0,0000 3836 0,0000 4204 0,0000 2943 0,0000 3379 0,0000 3446 0,0000 3974 0,0000 Evi5 3354 0,0000 4288 0,0000 2266 0,0000 2962 0,0000 4101 0,0000 4358 0,0000 3623 0,0000 2719 0,0000 Faf1 1616 0,0074 1620 0,0413 1245 0,0209 ND 0,0932 1580 0,0403 ND 0,0853 ND 0,0740 ND 0,0921 Fzr1 887 0,0000 994 0,0000 927 0,0000 790 0,0000 949 0,0000 843 0,0000 817 0,0000 787 0,0000 G0s2 2060 0,0000 3144 0,0000 5504 0,0000 2086 0,0000 3818 0,0000 2668 0,0000 7191 0,0000 4702 0,0000 Gadd45a 715 0,0000 476 0,0000 1711 0,0000 1415 0,0000 665 0,0000 732 0,0000 2446 0,0000 2104 0,0000 Gak 6048 0,0000 6579 0,0000 5817 0,0000 5434 0,0000 6425 0,0000 5513 0,0000 5736 0,0000 5913 0,0000 Gas2 316 0,0000 264 0,0000 205 0,0000 255 0,0000 264 0,0000 278 0,0000 268 0,0000 232 0,0000 Gas2l1 240 0,0006 254 0,0000 370 0,0011 284 0,0001 232 0,0000 213 0,0004 239 0,0002 285 0,0030 H2afx 522 0,0000 530 0,0000 773 0,0000 1007 0,0000 516 0,0000 533 0,0000 637 0,0000 921 0,0000 Hcfc1 1035 0,0000 1135 0,0000 701 0,0000 1038 0,0000 1177 0,0000 1157 0,0000 1056 0,0000 957 0,0000 Hhex 4570 0,0000 3841 0,0000 3220 0,0000 4464 0,0000 2877 0,0000 2493 0,0000 3818 0,0000 4405 0,0000 Hipk2 261 0,0000 341 0,0000 395 0,0000 216 0,0000 339 0,0000 260 0,0000 245 0,0000 302 0,0000 Hmg20b 581 0,0000 695 0,0000 645 0,0000 502 0,0000 575 0,0000 552 0,0000 566 0,0000 534 0,0000 Hmox1 540 0,0000 379 0,0000 832 0,0000 487 0,0000 373 0,0000 463 0,0000 538 0,0000 581 0,0000 Hpn 2076 0,0000 1776 0,0000 3114 0,0000 2070 0,0000 2305 0,0000 2119 0,0000 2224 0,0000 2346 0,0000 Htatip2 5554 0,0000 4702 0,0000 5037 0,0000 3798 0,0000 6066 0,0000 6112 0,0000 5166 0,0000 4813 0,0000 Hyal1 1358 0,0000 1588 0,0000 1242 0,0000 1025 0,0000 1361 0,0000 985 0,0000 890 0,0000 800 0,0000 Ilk 1011 0,0048 993 0,0015 829 0,0001 947 0,0000 1102 0,0001 922 0,0001 1014 0,0005 1149 0,0001 Ing4 842 0,0000 1036 0,0000 1029 0,0000 780 0,0000 995 0,0000 814 0,0000 714 0,0000 860 0,0000 Inhba 426 0,0000 514 0,0000 410 0,0000 497 0,0000 256 0,0000 248 0,0000 269 0,0000 321 0,0000 Katna1 1216 0,0000 1326 0,0000 2291 0,0000 3934 0,0000 1348 0,0000 1435 0,0000 3313 0,0000 5322 0,0000 Khdrbs1 319 0,0000 286 0,0000 333 0,0000 426 0,0000 343 0,0000 329 0,0000 341 0,0000 392 0,0000 Lepre1 205 0,0000 199 0,0000 246 0,0000 233 0,0000 203 0,0000 194 0,0000 202 0,0000 235 0,0000 Lig3 514 0,0000 471 0,0000 444 0,0000 544 0,0000 455 0,0000 438 0,0000 470 0,0000 497 0,0000 Lzts2 393 0,0000 372 0,0000 300 0,0000 362 0,0000 391 0,0000 333 0,0000 302 0,0000 293 0,0000 Mad1l1 302 0,0000 307 0,0000 578 0,0000 486 0,0000 288 0,0000 265 0,0000 458 0,0000 722 0,0000 Mad2l1 216 0,0000 223 0,0000 182 0,0000 237 0,0000 275 0,0000 254 0,0000 256 0,0000 236 0,0000 Mad2l2 402 0,0000 532 0,0000 577 0,0000 334 0,0000 363 0,0000 506 0,0000 451 0,0000 311 0,0000 Maea 186 0,0000 210 0,0000 263 0,0000 261 0,0000 239 0,0000 261 0,0000 249 0,0000 287 0,0000 Mafb ND 0,5147 167 0,0000 ND 0,1682 ND 0,1787 ND 0,1096 228 0,0000 ND 0,1518 ND 0,1641 Map3k11 1547 0,0000 1826 0,0000 1801 0,0000 1462 0,0000 1553 0,0000 1529 0,0000 1498 0,0000 1419 0,0000 Mapk1 1423 0,0000 1288 0,0000 1394 0,0000 1592 0,0000 1676 0,0000 1798 0,0000 1889 0,0000 1945 0,0000 Mapk12 ND 0,0648 178 0,0223 167 0,0106 185 0,0016 192 0,0176 175 0,0009 ND 0,0881 210 0,0007 Mapk3 233 0,0000 240 0,0000 291 0,0000 197 0,0000 250 0,0000 219 0,0000 238 0,0000 228 0,0000 Mapk6 767 0,0000 597 0,0000 494 0,0000 751 0,0000 606 0,0000 634 0,0000 657 0,0000 743 0,0000 Mapre1 1732 0,0000 2609 0,0000 2004 0,0000 2685 0,0000 1828 0,0000 2279 0,0000 2309 0,0000 2468 0,0000 Mapre2 387 0,0000 340 0,0000 243 0,0000 322 0,0000 362 0,0000 358 0,0000 310 0,0000 298 0,0000 Mcm2 207 0,0000 183 0,0000 191 0,0000 417 0,0000 210 0,0000 200 0,0000 219 0,0000 456 0,0000 Mcm5 284 0,0000 266 0,0000 346 0,0000 666 0,0000 410 0,0000 305 0,0000 326 0,0000 545 0,0000 Mcts1 2752 0,0000 3142 0,0000 2555 0,0000 3218 0,0000 2950 0,0000 3683 0,0000 3580 0,0000 2977 0,0000 Mnat1 492 0,0000 418 0,0000 419 0,0000 419 0,0000 460 0,0000 458 0,0000 408 0,0000 391 0,0000 Msh2 234 0,0000 215 0,0000 247 0,0000 193 0,0000 235 0,0000 222 0,0000 196 0,0000 179 0,0000 Mtus1 ND 0,2829 ND 0,1805 ND 0,1287 ND 0,5820 ND 0,2852 971 0,0243 ND 0,1171 ND 0,3686 Nasp 333 0,0005 305 0,0016 378 0,0030 458 0,0000 347 0,0000 333 0,0161 368 0,0057 454 0,0002 Nat6 578 0,0000 641 0,0000 564 0,0000 387 0,0000 656 0,0000 501 0,0000 476 0,0000 480 0,0000 Nde1 432 0,0000 385 0,0000 491 0,0000 582 0,0000 485 0,0000 375 0,0000 431 0,0000 584 0,0000 Nedd1 962 0,0000 1169 0,0000 479 0,0000 988 0,0000 957 0,0000 1242 0,0000 1128 0,0000 874 0,0000 Nedd9 513 0,0000 679 0,0000 1894 0,0000 1783 0,0000 432 0,0000 683 0,0000 907 0,0000 1579 0,0000 Nek3 333 0,0000 301 0,0000 221 0,0000 260 0,0000 284 0,0000 272 0,0000 217 0,0000 211 0,0000 Nek6 263 0,0000 290 0,0000 301 0,0000 270 0,0000 215 0,0000 224 0,0000 173 0,0000 235 0,0000 Nek9 1486 0,0000 1377 0,0000 1064 0,0000 1466 0,0000 1434 0,0000 1206 0,0000 1260 0,0000 1384 0,0000 Nipbl 504 0,0000 514 0,0000 423 0,0000 495 0,0000 616 0,0000 491 0,0000 501 0,0000 523 0,0000 Npm1 8369 0,0000 8085 0,0000 6677 0,0000 9905 0,0000 7482 0,0000 9221 0,0000 7934 0,0000 7079 0,0000 Nudc 6104 0,0000 5855 0,0000 6642 0,0000 5726 0,0000 5485 0,0000 4967 0,0000 5060 0,0000 5453 0,0000 Nup62 979 0,0000 995 0,0000 773 0,0000 1263 0,0000 1045 0,0000 940 0,0000 1105 0,0000 982 0,0000 Pard3 184 0,0000 169 0,0020 218 0,0000 194 0,0012 193 0,0000 183 0,0003 190 0,0001 207 0,0000 Pard6a 462 0,0000 484 0,0000 453 0,0000 372 0,0000 443 0,0000 434 0,0000 414 0,0000 366 0,0000 Pard6g 227 0,0000 247 0,0000 203 0,0000 205 0,0000 218 0,0000 242 0,0000 230 0,0000 230 0,0000 Pdcd4 244 0,0000 242 0,0000 221 0,0000 239 0,0000 247 0,0000 305 0,0000 255 0,0000 197 0,0000 Pdcd6ip 227 0,0000 204 0,0000 403 0,0000 241 0,0000 238 0,0000 228 0,0000 232 0,0000 267 0,0000 Pelo 1919 0,0000 2166 0,0000 2864 0,0000 3486 0,0000 1969 0,0000 2169 0,0000 2638 0,0000 3313 0,0000 Pkd2 402 0,0000 396 0,0000 381 0,0000 355 0,0000 386 0,0000 367 0,0000 372 0,0000 312 0,0000 Plk1 146 0,0346 ND 0,0962 176 0,0000 ND 0,0720 217 0,0000 153 0,0051 147 0,0179 158 0,0051 Plk2 331 0,0000 278 0,0000 208 0,0000 258 0,0000 245 0,0000 230 0,0000 228 0,0000 213 0,0000 Plk3 867 0,0000 1734 0,0000 2064 0,0000 1763 0,0000 917 0,0000 2686 0,0000 1886 0,0000 2392 0,0000 Pmf1 486 0,0000 527 0,0000 626 0,0000 359 0,0000 454 0,0000 475 0,0000 495 0,0000 416 0,0000 Pml 608 0,0325 ND 0,0825 445 0,0433 474 0,0017 539 0,0019 515 0,0155 ND 0,0766 380 0,0273 Pmp22 ND 0,2277 ND 0,2832 ND 0,0655 ND 0,1409 ND 0,1980 ND 0,1709 242 0,0238 ND 0,1989 Pms2 201 0,0000 202 0,0000 158 0,0026 208 0,0000 201 0,0000 188 0,0000 178 0,0000 202 0,0000 Polb 346 0,0000 334 0,0000 443 0,0000 441 0,0000 341 0,0000 314 0,0000 375 0,0000 507 0,0000 Pols 885 0,0000 708 0,0000 589 0,0000 976 0,0000 737 0,0000 602 0,0000 697 0,0000 760 0,0000 Ppm1d 436 0,0000 483 0,0000 350 0,0000 456 0,0000 411 0,0000 483 0,0000 456 0,0000 406 0,0000 Ppm1g 833 0,0000 778 0,0000 917 0,0000 1326 0,0000 848 0,0000 812 0,0000 999 0,0000 1267 0,0000 Ppp1ca 6462 0,0000 6731 0,0000 9183 0,0000 5316 0,0000 5801 0,0000 6893 0,0000 6238 0,0000 5596 0,0000 Ppp1cc 156 0,0038 151 0,0167 207 0,0000 239 0,0000 171 0,0000 169 0,0000 187 0,0000 209 0,0000 Ppp6c 2111 0,0000 2225 0,0000 2390 0,0000 2743 0,0000 2311 0,0000 2431 0,0000 2728 0,0000 2837 0,0000 Prc1 201 0,0000 179 0,0000 289 0,0000 198 0,0000 422 0,0000 190 0,0000 211 0,0000 230 0,0000 Psme3 2711 0,0000 2719 0,0000 3404 0,0000 3103 0,0000 2344 0,0000 2011 0,0000 2351 0,0000 3356 0,0000 Pten 357 0,0000 307 0,0000 318 0,0000 454 0,0000 338 0,0000 511 0,0000 425 0,0000 347 0,0000 Rad17 355 0,0001 361 0,0005 452 0,0000 400 0,0000 345 0,0001 381 0,0000 421 0,0000 396 0,0000 Rad50 236 0,0029 ND 0,5595 ND 0,0903 ND 0,4309 ND 0,4150 ND 0,1561 ND 0,2708 ND 0,5163 Rassf1 347 0,0000 401 0,0000 351 0,0000 361 0,0000 413 0,0000 330 0,0000 346 0,0000 424 0,0000 Rassf4 318 0,0003 313 0,0003 361 0,0003 250 0,0003 317 0,0003 278 0,0003 260 0,0003 246 0,0003 Rassf5 866 0,0000 600 0,0000 655 0,0000 596 0,0000 867 0,0000 601 0,0000 546 0,0000 583 0,0000 Rb1 440 0,0000 477 0,0000 318 0,0000 434 0,0000 444 0,0000 544 0,0000 489 0,0000 414 0,0000 Rbm5 ND 0,1542 ND 0,1236 ND 0,1622 1066 0,0176 ND 0,1074 ND 0,0534 1182 0,0380 ND 0,1273 Reck 271 0,0000 219 0,0000 194 0,0000 221 0,0000 184 0,0000 189 0,0000 190 0,0000 193 0,0000 Rhob 1003 0,0000 1193 0,0000 931 0,0000 1135 0,0000 879 0,0000 1423 0,0000 1226 0,0000 1179 0,0000 Ruvbl1 877 0,0000 807 0,0000 939 0,0000 1119 0,0000 787 0,0000 740 0,0000 806 0,0000 972 0,0000 S100a6 231 0,0000 333 0,0000 219 0,0000 242 0,0000 208 0,0000 239 0,0000 246 0,0000 216 0,0000 Sesn1 597 0,0062 534 0,0485 372 0,0125 ND 0,2260 639 0,0000 477 0,0331 ND 0,2434 337 0,0139 Setd8 369 0,0371 366 0,0405 413 0,0206 440 0,0233 391 0,0269 345 0,0354 359 0,0327 465 0,0336 Siah1a 503 0,0000 530 0,0000 533 0,0000 459 0,0000 470 0,0000 524 0,0000 533 0,0000 533 0,0000 Siah2 378 0,0000 322 0,0000 214 0,0000 351 0,0000 367 0,0000 327 0,0000 308 0,0000 325 0,0000 Sirt2 1061 0,0000 1027 0,0000 951 0,0000 911 0,0000 985 0,0000 1019 0,0000 962 0,0000 923 0,0000 Skil ND 0,3702 ND 0,2335 ND 0,3385 ND 0,2373 ND 0,3588 ND 0,2012 ND 0,0997 381 0,0040 Slc9a1 611 0,0000 703 0,0000 617 0,0000 481 0,0000 668 0,0000 573 0,0000 470 0,0000 487 0,0000 Smad3 410 0,0000 372 0,0000 341 0,0000 362 0,0000 401 0,0000 325 0,0000 361 0,0000 387 0,0000 Smarcb1 574 0,0000 585 0,0000 524 0,0000 773 0,0000 599 0,0000 590 0,0000 588 0,0000 631 0,0000 Smc1a 815 0,0010 949 0,0011 978 0,0027 947 0,0006 890 0,0003 809 0,0041 839 0,0012 899 0,0007 Smpd3 185 0,0000 248 0,0000 187 0,0000 312 0,0000 204 0,0000 223 0,0000 267 0,0000 383 0,0000 Snf1lk 159 0,0000 190 0,0000 186 0,0000 249 0,0000 183 0,0000 259 0,0000 170 0,0000 248 0,0000 Socs5 351 0,0000 332 0,0000 331 0,0000 345 0,0000 308 0,0000 356 0,0000 343 0,0000 319 0,0000 Spc24 529 0,0000 492 0,0000 752 0,0000 494 0,0000 525 0,0000 579 0,0000 566 0,0000 488 0,0000 Spc25 179 0,0000 177 0,0000 166 0,0000 212 0,0000 268 0,0000 220 0,0000 259 0,0000 221 0,0000 Stag2 596 0,0000 620 0,0000 384 0,0000 641 0,0000 689 0,0000 829 0,0000 735 0,0000 556 0,0000 Stard13 535 0,0000 518 0,0000 671 0,0000 444 0,0000 575 0,0000 600 0,0000 446 0,0000 440 0,0000 Stk11 1808 0,0000 1950 0,0000 2186 0,0000 1344 0,0000 2029 0,0000 1644 0,0000 1584 0,0000 1533 0,0000 Strn3 392 0,0000 314 0,0000 214 0,0000 511 0,0000 351 0,0000 418 0,0000 482 0,0000 403 0,0000 Suv39h1 218 0,0000 218 0,0000 217 0,0000 201 0,0000 236 0,0000 210 0,0000 190 0,0000 213 0,0000 Tacc1 577 0,0000 502 0,0000 386 0,0000 479 0,0000 429 0,0000 480 0,0000 468 0,0000 378 0,0000 Tbrg1 646 0,0000 535 0,0000 824 0,0000 998 0,0000 610 0,0000 657 0,0000 749 0,0000 976 0,0000 Terf2 405 0,0000 369 0,0000 301 0,0000 352 0,0000 383 0,0000 383 0,0000 360 0,0000 348 0,0000 Tfdp1 490 0,0000 335 0,0000 689 0,0000 691 0,0000 512 0,0000 458 0,0000 488 0,0000 634 0,0000 Tgfb1 404 0,0000 408 0,0000 676 0,0000 338 0,0000 365 0,0000 373 0,0000 385 0,0000 476 0,0000 Thap1 193 0,0000 186 0,0000 238 0,0000 212 0,0000 198 0,0000 212 0,0000 212 0,0000 212 0,0000 Tipin 277 0,0412 283 0,0242 ND 0,0933 397 0,0001 272 0,0076 319 0,0270 350 0,0002 327 0,0223 Tlk1 2347 0,0000 2815 0,0000 1791 0,0000 2159 0,0000 3119 0,0000 2427 0,0000 2408 0,0000 2461 0,0000 Tlk2 1113 0,0000 1407 0,0000 1128 0,0000 1180 0,0000 1251 0,0000 998 0,0000 1129 0,0000 1261 0,0000 Tnfrsf12a 354 0,0000 431 0,0000 756 0,0000 633 0,0000 348 0,0000 378 0,0000 519 0,0000 737 0,0000 Trp53 950 0,0000 855 0,0000 1008 0,0000 973 0,0000 802 0,0000 717 0,0000 743 0,0000 920 0,0000 Trp53bp2 366 0,0000 358 0,0000 421 0,0000 308 0,0000 337 0,0000 365 0,0000 327 0,0000 327 0,0000 Trp53inp1 945 0,0000 2291 0,0000 866 0,0000 795 0,0000 1037 0,0000 4606 0,0000 1762 0,0000 1158 0,0000 Tsc2 2082 0,0000 2349 0,0000 2138 0,0000 1646 0,0000 2379 0,0000 1968 0,0000 1704 0,0000 1931 0,0000 Tsg101 1017 0,0000 883 0,0000 859 0,0000 1103 0,0000 851 0,0000 966 0,0000 1016 0,0000 911 0,0000 Tusc4 1852 0,0000 2064 0,0000 1516 0,0000 2076 0,0000 1970 0,0000 1888 0,0000 2089 0,0000 2076 0,0000 Txnip 2046 0,0000 2366 0,0000 3266 0,0000 1692 0,0000 2536 0,0000 2049 0,0000 2880 0,0000 2804 0,0000 Txnl4b 784 0,0000 841 0,0000 817 0,0000 731 0,0000 949 0,0000 687 0,0000 835 0,0000 671 0,0000 Uhrf2 745 0,0003 766 0,0003 635 0,0003 840 0,0003 882 0,0003 751 0,0003 745 0,0003 665 0,0003 Upf1 938 0,0000 1168 0,0000 1213 0,0000 954 0,0000 1126 0,0000 884 0,0000 956 0,0000 1191 0,0000 Usp16 861 0,0000 674 0,0000 677 0,0000 1237 0,0000 834 0,0000 843 0,0000 1027 0,0000 1128 0,0000 Usp22 1657 0,0000 1349 0,0000 1507 0,0000 1397 0,0000 1611 0,0000 1265 0,0000 1307 0,0000 1462 0,0000 Vps24 1125 0,0000 1088 0,0000 616 0,0000 1022 0,0000 1093 0,0000 1132 0,0000 1143 0,0000 904 0,0000 Vps4a 638 0,0000 689 0,0000 621 0,0000 654 0,0000 583 0,0000 590 0,0000 639 0,0000 631 0,0000 Vps4b 204 0,0000 223 0,0000 155 0,0026 247 0,0000 224 0,0000 248 0,0000 283 0,0000 197 0,0000 Wdr6 453 0,0000 513 0,0000 542 0,0000 340 0,0000 390 0,0000 419 0,0000 374 0,0000 281 0,0000 Xpc 810 0,0000 716 0,0000 607 0,0000 606 0,0000 853 0,0000 666 0,0000 620 0,0000 603 0,0000 Zc3hc1 587 0,0011 601 0,0007 631 0,0003 554 0,0003 561 0,0003 551 0,0003 526 0,0003 531 0,0003

Zw10 400 0,0000 380 0,0001 326 0,0000 452 0,0000 396 0,0000 364 0,0000 437 0,0000 470 0,0000

Supplementary Material

Genotyping by Southern Blot and PCR amplification:

The genetic background of c-junf/f and c-jun∆li mice was C57Bl/6 X 129 x FVB/N. Males carrying the floxed allele of c-jun and Alfp-Cre allele were crossed with females carrying a floxed allele of c-jun. Genomic DNA was obtained from livers of c- junf/f and c-jun∆li mice by standard phenol/chloroform extraction. For Southern blot analysis,10 µg of DNA were digested with XbaI yielding a 6.9 Kb fragment for the floxed c-jun allele and a 3.3 Kb fragment for the deleted c-jun allele. Digested DNA was size-fractioned by 0.8% agarose gel electrophoresis, subsequently transferred to a Hybond-XL-membrane (Amersham

Biosciences, Buckinghamshire, UK) and cross-linked by UV exposure. The 32P-labeled probe used for hybridization was obtained by PCR amplification with Platinum Taq DNA

Polymerase (Invitrogen, Carlsbad, CA) using the following primers: forward primer 5’- cctcccaagagctcagtgac-3’ and reverse primer 5’-cttctgggggctattgttga-3’. DNA probes were labelled with [α32P]dCTP by random priming (ready to go DNA labelling beads or

Megaprime DNA Labeling Systems; Amersham Bioscience). Unincorporated nucleotides were removed with Microspin G50 columns (GE Healthcare, Little Chalfont,

Buckinghamshire, UK). Membranes were exposed to autoradiographic film (Eastman

Kodak, Sigma Chemical Co.). For PCR reaction, the fragment for the deleted c-jun allele and the fragment for the floxed allele were PCR amplified using forward primer 5’- ctcataccagttcgcacaggcggc-3’ and reverse primer 5’-cagggcgttgtgtcactgagct-3’and forward primer 5’-ctcataccagttcgcacaggcggc-3’ and reverse primer 5’-ccgctagcactcacgttggtaggc-3’, respectively (1). The PCR reaction mix contained 50 ng of genomic DNA, 100 µM deoxynucleosidetriphosphates dNTPs, 1.5 mmol/L MgCl2, 0.5 U of Platinum Taq DNA

Polymerase (Invitrogen) and 7.5 pmol of each primer; the final volume was adjusted to 50

µL. PCR was carried out at 95°C for 15 seconds, at 57°C for 10 seconds, and 72°C for 30 seconds in a GeneAmp PCR System 9700 (Applied Biosystems) for a total of 40 cycles.

Quality and genotyping analysis of PCR amplifications were assessed by loading the reaction products on ethidium bromide stained 2.5% agarose gels.

Determination of Apoptosis:

The incidence of apoptotic bodies in normal liver was quantified on H&E stained sections according to the following morphological criteria: cytoplasmic eosinophilia and fragmentation of nuclei. Only membrane-surrounded apoptotic bodies containing nuclear fragments were recorded. The apoptotic index (A.I.) was calculated as number of apoptotic bodies/100 hepatocytes. TUNEL staining was performed using the in situ cell death detection kit (Roche Diagnostic, Mannheim, Germany) according to the manufacturers recommendations. Nuclei were counterstained with the DAPI reagent.

Serum ALT and AST:

Immediately after sacrifice, blood samples were collected from the abdominal aorta and centrifuged at 1500 rpm for 20 minutes; the serum was analyzed for aspartate aminotransferases (AST), and alanine aminotransferases (ALT), using a commercially available kit from Sigma Diagnostics (Sigma-Aldrich, Milan, Italy).

Lentivirus production, cell transduction and mice injection:

Viral p24 antigen was assessed using the HIV-1 p24 core profile ELISA kit (NEN Life

Science Products, Boston, MA). For in vitro studies NIH 3T3 cells were transduced using 1

μg/ml of p24 in the presence of 8 μg/ml polybrene (Sigma). For the in vivo studies, viral particles were purified by ultracentrifugation and resuspended in sterile, endotoxin-free

PBS. Purified p24 (30 μg/mice in 300 µl PBS) was injected into the tail vein of CD-1 female mice 3 days before the TCPOBOP or CCl4 administration. The shRNA against c-jun (in pLKO lentiviral vector) was obtained from Sigma (TRCN0000042696; ShRNA Sequence:

CAGTAACCCTAAGATCCTAAA; Control shRNA: CTCATAGGAAGACCCCATT ).

Microarrays analysis:

For time-course expression profiling, total liver RNA was extracted and purified from the liver of three to four animals before (t = 0) or 1, 3 or 6 hrs after treatment. For each time- point, 5 µg purified RNA/animal were pooled together to minimize sample-to-sample variations and analyzed together in triplicate. The pools obtained were amplified, labeled and hybridized on Illumina MouseRef-8 microarray including 18,118 gene specific oligonucleotide probes. Among 7,000 expressed transcripts, 458 showed reproducible up- or down-regulation in response to the stimulus

Transcript profiling data have been submitted to EBI’s ArrayExpress

(URL:www.ebi.ac.uk/microarray-as/ae/; accession number E-TABM-935). From each sample, 4 technical replicates were produced and 750 ng of cRNA were hybridized for

18hrs to MouseRef-8 Expression BeadChips v2 (Illumina Inc., San Diego, CA, USA) as described earlier (2). For data analysis, the intensity files were loaded into the Illumina

BeadStudio 3.0.19.0 software (Illumina Inc) for quality control and gene expression analysis. First, the quantile normalization algorithm was applied on the dataset. For differential expression analysis, technical replicates of each sample were grouped together and genes with a detection p-value <0.05 and fluorescent Signal (AVG_Signal) ≤208 were considered as detected. Multiple testing corrections using Benjamini and Hochberg False

Discovery Rate were performed. Differentially expressed genes were selected with Diff

Score cutoff set at ± 30, corresponding to a q-value of 0.001and fold-change cutoff ±2.

Genes were classified according to their role in biological process, cellular components and molecular function from Database for Annotation, Visualization, and Discovery

(DAVID), Mouse Genome Informatics (The Jackson Laboratory) and GeneCards (Weizmann Institute of Science). Canonical pathways were also examined utilizing

PathwayStudio 5.0 (Ariadne Genomics, USA).

For enriched pathway identification after 3hrs treatment with GSEA (Gene Set Enrichment

Analysis) software, were used quantile normalized data (3). To increase the accuracy of the p-value, a number of permutations of 1000 was set and then Gene Sets up and down regulated (3 hrs versus 0 hrs in c-junf/f and c-jun∆li) with FDR <25% were selected.

Real Time-PCR specific assays:

2 µg of RNA were reverse transcribed by using High Capacity cDNA reverse transcription

Kit (Applied Biosystems). Real-Time amplification mixture contained 20ng of cDNA, 12.5 µl

2X TaqMan Gene Expression PCR Master mix (Applied Biosystems, Foster City, CA) and

1,25 µl of specific TaqMan

Gene Expression Assay.

Mm00432359_m1, Cyclin D1; Mm00487425_m1, Fos; Mm00495062_s1, Jun;

Mm00443258_m1, TNF-α; Mm00456591_m1, Cyp2b10; Mm00731567_m1, Cyp3a11;

Mm00438163_m1, Cdk6; Mm00726334_s1, Cdk4;Mm00494449_m1 Cdkn2a;

Mm00432448_m1, p21; Mm00437986_m1, CAR; Mm00435123_m1, Gadd45β. Mouse

GAPD endogenous control, GAPDH (Applied Biosystem). The experiments were carried out in triplicate and relative differences in gene expression were evaluated according to

∆li f/f the comparative ΔΔCt method using gene expression levels of c-jun and c-jun untreated mice as calibrators.

Antibodies for Western Blotting:

Immunoblotting was performed using the following primary antibodies: mouse monoclonal antibodies directed against Cyclin D1 (72-13 G) and PCNA (PC-10) (Santa Cruz

Biotechnology, CA), Actin and Vinculin (Sigma Ch.); goat polyclonal antibody directed against albumin (Bethyl Lab, Montgomery, TX) and against p107 (C-18) (Santa Cruz); rabbit polyclonal antibodies anti Cyclin A (C-19), E2F-1 (C-20) (Santa Cruz), anti

SAPK/JNK, and phospho SAPK/JNK (Cell Signalling Technology, Beverly, MA, USA); anti- mouse c-jun (clone 60A8) (Cell Signalling Technology, Danvers, MA). Anti-mouse- and anti-rabbit-horseradish peroxidase conjugated IgG were from Santa Cruz, while anti-goat

IgG peroxidase conjugated was from Sigma. Monoclonal anti-CAR antibody was from

Perseus Proteomics Inc, Tokyo, Japan

Legend to Supplementary Figures

Figure S1. Mouse genotyping by Southern blot and PCR amplification. (A) Southern

f/f f/f blotting genomic DNA isolated from the liver of a c-jun and a c-jun Alfp-cre mouse (c- jun∆li). The XbaI digested DNA yelding a 6.9 Kb fragment for the floxed c-jun allele (f) and a 3.3 Kb fragment for the deleted c-jun allele (∆li). (B) PCR analysis of genomic DNA

f/f ∆li ∆li isolated from the liver of c-jun and c-jun Alfp-Cre mice (c-jun ) at the time of sacrifice.

li ∆li The presence of the PCR product ∆ identifies c-jun mice.

Figure S2. Schematic representation of the Experimental Protocol. Mice were injected intraperitoneally with a single dose of DENA (90 mg/kg). After 1 week, mice were treated with TCPOBOP (3 mg/kg) once a week for 20 and 27 weeks. Immediately after the last treatment, all animals were given BrdU in drinking water and were sacrificed three days afterwards.

Figure S3. Determination of cell death in TCPOBOP-treated mouse liver. (A) TUNEL

f/f ∆li assay on liver sections from c-jun and c-jun mice treated with TCPOBOP and sacrificed

4 days after treatment. Mice sacrificed 3 hours after intraperitoneal treatment with Jo2 (5

µg/10 g body weight, Sigma) were used as positive controls. Less than 0.001 of TUNEL- positive cells was present in untreated and TCPOBOP-treated mice . *Statistically different

f/f ∆li from untreated and TCPOBOP-treated c-jun and c-jun mice. (B) Serum levels of AST

f/f ∆li and ALT in c-jun and c-jun mice treated with TCPOBOP and sacrificed 4 days after treatment. No statistically significant difference was found between treated and untreated mice, irrespectively of the genotype.

Figure S4. c-jun silencing. (A) Western blot analysis of murine cells (NIH 3T3 fibroblasts and mouse liver oval cells (MLP29 cells) infected with lentiviruses encoding control shRNAs (shc) or shRNAs against c-jun (shjun). Cells were extracted 72 hours after infection. NIH 3T3 cells were kept for 24 hours in media containing 2% FBS and then left for 1 hour in the presence of 20% FBS in order to stimulate c-jun expression. (B) Western blot analysis of livers of animals injected 72 hours before TCPOBOP treatment (3 mg/kg, upper panel) or CCl4 administration (2 ml/kg, lower panel) with lentiviruses encoding either control shRNAs or shRNAs against c-jun. Vinculin was used as loading control in both western blots. Columns show quantitation of the band intensity. As shown, specific c-jun shRNAs downregulated c-jun expression both in vitro (A) and in vivo (B).

Figure S5. Real Time-PCR validation of selected genes: Gene expression analysis of selected genes was performed in triplicate on a pool of 3-4 livers per group/time. GAPDH was used as endogenous control.

Figure S6. Functional analysis of chemically-treated mouse livers: (A) Western blot analysis of CAR. Nuclear protein extracts (100 µg/lane) were prepared from the livers, and

Western analysis was performed as described in Materials and Methods. Numbers below the blots represent quantification as normalized to actin. (B) Real Time-PCR analysis of GADD45β and Cyp3a11 in livers from c-junf/f and c-jun∆li mice sacrificed 18 and 24 hours after treatment with TCPOBOP. Results were obtained from a pool of 4 livers per group.

(C) Real Time-PCR analysis of c-jun in the liver from CD-1 mice treated with CCl4 (2 ml/kg), TCPOBOP (3 mg/kg) and PB (80 mg/kg) and sacrificed 3 hours later. (D) Western blot analysis of Phospho-JNK and JNK in livers from animals sacrificed 3 hours after treatment

Figure S7. Gene Set Enrichment Analysis (GSEA). Pathways with gene regulated in c- junf/f and c-jun∆li mice 3 hours after TCPOBOP treatment. Common pathways between the two genotypes are highlighted in red.

References

[1]. Zenz R, Scheuch H, Martin P, Frank, Eferl R, Kenner L, Sibilia M, Wagner EF. c-Jun regulates eyelid closure and skin tumor development through EGFR signaling. Dev Cell.

2003,4:879-889.

[2]. Cicatiello L, Mutarelli M, Grober OM, Paris O, Ferraro L, Ravo M, Tarallo R, Luo S,

Schroth G.P, Seifert M, Zinser C, Chiusano ML, Traini A, De Bortoli M, Weisz A. A gene network controlled by estrogen receptor α in luminal-like breast cancer cells comprising multiple transcription factors and microRNAs. Am. J. Pathol. 2010;176:2113-2130

[3] Subramanian A, Tamayo P, Mootha VK, Mukherjee S, Ebert BL, Gillette MA, Paulovich

A, Pomeroy SL, Golub TR, Lander ES, Mesirov JP. Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles. Proc Natl

Acad Sci U S A. 2005;102:15545-15550].