Downloaded from Ensembl
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Analyse Genetischer Stabilität in Den Nachkommen Bestrahlter Zellen Mittels Klassischer Chromosomenbänderung Und Verschiedener Hochdurchsatz-Techniken
Analyse genetischer Stabilität in den Nachkommen bestrahlter Zellen mittels klassischer Chromosomenbänderung und verschiedener Hochdurchsatz-Techniken Dissertation zur Erlangung des naturwissenschaftlichen Doktorgrades der Julius-Maximilians-Universität Würzburg vorgelegt von Julia Flunkert geboren in Schwerte Würzburg, 2018 Eingereicht am: …………………………………………….................... Mitglieder der Promotionskommission: Vorsitzender: Gutachter: Univ.-Prof. Dr. med. Thomas Haaf Gutachter: Univ.-Prof. Dr. Thomas Dandekar Tag des Promotionskolloquiums: ……………………….................. Doktorurkunde ausgehändigt am: ………………………................. Eidesstattliche Versicherung Die vorliegende Arbeit wurde von November 2014 bis September 2018 am Institut für Humangenetik der Universität Würzburg unter Betreuung von Herrn Univ.-Prof. Dr. med. Thomas Haaf angefertigt. Hiermit erkläre ich an Eides statt, die Dissertation: „Analyse genetischer Stabilität in den Nachkommen bestrahlter Zellen mittels klassischer Chromosomenbänderung und verschiedener Hochdurchsatz-Techniken“, eigenständig, d. h. insbesondere selbständig und ohne Hilfe eines kommerziellen Promotionsberaters, angefertigt und keine anderen, als die von mir angegebenen Quellen und Hilfsmittel verwendet zu haben. Ich erkläre außerdem, dass die Dissertation weder in gleicher noch in ähnlicher Form bereits in einem anderen Prüfungsverfahren vorgelegen hat. Weiterhin erkläre ich, dass bei allen Abbildungen und Texten bei denen die Verwer- tungsrechte (Copyright) nicht bei mir liegen, diese von den Rechtsinhabern -
Computational Genome-Wide Identification of Heat Shock Protein Genes in the Bovine Genome [Version 1; Peer Review: 2 Approved, 1 Approved with Reservations]
F1000Research 2018, 7:1504 Last updated: 08 AUG 2021 RESEARCH ARTICLE Computational genome-wide identification of heat shock protein genes in the bovine genome [version 1; peer review: 2 approved, 1 approved with reservations] Oyeyemi O. Ajayi1,2, Sunday O. Peters3, Marcos De Donato2,4, Sunday O. Sowande5, Fidalis D.N. Mujibi6, Olanrewaju B. Morenikeji2,7, Bolaji N. Thomas 8, Matthew A. Adeleke 9, Ikhide G. Imumorin2,10,11 1Department of Animal Breeding and Genetics, Federal University of Agriculture, Abeokuta, Nigeria 2International Programs, College of Agriculture and Life Sciences, Cornell University, Ithaca, NY, 14853, USA 3Department of Animal Science, Berry College, Mount Berry, GA, 30149, USA 4Departamento Regional de Bioingenierias, Tecnologico de Monterrey, Escuela de Ingenieria y Ciencias, Queretaro, Mexico 5Department of Animal Production and Health, Federal University of Agriculture, Abeokuta, Nigeria 6Usomi Limited, Nairobi, Kenya 7Department of Animal Production and Health, Federal University of Technology, Akure, Nigeria 8Department of Biomedical Sciences, Rochester Institute of Technology, Rochester, NY, 14623, USA 9School of Life Sciences, University of KwaZulu-Natal, Durban, 4000, South Africa 10School of Biological Sciences, Georgia Institute of Technology, Atlanta, GA, 30032, USA 11African Institute of Bioscience Research and Training, Ibadan, Nigeria v1 First published: 20 Sep 2018, 7:1504 Open Peer Review https://doi.org/10.12688/f1000research.16058.1 Latest published: 20 Sep 2018, 7:1504 https://doi.org/10.12688/f1000research.16058.1 Reviewer Status Invited Reviewers Abstract Background: Heat shock proteins (HSPs) are molecular chaperones 1 2 3 known to bind and sequester client proteins under stress. Methods: To identify and better understand some of these proteins, version 1 we carried out a computational genome-wide survey of the bovine 20 Sep 2018 report report report genome. -
Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model
Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021 T + is online at: average * The Journal of Immunology , 34 of which you can access for free at: 2016; 197:1477-1488; Prepublished online 1 July from submission to initial decision 4 weeks from acceptance to publication 2016; doi: 10.4049/jimmunol.1600589 http://www.jimmunol.org/content/197/4/1477 Molecular Profile of Tumor-Specific CD8 Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A. Waugh, Sonia M. Leach, Brandon L. Moore, Tullia C. Bruno, Jonathan D. Buhrman and Jill E. Slansky J Immunol cites 95 articles Submit online. Every submission reviewed by practicing scientists ? is published twice each month by Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://jimmunol.org/subscription Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html http://www.jimmunol.org/content/suppl/2016/07/01/jimmunol.160058 9.DCSupplemental This article http://www.jimmunol.org/content/197/4/1477.full#ref-list-1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material References Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2016 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of September 25, 2021. The Journal of Immunology Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A. -
Autism Multiplex Family with 16P11.2P12.2 Microduplication Syndrome in Monozygotic Twins and Distal 16P11.2 Deletion in Their Brother
European Journal of Human Genetics (2012) 20, 540–546 & 2012 Macmillan Publishers Limited All rights reserved 1018-4813/12 www.nature.com/ejhg ARTICLE Autism multiplex family with 16p11.2p12.2 microduplication syndrome in monozygotic twins and distal 16p11.2 deletion in their brother Anne-Claude Tabet1,2,3,4, Marion Pilorge2,3,4, Richard Delorme5,6,Fre´de´rique Amsellem5,6, Jean-Marc Pinard7, Marion Leboyer6,8,9, Alain Verloes10, Brigitte Benzacken1,11,12 and Catalina Betancur*,2,3,4 The pericentromeric region of chromosome 16p is rich in segmental duplications that predispose to rearrangements through non-allelic homologous recombination. Several recurrent copy number variations have been described recently in chromosome 16p. 16p11.2 rearrangements (29.5–30.1 Mb) are associated with autism, intellectual disability (ID) and other neurodevelopmental disorders. Another recognizable but less common microdeletion syndrome in 16p11.2p12.2 (21.4 to 28.5–30.1 Mb) has been described in six individuals with ID, whereas apparently reciprocal duplications, studied by standard cytogenetic and fluorescence in situ hybridization techniques, have been reported in three patients with autism spectrum disorders. Here, we report a multiplex family with three boys affected with autism, including two monozygotic twins carrying a de novo 16p11.2p12.2 duplication of 8.95 Mb (21.28–30.23 Mb) characterized by single-nucleotide polymorphism array, encompassing both the 16p11.2 and 16p11.2p12.2 regions. The twins exhibited autism, severe ID, and dysmorphic features, including a triangular face, deep-set eyes, large and prominent nasal bridge, and tall, slender build. The eldest brother presented with autism, mild ID, early-onset obesity and normal craniofacial features, and carried a smaller, overlapping 16p11.2 microdeletion of 847 kb (28.40–29.25 Mb), inherited from his apparently healthy father. -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
Epigenetic Regulation of the Human Genome by Transposable Elements
EPIGENETIC REGULATION OF THE HUMAN GENOME BY TRANSPOSABLE ELEMENTS A Dissertation Presented to The Academic Faculty By Ahsan Huda In Partial Fulfillment Of the Requirements for the Degree Doctor of Philosophy in Bioinformatics in the School of Biology Georgia Institute of Technology August 2010 EPIGENETIC REGULATION OF THE HUMAN GENOME BY TRANSPOSABLE ELEMENTS Approved by: Dr. I. King Jordan, Advisor Dr. John F. McDonald School of Biology School of Biology Georgia Institute of Technology Georgia Institute of Technology Dr. Leonardo Mariño-Ramírez Dr. Jung Choi NCBI/NLM/NIH School of Biology Georgia Institute of Technology Dr. Soojin Yi, School of Biology Georgia Institute of Technology Date Approved: June 25, 2010 To my mother, your life is my inspiration... ACKNOWLEDGEMENTS I am evermore thankful to my advisor Dr. I. King Jordan for his guidance, support and encouragement throughout my years as a PhD student. I am very fortunate to have him as my mentor as he is instrumental in shaping my personal and professional development. His contributions will continue to impact my life and career and for that I am forever grateful. I am also thankful to my committee members, John McDonald, Leonardo Mariño- Ramírez, Soojin Yi and Jung Choi for their continued support during my PhD career. Through my meetings and discussions with them, I have developed an appreciation for the scientific method and a thorough understanding of my field of study. I am especially grateful to my friends and colleagues, Lee Katz and Jittima Piriyapongsa for their support and presence, which brightened the atmosphere in the lab in the months and years past. -
Primate Specific Retrotransposons, Svas, in the Evolution of Networks That Alter Brain Function
Title: Primate specific retrotransposons, SVAs, in the evolution of networks that alter brain function. Olga Vasieva1*, Sultan Cetiner1, Abigail Savage2, Gerald G. Schumann3, Vivien J Bubb2, John P Quinn2*, 1 Institute of Integrative Biology, University of Liverpool, Liverpool, L69 7ZB, U.K 2 Department of Molecular and Clinical Pharmacology, Institute of Translational Medicine, The University of Liverpool, Liverpool L69 3BX, UK 3 Division of Medical Biotechnology, Paul-Ehrlich-Institut, Langen, D-63225 Germany *. Corresponding author Olga Vasieva: Institute of Integrative Biology, Department of Comparative genomics, University of Liverpool, Liverpool, L69 7ZB, [email protected] ; Tel: (+44) 151 795 4456; FAX:(+44) 151 795 4406 John Quinn: Department of Molecular and Clinical Pharmacology, Institute of Translational Medicine, The University of Liverpool, Liverpool L69 3BX, UK, [email protected]; Tel: (+44) 151 794 5498. Key words: SVA, trans-mobilisation, behaviour, brain, evolution, psychiatric disorders 1 Abstract The hominid-specific non-LTR retrotransposon termed SINE–VNTR–Alu (SVA) is the youngest of the transposable elements in the human genome. The propagation of the most ancient SVA type A took place about 13.5 Myrs ago, and the youngest SVA types appeared in the human genome after the chimpanzee divergence. Functional enrichment analysis of genes associated with SVA insertions demonstrated their strong link to multiple ontological categories attributed to brain function and the disorders. SVA types that expanded their presence in the human genome at different stages of hominoid life history were also associated with progressively evolving behavioural features that indicated a potential impact of SVA propagation on a cognitive ability of a modern human. -
A Multi-Omics Interpretable Machine Learning Model Reveals Modes of Action of Small Molecules Natasha L
www.nature.com/scientificreports OPEN A Multi-Omics Interpretable Machine Learning Model Reveals Modes of Action of Small Molecules Natasha L. Patel-Murray1, Miriam Adam2, Nhan Huynh2, Brook T. Wassie2, Pamela Milani2 & Ernest Fraenkel 2,3* High-throughput screening and gene signature analyses frequently identify lead therapeutic compounds with unknown modes of action (MoAs), and the resulting uncertainties can lead to the failure of clinical trials. We developed an approach for uncovering MoAs through an interpretable machine learning model of transcriptomics, epigenomics, metabolomics, and proteomics. Examining compounds with benefcial efects in models of Huntington’s Disease, we found common MoAs for compounds with unrelated structures, connectivity scores, and binding targets. The approach also predicted highly divergent MoAs for two FDA-approved antihistamines. We experimentally validated these efects, demonstrating that one antihistamine activates autophagy, while the other targets bioenergetics. The use of multiple omics was essential, as some MoAs were virtually undetectable in specifc assays. Our approach does not require reference compounds or large databases of experimental data in related systems and thus can be applied to the study of agents with uncharacterized MoAs and to rare or understudied diseases. Unknown modes of action of drug candidates can lead to unpredicted consequences on efectiveness and safety. Computational methods, such as the analysis of gene signatures, and high-throughput experimental methods have accelerated the discovery of lead compounds that afect a specifc target or phenotype1–3. However, these advances have not dramatically changed the rate of drug approvals. Between 2000 and 2015, 86% of drug can- didates failed to earn FDA approval, with toxicity or a lack of efcacy being common reasons for their clinical trial termination4,5. -
Cellular and Molecular Signatures in the Disease Tissue of Early
Cellular and Molecular Signatures in the Disease Tissue of Early Rheumatoid Arthritis Stratify Clinical Response to csDMARD-Therapy and Predict Radiographic Progression Frances Humby1,* Myles Lewis1,* Nandhini Ramamoorthi2, Jason Hackney3, Michael Barnes1, Michele Bombardieri1, Francesca Setiadi2, Stephen Kelly1, Fabiola Bene1, Maria di Cicco1, Sudeh Riahi1, Vidalba Rocher-Ros1, Nora Ng1, Ilias Lazorou1, Rebecca E. Hands1, Desiree van der Heijde4, Robert Landewé5, Annette van der Helm-van Mil4, Alberto Cauli6, Iain B. McInnes7, Christopher D. Buckley8, Ernest Choy9, Peter Taylor10, Michael J. Townsend2 & Costantino Pitzalis1 1Centre for Experimental Medicine and Rheumatology, William Harvey Research Institute, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, Charterhouse Square, London EC1M 6BQ, UK. Departments of 2Biomarker Discovery OMNI, 3Bioinformatics and Computational Biology, Genentech Research and Early Development, South San Francisco, California 94080 USA 4Department of Rheumatology, Leiden University Medical Center, The Netherlands 5Department of Clinical Immunology & Rheumatology, Amsterdam Rheumatology & Immunology Center, Amsterdam, The Netherlands 6Rheumatology Unit, Department of Medical Sciences, Policlinico of the University of Cagliari, Cagliari, Italy 7Institute of Infection, Immunity and Inflammation, University of Glasgow, Glasgow G12 8TA, UK 8Rheumatology Research Group, Institute of Inflammation and Ageing (IIA), University of Birmingham, Birmingham B15 2WB, UK 9Institute of -
Cell-Type–Specific Eqtl of Primary Melanocytes Facilitates Identification of Melanoma Susceptibility Genes
Downloaded from genome.cshlp.org on November 19, 2018 - Published by Cold Spring Harbor Laboratory Press Research Cell-type–specific eQTL of primary melanocytes facilitates identification of melanoma susceptibility genes Tongwu Zhang,1,7 Jiyeon Choi,1,7 Michael A. Kovacs,1 Jianxin Shi,2 Mai Xu,1 NISC Comparative Sequencing Program,9 Melanoma Meta-Analysis Consortium,10 Alisa M. Goldstein,3 Adam J. Trower,4 D. Timothy Bishop,4 Mark M. Iles,4 David L. Duffy,5 Stuart MacGregor,5 Laufey T. Amundadottir,1 Matthew H. Law,5 Stacie K. Loftus,6 William J. Pavan,6,8 and Kevin M. Brown1,8 1Laboratory of Translational Genomics, Division of Cancer Epidemiology and Genetics, National Cancer Institute, National Institutes of Health, Bethesda, Maryland 20892, USA; 2Biostatistics Branch, Division of Cancer Epidemiology and Genetics, National Cancer Institute, National Institutes of Health, Bethesda, Maryland 20892, USA; 3Clinical Genetics Branch, Division of Cancer Epidemiology and Genetics, National Cancer Institute, National Institutes of Health, Bethesda, Maryland 20892, USA; 4Section of Epidemiology and Biostatistics, Leeds Institute of Cancer and Pathology, University of Leeds, Leeds, LS9 7TF, United Kingdom; 5Statistical Genetics, QIMR Berghofer Medical Research Institute, Brisbane, Queensland, 4006, Australia; 6Genetic Disease Research Branch, National Human Genome Research Institute, National Institutes of Health, Bethesda, Maryland 20892, USA Most expression quantitative trait locus (eQTL) studies to date have been performed in heterogeneous tissues as opposed to specific cell types. To better understand the cell-type–specific regulatory landscape of human melanocytes, which give rise to melanoma but account for <5% of typical human skin biopsies, we performed an eQTL analysis in primary melanocyte cul- tures from 106 newborn males. -
Role of Amylase in Ovarian Cancer Mai Mohamed University of South Florida, [email protected]
University of South Florida Scholar Commons Graduate Theses and Dissertations Graduate School July 2017 Role of Amylase in Ovarian Cancer Mai Mohamed University of South Florida, [email protected] Follow this and additional works at: http://scholarcommons.usf.edu/etd Part of the Pathology Commons Scholar Commons Citation Mohamed, Mai, "Role of Amylase in Ovarian Cancer" (2017). Graduate Theses and Dissertations. http://scholarcommons.usf.edu/etd/6907 This Dissertation is brought to you for free and open access by the Graduate School at Scholar Commons. It has been accepted for inclusion in Graduate Theses and Dissertations by an authorized administrator of Scholar Commons. For more information, please contact [email protected]. Role of Amylase in Ovarian Cancer by Mai Mohamed A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy Department of Pathology and Cell Biology Morsani College of Medicine University of South Florida Major Professor: Patricia Kruk, Ph.D. Paula C. Bickford, Ph.D. Meera Nanjundan, Ph.D. Marzenna Wiranowska, Ph.D. Lauri Wright, Ph.D. Date of Approval: June 29, 2017 Keywords: ovarian cancer, amylase, computational analyses, glycocalyx, cellular invasion Copyright © 2017, Mai Mohamed Dedication This dissertation is dedicated to my parents, Ahmed and Fatma, who have always stressed the importance of education, and, throughout my education, have been my strongest source of encouragement and support. They always believed in me and I am eternally grateful to them. I would also like to thank my brothers, Mohamed and Hussien, and my sister, Mariam. I would also like to thank my husband, Ahmed. -
Table SI. Primer List of Genes Used for Reverse Transcription‑Quantitative PCR Validation
Table SI. Primer list of genes used for reverse transcription‑quantitative PCR validation. Genes Forward (5'‑3') Reverse (5'‑3') Length COL1A1 AGTGGTTTGGATGGTGCCAA GCACCATCATTTCCACGAGC 170 COL6A1 CCCCTCCCCACTCATCACTA CGAATCAGGTTGGTCGGGAA 65 COL2A1 GGTCCTGCAGGTGAACCC CTCTGTCTCCTTGCTTGCCA 181 DCT CTACGAAACCAGGATGACCGT ACCATCATTGGTTTGCCTTTCA 192 PDE4D ATTGCCCACGATAGCTGCTC GCAGATGTGCCATTGTCCAC 181 RP11‑428C19.4 ACGCTAGAAACAGTGGTGCG AATCCCCGGAAAGATCCAGC 179 GPC‑AS2 TCTCAACTCCCCTCCTTCGAG TTACATTTCCCGGCCCATCTC 151 XLOC_110310 AGTGGTAGGGCAAGTCCTCT CGTGGTGGGATTCAAAGGGA 187 COL1A1, collagen type I alpha 1; COL6A1, collagen type VI, alpha 1; COL2A1, collagen type II alpha 1; DCT, dopachrome tautomerase; PDE4D, phosphodiesterase 4D cAMP‑specific. Table SII. The differentially expressed mRNAs in the ParoAF_Control group. Gene ID logFC P‑Value Symbol Description ENSG00000165480 ‑6.4838 8.32E‑12 SKA3 Spindle and kinetochore associated complex subunit 3 ENSG00000165424 ‑6.43924 0.002056 ZCCHC24 Zinc finger, CCHC domain containing 24 ENSG00000182836 ‑6.20215 0.000817 PLCXD3 Phosphatidylinositol‑specific phospholipase C, X domain containing 3 ENSG00000174358 ‑5.79775 0.029093 SLC6A19 Solute carrier family 6 (neutral amino acid transporter), member 19 ENSG00000168916 ‑5.761 0.004046 ZNF608 Zinc finger protein 608 ENSG00000134343 ‑5.56371 0.01356 ANO3 Anoctamin 3 ENSG00000110400 ‑5.48194 0.004123 PVRL1 Poliovirus receptor‑related 1 (herpesvirus entry mediator C) ENSG00000124882 ‑5.45849 0.022164 EREG Epiregulin ENSG00000113448 ‑5.41752 0.000577 PDE4D Phosphodiesterase