Long-Term Outcomes Resulting from Exposure to Stress and Fluoxetine During Development

University of Calgary PRISM: University of Calgary's Digital Repository

Graduate Studies The Vault: Electronic Theses and Dissertations

2017 Long-Term Outcomes Resulting from Exposure to Stress and Fluoxetine During Development

Kiryanova, Veronika

Kiryanova, V. (2017). Long-Term Outcomes Resulting from Exposure to Stress and Fluoxetine During Development (Unpublished doctoral thesis). University of Calgary, Calgary, AB. doi:10.11575/PRISM/26786 http://hdl.handle.net/11023/3769 doctoral thesis

University of Calgary graduate students retain copyright ownership and moral rights for their thesis. You may use this material in any way that is permitted by the Copyright Act or through licensing that has been assigned to the document. For uses that are not allowable under copyright legislation or licensing, you are required to seek permission. Downloaded from PRISM: https://prism.ucalgary.ca UNIVERSITY OF CALGARY

Long-Term Outcomes Resulting from Exposure to Stress and Fluoxetine During

Development

Veronika Kiryanova

A THESIS

SUBMITTED TO THE FACULTY OF GRADUATE STUDIES

IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE

DEGREE OF DOCTOR OF PHILOSOPHY

GRADUATE PROGRAM IN PSYCHOLOGY

CALGARY, ALBERTA

APRIL, 2017

Abstract

Depression, anxiety, and stress are common in pregnant women. One of the primary pharmacological treatments for anxiety and depression is the antidepressant fluoxetine (Flx). Maternal stress, depression, and Flx exposure are known to effect neurodevelopment of the offspring; however, their combined effects have been scarcely studied. In this thesis, we examine the combined effects of maternal stress during pregnancy and perinatal exposure to Flx on the behaviour and the biochemical outcomes of mice as adults. Furthermore, we examine whether serotonin 1A (5-HT1A) receptors mediate the effects of maternal stress on mouse behaviour. In the adult male offspring, while perinatal exposure to Flx increased aggressive behaviour, prenatal maternal stress decreased aggressive behaviour. Interestingly, the combined effects of stress and Flx normalized aggressive behaviour. Furthermore, perinatal Flx treatment led to a decrease in anxiety-like behaviour in male offspring. In adult female offspring, maternal stress led to hyperactivity and alterations of prepulse inhibition. Maternal treatment with Flx had a potentially beneficial effect on spatial memory. The combination of prenatal stress and perinatal Flx exposure did not interact in their effects. Examination of the circadian behaviour demonstrated that mice exposed to prenatal stress had smaller light-induced phase-delays. Mice exposed to perinatal Flx required more days to re-entrainment to an 8-hour phase advance of their light-dark cycle. Mice subjected to either perinatal Flx or to PS had larger light-induced phase- advances and smaller phase advances to 8-OH-DPAT. Flx treatment partially reversed the effect of PS on phase shifts to late-night light exposure and to 8-OH-DPAT.

An examination of the biochemical outcomes showed that the serotonergic, the endocannabinoid and the glucocorticoid systems were altered following exposure to perinatal stress and Flx. These alterations were long-lasting and sex-specific.

Using the 5-HT1A receptor knockout mouse model, we show that, 5-HT1A receptor genotype moderated the effects of stress on social behaviour of male mice and on activity levels of females. Furthermore, independent of genotype, prenatal stress resulted in a change in locomotor activity and fear memory in male mice and a change in prepulse inhibition in female animals. 5-HT1A receptor knockout affected anxiety in male mice and fear memory and prepulse inhibition in female mice.

Together, these data indicate that maternal exposure to stress and Flx have a number of sustained effects on the brain and behaviour of male and female offspring, however, females appear to be protected from the behavioural effects of Flx and some of the effects of stress. Our findings also indicate that 5-HT1A receptor availability can affect outcomes of the offspring following prenatal stress; these effects are highly sex specific.

Acknowledgements I would like to thank everyone who was a part of this journey, knowingly or not.

First and foremost, I would like to thank my supervisor and mentor Dr. Richard Dyck. I truly appreciate the unconditional support, thoughtful advice, enthusiastic encouragement, and endlessly patient guidance you have been giving me during my time as your student. I deeply value the creative scientific freedom you have provided and appreciate the personal training experience you creatively crafted. I infinitely appreciate your encouragement of my professional and personal growth, and your support of my teaching, leadership, and volunteer involvement. I deeply thank you for your acceptance of my strengths, and patience with my weaknesses. I also truly value the comfortable, collaborative, and friendly environment you nurture in your lab. You made me a better thinker, better communicator, and a more capable and well-rounded human being.

Second, I would like to sincerely thank all my lab mates, and especially Brendan, Sarah, Sarah Jr, Vicky, Nicoline, Corrine, and Jacqueline, for the emotional and intellectual support you have been generously giving me. I could not have done this without you.

Third, I would like to thank the professors who were involved in the circadian behaviour and the biochemical analysis components of this thesis; to Dr. Mike Antle who has been infinitely generous with his time, expertise, and advice during my entire graduate degree, and Dr Matthew Hill, who introduced me to a new and fascinating area of neuroscience.

Lastly, I would like to thank my friends and family for their love and support. I would like to extend a special thank you to Jonathan Gallagher, who encouraged me, helped me at every step, and, more importantly, has been my rock through it all.

Table of Contents

Abstract ...... 1 Acknowledgements ...... 3 Table of Contents ...... 4 List of Tables ...... 9 List of Figures and Illustrations ...... 10 List of Symbols, Abbreviations and Nomenclature ...... 12

INTRODUCTION ...... 14 1.1 Prenatal Development ...... 15 1.1.1 Role of Serotonin in Early Development ...... 15 1.1.2 Defining Stress ...... 16 1.1.3 Biology of the Stress Response ...... 17 1.1.4 Prenatal Expression of Glucocorticoid Receptors ...... 20 1.1.5 Roles of Glucocorticoid Receptors During Early Development ...... 21 1.2 Exposure to Stress During Early Development ...... 22 1.2.1 Glucocorticoid Exposure as a Model of Maternal Stress ...... 22 1.2.1.1 Early-Developmental Effects ...... 24 1.2.1.2 Long-term Outcomes ...... 26 1.2.2 Maternal Stress ...... 27 1.2.2.1 Animal Models of Early Stress ...... 27 1.2.2.2 Early-Developmental Effects ...... 28 1.2.2.3 Long-term Outcomes ...... 29 1.3 Exposure to Fluoxetine During Early Development ...... 34 1.3.1 Early-Developmental Effects ...... 36 1.3.2 Long-term Outcomes ...... 40 1.3.2.1 Behaviour ...... 40 1.3.2.2 Neuroanatomy ...... 48 1.4 Exposure to Stress and Fluoxetine During Early Development ...... 51 1.4.1 Maternal Stress and the Serotonergic System Integrity ...... 51 1.4.2 Long-term Outcomes of Maternal Stress and Fluoxetine Exposure ...... 53 1.5 Rationale ...... 56

EFFECTS OF MATERNAL STRESS AND PERINATAL FLUOXETINE EXPOSURE ON BEHAVIOURAL OUTCOMES OF ADULT MALE OFFSPRING ...... 58 2.1 Introduction ...... 59 2.2 Materials and Methods ...... 63 2.2.1 Animals ...... 63 2.2.2 Chronic Unpredictable Stress Paradigm ...... 64 2.2.3 Drug Treatment ...... 64 2.2.4 Maternal Behaviour ...... 65 2.2.4.1 Assessment of Maternal Behaviour ...... 65 2.2.4.2 Pup retrieval ...... 66

2.2.5 Measurement of Fluoxetine, Norfluoxetine, and Serotonin in Pup Brains .....67 2.2.5.1 Sample collection...... 67 2.2.5.2 Sample analysis...... 67 2.2.6 Behavioural Analysis ...... 67 2.2.6.1 Open Field ...... 68 2.2.6.2 Elevated Plus Maze ...... 68 2.2.6.3 Morris Water Task ...... 69 2.2.6.4 Passive Avoidance ...... 71 2.2.6.5 Prepulse Inhibition ...... 71 2.2.6.6 Resident/Intruder task ...... 72 2.2.7 Measurement of BDNF in Adult Brains ...... 73 2.3 Data Analysis ...... 74 2.4 Results ...... 75 2.4.1 Pup retrieval ...... 75 2.4.2 Assessment of Maternal Behaviour ...... 75 2.4.3 Actual Dose of Fluoxetine ...... 75 2.4.4 Fluoxetine, Norfluoxetine, and Serotonin Levels in Pup Brains ...... 75 2.4.5 Behavioural Evaluation of Adult Animals ...... 76 2.4.5.1 Open Field ...... 76 2.4.5.2 Elevated Plus ...... 76 2.4.5.3 Passive Avoidance ...... 77 2.4.5.4 Morris Water Task ...... 77 2.4.5.5 Prepulse Inhibition ...... 77 2.4.5.6 Resident Intruder ...... 78 2.4.6 BDNF in Frontal Cortex ...... 78 2.4.7 Discussion ...... 79 2.4.8 Effects of Prenatal Stress ...... 80 2.4.9 Effects of Perinatal Fluoxetine ...... 82 2.4.10 Combination of Prenatal Stress and Perinatal Flx Exposure ...... 84 2.4.11 Limitations ...... 85 2.4.12 Conclusion ...... 86

BEHAVIOURAL OUTCOMES OF ADULT FEMALE OFFSPRING FOLLOWING MATERNAL STRESS AND PERINATAL FLUOXETINE EXPOSURE ...... 96 3.1 Introduction ...... 97 3.2 Methods ...... 100 3.2.1 Animals ...... 100 3.2.2 Chronic Unpredictable Stress Paradigm ...... 101 3.2.3 Drug Treatment ...... 101 3.2.4 Measurement of Fluoxetine and Norfluoxetine in Pup Brains ...... 102 3.2.4.1 Sample collection...... 102 3.2.4.2 Sample analysis...... 102 3.2.5 Behavioural Analysis ...... 103 3.2.5.1 Open Field ...... 103

3.2.5.2 Elevated Plus Maze ...... 104 3.2.5.3 Morris Water Task ...... 105 3.2.5.4 Passive Avoidance ...... 105 3.2.5.5 Prepulse Inhibition ...... 106 3.2.5.6 Fear Conditioning ...... 107 3.2.6 Data Analysis ...... 108 3.3 Results ...... 109 3.3.1 Actual Dose of Fluoxetine ...... 109 3.3.2 Fluoxetine and Norfluoxetine in Pup Brains ...... 109 3.3.3 Behavioural Evaluation of Adult Animals ...... 109 3.3.3.1 Open Field ...... 109 3.3.3.2 Elevated Plus Maze ...... 109 3.3.3.3 Passive Avoidance ...... 109 3.3.3.4 Prepulse Inhibition ...... 110 3.3.3.5 Morris Water Task ...... 110 3.4 Discussion ...... 111 3.5 Conclusion ...... 114

CIRCADIAN BEHAVIOR OF ADULT MICE EXPOSED TO STRESS AND FLUOXETINE DURING DEVELOPMENT ...... 120 4.1 Introduction ...... 121 4.2 Materials and Methods ...... 123 4.2.1 Animals ...... 123 4.2.2 Chronic Unpredictable Stress Paradigm ...... 124 4.2.3 Drug Treatment ...... 125 4.2.4 Behavioral Testing ...... 126 4.2.5 Circadian behavior parameters ...... 127 4.2.5.1 Re-entrainment to an 8-hour advance of the light dark cycle ...... 128 4.2.5.2 Phase shifts to short-duration light pulses ...... 128 4.2.5.3 Phase shifts to 8-OH-DPAT ...... 128 4.3 Data Analysis ...... 129 4.4 Results ...... 130 4.4.1 Circadian behavior parameters ...... 130 4.4.2 Re-entrainment to 8-hour light dark cycle advance ...... 130 4.4.3 Phase shifts to short-duration light ...... 131 4.4.4 Phase shifts to 8-OH-DPAT ...... 132 4.5 Discussion ...... 132

BEHAVIOUR OF ADULT 5-HT1A RECEPTOR KNOCKOUT MICE EXPOSED TO STRESS DURING DEVELOPMENT ...... 151 5.1 Introduction ...... 152 5.2 Materials and Methods ...... 154 5.2.1 Animals ...... 154 5.2.2 Chronic Unpredictable Stress Paradigm ...... 156 5.2.3 Maternal Behaviour ...... 156

5.2.4 Behavioural Analysis ...... 157 5.2.4.1 Open Field ...... 157 5.2.4.2 Elevated Plus Maze ...... 158 5.2.4.3 Novelty Suppressed Feeding ...... 159 5.2.4.4 Three-Chamber Social Task ...... 159 5.2.4.5 Prepulse Inhibition ...... 160 5.2.4.6 Fear Conditioning ...... 161 5.2.4.7 Resident/Intruder Task ...... 162 5.3 Data Analysis ...... 163 5.4 Results ...... 164 5.4.1 Assessment of Maternal Behaviour ...... 164 5.4.2 Pup Retrieval ...... 164 5.4.3 Behavioural Evaluation of Adult Animals ...... 164 5.4.3.1 Open Field ...... 164 5.4.3.2 Elevated Plus Maze ...... 165 5.4.3.3 Novelty Suppressed Feeding ...... 165 5.4.3.4 Three-Chamber Social Task ...... 166 5.4.3.5 Prepulse Inhibition ...... 167 5.4.3.6 Fear Conditioning ...... 167 5.4.3.7 Resident/Intruder Task ...... 168 5.5 Discussion ...... 168 5.5.1 Stress ...... 169 5.5.2 Genotype ...... 170 5.5.3 Interaction ...... 171 5.5.4 Limitations ...... 172 5.6 Conclusion ...... 173

MOLECULAR ALTERATIONS ...... 181 6.1 Introduction ...... 181 6.2 Methods ...... 184 6.2.1 Animals ...... 184 6.2.2 Chronic Unpredictable Stress Paradigm and Drug Treatment ...... 184 6.2.3 Measurement of mRNA and Endocannabinoid Levels ...... 184 6.2.3.1 Sample collection for qPCR...... 184 6.2.3.2 Tissue processing for mRNA isolation and cDNA synthesis ...... 185 6.2.3.3 SyberGreen real-time PCR ...... 186 6.2.3.4 Sample collection and endocannabinoid quantification...... 187 6.2.3.5 CORT measurement; adrenal glands and thymus collection ...... 187 6.3 Data Analysis ...... 188 6.4 Results ...... 188 6.4.1 Effect of Treatment on Gene Expression Levels ...... 188 6.4.2 Effect of Treatment on Endocannabinoid Levels ...... 189 6.4.2.1 AEA ...... 189 6.4.2.2 2-AG ...... 189

6.4.3 Effect of Treatment on Levels of CORT and on Thymus and Adrenal Weights...... 190 6.5 Discussion ...... 190 6.5.1 The Serotonergic System ...... 190 6.5.1.1 Effects of prenatal stress ...... 190 6.5.1.2 Effects of perinatal fluoxetine ...... 193 6.5.2 The Endocannabinoid System ...... 194 6.5.2.1 Effects of prenatal stress ...... 194 6.5.2.2 Effects of perinatal fluoxetine ...... 195 6.5.3 The Glucocorticoid System ...... 196 6.5.4 The combination of Perinatal Stress and Fluoxetine Exposure: Effects on Serotonergic, Endocannabinoid, and Glucocorticoid Systems ...... 197 6.5.5 Review of the Hypothesis ...... 197 6.6 Conclusion ...... 198

GENERAL DISCUSSION ...... 212 7.1 Main Findings ...... 212 7.2 Interpretation and Integration of our Findings ...... 214 7.2.1 Memory ...... 214 7.2.2 Anxiety ...... 216 7.2.3 Aggressive Behaviour ...... 217 7.2.4 CORT levels ...... 218 7.2.5 BDNF ...... 218 7.2.6 Hyperactivity ...... 218 7.2.7 Prepulse Inhibition ...... 219 7.2.8 Circadian Behaviour ...... 220 7.2.9 Sexual Dimorphism of the Behavioural Findings ...... 220 7.2.10 Protective Effect of Endocannabinoids ...... 221 7.3 Considerations, Limitations and Future Directions ...... 221 7.4 Conclusion ...... 226

REFERENCES ...... 227

List of Tables

Table 2.1. Chronic Unpredictable Stress Schedule used on pregnant mouse dams from E4 to E18...... 88

Table 2.2. Behaviour of mouse dams exposed to chronic unpredictable stress and fluoxetine...... 89

Table 2.3A. Summary of results of behavioural testing battery demonstrating effects of prenatal stress and perinatal fluoxetine exposure on behaviour of male mice as adults...... 90

Table 2.3B: Summary of results of behavioural testing battery demonstrating effects of prenatal stress and perinatal fluoxetine exposure on behaviour of male mice as adults ...... 91

Table 3.1A. Summary of results of behavioural testing battery demonstrating effects of prenatal stress and perinatal fluoxetine exposure on behaviour of female mice as adults...... 116

Table 3.1B. Summary of results of behavioural testing battery demonstrating effects of prenatal stress and perinatal fluoxetine exposure on behaviour of female mice as adults...... 117

Table 4.1. Average phase angle of entrainment, locomotor activity duration (alpha), and free-running periods (tau), for animals exposed to prenatal stress and/or perinatal Flx ...... 140

Table 5.1. Behaviour of mouse dams...... 174

List of Figures and Illustrations

Figure 2-1. Serotonin concentration in the brain ...... 92

Figure 2-2. Performance on the elevated plus maze...... 93

Figure 2-3. Behaviour of male mice in the resident intruder test ...... 94

Figure 2-4. BDNF levels in frontal cortex ...... 95

Figure 3-1. Prepulse Inhibition ...... 118

Figure 3-2. Performance in the Morris Water Task ...... 119

Figure 4-1. Experimental timeline ...... 141

Figure 4-2. Average waveforms activity in LD ...... 142

Figure 4-3. Representative actogram and average magnitude of phase shifts to 8-h LD cycle advance ...... 143

Figure 4-4. Representative actogram and average magnitude of phase shifts to late- night short duration light ...... 145

Figure 4-5. Representative actogram and average magnitude of phase shifts to early- night short duration light ...... 147

Figure 4-6. Representative actogram and average magnitude of phase shifts to 8-OH- DPAT ...... 149

Figure 5-1. Performance in the Open Field ...... 175

Figure 5-2. Performance in the Elevated Plus Maze ...... 176

Figure 5-3. Performance in the Three-Chamber Social Task ...... 177

Figure 5-4. Prepulse Inhibition ...... 179

Figure 5-5. Cued Fear Conditioning ...... 180

Figure 6-1. Serotonin 1A Receptor mRNA Levels ...... 199

Figure 6-2. Levels of SERT mRNA ...... 200

Figure 6-3. Levels of Cannabinoid Receptor 1 mRNA ...... 201

Figure 6-4. Levels of Monoglyceride Lipase mRNA ...... 202

Figure 6-5. Levels of Fatty Acid Amide Hydrolase mRNA ...... 203

Figure 6-6. Levels of Nuclear Receptor Subfamily 3 Group C Member 1 mRNA ...... 204

Figure 6-7. Levels of Nuclear Receptor Subfamily 3 Group C Member 2 mRNA ...... 205

Figure 6-8. Anandamide Levels in the medial Prefrontal Cortex of Female Mice ...... 206

Figure 6-9. Anandamide Levels in the Amygdala of Female Mice ...... 207

Figure 6-10. 2-Arachidonoylglycerol Levels in the Amygdala of Male Mice ...... 208

Figure 6-11. 2-Arachidonoylglycerol Levels in the Medial Prefrontal Cortex of Female Mice ...... 209

Figure 6-12. 2-Arachidonoylglycerol Levels in the Amygdala of Female Mice ...... 210

Figure 6-13. Basal Corticosterone Levels ...... 211

List of Symbols, Abbreviations and Nomenclature

Symbol Definition

11β-HSD2 11β-hydroxysteroid dehydrogenase type 2 2-AG 2-arachidonylglycerol 5-HT 5-hydroxytryptophan also serotonin 5-HT1AR serotonin 1A receptor 5-HTAA 5-Hydroxyindoleacetic acid 5-HTT serotonin transporter 5-HTTLPR serotonin-transporter-linked polymorphic region 8-OH-DPAT (±)-8-hydroxy-2-(dipropylamino)tetralin hydrobromide ACTH adrenocorticotropic hormone ADHD attention deficit hyperactivity disorder AEA anandamide ANOVA analysis of variance BDNF brain derived neurotrophic factor CB1 cannabinoid type 1 receptor CB2 cannabinoid type 2 receptor CeA central nucleus of the amygdala CON control CORT corticosterone CRH corticotrophin-releasing hormone CS conditioned stimulus CT16 circadian time, 4 hours after activity onset CT22 circadian time, 10 hours after activity onset DA dopamine DD constant darkness HPC hippocampus E embryonic eCB endocannabinoid EPM elevated plus maze FAAH fatty acid amide hydrolase Flx fluoxetine GR glucocorticoid receptor HL hypothalamus HPA hypothalamic–pituitary–adrenal IP intraperitoneal KO knockout LD light/dark cycle LL constant light LP light pulse MAG lipase monoacylglycerol lipase

MAO monoamine oxidase mPFC medial prefrontal cortex (mPFC) MR mineralocorticoid receptor mRNA messenger ribonucleic acid MWT Morris water test NE norepinephrine NorFlx norfluoxetine OFT open field test P postnatal PFC prefrontal cortex PPI prepulse inhibition PS prenatal stress RI resident intruder SCN suprachiasmatic nuclei SERT serotonin transporter SSRI selective serotonin reuptake inhibitor VHPC ventral hippocampus

Introduction

Clinical studies show that maternal stress is linked to unfavourable pregnancy outcomes, such as reduced gestational length, lower birth weight, and impaired emotional and cognitive development in infants and children (Beydoun and Saftlas 2008). Maternal stress increases a child’s risk for developing affective and psychiatric disorders, such as schizophrenia and autism (Kinney et al. 2008; Talge et al. 2007). Stress can precipitate depressive episodes, which may occur during pregnancy (for a review see Monroe and

Hadjiyannakis 2002; Tennant 2002). The prevalence of depression among pregnant women is 10-20% (Andersson et al. 2003; Gavin et al. 2005; Kitamura et al. 1993;

Marcus et al. 2003), and can reach 51% in pregnant women of low socio-economic status

(Hobfoll et al. 1995; McKee et al. 2001). Selective serotonin reuptake inhibitors (SSRIs) are the primary pharmacological treatment for depression (Mandrioli et al. 2012). SSRI use in pregnant women is on the rise, with 6.2% exposed to this medication (Andrade et al. 2008; Cooper et al. 2007). Fluoxetine (brand name Prozac, Sarafem, Rapiflux) is one of the most commonly prescribed SSRIs, with 1.9-2.1% of women taking fluoxetine (Flx) at one point during pregnancy (Andrade et al. 2008; Cooper et al. 2007). In fact, Flx is one of the top 20 specific prescription medications most commonly taken by pregnant women (Mitchell et al. 2011). This thesis investigates the effects of prenatal maternal stress and the effects of perinatal maternal exposure to Flx, separately and in combination, on the behaviour and molecular integrity of the brain of the adult male and female offspring. This thesis also examines the role of the serotonin 1A receptor in the long-term effects of maternal stress.

1.1 Prenatal Development

The reason that early development is especially vulnerable to environmental insults is that the precise orchestration of multiple signals is needed for every neurodevelopmental process. Multiple factors that have little or no effect in the adult brain serve important roles during development, yet, disruption of any one of these factors, or changes in the concentration of any inducing signals have a potential to substantially alter the development of the nervous system. The nature and extent of the exposure determine the developmental outcome.

1.1.1 Role of Serotonin in Early Development

Serotonin (5-HT) has been detected as early as the blastula developmental stage

(Lauder 1993). In early developmental stages serotonin acts as a developmental cue. This use of serotonin is made possible through the serotonin supplied maternally (Côté et al.

2007; Yavarone et al. 1993). During development, serotonin is secreted by growing axons. Serotonin regulates neuronal growth cone motility (Gaspar et al. 2003; McCobb et al. 1988), and is involved in various developmental processes such as neuronal and glial proliferation, neuronal differentiation, formation, and migration, synaptogenesis, axon myelination, and regulation of apoptotic cell death (Chubakov et al. 1986; Lauder and

Krebs 1978; Vitalis and Parnavelas 2003). Because serotonin participates in many neurodevelopmental processes, changes in the function of the serotonergic system, for example via exposure to the serotonin-altering drug Flx, during development, has the potential to affect normal neurodevelopmental processes and lead to altered brain organization and, consequently, behaviour.

1.1.2 Defining Stress

The stress response is a physiological and behavioural reaction to a challenge or threat to an organism's well-being. The stress response is essential to an organism’s survival, as it ensures an appropriate and fast response to a threat. Acute stress has beneficial effects; it enhances memory and improves immune function (McEwen 2013).

Once the threat is no longer relevant, the stress response is shut off, and the organism returns to routine activities. Occasional activation of the stress response is not detrimental to an organism; however, when the stress response is not shut off, or if it is activated repeatedly, the body can suffer negative, long-term consequences (McEwen 1998; 2013).

These consequences can be especially detrimental for a developing organism.

Stress can ambiguously refer to a plethora of events and responses. Some of these interpretations are healthy reactions to normal life events that promote coping skills while others can pose a threat to wellbeing. Defining and distinguishing different types of stress helps mitigate this ambiguity. The classification that follows was formulated to help define stressful life events in children yet these definitions are helpful to understanding stress and its effects throughout life. To distinguish the different types of stress response, stress reaction can be described as positive, tolerable or toxic (Boyce 2014; Shonkoff

2010) based on the nature and severity of stress and the ability of such stress to lead to long-term, unfavorable outcomes. Positive stress refers to controllable and predictable stress such as meeting new people, dealing with frustration and other mundane events.

Positive stress leads to a brief and mild elevation of stress hormones and heart rate, and is considered essential for normal development. Tolerable stress response may result from a negative event such as death or illness in the family. This response is longer in duration

17 and severity compared to positive stress, but still occurs within a limited time period.

Such stress responses have the potential to affect development; however, when the family environment is supportive, and the feeling of control remains intact, no long-term effects are likely. In children, stressful life events that are chronic and uncontrollable, especially in the absence of strong family support, can provoke a toxic reaction to stress. Situations that can lead to this are sexual and physical abuse, neglect, family members with psychiatric disorders and family violence. A toxic response to stress is characterized by frequent, strong and prolonged activation of the stress response system (Boyce 2014;

Shonkoff 2010). Such activation disrupts brain development and the activity of the stress- response system, and leads to mood disorders, psychiatric disorders, substance use and personality disorders later in life (for a review see Carr et al. 2013). Toxic reactions to stress are capable of altering the developmental trajectory of a child, leading to long-term developmental effects. This toxic stress is the type of stress this thesis will refer to when addressing long-term outcomes of developmental stress.

1.1.3 Biology of the Stress Response

While multiple psychological and physiological factors elicit stress, the physiological response to stress involves a common pathway that combines the activation of a fast, autonomic response and a slower neuroendocrine response. Activation of the sympathetic nervous system leads to the release of norepinephrine from the locus coeruleus which, in turn causes an increase in attention and arousal, initiates the fight or flight response and contributes to the activation of the hypothalamus-pituitary-adrenal

(HPA) system (Itoi et al. 1994; Tasker and Herman 2011). Activation of the

18 neuroendocrine HPA axis leads to the release of stress hormones that mobilize energy stores, enhance cardiovascular function and suppress appetite and inflammation

(Sapolsky et al. 2000; Tasker and Herman 2011). Upon HPA activation, the amygdala sends excitatory signals to the paraventricular nucleus of the hypothalamus, which then releases corticotrophin-releasing hormone (CRH) and vasopressin into the portal system of the pituitary gland. CRH and vasopressin then stimulate the release of adrenocorticotropic hormone (ACTH) from the anterior pituitary gland to systemic circulation. The adrenal cortex responds to the increase in ACTH blood levels by synthesizing and releasing glucocorticoids. Cortisol is the primary glucocorticoid produced in adult primate adrenal glands as a response to stress while in a number of other vertebrate species, including rodents (and possibly primate fetuses (Wynne-

Edwards et al. 2013), it is corticosterone (CORT). Glucocorticoids target glucocorticoid receptors (GR) and mineralocorticoid receptors (MR) that are abundant in most peripheral tissues and in the nervous system, including the brain (Hill and Tasker 2012;

McEwen 2013). In the brain, GR and MR differ in their distribution patterns and their affinity and capacity. The GR is more ubiquitously distributed in the brain and has lower affinity and higher capacity than the MR. Such difference in affinity helps predetermine their roles: the MR receptor assists in homeostasis maintenance, while the GR ensures return to homeostasis following a response to stress (de Kloet et al. 2005).

Glucocorticoids cross the cellular membrane and bind to GRs and MRs, which are predominantly cytoplasmic. Once glucocorticoids bind to the receptor, they form a complex which translocates to the nucleus and binds to nuclear structures. Activated hormone-receptor complexes can change (suppress or promote) gene transcription by

19 binding to gene promoter regions, interacting with transcription factors or with factors that enable transcription factor binding to the DNA, and affecting the ease of access of transcription factors to the genes (through acetylation and deacetylation). However, the exact molecular mechanism of glucocorticoid action on physiology and behaviour are not yet well understood (Sapolsky et al. 2000).

Glucocorticoids are not only needed to sustain the stress response, but they are also required to terminate it. Activation of glucocorticoid receptors is necessary for the neuroendocrine negative feedback loop that inhibits further release of CRH, and therefore shuts off the stress response. This effect is achieved directly through an inhibition of the amygdala, specifically of the central nucleus of the amygdala, as well as of the hypothalamus and pituitary. It is also mediated indirectly through the hippocampus and medial prefrontal cortex (mPFC); the hippocampus and mPFC's activity is enhanced by

GR activation, and because these structures have an inhibitory effect on the HPA axis activity, their excitation by glucocorticoids inhibits the HPA axis (Hill and Tasker 2012).

In addition to being involved in the disruption of homeostasis, glucocorticoids are involved in homeostasis maintenance. Levels of CORT, CRH and ACTH show circadian rhythmicity. CORT levels peak at the beginning of an active phase (early morning in diurnal and early night in nocturnal animals) to mobilize energy stores, and prepare the body for the demands of physical activity (Dickmeis 2009).

Another important component that modulates initiation and suppression of the

HPA axis is the endocannabinoid system. Outside of the stress response, this system regulates feeding, emotion, memory (especially short-term, working, emotional memory and the process of forgetting), pain, and inflammation. At this time, two endocannabinoid

20 ligands, both acting in a retrograde fashion and having an inhibitory effect, but differing in affinity and efficacy, have been characterized: anandamide (AEA) and 2- arachidonylglycerol (2-AG). These ligands bind to two receptors: cannabinoid type 1 receptor (CB1) and cannabinoid type 2 receptor (CB2), with former being most ubiquitously expressed in the brain. The endocannabinoid system is a pro-homeostatic system that is activated by stress. In acute response to stress, the basal/ “un-activated” condition of amygdala is disrupted due to an increase in fatty acid amide hydrolase

(FAAH; metabolizes AEA) levels, that decreases levels of AEA and allows the stress- response to occur. Peripherally-released glucocorticoids induce release of 2-AG in the amygdala thereby promoting recovery from stress. Furthermore, endocannabinoids mediate the effect of CORT on the paraventricular nucleus neurons (shutting off CRH production) during the rapid negative feedback process, and the effect of CORT on the

PFC and the hippocampus, during the delayed-feedback inhibition of the HPA axis (for review see (for a review seeHill and McEwen 2010; Hill and Tasker 2012).

1.1.4 Prenatal Expression of Glucocorticoid Receptors

Glucocorticoid receptors (GRs) begin their expression in fetal tissue just before mid-gestation. Fetal tissue begins expressing GR mRNA as early as embryonic day (E)

9.5 in a mouse (Cole et al. 1995; Speirs et al. 2004), E11.5 in a rat (Diaz et al. 1998) and gestational week 8 in humans (Costa et al. 1996). GR expression in the neuroepithelium is detectable by E 10-12.5 in rodents; GR expression in neural tissues increases steadily until birth (Diaz et al. 1998; Speirs et al. 2004). Initial effects of glucocorticoids may be in part counteracted by 11β-hydroxysteroid dehydrogenase type 2 (11β-HSD2) which

21 catalyzes glucocorticoid breakdown to inactive forms, and whose expression begins at the same time as the expression of GRs; however, after E13.5, 11β-HSD2 expression begins to decline, and is expressed in fewer brain areas (Diaz et al. 1998). This decline allows for enhanced glucocorticoid activation of GR receptors. Expression of mineralocorticoid receptors begins much later, during E16.5, and shows patterns of expression similar to that of an adult animal (Kretz et al. 2001).

Other components of the HPA axis and its control circuit also begin to be established during mid-gestation. In mice, GR mRNA in the pituitary gland is abundant by E12 (Speirs et al. 2004), while CRH can be detected by E13.5 in the paraventricular nucleus (Keegan et al. 1994). The HPA axis and its negative feedback circuit become functional by E16.5 in mice (Reichardt and Schutz 1996). The human HPA axis is fully responsive to stress from birth (Gunnar 1992). HPA axis responsiveness to stressors decreases from the first year of life until preschool age in humans and from P4 until P14 in rats. This period of hyposensitivity is thought to provide developmental protection by guarding the developing brain from the actions of glucocorticoids (Tarullo and Gunnar

2006).

1.1.5 Roles of Glucocorticoid Receptors During Early Development

Glucocorticoid surges prior to birth prepare the fetal body to take over the functions performed by the maternal placenta. Glucocorticoids are important to the maturation of a number of tissues including kidneys, lungs, gut and liver, and physiological systems such as metabolic balance and glucose storage and supply (Li et al.

2013). While the function that glucocorticoids play in the developing brain is still under

22 investigation, many glucocorticoid roles have been uncovered, and it is clear that glucocorticoids are required for normal brain maturation. Administration of exogenous glucocorticoids limits neural progenitor cell proliferation (Carson et al. 1973;

Samarasinghe et al. 2011), while adrenelectomy has the opposite effect (Meyer 1983).

Therefore, glucocorticoids appear to shift cell proliferation to cell maturation and differentiation during development (Meyer 1983); further, an exposure to increased levels of glucocorticoid may hasten cell differentiation thereby limiting the growth of the fetal brain. Similarly, glucocorticoids also regulate the neuronal myelination inhibiting this process (Meyer 1983) and promote terminal maturation and cell survival. Glucocorticoid effects on the brain are region-specific due to the dynamic distribution of the GR receptors (Keegan et al. 1994; Seckl 2008; Speirs et al. 2004).

1.2 Exposure to Stress During Early Development

1.2.1 Glucocorticoid Exposure as a Model of Maternal Stress

Throughout prenatal development, the fetus is exposed to glucocorticoids, supplied by the mother (Venihaki et al. 2000). Because glucocorticoids are lipophilic, they can easily cross the placental barrier. However, the fetus is partially protected from high glucocorticoid levels found in maternal blood. This is because, during development,

80-90% of maternal physiological glucocorticoids (cortisol and corticosterone) are inactivated in the placenta by 11β-HSD2, which catalyzes glucocorticoid breakdown to inactive forms (Benediktsson et al. 1993; Venihaki et al. 2000). Changes in the integrity of this 11β-HSD2 barrier, for example due to maternal malnutrition, lead to an increase in

23 the amount of maternal glucocorticoids that cross the placental barrier (Belkacemi et al.

2011).

Even when the 11β-HSD2 barrier is fully functional, it is not able to guard the fetus completely against fluctuations in maternal glucocorticoids, for example when the mother receives synthetic glucocorticoids (discussed below). This barrier is also not able to guard against increases in maternal blood glucocorticoid levels that are caused by stress (Takahashi et al. 1998). Such increases in fetal exposure to glucocorticoids following maternal stress are thought to be the mechanism by which maternal stress affects fetal development. In fact, when maternal glucocorticoid levels are artificially kept constant, maternal stress appears to have no effect on some aspects of fetal development that are normally altered by stress (Barbazanges et al. 1996). Maternal exposure to exogenous glucocorticoids is frequently used to model and study the effects of maternal stress due to the ease of control, quantification, and standardization of the glucocorticoid administration.

Expecting mothers can be administered glucocorticoids for various reasons. The most common reason is to reduce the risk of preterm delivery. Treatment with glucocorticoids speeds up fetal maturation, reducing the risk of death and respiratory distress in infants born preterm, and decreases the chance of developing disabilities later in life (Consensus 1995; Crowther et al. 2013). Such treatment is administered during the third trimester of gestation. A less common reason for glucocorticoid administration is the genetic risk of congenital adrenal hyperplasia (CAH; a disorder that leads to glucocorticoid deficiency); such treatment begins in the first trimester. Genetic testing is conducted during gestational week 12, and the treatment is discontinued if the genetic

24 risk is absent. These genetically healthy children can be followed, throughout life, helping uncover the effects of early gestational exposure to glucocorticoids (Miller and

Witchel 2013). Animal models of fetal exposure to increased levels of maternal glucocorticoids include maternal exposure to exogenous glucocorticoids and induced deficiency in placental 11β-HSD2.

1.2.1.1 Early-Developmental Effects

As mentioned above, one of the reasons for glucocorticoid administration to pregnant women at risk for preterm birth is that glucocorticoids speed up the maturation of fetal tissue, especially lungs. Glucocorticoids decrease cell proliferation by switching the cell to the next developmental stage (cell maturation and differentiation) (Meyer

1983). Therefore, it is not surprising that a decrease in birth weight is one of the most common findings in animal and human literature of prenatal glucocorticoid exposure.

Administration of glucocorticoids and inhibition of 11β-HSD2 activity in animals is associated with lower birth weight in sheep (Newnham et al. 1999), rats (Benediktsson et al. 1993; Lindsay et al. 1996a; Welberg et al. 2001) and mice (Reinisch et al. 1978). Birth weight reduction has also been reported in human newborns with genetic deficiency of

11β-HSD2 enzyme activity (Dave-Sharma et al. 1998) and newborns whose mothers were administered glucocorticoids during the last trimester of pregnancy (Bloom et al.

2001; French et al. 1999). Interestingly, a number of studies reported that if the glucocorticoid treatment spanned the entire duration of pregnancy, such treatment did not affect the birth weight or head circumference of newborn children (Carlson et al. 1999;

New et al. 2001). This finding may indicate an adaptation to increased glucocorticoid

25 exposure when the exposure spans the entire length of prenatal development; alternatively, such outcomes may be a characteristic of the population studied, as glucocorticoid treatment that spans an entire pregnancy duration is most frequently administered in pregnancies with a confirmed case of fetal CAH. Because decreased birth weight is associated with an increased incidence of diabetes, psychiatric and cardiovascular disorders (for a review see Seckl 2008), the association between timing of glucocorticoid exposure and offspring birth weight needs to be examined more carefully.

Some teratogenic effects have been reported in human newborns, including an increased risk of orofacial clefts after 1st trimester glucocorticoid exposure (Carmichael et al. 2007) and a reduction in head circumference following 3rd trimester glucocorticoid exposure (French et al. 1999); however, these newborns were born preterm. Current clinical research suggests that maternal treatment with glucocorticoids during the first trimester of pregnancy may have several persistent effects on school-aged children and adolescents. Exposure to glucocorticoids during the first trimester had no effect on cognitive, motor or social skills of preschoolers (Meyer-Bahlburg et al. 2004), and intelligence, memory encoding or long-term memory of 7-17-year-olds (Hirvikoski et al.

2007). However, in 7-17-year-olds, such exposure was associated with decreased verbal working memory, poorer self-perception of scholastic competence (Hirvikoski et al.

2007), and changes in gender role behaviour, in particular, reduction of masculine behaviour in boys (Hirvikoski et al. 2011).

Clinical investigation of the effects of exposure to glucocorticoids during the third trimester on the long-term outcomes of the offspring is very limited and has only been performed on children born preterm. Compared to preterm 6-year-old children that were

26 not exposed to maternal glucocorticoids, preterm children treated prenatally with glucocorticoids had very few cognitive disadvantages. They had lower scores in a test of visual memory and a test of visual abilities that required them to locate a target object in a busy background. However, they performed as well as control children on many of the other tests of language abilities and cognition and did not differ in any measures of progress in school (MacArthur et al. 1982). Adolescents prenatally exposed to glucocorticoids have higher blood pressure than those who were not; however, this group was born preterm (Doyle et al. 2000). However, all aforementioned studies were conducted with humans born preterm; preterm birth is inherently risky. No studies of children, adolescents or adults exposed to glucocorticoids in utero but carried to term have been conducted.

1.2.1.2 Long-term Outcomes

Preclinical data demonstrate that prenatal glucocorticoid exposure alters HPA axis activity and feedback in adult non-human animals. In adult rats, prenatal glucocorticoid exposure leads to an increase in basal levels of ACTH and CORT (Levitt et al. 1996;

O'Regan et al. 2004) and is associated with increased CORT levels in response to stress

(Muneoka et al. 1997). Such early exposure is also associated with enhanced CRH expression in the amygdala and hypothalamus (Welberg et al. 2001). This increase in expression and the levels of stress hormones indicates enhanced HPA axis activity.

Furthermore, perinatal exposure to glucocorticoids leads to reduced GR expression in the hippocampus, indicating impairment in the negative feedback ability of the HPA axis

(Levitt et al. 1996; Welberg et al. 2001). This alteration in HPA axis activity and

27 feedback is likely the reason for the anxious phenotype of these animals; these animals show increased anxiety and decreased exploratory and locomotor behaviours (Diaz et al.

1997; Welberg et al. 2001). This HPA axis alteration is also the mechanism that may trigger the higher blood pressure and disruption of glucose metabolism observed in these animals (Benediktsson et al. 1993; Levitt et al. 1996; Lindsay et al. 1996a; Lindsay et al.

1996b)

Early exposure to glucocorticoids also leads to permanent disruption of serotonin, dopamine and norepinephrine system function in the affected offspring (Diaz et al. 1997;

Muneoka et al. 1997; Oliveira et al. 2011). Alterations in these neurotransmitter systems may underlie the memory impairment (Welberg et al. 2001) and altered motor behaviour observed in the adult offspring (Diaz et al. 1997; Welberg et al. 2001), and may also contribute to the impairment in sexual behaviour reported in adult male rats (Oliveira et al. 2011). It is important to note that effects of glucocorticoids depend on the timing of prenatal exposure (Welberg et al. 2001), sex of the offspring (Diaz et al. 1997; Glynn and

Sandman 2012; O'Regan et al. 2004), and strain of the animal (Holmes et al. 2006).

1.2.2 Maternal Stress

1.2.2.1 Animal Models of Early Stress

There are a number of procedures that can be used to induce stress in a pregnant rat or mouse. Stressors can be of social/ psychological nature, such as crowding multiple dams into one cage (Hayashi et al. 1998), subjecting dams to social defeat (Brunton and

Russell 2010), exposure to a cat (Patin et al. 2002) or exposure to loud noise or flashing lights (Fride et al. 1986; Nishio et al. 2001). Stressors can also be of physical nature, such

28 as injections (Hayashi et al. 1998; Peters 1982), immersion in cold water, sleep deprivation (Velazquez-Moctezuma et al. 1993), electric foot shock (Takahashi et al.

1992) and restraint stress of various durations repeated 1 to 3 times a day (Miyagawa et al. 2011; Stohr et al. 1998; Vallee et al. 1997b). These stressors can also be combined in a predictable (same every day) (Bosch et al. 2006; Pascual et al. 2010; Zimmerberg and

Blaskey 1998) or an unpredictable manner, also known as chronic variable stress (Secoli and Teixeira 1998). Such disruptive manipulations of physical or psychological nature increase CORT levels in pregnant rodents (Barbazanges et al. 1996; Koehl et al. 1999;

Patin et al. 2002). The timing of exposure to stress varies across studies, with some studies administering stress for the entire pregnancy duration (Peters 1982), and others administering stress only for a part of pregnancy; frequently, the end of pregnancy is chosen as it is considered to be a more sensitive developmental period due to a surge of glucocorticoids and an increase of GRs in the brain.

1.2.2.2 Early-Developmental Effects

Clinical studies show that maternal stress is linked to unfavorable pregnancy outcomes: reduced gestational length, lower birth weight, impaired emotional and cognitive development in infants and children and behavioural problems (Bergman et al.

2007; Gutteling et al. 2005; Van den Bergh et al. 2005; Ward 1991; Witt et al. 2014). An association reported in clinical studies showed a link between maternal prenatal stress and childhood attention deficit hyperactivity disorder (ADHD)(Grizenko et al. 2012;

Rodriguez and Bohlin 2005; Ronald et al. 2010); this link is especially pronounced in boys (Rodriguez and Bohlin 2005). A link between maternal stress and incidence of

29 autism has also been reported (Kinney et al. 2008). One study followed children of women who were pregnant at the time of, and directly affected by the 9/11 attacks in the

United States. Children of these women had decreased salivary CORT levels at one year of age; these children were affected to a greater extent if their mothers were in the 3rd trimester of pregnancy during the attack (Yehuda et al. 2005).

Similar to observations made in humans, exposure to prenatal stress is linked to a decrease in birth weight and slower growth rate in non-human animal models (Lesage et al. 2004; Patin et al. 2002); increased rates of spontaneous abortion and postnatal mortality have also been reported (Patin et al. 2002). Prenatal stress also leads to a decrease in the weight of adrenal glands and a reduction in CORT blood levels in newborn animals that could be an early indicator of an HPA axis disruption (Dahlof et al.

1978; Lesage et al. 2004). Maternal stress has the ability to alter serotonergic system function in newborn pups; it elevates tryptophan, serotonin and the serotonin metabolite

5-HTAA levels in pup cortices. This increase has been detected at birth, immediately after maternal stress treatment is discontinued, with some changes lasting up to P16

(Peters 1982; 1990). The exact pattern and timing of these serotonergic changes differs between male and female offspring (Peters 1982).

1.2.2.3 Long-term Outcomes

Clinical studies have shown that maternal stress puts adult offspring at a higher risk for developing affective and psychiatric disorders such as schizophrenia (Selten et al.

1999; van Os and Selten 1998; Watson et al. 1999). However, all current studies of the

30 effects of prenatal stress in adults are retrospective, archival studies. Prospective studies are necessary to confirm such findings.

Preclinical studies demonstrate that prenatal stress causes molecular changes in the brains of adult offspring. Anatomical changes reported in preclinical studies include decreased hippocampal neurogenesis (Morley-Fletcher et al. 2011), decreased pyramidal cell density and smaller hippocampal glial cell density and number (Behan et al. 2011).

Furthermore, prenatal stress leads to decreased BDNF levels in the brains of adult offspring (Fumagalli et al. 2004; Matrisciano et al. 2012). Maternal stress leads to long- term alterations in a number of neurotransmitter systems; it increases serotonin (Peters

1982), dopamine and norepinephrine turnover in the adult brain (Takahashi et al. 1992), reduces dopamine release (Alonso et al. 1994), and increases dopamine auto-receptor density (Henry et al. 1995) in the nucleus accumbens.

In adult animals, one of the most robust findings regarding changes resulting from gestational stress exposure is the alteration of the HPA axis function. Prenatal stress alters circadian fluctuation of plasma CORT levels in adult rats; the peak of the CORT plasma levels occurs earlier in these animals (Koehl et al. 1999). HPA axis response to stress is also altered following prenatal stress exposure. In adult rats and mice, baseline CORT levels (Barbazanges et al. 1996; Behan et al. 2011; Dugovic et al. 1999; Henry et al.

1994; Koenig et al. 2005; Vallee et al. 1999; Vallee et al. 1997b), and the stress-response peak of CORT (Behan et al. 2011; Henry et al. 1994; Koenig et al. 2005; Vallee et al.

1999; Vallee et al. 1997b) do not differ in animals exposed and not exposed to prenatal stress. However, the post-stress CORT level of animals exposed to gestational stress are elevated (Barbazanges et al. 1996; Dugovic et al. 1999; Henry et al. 1994; Koenig et al.

2005; Vallee et al. 1999; Vallee et al. 1997b). ACTH response to stress is also augmented in this group (Brunton and Russell 2010). Furthermore, GR and MR levels are lower in the hippocampus and amygdala of animals exposed to stress in utero (Barbazanges et al.

1996; Henry et al. 1994; Koehl et al. 1999; Lee et al. 2011; Maccari et al. 1995). These changes in hippocampal GRs emerge late in development, as these alterations were observed in P21 and P90, but not P3 rats (Henry et al. 1994). Prolonged stress-response and GR alteration suggests a disruption of the HPA axis’ negative feedback loop in adult animals exposed to stress prenatally.

This alteration in HPA axis activity may be responsible for the increased anxiety often displayed by animals exposed to gestational stress, as demonstrated by animals’ performance in the elevated plus maze (EPM) apparatus (Bosch et al. 2006; Miyagawa et al. 2011; Morley-Fletcher et al. 2011; Vallee et al. 1997b; Zimmerberg and Blaskey

1998) and modified hole-board (Bosch et al. 2006). This increase in anxiety-like behaviour seems to depend on the animal’s genotype and the intensity of gestational stress (Bosch et al. 2006; Miyagawa et al. 2011). This anxiety does not become evident in all standard anxiety tests, as no change in anxiety-like behaviour is seen in the open field

(Koenig et al. 2005; Miyagawa et al. 2011) and elevated zero-maze (Behan et al. 2011).

In addition to changes in anxiety-like behaviours, the offspring of gestationally stressed mothers show alterations in a number of other behaviours. They display decreased performance in an object recognition task (Behan et al. 2011) and reduced social exploration (Matrisciano et al. 2012). They also show impairment in fear memory (Lee et al. 2011) that is not due to their inability to sense the shock; on the contrary, behavioural reaction to shock is enhanced in these animals (Takahashi et al. 1992).

To date, little work has been done to examine how perinatal stress exposure might affect sleep and circadian system functions. However, it does appear that both are altered.

Perinatally stressed male rats show several sleep abnormalities: an increase in paradoxical sleep; an increase in dark-phase, light slow-wave sleep; a decrease in deep slow-wave sleep; and a decrease in time spent awake during the dark phase of the circadian cycle (Dugovic et al. 1999). In adult animals, perinatal stress also leads to changes in the circadian rhythm of the corticosteroid function (Koehl et al. 1997; Markel et al. 1981); a shorter free-running period in constant darkness (Maccari et al. 2003); and stress-induced disruption of sleep patterns (Tiba et al. 2003).

Behavioural changes associated with perinatal stress often depend on stress intensity (Miyagawa et al. 2011), nature and timing of the stressor (Koenig et al. 2005;

Velazquez-Moctezuma et al. 1993), age of testing (Vallee et al. 1999), sex and genotype

(Behan et al. 2011; Bosch et al. 2006; Stohr et al. 1998); therefore it is not surprising that different studies report different behavioural outcomes following perinatal stress.

Behavioural changes in the offspring of dams stressed during pregnancy include bidirectional alterations in prepulse inhibition of acoustic startle (PPI) (increase:

(Lehmann et al. 2000), decrease: (Kjaer et al. 2010; Koenig et al. 2005; Matrisciano et al.

2012)) and alterations of exploratory behaviour (no change: (Behan et al. 2011; Koenig et al. 2005; Miyagawa et al. 2011; Stohr et al. 1998; Zimmerberg and Blaskey 1998), increase: (Bosch et al. 2006; Matrisciano et al. 2012; Stohr et al. 1998; Vallee et al.

1997b), decrease:(Bosch et al. 2006; Miyagawa et al. 2011)). Perinatally stressed mice show reduced aggressive behaviour (Kinsley and Svare 1987; Patin et al. 2005; Politch and Herrenkohl 1979; Tsuda et al. 2011); however, sex and strain can change levels of

33 aggressive behaviour of perinatally stressed mice (Kinsley and Svare 1987). Active avoidance learning was reported as decreased (Lehmann et al. 2000), increased (Stohr et al. 1998), and not changed (Stohr et al. 1998). Reports of spatial memory abilities are also not uniform. Morris Water Task (MWT) performance is impaired in adult male mice

(Bustamante et al. 2010) but not in adolescent (Hayashi et al. 1998) or adult rats (Vallee et al. 1999; Vallee et al. 1997b). Water-filled T-maze performance is impaired in male but not female rats (Nishio et al. 2001). Y-maze performance of prenatally stressed, adult male rats is not affected by perinatal stress (Vallee et al. 1999; Vallee et al. 1997b).

Results of the assessment of depressive-like behaviours, as measured with the forced swim test and in the inescapable shock paradigm, also vary; increase (Morley-Fletcher et al. 2011; Secoli and Teixeira 1998), decrease (Stohr et al. 1998), and no change in depressive-like behaviours following exposure to stress during the second to last or last week of pregnancy (Stohr et al. 1998).

Previous findings demonstrate that prenatal stress is associated with dysmasculinization in the anatomy and behaviour of male offspring. Anogenital distance and testicular weight are reduced in neonate male rats exposed to prenatal stress (Dahlof et al. 1978; Keshet and Weinstock 1995). In the male adult offspring exposed to prenatal stress, the size of the sexually-dimorphic nucleus of the preoptic area is reduced, indicating feminization of this area, as it is normally smaller in females (Rhees et al.

1999). Prenatal stress is also associated with dysmasculinization in sexual behaviour and hormones, and reduced sex-difference in hippocampal gene expression of adult male offspring (Biala et al. 2011; Velazquez-Moctezuma et al. 1993; Ward 1972). Because aggressive behaviour is characteristically male, reduced aggression in prenatal stress

34 adult male offspring (Kinsley and Svare 1987; Patin et al. 2005; Politch and Herrenkohl

1979; Tsuda et al. 2011) may also indicate dysmasculinization. Masculinization of the male fetal brain is mediated by testosterone and aromatase. Maternal stress causes a decrease in the level of peripheral testosterone and hypothalamic aromatase in male offspring, potentially leading to the dysmasculinizing characteristics observed in these animals (Murase 1994; Ward and Weisz 1984)

1.3 Exposure to Fluoxetine During Early Development

Some sections of the work contained below were previously published:

Kiryanova, V., McAllister, B., & Dyck, R. (2013). Long-Term Outcomes of

Developmental Exposure to Fluoxetine: A Review of the Animal Literature. Mini-reviews in Developmental Neuroscience, 35(6), 437-449. PMID: 24247012

The author was responsible for writing the first draft of the manuscript, and manuscript revisions. McAllister, B revised the manuscript. Dr. Dyck contributed to revisions of the manuscript.

A significant number of infants are exposed to selective serotonin reuptake inhibitor (SSRI) medications prior to birth or while nursing. Women of child-bearing age are the population at highest risk of experiencing depression (Noble 2005), for which

SSRIs are the treatment of choice. Overall, over 6.2% of pregnant women use SSRIs during pregnancy (Andrade et al. 2008; Cooper et al. 2007). Fluoxetine (brand name

Prozac, Sarafem, Rapiflux) is one of the most commonly prescribed SSRIs, with 1.9-

2.1% of women taking fluoxetine (Flx) at one point during pregnancy (Andrade et al.

2008; Cooper et al. 2007). In fact, Flx is one of the top 20 specific prescription medications most commonly taken by pregnant women (Mitchell et al. 2011). Flx inhibits serotonin (5-HT) reuptake, thereby increasing the levels of serotonin at the synapse.

Flx and its metabolite norfluoxetine (NorFlx) cross the placental barrier (Kim et al. 2006) and are excreted in breast milk, resulting in plasma concentrations that can reach therapeutic levels in breastfed infants (Lester et al. 1993). To date, a considerable amount of research has been conducted on the effects of exposure to SSRIs during development. The majority of this work has focused on exposure to SSRIs in general, with significantly fewer studies focusing specifically on the effects of Flx or other individual SSRIs. In all cases, however, there has been a complete lack of focus on the outcomes of exposed individuals beyond the preschool age (Alwan and Friedman 2009).

This is concerning, given that serotonin modulates a multitude of developmental processes (for a review see Vitalis and Parnavelas 2003), and that genetic variation in the availability of serotonin is known to alter the organization of the brain as well as behaviour later in life (Nordquist and Oreland 2010). To address this concern, many laboratories have turned to modeling the developmental effects of SSRI exposure in non- humans. As in humans, Flx crosses the placental barrier in rats and mice, producing a comparable level of fetal exposure (Noorlander et al. 2008; Olivier et al. 2011b). It also crosses the rodent fetal blood-brain barrier, leading to detectable Flx and NorFlx levels in the blood and brain of pups. As such, these animals can serve as useful models of Flx exposure, allowing for the investigation of parameters that would not easily be probed in humans, particularly neurodevelopmental and long-term behavioural outcomes. However,

36 there is still a great deal of discrepancy amongst the results of studies in this area. This likely results from many factors, including differences in the dosage and route of administration; the length of exposure and the period in development over which it occurs; the species, strain, and sex of animal used; the age of the animal during exposure and at testing; the animal’s history of exposure to stress and handling; and the behavioural testing protocol.

1.3.1 Early-Developmental Effects

In most studies that have examined the effects of developmental Flx exposure in non-human animals, teratogenic and early postnatal outcomes have not been a major focus. This is perhaps because these are the effects most easily studied in human infants.

Nevertheless, several studies have provided such data, and the pattern is remarkably similar to what has been observed by clinical researchers. The majority of the clinical studies have not detected an increase in the risk of developing major malformations, both following fetal exposure to all SSRIs considered together or to Flx specifically (see Malm

2012 for a review of the subject). However, there are a few notable exceptions. One study found that women who were prescribed Flx during pregnancy gave birth to infants who were at higher risk of developing cardiovascular abnormalities, specifically ventricular septal defects, but were not at a higher overall risk for other malformations (Malm et al.

2011). Another study found an association between first-trimester Flx exposure and cardiovascular anomalies, but again, not with other malformations (Diav-Citrin et al.

2008). On the other hand, a third study found a contrasting pattern, where there was a small increase in the overall risk for major malformations in children of women who

37 reported Flx use during pregnancy, but no increase in the risk of cardiovascular defects specifically (Reis and Kallen 2010), and another study found an increase in the risk of developing septal heart defects following exposure to other SSRIs, but not fluoxetine in particular (Pedersen et al. 2009). Additionally, it appears that Flx exposed infants may also be more likely to display persistent pulmonary hypertension after birth, though the absolute risk level remains low even following SSRI exposure (Kieler et al. 2012).

Unfortunately, none of these studies were able to control for the potential effects of maternal depression, which makes it difficult to be certain that Flx is the true cause of these malformations. In studies of non-human animals, few major malformations have been reported, though many researchers, especially those interested in long-term effects, likely do not examine for these all that closely. However, as with studies of human infants, a few have noted cardiovascular abnormalities. In one study, exposure to Flx from mid-to-late gestation in rats caused pulmonary hypertension and structural abnormalities of the heart and pulmonary vascular system, coinciding with an increase in postnatal mortality from 0% in controls to 15% in exposed pups (Fornaro et al. 2007). A similar increase was noted by Vorhees et al. (1994) following prenatal exposure, and by

Müller et al. (2013) following administration of a high dosage of Flx to the dam from one week after conception to weaning, though lower dosages did not have the same effect. In neither study was the cause of this increased mortality examined. However, a related finding in mice, wherein Flx exposure beginning after the first week of gestation resulted in a very dramatic rate of mortality of 81%, was linked to an abnormality of the heart, specifically, dilated cardiomyopathy (Noorlander et al. 2008). Oddly, the high mortality rate noted in this study, despite resulting from a very low maternal dosage (0.8

38 mg/kg/day, i.p.), has not been consistently replicated in numerous other studies using much larger dosages over a similar period of time during development (Bairy et al. 2007;

Byrd and Markham 1994; da-Silva et al. 1999). Together, these findings suggest that such a small dosage only has a pronounced effect when administered by intraperitoneal injection, and more broadly, that increased mortality might result only from exposure during a critical period in development, perhaps organogenesis, though it should be noted that some researchers who reported no change in mortality began administration as early as the sixth gestational day (Bairy et al. 2007; Byrd and Markham 1994). In addition to cardiac malformations, minor abnormalities and developmental delays have also been noted in Flx-exposed rats, such as transient impairment of the negative geotaxis reflex and delayed eruption of the incisor teeth (Bairy et al. 2007), as well as an increase in the rate of ultrasonic vocalizations (Cagiano et al. 2008). Unfortunately, these findings have not been well corroborated, as the same measures have not commonly been examined across studies. Delays in reflex development may have some relation to a subtle impairment in fine motor skill noted in children between the ages of 6 and 40 months who were exposed to Flx during pregnancy (Casper et al. 2003), which to our knowledge is one of the very few effects of developmental exposure noted beyond early infancy.

Whether or not this impairment was persistent or transient is not known, as no follow-up testing was conducted. Finally, sexual differentiation during early life may also be altered, as postnatally exposed male (but not female) rats were found to have shorter than normal anogenital distances at three weeks of age, though serum testosterone was not altered, and the difference in anogenital distance was no longer apparent by adulthood in

39 males (Rayen et al. 2013). In another study, prenatal exposure to low and high dosages of

Flx was found to have no effect on anogenital distance at birth (Muller et al. 2013).

As in the case of congenital malformations, it is still an open question whether prenatal Flx exposure affects factors such as gestational length, birth weight, and litter size. Some clinical studies have reported decreases in gestational length and birth weight following maternal Flx exposure (Chambers et al. 1996; Hendrick et al. 2003), though the majority have not (as reviewed in Cohen et al. 2000; Malm 2012). However, it is worth noting that such findings are often difficult to interpret, as the effect of Flx exposure can be confounded by the effect of maternal depression, which itself might increase the risk for premature birth (Wisner et al. 2009). Maternal condition is more easily controlled for in studies of non-human animals, some of which have found that Flx has a deleterious effect on one or more measures, including decreased pregnancy duration (da-Silva et al.

1999), litter size (Bauer et al. 2010; Olivier et al. 2011b) and birth weight (Bairy et al.

2007; Cabrera and Battaglia 1994; Cagiano et al. 2008; da-Silva et al. 1999; Muller et al.

2013; Vorhees et al. 1994). However, as in the clinical research, for each of these factors there are multiple studies that report no significant alterations, even using similar dosages and periods of exposure. Thus, straightforward conclusions are difficult to draw, a problem that is exacerbated by the fact that not all studies include these relatively simple measures.

Another interesting, although limited, line of research is the effect of prenatal Flx exposure in sheep. Flx was administered by a method of intravenous infusion into the ewe that produced serum levels within the human therapeutic range (Morrison et al.

2001), and the fetuses were assessed. Flx exposure decreased time spent in the low-

40 voltage electrocortical/rapid eye movement behavioural state (Morrison et al. 2001) and increased levels of stress hormones, indicating disruption of HPA axis function (Morrison et al. 2004). Gestational age and birth weight were not altered.

1.3.2 Long-term Outcomes

1.3.2.1 Behaviour

Due to the role of serotonin in development, it is not surprising that Flx exposure can exert developmental effects. Whether or not these effects are behaviourally significant and persist into maturity, however, is another question. In human infants, little research has been done to address this question, as Flx exposed infants have not been examined beyond the age of seven (as reviewed in Alwan and Friedman 2009).

Fortunately, one of the strengths of modelling Flx exposure in non-human animals is that the effects of exposure during development on the behavioural outcomes of mature animals can be relatively easily assessed. Numerous studies have been conducted on just this topic.

1.3.2.1.1 Depression and anxiety

As an indicator of depression-like behaviour, several studies have assessed the amount of time spent immobile in the forced swim test. In this test, the animal is placed in a stressful, inescapable situation, and immobility is considered to be a form of

“behavioural despair” where the animal ceases its attempts to escape. There appear to be sex differences in the effect of early Flx exposure on this behaviour, as female, but not male, mice exposed to Flx throughout pregnancy and until weaning show an increase in

41 immobility when tested during adolescence and adulthood (Lisboa et al. 2007). The conclusion that Flx exposure increases depression, however, is obscured by the finding that exposed female mice take longer to become immobile (McAllister et al. 2012), which is associated with a decrease in depression, though the larger dosage, more restricted period of exposure, and non-stressful method of administration used in this study might account for the difference in findings. In addition, it has been observed that male Flx exposed mice spend less time immobile (Karpova et al. 2009), though it is difficult to compare this finding to the previous two, as Flx exposure was exclusively postnatal and administered directly to the pups via a stressful method (injection) rather than indirectly by maternal administration. Other studies examining exclusively prenatal or exclusively postnatal exposure have failed to detect changes in immobility (Olivier et al. 2011b; Rayen et al. 2011).

Changes in anxiety-like behaviour have also been examined, most commonly using the open-field test (OFT) and elevated plus maze (EPM), but also using the novelty-suppressed feeding/drinking tests. The bulk of the evidence indicates that Flx exposure either does not alter anxiety in adolescent or adult animals (Bairy et al. 2007;

Capello et al. 2011; Forcelli and Heinrichs 2008; Karpova et al. 2009; Lee and Lee 2012;

Lisboa et al. 2007; Nagano et al. 2012; Zheng et al. 2011) or causes an increase (Ansorge et al. 2008; Ansorge et al. 2004; Noorlander et al. 2008; Olivier et al. 2011b; Rebello et al. 2014; Smit-Rigter et al. 2012). Interestingly, it appears that the novelty-suppressed feeding/drinking tests are particularly sensitive to the effects of Flx exposure, as differences have been found on these tests without observing changes in the EPM or OFT

(Ansorge et al. 2008; Ansorge et al. 2004; Olivier et al. 2011b). Of the studies that did

42 observe increased anxiety in the EPM or OFT, one used a sample that could be considered exceptional due to the uncommonly high mortality rate, discussed above

(Noorlander et al. 2008), and the other used a non-standard stress-preceded version of the

EPM in addition to the standard EPM. In the standard EPM, no differences were observed (Olivier et al. 2011b). To our knowledge, only three studies in this area have noted a decrease in anxiety. In two of them, female offspring exposed to Flx by non- stressful maternal administration showed decreased anxiety in the EPM, though not in the

OFT (Kiryanova and Dyck 2014; McAllister et al. 2012). In the other, adolescent, but not adult, male and female rats exposed to Flx from gestation through to weaning showed decreased anxiety in the novelty-suppressed feeding test (Francis-Oliveira et al. 2013).

There do not appear to be any obviously identifiable experimental factors that can account for these disparate finding. However, it is possible that differences may have resulted from seemingly minor differences in behavioural testing methodology. For example, in the EPM, prior handling is known to exert considerable effects (Andrews and

File 1993; Schmitt and Hiemke 1998), which means that the temporal position of the

EPM within the test battery and the animals’ history of handling or stress could shape the results. This point is further emphasized by the fact, mentioned above, that differing results have been obtained depending on the level of stress of the animal being tested in the EPM.

1.3.2.1.2 Locomotion, motor coordination, sensorimotor function, and circadian rhythmicity

The effect of developmental Flx exposure on exploratory locomotion has been widely examined, with results that show greater consistency than any other behavioural domain so far assessed. In adolescence, early exposure inhibits locomotion (Bairy et al.

2007; Lee 2009; Lee and Lee 2012; Vieira et al. 2013) and decreases novel object exploration (Rodriguez-Porcel et al. 2011). Lisboa et al. (Lisboa et al. 2007) observed decreased locomotion only in male mice, suggesting a difference in sensitivity between the sexes. Moreover, this hypolocomotion appears to persist into adulthood, and does not depend on whether Flx exposure is prenatal or postnatal, or whether Flx is administered directly to the pup or indirectly via the dam (Ansorge et al. 2008; Ansorge et al. 2004;

Bairy et al. 2007; Forcelli and Heinrichs 2008; Karpova et al. 2009; Zheng et al. 2011).

Though some other studies have failed to detect an effect, to our knowledge no study has reported an increase in locomotion following developmental Flx exposure.

Interestingly, Flx exposure may affect not just the quantity of motor activity, but its quality as well, though the evidence for this is mixed. Bairy et al. (2007) noted that male and female rats exposed prenatally to Flx performed better on a test of motor coordination in which the rat had to walk on a rotating cylinder. However, Lee and Lee

(2012) found that male adolescent rats briefly exposed to a higher dosage of Flx during the early postnatal period were quicker to fall off the cylinder than controls, though this difference was abolished after several training sessions. Though these reports appear contradictory, it is possible that both are accurate; it could be the case that Flx is beneficial to motor coordination during the prenatal period but deleterious postnatally, or that Flx improves motor coordination at lower levels of exposure while impairing it at higher levels.

There is limited evidence that Flx may also affect sensory capability. Lee (2009) found that rats briefly exposed to Flx during the early postnatal period crossed shorter distances in the gap-crossing test, which is suggestive of impaired vibrissal function.

Though this test has some issues in that it is potentially confounded by motivation or anxiety, the same rats also showed reduced thermal sensitivity in the hot-plate test (Lee

2009), which likely cannot be explained by such factors. However, Lisboa et al. (2007) showed that female and male mice treated throughout pregnancy and lactation were no different than controls in terms of thermal sensitivity, and Knaepen et al. (2013) observed no effect of postnatal Flx exposure on sensitivity to thermal (or mechanical) stimuli in male rats, though the treatments used in both studies likely resulted in a substantially lower concentrations of Flx than the one used by Lee (2009). Thermal sensitivity was also assessed in a study by Vartazarmian et al. (2005), in which male and female guinea pigs were exposed to Flx throughout the entirety of gestation by implanting osmotic mini-pumps into the pregnant sow. Intriguingly, Flx exposure did not alter thermal sensitivity relative to untreated controls, but it did normalize thermal sensitivity by reversing the sensitizing effect of vehicle treatment. The fact that vehicle treatment increased thermal sensitivity, perhaps through an effect of maternal stress associated with repeated mini-pump implantation, is very interesting, and highlights the importance of considering the way in which Flx treatment might interact with the stress caused by most administration methods. Additionally, it was found that, relative to the performance of vehicle treated animals, Flx did not affect sensorimotor gating function, as assessed by prepulse inhibition (PPI) of the acoustic startle response, though both vehicle and Flx treatment increased PPI relative to untreated controls (Vartazarmian et al. 2005). In

45 another examination of PPI, no effect of Flx treatment was observed in female mice

(McAllister et al. 2012), nor has the magnitude of the acoustic startle response itself been found to be altered in guinea pigs (Vartazarmian et al. 2005), female mice (McAllister et al. 2012), or adolescent and adult rats (Vorhees et al. 1994).

To date, little work has been done to examine how developmental Flx exposure might affect the circadian system, though the evidence that does exist suggests that it is indeed altered. Specifically, exposure resulted in larger phase advances in response to a light-pulse, a shortened free-running circadian period in constant darkness, and a decrease in the phase-shifting response to the 5-HT1A/7 agonist 8-OH-DPAT (Kiryanova et al. 2013b).

1.3.2.1.3 Social, sexual, and aggressive behaviours

In contrast with the emotional and motor behaviours studied above, social and reproductive behaviours have been relatively poorly characterized. This is concerning, considering a recent report demonstrating that children with autism spectrum disorders, which are often associated with significant social impairments, were more likely than control children to have been prenatally exposed to SSRIs (Croen et al. 2011). Though few studies have examined whether early Flx exposure affects social behaviours in rodents, the findings of those that have suggest these behaviours may be impaired.

Aspects of social play are reduced considerably in male, but not female, adolescent rats following postnatal exposure to Flx (Rodriguez-Porcel et al. 2011). Similar effects on the social play of male adolescent rats have also been observed following prenatal exposure

(Olivier et al. 2011b), suggesting that this effect is consistent regardless of the period of

46 exposure. In adults, a test of preference for investigating a novel conspecific versus an inanimate object showed that adult male and female Flx-exposed rats had less of a preference for the conspecific (Rodriguez-Porcel et al. 2011), which could reflect reduced social motivation. Sexual behaviours in male rats are disrupted or decreased by postnatal

Flx, administered either directly to the pup or indirectly via the dam’s milk (Rayen et al.

2013; Rodriguez-Porcel et al. 2011), but not following exposure throughout pregnancy and lactation in mice, though this treatment was found to reduce sexual motivation, as assessed by preference for investigating a receptive female over an adult male (Gouvea et al. 2008). Other studies have found no effect on male sexual behaviour or motivation following prenatal or combined prenatal and postnatal exposure. Unlike in males, sexual behaviours in female rats are increased following postnatal exposure to Flx (Rayen et al.

2014).

Aggressive behaviour represents a particularly interesting case, given that an over-abundance of serotonin in humans, caused by loss of the MAOA gene, has been found to produce a notable syndrome of impulsive aggression (Brunner et al. 1993), an effect that is mirrored in MAOA knockout mice (Cases et al. 1995). This might also be the case following developmental Flx exposure. Some studies show that prenatal exposure increases the incidence of fighting bouts in a test of footshock-induced aggression (Singh et al. 1998) and increases the time spent exhibiting aggressive behaviours in the resident- intruder task (Kiryanova and Dyck 2014). On the other hand,

Lisboa et al. (2007) found that treating dams with Flx throughout pregnancy and lactation exerted no effect on the aggressive behaviour of offspring in the resident-intruder test, other than a non-significant tendency toward increasing latency to the first attack, which

47 could indicate a subtle decrease in aggression. The fact that aggression is not a homogenous behaviour, and that one study examined aggression resulting from exposure to painful stimuli whereas the other assessed territorial aggression, may account for the difference in findings.

1.3.2.1.4 Learning, memory, and reward

Limited evidence suggests that developmental Flx exposure may actually improve spatial memory, as decreased escape times have been noted in male adolescent rats and mice in a water maze (Bairy et al. 2007; Kiryanova and Dyck 2014). On the other hand, the same was not found in female mice (McAllister et al. 2012) or by another group examining the performance of adolescent rats in a water maze and on a test of spontaneous alternation using a very similar dosage and period of administration

(Vorhees et al. 1994).

Flx exposure during development may also strengthen fear memory in later life, though here, too, the evidence is mixed. In a passive avoidance test, prenatally exposed male and female adolescent rats took longer to enter a compartment previously associated with a shock (Bairy et al. 2007), though a similar study did not find the same effect in either sex (Vorhees et al. 1994). In adulthood, prenatally Flx exposed male rats showed increased fear memory in a shock-induced place aversion test (Olivier et al. 2011b).

Furthermore, adult mice show an impairment in fear extinction memory (Rebello et al.

2014). On the other hand, postnatally exposed mice have been found to take longer to escape a foot-shock in an active avoidance test (Ansorge et al. 2008; Ansorge et al. 2004), though this may reflect an altered stress response (Ansorge et al. 2004) rather than an

48 impairment in fear learning. Finally, prenatal Flx exposure in rats has been found to increase place preference in response to cocaine administration and increase the number of attempted self-administrations during an extinction trial, indicating that Flx exposure might increase sensitivity to the rewarding effect of this drug (Forcelli and Heinrichs

2008).

1.3.2.2 Neuroanatomy

As one would expect, given its ability to manipulate behavioural outcomes, Flx has been tied to long-term chemical and physiological changes in the brains of animals exposed in early development. Not surprisingly, many of these changes are of the serotonin system itself. It is also not surprising that the pattern of findings is complex, mirroring the way in which the behavioural outcomes of Flx exposure differ extensively based on when exposure occurs and when outcomes are assessed. Prenatal exposure reduced serotonin in the frontal cortex of adolescent rats (Cabrera-Vera et al. 1997), but the same measure was increased in adults and adolescents when exposure was postnatal

(Nagano et al. 2012). Similarly, in adolescents, an increase in serotonin was noted in ventral, though not dorsal, hippocampus when administration was postnatal (Nagano et al. 2012), yet no effect was found on hippocampal serotonin, nor on serotonin in the hypothalamus, striatum, or midbrain, when Flx was given prenatally (Cabrera-Vera et al.

1997). By adulthood, however, a decrease in midbrain serotonin had emerged, while frontal cortex serotonin had normalized (Cabrera-Vera et al. 1997). This decrease in midbrain serotonin could be related to changes in serotonergic neurons themselves, as postnatal Flx exposure has been found to reduce the number and size of neurons in the

49 raphe nuclei (Silva et al. 2010), which could also account for the noted reduction in serotonin transporter (SERT) in this region following prenatal exposure (Forcelli and

Heinrichs 2008; Noorlander et al. 2008).

Changes in SERT and serotonin receptor density have been found to show similarly complex patterns. In adolescent rats exposed prenatally, SERT density is decreased in the dorsomedial hypothalamus, but increased in the lateral hypothalamus, hippocampus, and amygdala (Cabrera-Vera and Battaglia 1998), demonstrating that even regional changes might be obscured by differential changes in sub-regions. Limited evidence suggests that there is little effect on serotonin receptors at this stage, as no differences were found in hypothalamic 5-HT2A and 5-HT2C density (Cabrera and

Battaglia 1994) or prefrontal 5-HT1A and 5-HT2A mRNA expression (Nagano et al. 2012).

In contrast, by adulthood changes in SERT density outside the raphe nuclei appear negligible (Cabrera-Vera and Battaglia 1998; Cabrera-Vera et al. 1997; Capello et al.

2011; Forcelli and Heinrichs 2008), whereas changes in receptor density emerge, at least in the case of 5HT2A and 5HT2C receptors within the hypothalamus, which are downregulated (Cabrera and Battaglia 1994). It will be interesting to see whether this tentative pattern is upheld by future findings.

Beyond the serotonergic system, early Flx exposure alters neuronal morphology in regions widely dispersed throughout the brain. For the most part, Flx exposure appears to reduce later neuronal complexity. In adolescent rats, early postnatal exposure decreases the dendritic complexity of both thalamocortical afferents and spiny stellate neurons in layer IV of somatosensory cortex (Lee 2009), and prenatal exposure reduces the complexity of layer II/III pyramidal neurons in the same region in adolescent and adult

50 mice (Smit-Rigter et al. 2012). This loss of complexity in somatosensory cortex may account for the deficits in tactile sensation described above. Similar decreases in either spine density or dendritic complexity have also been noted in pyramidal neurons in layer

V of motor cortex and medium spiny neurons in the striatum (Lee and Lee 2012), though a rare increase in spine density was observed in hippocampal CA1 dendrites in adult mice following postnatal exposure (Zheng et al. 2011).

Flx exposure also appears to have effects on broader systems, causing alterations in neurogenesis and the stress response. Postnatal exposure decreased cell proliferation in the dentate gyrus in adolescence, though the number of migrating cells was not altered

(Rayen et al. 2011), suggesting an increase in the survival of proliferating cells.

Decreased glucocorticoid receptor density and glucocorticoid receptor interacting protein expression have been noted in male, but not female, adolescent rats in the CA3 region, though not in CA1 or dentate gyrus (Pawluski et al. 2012c). The effects of Flx exposure on stress-responsivity also extend beyond the hippocampus, as decreased serum corticosterone and a decrease in the free corticosterone index have also been noted, again only in males (Pawluski et al. 2012c). Additionally, Flx exposure appears to alter activation of certain regions of the brain in response to restraint stress, with adolescent males showing less activation of the basolateral amygdala, and adult males showing less activation of both the basolateral and medial regions of the amygdala (Francis-Oliveira et al. 2013). None of these changes were observed in females, nor was activity in the central nucleus of the amygdala or the paraventricular nucleus altered in either sex. Such sex specific changes might hint at the cause behind the sex differences observed in certain behavioural effects of Flx exposure. Further relating to sex differences, Flx exposure may

51 have effects on certain sexually dimorphic regions of the brain. This has not been well studied to date, but recently it was reported that postnatal exposure to fluoxetine in male

(but not female) rats decreases the volume of the sexually dimorphic nucleus of the preoptic area in the hypothalamus, which is normally larger in males than in females, though it was not found to alter two other dimorphic regions of the brain, the posterior bed nucleus of the stria terminalis and the anteroventral periventricular nucleus, in males or females (Rayen et al. 2013; 2014). Finally, serotonin may not be the only neurotransmitter system affected by developmental exposure to Flx. One study has reported that exposure during pregnancy and the pre-weaning period reduces the intensity of dopamine-mediated behaviours following pharmacological challenge in female adolescent mice (Favaro et al. 2008). This raises the possibility of long-term changes in the dopaminergic system, though more specific analysis is still required. So far, no other changes have been found, though only basal dopamine and norepinepherine levels

(Cabrera-Vera et al. 1997), as well as norepinepherine transporter density in frontal cortex

(Capello et al. 2011) have been examined.

1.4 Exposure to Stress and Fluoxetine During Early Development

1.4.1 Maternal Stress and the Serotonergic System Integrity

As discussed earlier (sections 1.2.1.2 and 1.2.2.3), multiple studies show that maternal stress and glucocorticoid exposure lead to alterations in offspring’s brain anatomy and behaviours that last into adulthood. However, programming sensitivity to maternal stress can be modulated by genetic factors, especially those that are responsible for the serotonergic system integrity.

Genetic factors that affect the function of the serotonergic system interact with early adverse environment to affect long-term behaviours. This interaction has been observed in humans (Caspi et al. 2002; Foley et al. 2004; Frazzetto et al. 2007; Nilsson et al. 2006), and non-human primates (Barr et al. 2003; Chen et al. 2010; Newman et al.

2005). For example, Newman (Newman et al. 2005) studied the interaction between monoamine oxidase A gene (MAOA; degrades synaptic serotonin, dopamine and norepinephrine) polymorphism and early adversity on the behavioural outcomes of rhesus monkeys. The aggressive behaviour of monkeys with high MAOA activity was not affected by an adverse rearing environment, while aggressive behaviour of monkeys with low MAOA activity was affected by an adverse rearing environment. Similarly, only low

MAOA activity is associated with behavioural changes such as conduct disorders and criminal behaviours in adolescent human males exposed to an adverse childhood environment (Caspi et al. 2002; Foley et al. 2004; Nilsson et al. 2006). Therefore, high

MAOA activity might reduce programming sensitivity, and/or low MAOA activity could promote programing sensitivity to early stress.

Similarly, alterations in the expression of serotonin transporter (5-HTT; removes serotonin from the synaptic space) may be able to affect offspring’s programming sensitivity to early stress. Inactivation of one or both copies of the 5-HTT gene sensitizes mice to the effects of prenatal stress, leading to increased anxiety and depressive behaviours (Heiming et al. 2009; Van den Hove et al. 2011). In adult rhesus monkeys, polymorphism that reduces 5-HTT activity also leads to higher alcohol preference in females and higher HPA stress response in both sexes, but only when combined with

53 disadvantageous early experience (Barr et al. 2004; Hoffman et al. 2007). Therefore, activity of 5-HTT may also modulate programming sensitivity of early stress.

1.4.2 Long-term Outcomes of Maternal Stress and Fluoxetine Exposure

Low activity of MAOA and 5-HTT genes appears to promote programing sensitivity to stress. Interestingly, both alterations lead to increased serotonergic tone.

Therefore, it is possible that exposure to non-genomic factors that increase serotonergic tone may have a similar effect. Selective serotonin reuptake inhibitors (SSRIs) are the primary pharmacological treatment for depression (Mandrioli et al. 2012) and about 6% of pregnant women in the U.S. are prescribed an SSRI at some point during their pregnancy (Andrade et al. 2008; Andrade et al. 2016). Depression is frequently precipitated or accompanied by stress (for a review see Monroe and Hadjiyannakis 2002;

Tennant 2002). Therefore, it is common for a human fetus to be exposed to a combination of maternal stress and SSRIs. At one time, Flx was the most commonly prescribed SSRI during pregnancy (Andrade et al. 2008). While sertraline has overtaken Flx in recent years for treatment of depression during pregnancy, more than 1% of pregnant women are still prescribed Flx at some point during their pregnancy (Andrade et al. 2016). Of those prescribed an antidepressant, between 20-25% will receive Flx (Andrade et al. 2016).

While many laboratories examine effects of SSRIs on foetal development (see section 1.3), it is the case, that people are not given Flx or other antidepressant medications arbitrarily, but rather because they are experiencing a condition, often depression, which may be associated with high levels of stress. Examining the offspring of healthy animals, then, is of questionable ethological validity when attempting to draw

54 inferences about exposed humans. Depression is often viewed as a stress-related disorder given the relationship between stressful life events and the onset of depressive episodes

(Kessler 1997). Though the degree to which human depression can be meaningfully modeled in rodents is debatable, it thus seems likely that inducing maternal stress would be highly valuable when conducting studies in this area. So far, relatively few studies have done so, though the ones that have seem to indicate that it is a worthy endeavour, as maternal stress and Flx exposure appear to interact in ways that differ from the effects of either in isolation.

It has been found that prenatal maternal stress potentiates the stress response, as measured by plasma corticosterone, of the offspring when assessed during adolescence and adulthood, and that perinatal Flx treatment reverses this effect while having no effect in the absence of stress (Ishiwata et al. 2005; Salari et al. 2016). Moreover, when adult offspring were assessed, a similar pattern was observed in hippocampal dendritic spine and synapse density, with stress causing a decrease and Flx reversing it, as well as behaviourally in the MWT, with prenatal stress causing a decline in spatial and reversal learning and postnatal Flx reverting these functions to normal (Ishiwata et al. 2005).

Early-postnatal Flx has also been found to reverse some other behavioural alterations caused by prenatal maternal stress, including depression-like and anxiety-like behaviours in adolescent (Ordian et al. 2010b; Rayen et al. 2011) and adult rats (Boulle et al. 2016), and effects of prenatal maternal stress on post-operative pain. Specifically, stress dulled the hypersensitivity to mechanical stimuli induced by hind-paw incision, whereas postnatal Flx exposure intensified this post-operative pain (Knaepen et al. 2013). In combination, the effects appeared to cancel out, leaving offspring no different than

55 normal. In the hippocampus, postnatal Flx normalizes the prenatal stress-induced downregulation of neurogenesis in adolescent rats (Rayen et al. 2011) and alterations in hippocampal morphology in adult rats (Ishiwata et al. 2005; Rayen et al. 2015). However, when administered in the absence of stress, postnatal Flx appears to cause a decrease in hippocampal proliferation, though not in the number of migrating neuroblasts, providing another example of how Flx exposure interacts with maternal stress (Rayen et al. 2011).

It is important to note that while perinatal stress and Flx exposure interact in their effect on some behavioural and molecular outcomes, they also have a number of distinct long-term effects on the offspring. Perinatal stress and Flx have distinct effects on reproductive behaviour (Rayen et al. 2013; 2014), sexual brain differentiation (Rayen et al. 2013), and hippocampal and cortical BDNF signaling (Boulle et al. 2016).

Despite the growing interest in this area, there has been a lack of focus on behavioural changes in adulthood. Behaviours in adults have not yet been thoroughly examined aside from reproductive behaviour (Rayen et al. 2013) and spatial memory

(Ishiwata et al. 2005) in males, and reproductive (Rayen et al. 2014) and depressive-like behaviours (Boulle et al. 2016) in females. Furthermore, molecular mechanisms of stress by fluoxetine interaction are not yet understood.

Though the exact mechanism by which this interaction occurs is not known, it may have to do with the long-term effects of developmental Flx exposure and maternal stress on serotonin levels. It has been observed that Flx exposure decreases serotonin levels in the cortex of adolescent rats (Cabrera-Vera et al. 1997) whereas prenatal maternal stress increases them (Peters 1982). Conversely, it has also been reported that prenatal stress decreases serotonin in mice when measured around the time of weaning,

56 while postnatal Flx treatment alone or in combination with prenatal stress increases serotonin (Ishiwata et al. 2005). As such, while the effects of stress and Flx exposure, in early development, on the serotonergic system are not entirely clear, it appears that these effects may be act in opposition, which could account for why the occurrence of both in tandem normalizes the effects of either in isolation.

1.5 Rationale

It is apparent that Flx and stress exposure during development are capable of affecting long-term offspring outcomes. However, much remains to be elucidated about their combined effects on brain and behaviour. The five studies conducted in this thesis will serve to answer questions regarding long-term behavioural outcomes, integrity of offspring’s circadian system, and mechanisms and molecular consequences of perinatal exposure to stress and Flx.

Recent research has indicated that perinatal exposure to stress and Flx, separately, lead to significant behavioural alterations. However, little attention has been dedicated to their combined effects. In Chapters 2 and 3, thorough behavioural assessment of male

(Chapter 2) and female (Chapter 3) mice will be conducted. Additionally, circadian behaviour of male offspring will be examined in Chapter 4.

Considering the evidence for the serotonergic system’s involvement in long-term effects of stress and Flx, serotonin receptor knockout mice will be used to model the long-term effects of Flx and to examine serotonin 1A receptor involvement in long-term effects of stress Chapter 5.

In Chapter 6, to enhance our understanding of the biochemical mechanisms of stress and Flx exposure, several molecular features of the brain will be evaluated to determine endocannabinoid and serotonergic system function of male and female offspring.

Effects of maternal stress and perinatal fluoxetine exposure on behavioural outcomes of adult male offspring

The work contained within this Chapter was previously published:

Kiryanova, V., Meunier, S., Vecchiarelli, H., Hill, M. N., & Dyck, R. H. (2016). Effects of maternal stress and perinatal fluoxetine exposure on behavioural outcomes of adult male offspring. Neuroscience, 320, 281–296. PMID: 26872999

The author designed the study, performed the stress and fluoxetine manipulations, performed behavioural assessments, assisted with tissue collection, assisted with BDNF analysis, conducted statistical analysis, and wrote the manuscript. Meunier, S contributed to study design and assisted with behavioural assessments. Vecchiarelli, H performed

BDNF analysis, and assisted in writing the relevant section of the methodology. Hill, M.

N performed tissue dissection for BDNF analysis and contributed to revisions of the manuscript. Dr. Dyck contributed to study design, performed tissue dissection for LC/MS and contributed to revisions of the manuscript.

2.1 Introduction

Clinical studies show that maternal stress is linked to unfavourable pregnancy outcomes, such as reduced gestational length, lower birth weight, and impaired emotional and cognitive development in infants and children (Beydoun and Saftlas 2008). Maternal stress increases a child’s risk for developing affective and psychiatric disorders, such as schizophrenia and autism (for a review see Kinney et al. 2008; Talge et al. 2007). Stress can precipitate a depressive episode and may accompany depression, which may occur during pregnancy (for a review see Monroe and Hadjiyannakis 2002; Tennant 2002). The prevalence of depression among pregnant women is 10-20% (Andersson et al. 2003;

Gavin et al. 2005; Kitamura et al. 1993; Marcus et al. 2003), and can reach 51% in pregnant women of low socio-economic status (Hobfoll et al. 1995; McKee et al. 2001).

Selective serotonin reuptake inhibitors (SSRIs) are the primary pharmacological treatment for depression (Mandrioli et al. 2012). SSRI use in pregnant women is on the rise, with 6.2% exposed to this medication (Andrade et al. 2008; Cooper et al. 2007).

Fluoxetine (brand name Prozac, Sarafem, Rapiflux) is one of the most commonly prescribed SSRIs, with 1.9-2.1% of women taking fluoxetine (Flx) at one point during pregnancy (Andrade et al. 2008; Cooper et al. 2007). In fact, Flx is one of the top 20 specific prescription medications most commonly taken by pregnant women (Mitchell et al. 2011).

Preclinical studies of gestational stress show a number of alterations in the anatomy, physiology, and behaviour of the offspring. Some of the anatomical changes include decrease in hippocampal neurogenesis in males (Morley-Fletcher et al. 2011), alteration in serotonin 2A receptor and metabotropic glutamate receptor 2 expression in

60 the brain (Holloway et al. 2013), and sex-dependent decrease in pyramidal cell and hippocampal glial cell density (Behan et al. 2011). Exposure to gestational stress has also been found to alter feedback inhibition of the hypothalamic-pituitary-adrenal axis function (but see Behan et al. 2011; Dugovic et al. 1999; Koenig et al. 2005; Vallee et al.

1999; Vallee et al. 1997a) and to decrease BDNF levels in the frontal cortex of adult offspring (Fumagalli et al. 2004; Matrisciano et al. 2012). Behavioural changes associated with perinatal stress have been extensively studied. However, studies have found contradictory results for every behaviour, including learning and memory

(Bustamante et al. 2010; Lehmann et al. 2000; Nishio et al. 2001; Stohr et al. 1998;

Vallee et al. 1999; Vallee et al. 1997b), exploratory behaviour (Matrisciano et al. 2012;

Miyagawa et al. 2011; Vallee et al. 1997b), and depressive- and anxiety-like behaviours

(Bosch et al. 2006; Miyagawa et al. 2011; Morley-Fletcher et al. 2011; Stohr et al. 1998).

Depression is often viewed as a stress-related disorder given the relationship between stressful life events and the onset of depressive episodes (Kessler 1997). SSRI’s are the most common medications used to treat depression, and pre-clinically, SSRI treatment has been found to reverse many of the adverse effects of chronic stress with a similar response/non-response profile as seen in the clinic (Levinstein and Samuels

2014). That being said, there is very little work examining the interactive effects of stress and SSRI treatment during pregnancy on the outcome of the offspring. This is especially relevant because the number of women taking SSRI medication during pregnancy has increased dramatically over the last decade with four times as many pregnant women receiving SSRI treatment in 2006 than 1994 (Andrade et al. 2008). Therefore, it is common for a human fetus to be exposed to a combination of maternal stress and SSRIs.

Flx and its active metabolite norfluoxetine (NorFlx) cross the placental barrier (Kim et al.

2006), and are excreted in breast milk, resulting in plasma concentrations that can reach therapeutic levels in breastfed infants (Brent and Wisner 1998; Lester et al. 1993). Given that serotonin modulates a multitude of developmental processes, availability of serotonin alters the organization of the brain, as well as behaviour later in life (Nordquist and

Oreland 2010); therefore, it is important to understand long-term effects of perinatal exposure to Flx. Though a considerable amount of research has been conducted on the effects of perinatal Flx exposure (Alwan and Friedman 2009), there has been a lack of focus on the outcomes of exposed individuals beyond the preschool age. To address this concern, many laboratories have turned to modeling the developmental effects of perinatal SSRI exposure in non-humans. SSRIs cross the placental barrier in several mammalian species, producing a comparable level of fetal exposure to that seen in humans (Morrison et al. 2005; Noorlander et al. 2008; Olivier et al. 2011b). SSRIs cross the fetal blood-brain barrier of rodents, leading to detectable Flx and NorFlx levels in the blood and brain of pups (Ansorge et al. 2004; Capello et al. 2011; Kiryanova and Dyck

2014; Nagano et al. 2012; Noorlander et al. 2008; Olivier et al. 2011b).

Preclinical studies demonstrate that perinatal exposure to Flx has a number of short-term and long-term effects (for a review of the subject, see Kiryanova et al. 2013a).

This exposure leads to increased aggression (Kiryanova and Dyck 2014; Singh et al.

1998), alterations in circadian system (Kiryanova et al. 2013b), change in emotional memory (Olivier et al. 2011b; Rebello et al. 2014), and increase or decrease in anxiety- like and depressive-like behaviours (Karpova et al. 2009; Kiryanova and Dyck 2014;

Lisboa et al. 2007; Mendes-da-Silva et al. 2002; Noorlander et al. 2008; Olivier et al.

2011b; Rebello et al. 2014).

At this time, few studies examine combined effects of perinatal stress and fluoxetine exposure on adult offspring outcomes. Rayen (2013) demonstrates that Flx and stress have specific long-term effects on reproductive behaviour and sexual brain differentiation of the adult offspring. Other studies demonstrate that while maternal exposure to stress and fluoxetine can have distinct effects, treatment with Flx early in life can counteract some of the effects of maternal stress, including alterations in hippocampal morphology (Ishiwata et al. 2005; Rayen et al. 2015), spatial learning

(Ishiwata et al. 2005), and sensitivity to post-operative pain (Knaepen et al. 2013).

Behaviours in adults have not yet been examined aside from reproductive behaviour and spatial memory.

The present study investigated effects of prenatal maternal stress and effects of perinatal maternal exposure to Flx, separately and in combination, on the behaviour of the adult male offspring. This study sought to provide a more complete insight by conducting an in-depth behavioural analysis of offspring’s cognitive ability, memory, aggression, anxiety, sensorimotor information processing, and exploratory and risk assessment behaviours. Both, stress and antidepressant treatments, can regulate brain

BDNF levels in adulthood and during development (Fumagalli et al., 2004, Krishnan and

Nestler, 2008, Karpova et al., 2009, Matrisciano et al., 2012). Furthermore, early stress and early exposure to fluoxetine have the ability to affect offspring’s serotonin levels

(Cabrera-Vera et al. 1997; Peters 1990). Therefore, early-life alterations in brain

63 serotonin levels and later-life changes in prefrontal cortex BDNF levels were also examined in this experiment.

2.2 Materials and Methods

2.2.1 Animals

Animals were kept on a 12:12-h light/dark (lights on at 7:00 am; LD, 1,500 lx/0 lx) and were provided ad libitum access to food (LabDiet Mouse Diet 9F, #5020) and water throughout the experiment with the exception of stress manipulation measures (see below). Animal treatment and husbandry were performed in accordance with the

Canadian Council on Animal Care. All experimental procedures were approved by the

Ethics Committee for Animal Research at the University of Calgary.

C57BL/6J breeders were obtained from the University of Calgary Biological

Sciences breeding facility (Calgary, AB, Canada) and the Charles River animal facility

(Wilmington, MA, USA; equally dispersed between treatment groups). Dams were 3 months old at the time of pairing and were housed in pairs with a single male, for 4 days.

The day the seminal (copulation) plug was first observed was considered embryonic (E) day zero. The day of birth was considered to be postnatal (P) day 0.

Pregnant dams were randomly assigned into four groups: (i) dams subjected to chronic unpredictable mild stress (PS; n=6); (ii) dams administered fluoxetine (FLX; n=5); (iii) dams subjected to chronic unpredictable mild stress and administered Flx

(PS+FLX; n=6); (iiii) dams untreated (CON; n=6). One day following parturition litters were culled to 8 pups (pups that were culled were picked randomly). Litters were housed together with their mother until weaning at P21 after which they were housed with same sex littermates in groups of 3-5. Final groups for behavioural testing consisted of: (i) PS:

17 males; (ii) FLX: 17 males; (iii) PS+FLX: 16 males; and (iiii) CON: 18 males. Other male littermates were used for molecular brain analysis (see below). Female offspring were used in a different set of experiments.

2.2.2 Chronic Unpredictable Stress Paradigm

The chronic unpredictable mild stress paradigm was modified from that used by

Grippo and colleagues (Grippo et al. 2003). This protocol was intended to maximize the unpredictable nature of the stressors; this model produces neurobiological changes consistent with what is seen in depression (Hill et al. 2012). Beginning at E4 pregnant dams were subjected to a regimen of chronic unpredictable stressors; E18 was the last day stressors were administered. Stressors included restricted access to food (food was removed from the animal’s home cage for a maximum of 6 hours, the remainder of the time the animals were fed ad libitum), continuous lighting overnight, cage tilt (home cage tilted 30⁰), paired housing (animals were paired with another pregnant dam in either their home-cage or the other dam’s cage, assigned in a counterbalanced fashion), foreign object in cage (a novel plastic or wooden object), soiled cage (100ml of clean water spilled on bedding), irregular 16kHz tones (played at 80dB), white noise (played at

80dB), and restraint (for the duration of two hours mice were placed into plastic tubes that restricted their movement; see Table 2.1).

2.2.3 Drug Treatment

Pregnant dams were administered fluoxetine hydrochloride (Sigma-Aldrich, Saint

Louis, MO, USA) in their drinking water at a dose of 25mg/kg/day as previously described (Kiryanova and Dyck 2014). Treatment took place between E15 and P12, intended to approximate the second and third trimester in human brain development

(Clancy et al. 2007; Romijn et al. 1991). The amount of Flx administered was re- calculated and subsequently re-administered every 48 hours. This protocol intended to correct for changes in body weight and water consumption that are inherent to pregnancy.

An appropriate Flx concentration to be administered was calculated based on animal’s weight at the time of the calculation and animal’s water consumption for the preceding 48 hours. This treatment protocol has been demonstrated to lead to pup brain levels of Flx and its metabolite norfluoxetine that fall within the range observed in post-mortem brain tissue of humans who took this medication (Kiryanova and Dyck 2014), and to lead to detectable behavioural changes in the offspring (Kiryanova and Dyck 2014; Kiryanova et al. 2013b; McAllister et al. 2012).

2.2.4 Maternal Behaviour

Maternal behaviour was assessed in a different cohort of dams. These dams were treated identically to treatments described here: (i) dams subjected to chronic unpredictable stress (PS; n=7); (ii) dams administered fluoxetine (FLX; n=7); (iii) dams subjected to chronic unpredictable stress and administered Flx (PS+FLX; n=8); (iiii) dams untreated (CON; n=8).

2.2.4.1 Assessment of Maternal Behaviour

Maternal behaviours were assessed from P1 to P7 twice a day, once during the light phase of the light/dark cycle (between 1pm and 4pm; this time was selected to ensure that the observations were conducted at least one hour before lights off) and once during the dark phase of their light/dark cycle with an aid of night-vision goggles (between 8pm and

10pm; at least one hour after lights off). Each session lasted 30 minutes, during which each dam’s behaviour was assessed every 2 min for a total of 15 observations/session.

Each observation lasted 5 seconds, during which the experimenter recorded the behaviour the dam was displaying at that instance (Palanza et al. 2002; Pedersen et al. 2006).

Behaviours monitored were as follows:

In-nest behaviours:

Licking/grooming pups: dam was licking her pups. While it is impossible to see the movement of dam’s tongue, rhythmic up/down movements of the head while the mouth of the dam was in contact with any body part of any pup was used to score this behaviour.

Active Nursing: Dam is in an upright position with her legs extended around her pups, and her ventrum located over the pups.

Passive nursing: Dam is laying on her side with pups suckling.

Nest building: Dam manipulating nesting material with her mouth.

Self-groom: dam grooming her own body

Out-of-nest behaviours:

Eat or drink: eating a food pellet or drinking from the water bottle

Self-groom: dam grooming her own body

Other: laying and resting outside of the nest, moving around the cage.

2.2.4.2 Pup retrieval

The pup-retrieving task was used to evaluate maternal motivation of dams

(Chourbaji et al. 2011). This task was conducted when pups were 7 days of age. The mother and the pups were removed to separate cages. Three pups were immediately returned to the home cage and placed in different corners of the cage away from the nest.

The test began when the mother was reintroduced to the home cage. The latency to

67 approach each pup, the latency to pick up each pup, and the latency to retrieve each pup in to the nest was recorded. The pup was counted as retrieved once completely brought to the center of the nest. The test was terminated after 20 min.

2.2.5 Measurement of Fluoxetine, Norfluoxetine, and Serotonin in Pup Brains

2.2.5.1 Sample collection.

Pup brains were collected at P12 (CON: n=7, from 4 litters; FLX: n=5, from 3 litters PS: n=10, from 5 litters; PS+FLX: n=10, from 4 litters). After decapitation the brain was removed, the spinal cord was severed posterior to the cerebellum, and the olfactory bulbs were removed. Cortical structures (cortex and hippocampus) were peeled away from the thalamus and the subcortical portion was bisected between the cerebellum and inferior colliculus. The three resulting brain areas were separately frozen on dry ice and analyzed as: i. cortex and hippocampus, ii. thalamus/midbrain, and iii. hindbrain/cerebellum.

2.2.5.2 Sample analysis.

The sample preparation method was based on Raap et al. (1999). The concentrations of fluoxetine, norfluoxetine, and serotonin were quantified by high- performance liquid chromatography. Sample preparation and analysis were performed exactly as described in (Kiryanova and Dyck 2014).

2.2.6 Behavioural Analysis

Based on previous reports regarding long term behavioural consequences of both stress and Flx treatments, offspring were administered a behavioural test battery to assess exploratory behaviour and locomotion, anxiety-related behaviours, sensorimotor gating

68 and acoustic startle response, spatial and fear memory, and territorial aggression; behavioural testing starting at 2 months of age.

Tests were performed in the following order: open field was the first test and the elevated plus maze was the second test administered to all groups. The next three tests

(Morris water test, passive avoidance, and prepulse inhibition) were conducted in counterbalanced fashion, in that equal number of animals from each group received these tests in a different order. Resident intruder was the last test received by all groups. All testing was conducted during the light phase of the light-dark cycle, between 9am and

5pm. Tests were conducted five to seven days apart, except for the resident intruder test, which was conducted at the end, after a 10 day break.

2.2.6.1 Open Field

The open field arena consisted of white, circular Plexiglas surface (1.2 m in diameter) surrounded by a wall (35 cm high) illuminated by an overhead light

(170±30lux). Animals were placed individually in the arena’s centre and allowed to explore for 5min. Activity was recorded using an overhead mounted camera and HVS

Image 2020 Plus software (HVS Image Ltd, Twickenham, Middlesex, UK). Percent of time spent in the outer third of the arena, as well as an animal’s speed, and total distance traveled were recorded. Following each trial, the arena was cleaned using 70% ethanol.

2.2.6.2 Elevated Plus Maze

The elevated plus maze test was conducted as previously described (Handley and

Mithani 1984; Kiryanova and Dyck 2014; McAllister et al. 2012). The maze is a plus- shaped arena having two walled and two open arms (5cm x 28cm), with arms of the same type opposite to each other, extending from a central platform (5cm x 5cm) mounted 28

69 cm above the floor; it was illuminated evenly by an overhead light (75±8 lux). Animals were placed individually in the maze center facing an open arm then allowed to freely explore for 5min. Following each trial the maze was thoroughly cleaned using 70% ethanol.

The percent of total time a mouse spent on open arms, as well as the number of entries into open and closed arms, percent time spent active, speed and distance travelled were evaluated using ANY-maze software version 4.73 (Stoelting Company, Wood Dale,

Illinois, USA). Arm entry was operationally defined as 4 paws within an arm, or 95% of animal within an arm. Time spent active was defined as time spend moving around the apparatus and performing scanning and risk assessment behaviour. Manual scoring was done for scanning behaviour (head dip), and risk assessment behaviours (protective stretch). A head dip was defined as an instance when the animal looked over the edge towards the floor while on the open arms of the apparatus. A protective stretch was defined as an instance in which the animal stretched its head and forepaws into an open arm from a closed arm or the center space without making a full entry into the open arm

(Cruz et al. 1994). Anxiety-related behaviours are implied by decreased time spent on the open arms, decreased entries into open arms, as well as decreased number of head dips and protected stretches (scanning and risk assessment behaviours). Number of entries into open and closed arms, speed, distance, and time spent active were also taken as a measure of locomotion (Rodgers and Johnson 1995).

2.2.6.3 Morris Water Task

The Morris water task is among the most well validated tests of spatial learning and memory, and was conducted according to the procedure of Vorhees and Williams

(2006). A 1.2m diameter fibreglass pool, painted white, with no seams or marks on the inside wall, was filled to a depth of 20cm with water of 19.5 ± 0.5 °C. Skim milk powder was used to ensure the water was opaque and animals could not see the platform location.

A clear square platform (20 x 16) was placed 1.5cm below the water’s surface. Visual cues used were those endogenous to the room as well as several posters of different shapes and colors placed around the room walls.

The first four days were training days. For each trial on training days, a mouse was placed into the water tank facing the wall at one of the cardinal compass points, chosen in a pseudo-random order (N/S/E/W). Start location order was varied across the 4 learning days. The trial was stopped when the mouse climbed atop the platform or the trial timed out (60s). The mouse was then given 15s atop the platform in which to learn the visual spatial cues, if the mouse had failed to find the platform it was guided to the location by the experimenter. If the mouse failed to remain atop the platform during the 15s learning period it was gently held in place by its tail. Following a single trial the water was mixed to minimize olfactory cues. There was a 7-8 minute break between the trials. Across training days animals were video recorded overhead using HVS Image 2020 Plus software (HVS Image Ltd, Twickenham, Middlesex, UK) and the trials were analysed for speed, distance travelled, and latency to find the platform.

On the fifth day (probe trial), the platform was taken out of the pool and the mouse was placed in a novel location which was directly opposite from the previous location of the platform. Animals were given 30s to swim freely. The initial latency to where the platform had been previous days was recorded. Furthermore, the number of times the

71 mouse swam through the area of platform’s previous location (across or within one body space) was recorded and analysed.

2.2.6.4 Passive Avoidance

In order to assess fear memory, the passive avoidance test was utilized. This procedure measures an animal’s latency to enter a chamber in which they had previously experienced an aversive event (foot shock). Animals were placed individually in a white

Plexiglas chamber with a metal grate floor (20.32cm x 25.4cm x 35.71cm), part of the dual-chamber LM1000-B avoidance system (Hamilton-Kinder LLC, San Diego, CA).

Animals were given 2min to acclimatize to the chamber. Following acclimatization the chamber door opened allowing animals to enter a second dark chamber (black walls and roof), with the metal grate floor continuous between both chambers. When the mouse had entered the dark chamber (all four paws within the chamber) the animal was administered a mild foot shock (0.5mA, duration 1s) through the metal floor. Following the foot shock the animal was removed from the chamber. Twenty-four hours later the animals were placed individually within the white chamber with the door already opened to the dark chamber. Latency to enter the dark chamber was recorded for a maximum of

3 min.

2.2.6.5 Prepulse Inhibition

Prepulse inhibition and startle response to acoustic stimulus were measured and analyzed using the SM100SP Startle Monitor system (Hamilton-Kinder LLC; San Diego,

CA, USA). The apparatus consisted of a sound-attenuated chamber (27.6cm x 35.6cm x

49.5cm) housing a clear Plexiglas chamber (10cm x 3.8cm) with a piezoelectric device located underneath. Mice were placed individually in the clear Plexiglas chamber to

72 reduce animal rearing. The piezoelectric device allowed transformation of mouse whole body movements into an analogue signal, providing a measure of the animal’s startle response (muscle twitch) in response to the acoustic stimuli. The analogue signal was converted into a digital signal, which was recorded by the Startle Monitor software.

Animals were given a 5min acclimatization period within the chamber during which a 65 dB background steady ambient noise was delivered. Following acclimatization, a habituation phase took place in which a noise elevation up to 120dB

(duration 40ms) was delivered 10 times every 5-20s. Following habituation the testing phase occurred in which 3 types of trials were each presented 10 times with 5-20s intervals. The trials consisted of (i) no pulse, (ii) pulse alone (120dB, duration 40ms), and (iii) prepulse (80dB, duration 20ms) followed by a pulse (120dB, duration 40ms;

100ms interval). Percent PPI was calculated using the formula: 100-(100 x startle amplitude on prepulse trial)/startle amplitude on pulse alone trial. The animal’s average startle response to a pulse, as well as percent PPI, were analyzed.

2.2.6.6 Resident/Intruder task

The resident/intruder task was conducted as previously described (Kiryanova and

Dyck 2014). Resident mice spent the 10 days prior to the experiment in isolation; cage bedding was not changed during this time to maximize the number of territorial cues.

Intruders were C57BL/6J male mice that were obtained from the University of Calgary

Biological Sciences breeding colony (LESARC; Calgary, AB, Canada). Intruders were group housed prior to the test. Resident and intruder mice were matched by weight and age with a weight difference of no more than 5g.

The intruder mouse was labelled on its tail with a marker and placed into the resident’s cage. Interaction was allowed for 10min and the encounter was digitally recorded (Sony DCR-TRV10). The recorded video was later analyzed and scored by the blinded-to-condition experimenter for the latency to first attack, duration of resident attacks, as well as duration of social behaviours, and duration of aggressive behaviours.

Social behaviours included social sniff, climb, follow, and social grooming. Aggressive behaviours included fighting, offensive upright, chase, aggressive groom, and on top of intruder (de Boer et al. 1999).

2.2.7 Measurement of BDNF in Adult Brains

After the completion of all behavioural tests, at 16 weeks of age, a portion of mice were sacrificed for the BDNF analysis (PS: n=9; FLX: n=9; PS+FLX: n=7; CON: n=9; 1-

2 offspring per litter were randomly selected). For quantification of mature BDNF in the prefrontal cortex, mice were anaesthetized using isoflurane and killed by decapitation.

Brains were removed and prefrontal cortex was rapidly dissected and stored in microcentrifuge tubes at -80°C. The prefrontal cortex was defined as a tissue block composed of medial prefrontal cortex and anterior cingulate, which was anatomically defined as the area dorsal to the anterior olfactory nucleus and medial to the corpus callosum and claustrum formation. Tissue was homogenized using a glass mortar and pestle in 8 uL/mg tissue of lysis buffer (1x TBS, 10% Glycerol, 1% Tergital (NP-40), 1%

Triton X and Complete protease inhibitors (Roche). Total protein content assessed with a bicinchoninic acid (BCA) quantification kit (Thermo Scientific). BDNF levels were determined using an ELISA kit (Promega) according to the manufacturer’s instructions.

400 µg of protein were added per sample, in duplicate and compared to a BDNF standard curve, run in a two-fold dilution series, to determine absolute BDNF levels.

2.3 Data Analysis

Tests that involved a single measurement (i.e., open field, elevated plus maze, prepulse inhibition) were analysed using a two-way (fluoxetine x stress) factorial analysis of variance (ANOVA). For tasks that involved repeated testing of the animals (e.g., passive avoidance, Morris water test, and levels of serotonin, Flx and NorFlx in different brain regions) a split plot ANOVA was computed. Tukey’s post hoc test for multiple comparisons was used to assess differences between individual treatment groups.

Protected t-tests using the Bonferroni correction were used for multiple comparisons when following up main effects in repeated measurements (e.g., Morris water test).

Kaplan-Meier survival curves stratified by group were used to analyse differences in pup retrieval behaviour. When categorical variables had to be analyzed (e.g., attack behaviour) a chi-square analysis was computed. To correlate variables, Pearson’s correlation was used. To examine whether litter effects contributed to any of the significant findings, all significant treatment effects were followed up (p ≤ 0.05) with a nested ANOVA, this assessed the effect of litter nested within group. We failed to find any significant litter effects (p >.10) (data not shown). All statistics were two-tailed.

Values of p ≤ 0.05 were considered significant. All data and all figures are reported as means ± standard error of the mean (SEM).

2.4 Results

2.4.1 Pup retrieval

In the pup-retrieving test, 88% of all dams were able to retrieve their first and last pup within the first 10 min. There was no difference how long it took each group to approach the pups, latency to pick up the first pup, latency to retrieve the first and the last pup, or in the proportion of dams in each group that did not retrieve their first and last pup within 10 minutes of the test.

2.4.2 Assessment of Maternal Behaviour

On-going Flx administration reduced the amount of time dams spent self-grooming out of nest (fluoxetine: 1.72±.47 % of time; no fluoxetine: 4.03±.47 % of time; F(1, 26) =

11.96, p = .002). No passive nursing behaviours were observed. No other behaviour was significantly affected by either on-going Flx treatment or a previous exposure to stress

(see Table 2.2).

2.4.3 Actual Dose of Fluoxetine

While the intended Flx dose was 25 mg/kg, increased water consumption throughout pregnancy and lactation resulted in an actual mean Flx dose of 27.42±.55 mg/kg/day. Administered Flx dosage did not significantly differ between FLX and

FLX+PS groups, and there was no significant group by day interaction.

2.4.4 Fluoxetine, Norfluoxetine, and Serotonin Levels in Pup Brains

In the P12 offspring that were exposed to fluoxetine, the mean brain fluoxetine level was 0.392±0.07 µg/g and the overall brain level of NorFlx was 3.70±0.10 µg/g.

There was no significant difference among brain regions in fluoxetine or NorFlx concentration.

Fluoxetine treatment led to a significant reduction in the overall brain concentration of serotonin in P12 offspring (fluoxetine: 80.89±2.54 ng/g; no fluoxetine: 96.21±2.85 ng/g; F1, 28 = 20.04, p < .001; Fig.2.1.). There was also a significant effect of brain region on serotonin concentration (F2, 56 = 192.78, p < .001; Fig.2.1). Post-hoc comparisons revealed that serotonin concentration differed significantly between all examined brain regions (p ≤ .003), such that serotonin concentration was highest in the thalamus/midbrain region (139.85±3.92 ng/g), second highest in the hindbrain/cerebellum (69.60±3.50 ng/g), and lowest in the cortex and hippocampus

(56.19±1.45 ng/g).

2.4.5 Behavioural Evaluation of Adult Animals

2.4.5.1 Open Field

There was no effect of prenatal stress, Flx treatment, nor an interaction of the two, on time spent in the outer arena, speed, and distance travelled (see Table 2.3A).

2.4.5.2 Elevated Plus

Mice perinatally exposed to Flx (FLX and PS+FLX) spent more time on the open arms of the EPM (perinatal Flx: 20.43±2.3 %time; no perinatal Flx: 10.46±2.3 %time;

F(1, 64) = 9.48, p = .003; Fig. 2.2A) and showed a greater number of head dips (perinatal

Flx: 11.50±1.1 head dips; no perinatal Flx: 8.0±1.1 head dips; F(1, 64) = 5.01, p = .029) when compared to mice not exposed to Flx.

Male offspring of dams exposed to stress during pregnancy were more active in the

EPM compared to male offspring of dams not exposed to stress. Offspring of stressed dams spent more time active (maternal stress: 60.8±2.2%; no maternal stress:

50.96±2.1%; F(1, 64) = 10.47, p = .002), entered closed arms of the EPM more frequently

(maternal stress: 11.2±0.7; no maternal stress: 8.7±0.7; F(1, 64) = 6.53, p = .013; Fig. 2.2B), and travelled at a greater speed (maternal stress: .024±.001 m/s; no maternal stress:

.017±.001 m/s; F(1, 64) = 16.01, p < .001; Fig. 2.2C) a greater distance (maternal stress:

7.17±0.4m; no maternal stress: 5.09±0.4m; F(1, 64) = 15.92, p < .001; Fig. 2.2D) compared to male offspring of non-stressed dams.

2.4.5.3 Passive Avoidance

It took longer for mice to enter the dark chamber on day two, compared to day one

(F(1, 64) = 586.49, p < .001) indicating that all mice learned the dark chamber/shock association (see Table 2.3B). The proportion of mice that entered the dark chamber on day two was not affected by perinatal Flx administration, maternal stress, nor stress by

Flx interaction.

2.4.5.4 Morris Water Task

The offspring showed reduced latency to reach the platform across training days, indicating that all animals were able to learn the task (F(3, 192) = 76.01, p < .001).

No effect of perinatal Flx, prenatal stress nor the interaction of stress by Flx was observed on the mean latency to reach the platform, swimming speed, time spent in thigmotaxis during the training days, latency to reach the platform, or the number of times crossing the platform area during the probe trial (see Table 2.2B).

2.4.5.5 Prepulse Inhibition

There was no effect of prenatal stress, Flx administration, or interaction of stress by

Flx on the startle response and PPI of the offspring (see Table 2.3A).

2.4.5.6 Resident Intruder

One FLX mouse was excluded from this test due to illness. Treatment group and whether the resident attacked the intruder mouse were significantly related (χ2 (3, N = 67)

= 16.11, p = .001, Cramer’s V = .49). The proportion of PS mice that attacked an intruder

(.12) was significantly smaller than the proportion of CON (.44), FLX (.81), and

PS+FLX (.44) mice that attacked an intruder (Fig. 2.3A). Additionally, the proportion of

FLX mice that attacked an intruder was significantly greater than in all three other groups. When examining the mice that did attack, there was no effect of treatment on latency to attack. Perinatal Flx exposure was associated with a significant increase in the amount of time residents were aggressive towards an intruder (Flx:82.7±10.8s; No

Flx:25.64±10.4s; F(1, 63) = 14.54, p < .001), and prenatal stress tended to decrease the amount of time residents were aggressive towards an intruder (stress:39.6±10.6s; no stress:68.8±10.5s; F(1, 63) = 3.81, p = .055; (Fig. 2.3B). Perinatal Flx and stress did not affect the amount of time animals spent in social interaction with an intruder.

To examine whether an increase in aggressive behaviours in Flx-exposed mice could be linked with decreased anxiety observed in the EPM, correlation analysis was conducted. There was no significant correlation between percent of time spent on the open arms of the EPM and whether animals attacked or not in the RI test. There was also no significant correlation between percent of time spent on the open arms of the EPM and the amount of time spent in aggressive behaviours in the resident-intruder test.

2.4.6 BDNF in Frontal Cortex

There was a main effect of prenatal stress on BDNF concentration in the frontal cortex of male mice. Male offspring of dams exposed to stress during pregnancy (PS and

PS+FLX) had lower frontal cortex BDNF concentration (28.7±4.63 pg/mg) compared to male offspring of dams not exposed to stress (CON and FLX; 42.9±4.33 pg/mg; F(1, 30) =

5.01, p = .033; Fig. 2.4).

2.4.7 Discussion

The results of this study demonstrate that prenatal exposure to chronic stress and perinatal exposure to fluoxetine have a number of effects on the behaviour of male offspring when assessed as adults. Maternal stress, exposure to fluoxetine, and their combination did not affect cognitive abilities, social behaviour, emotional memory, spatial memory, PPI, and startle response of the offspring. However, prenatal stresses led to an increase in activity and reduced levels of BDNF in the frontal cortex, regardless of

Flx exposure. Offspring of mothers exposed to unpredictable chronic stress from E4 to

E18 spent more time being active, entered closed arms of the EPM more frequently, and traveled at greater speed for a longer distance in the EPM apparatus. These mice also demonstrated less aggressive behaviour, as evidenced by a reduction in time prenatally stressed mice spent being aggressive towards a novel male intruder mouse and a smaller proportion of these mice engaged in attack behaviour during the resident/intruder task.

Fluoxetine administration to dams led to therapeutically-relevant concentration of Flx and

NorFlx in pup brains during treatment (Kiryanova and Dyck 2014; Lewis et al. 2007).

Adult offspring of fluoxetine-exposed dams were less anxious and more aggressive in adulthood. A decrease in anxiety was inferred from an increase in time these animals spent on the open arms of the EPM apparatus. An increase in aggression was evident from their behaviour on the resident/intruder task, as fluoxetine-exposed animals spent more time being aggressive towards an intruder, and a greater proportion of fluoxetine-

80 exposed animals attacked the intruder mice. Interestingly, the combination of prenatal stress and perinatal Flx exposure ameliorated each treatment’s effect on aggressive behaviour. Individually, PS significantly reduced the number of mice that attacked the intruder and tended to reduce the overall time mice spent showing aggressive behaviours towards the intruder. Flx exposure had an opposite effect; it significantly increased the proportion of mice that attacked the intruder and the amount of time mice spent in aggressive behaviours. Mice exposed to both prenatal stress and Flx demonstrated aggressive behaviour similar to control mice.

2.4.8 Effects of Prenatal Stress

Hyperactivity in the offspring of mothers who are stressed is a well-established finding in both human and animal literature. In humans, maternal stress during pregnancy has been identified as a risk factor in developing attention deficit hyperactivity disorder, particularly in males (Rodriguez and Bohlin 2005; Ronald et al. 2010). Animal studies frequently report hyperactivity among perinatally stressed offspring (Bosch et al. 2006;

Matrisciano et al. 2012; Stohr et al. 1998; Vallee et al. 1997b); however, decrease and no change in activity levels following maternal stress have also been reported (Behan et al.

2011; Bosch et al. 2006; Miyagawa et al. 2011; Zimmerberg and Blaskey 1998).

Interestingly, hyperactivity has also been repeatedly documented as a consequence of chronic stress exposure in adulthood, particularly during tests of anxiety, such as the open field and the EPM, which have high emotional valence (Hill et al. 2013; Strekalova et al.

2005), suggesting that there may be some residual effects of prenatal stress in mice which mirror the effects of chronic stress in adulthood.

A reduction in aggressive behaviour in male mice of stressed mothers has also been previously demonstrated (Kinsley and Svare 1986; Patin et al. 2005; Tsuda et al. 2011); however, this effect was not evident in all strains of mice (Kinsley and Svare 1986;

1987). Exposure of adult animals to acute stress similarly leads to a reduction in aggressive behaviour (Wood et al. 2003; Yohe et al. 2012). Because aggressive behaviour is characteristically male, reduced aggression in PS male offspring may indicate dysmasculinization. Dysmasculinization in behaviour, hormones, and gene expression has been previously reported following gestational stress (Biala et al. 2011; Ward 1972).

In addition to behavioural alterations in adult male offspring, we found that prenatal stress decreased levels of brain derived neurotrophic factor (BDNF) in the frontal cortex by 33%. Previous studies have also found that perinatal stress leads to reduction in BDNF in the frontal cortex of the offspring; reduction of BDNF messenger ribonucleic acid

(mRNA) and protein levels is evident throughout an animal’s life span: at birth

(Matrisciano et al. 2012), adolescence (Matrisciano et al. 2012; Nagano et al. 2012), and adulthood (Fumagalli et al. 2004; Matrisciano et al. 2012), indicating that this reduction is likely immediate and long-lasting. Lower BDNF levels in adolescence and adulthood are linked with diminished aggressive behaviour in adult animals (Lang et al. 2009), therefore, in our study, lower BDNF levels of prenatally stressed mice may, in part, contribute to a dramatic decrease in aggressive behaviour observed in that cohort.

Furthermore, changes in PFC dendritic morphology, including delay in development and decrease in complexity, have been previously identified in pups and in adolescent animals exposed to prenatal stress (Gutierrez-Rojas et al. 2013; Markham et al. 2013;

Murmu et al. 2006; Mychasiuk et al. 2012). Reduced levels of BDNF, if also present

82 during early developmental period, may contribute to alterations in PFC morphology and synaptic connectivity. Future studies need to further examine the effect of perinatal stress on prefrontal cortex morphology and function of adult animals.

2.4.9 Effects of Perinatal Fluoxetine

Independent of maternal stress, perinatal exposure to fluoxetine had few effects on the behaviour of male offspring as adults. Fluoxetine exposure led to a decrease in anxiety and an increase in aggression in male adult offspring. This replicates our previous findings that demonstrated a reduction in anxiety and an increase in aggression in adult animals exposed to Flx perinatally (Kiryanova and Dyck 2014). Such replication is especially important in light of experiments conducted by other groups; other researchers report no change in anxiety (Ansorge et al. 2008; Ansorge et al. 2004; Lisboa et al. 2007) and no change in aggression (Lisboa et al. 2007) in mice perinatally exposed to Flx. Such disparity between our findings and findings of other groups is likely due to differences in methodology, including the difference of Flx dose used, Flx delivery method, timing of

Flx exposure, and strain of mice that were employed (for a review of the subject, see

Kiryanova et al. 2013a).

It is difficult to elucidate the mechanism of behavioural alterations that follow perinatal exposure to Flx, as such exposure has the potential to affect a myriad of developmental processes throughout the brain, the development and later function of the serotonergic system itself, and the function of systems that rely on serotonin system function (such as the limbic system). Research shows that transient early-life changes in serotonergic system function, for example through activation or blocking of serotonin receptors, can alter aggressive and anxiety-like behaviour in adulthood (Kusserow et al.

2004; Nautiyal et al. 2015; Vinkers et al. 2010). Therefore, a decrease in serotonin levels following maternal Flx administration that we observed in P12 animals may contribute to the alteration of aggression and anxiety-like behaviour observed in fluoxetine-exposed mice.

Interestingly, behavioural outcomes of mice perinatally exposed to Flx and behavioural outcomes of serotonin transporter knockout (SERT KO) animals differ dramatically, in spite of the similar mechanism of action of both manipulations. In the

SERT KO mouse model, serotonin reuptake is greatly diminished (hemizygotes) or completely absent (knockout)(Bengel et al. 1998), which prolongs the pre- and postsynaptic action of serotonin (Holmes 2001). This is similar to an action of fluoxetine, which inhibits the reuptake of serotonin, thereby increasing serotonergic activity at the synapse. Unlike Flx-exposed animals, SERT KO and hemizygous mice show increase in anxiety and decrease in aggression. This difference in behavioural outcomes highlights the importance of timing of the insult; KO animals have a life-long alteration in serotonergic function, while Flx-exposed animals do not. In fact, the effect of early exposure to Flx is dependent on timing of such exposure (Rebello et al. 2014).

Interestingly, SERT deficiency can interact with maternal stress exposure. Compared to their wild type siblings, adult SERT hemizygous offspring are more vulnerable to the behavioural effects of maternal stress; SERT hemizygous offspring exposed to maternal stress show increased depressive-like behaviour (Van den Hove et al. 2011).

Furthermore, an interaction between SERT genotype and maternal stress exposure differentially affects DNA expression and methylation in offspring hippocampus (Schraut et al. 2014; Van den Hove et al. 2011).

2.4.10 Combination of Prenatal Stress and Perinatal Flx Exposure

Perhaps the most interesting finding of this study is that the combination of prenatal stress and perinatal Flx exposure ameliorated each treatment’s individual effect on aggressive behaviour. The mechanism by which early adversity and serotonergic alterations interact in their long-term impact on the offspring is not yet understood. One of the possibilities is that these manipulations have opposite effects on the systems that regulate behaviours of interest. The serotonergic system, more than any other, is implicated in regulation of aggressive behaviour (Carrillo et al. 2009; Duke et al. 2013;

Moore et al. 2002). Earlier studies discovered that perinatal exposure to stress and perinatal exposure to Flx have opposite effects on the serotonergic system function.

Prenatal Flx exposure decreases (Cabrera-Vera et al. 1997), while perinatal stress exposure increases (Peters 1982) serotonin concentration in the brain. These findings fit with our behavioural observations, considering that serotonin has an inhibitory effect on aggression (Berman et al. 2009; Cleare and Bond 1995; 1997; Dolan et al. 2001). Of importance, is that such changes in serotonergic levels were observed later in life (in adolescence) (Cabrera-Vera et al. 1997; Peters 1982). In this study we measured serotonin at P12 only. Future experiments should assess brain levels of serotonin following maternal stress and Flx exposure in adolescent and adult animals.

In this study we found no effect of either prenatal chronic variable stress or perinatal fluoxetine exposure on maternal behaviour of mice. While a number of researchers (da-Silva et al. 1999; Kiryanova and Dyck 2014; Pawluski et al. 2012a;

Rayen et al. 2011) also did not find differences in maternal behaviour between Flx exposed and control dams, an increase in arched-back nursing (2012c) and the amount of

85 licking and grooming the dam performs on the pups (Johns et al. 2005) has also been reported. Our study differed from those that found an effect of Flx exposure in Flx treatment methodology, protocol for maternal behavioural assessment, and species used, potentially explaining the difference in our findings. Previous research regarding the effect of maternal stress on maternal behaviour is not consistent; increase (Meek et al.

2001; Rayen et al. 2011), decrease (Bosch et al. 2006; Smith et al. 2004), and no change

(Pawluski et al. 2012a; Pawluski et al. 2012b) in maternal behaviours has been reported.

Ours was the first study to examine the effect of prenatal chronic variable stress on maternal behaviour in mice.

2.4.11 Limitations

A number of potential limitations of the present study need to be acknowledged.

First, maternal behaviour is known to affect offspring outcomes; therefore, its thorough investigation following stress and Flx administration is imperative. In this study maternal behaviour was assessed with two daily half-hour long observations between P1 and P7.

While currently it is one of the more through maternal behavioural assessments following maternal Flx exposure in rodents, and the only assessment following chronic variable stress in mice, our observation protocol may be insufficient to detect subtle alterations in maternal behaviour. A more thorough examination that takes advantage of six daily observations may be necessary to reveal maternal behaviour changes if subtle. Second, this study utilized behavioural testing battery. While we counterbalanced some of the tests and arranged tests from least to most stressful, there is a potential for an interaction between group and testing experience. Fore example, stressful experience of testing may affect some but not other groups thereby changing behaviour of those groups on

86 subsequent tests. Another limitation is the dose of Flx selected. In breastfed infants, plasma Flx and norfluoxetine concentrations are variable; in some infants the levels are low or undetectable (Epperson et al. 2003; Kristensen et al. 1999), while in others they can reach or exceed adult therapeutic levels (Brent and Wisner 1998; Kristensen et al.

1999; Lester et al. 1993). We previously demonstrated that the treatment protocol used here can lead to Flx levels in pups that are compatible to therapeutic levels observed in humans (Kiryanova and Dyck, 2014), therefore mimicking higher end of exposure in infants. Thereby extrapolation of our data may be relevant to a sub-population of human infants exposed to the drug.

2.4.12 Conclusion

In this paper we demonstrate that maternal exposure to stress and Flx have long- lasting, dissociable effects. These behavioural outcomes are not likely to be a result of changes to maternal behaviour, as neither treatment affected maternal behaviour of mouse dams in this study. We show that Flx affects some, but not all behaviours.

Behaviours that are affected by Flx, such as an increase in aggression and a decrease in anxiety, are, not surprisingly, those that rely on serotonergic regulation. Maternal stress appears to also have a sustained effect on the male offspring. Interestingly, a decrease in

BDNF, hyperactivity, and suppression of aggressive behaviour observed in adult male mice exposed to maternal stress parallel the effects of stress administered in adulthood

(Biala et al. 2011; Fumagalli et al. 2004; Gronli et al. 2005; Katz et al. 1981; Ward 1972).

87 exposure have not been studied in relation to offspring aggressive behaviour. Our findings indicate that maternal intake of Flx is not necessarily detrimental and may alleviate some of the effects of maternal stress on the male offspring, however more research is necessary to better understand the mechanism of such effects and its translation to humans.

Table 2.1. Chronic Unpredictable Stress Schedule used on pregnant mouse dams from E4 to E18.

Monday Tuesday Wednesday Thursday Friday Saturday Sunday 9am Restricted access to food 9am- 3pm 10am Restraint Cage Tilt Restricted stress (30°) access to 10am- 10am-5pm food 10am- 12pm 5pm 11am Forced Swim Restraint stress 11am- 1pm 12pm White noise 12pm-3pm

1pm 2pm 3pm Irregular 16 kHZ tones 4pm 5pm Paired Continuous Foreign Paired Soiled cage Continuous Cage tilt Housing lighting object in housing 5pm-10am lighting (30°) 5pm-9am overnight cage 5pm-10am overnight 5pm- 5pm-10am 10am

Table 2.2. Behaviour of mouse dams exposed to chronic unpredictable stress and fluoxetine. Observations were collapsed across seven days (P1-P7). Behaviours are represented as percent of total observations for each group. Behaviour Control Fluoxetine Stress Stress + Effect of Flx Effect of Flx and Fluoxetine Stress Stress Interaction In-nest behaviour

Licking/groo 7.25±1.10 8.20±1.18 10.50±1.18 7.00±1.10 F(1, 26) = 1.16, p F(1, 26) = .735, F(1, 26) = 3.66, ming pups = .291 p = .399 p = .067

Nursing 48.7±2.66 53.63±2.85 48.41±2.85 54.40±2.66 F(1, 26) = 3.65, p F(1, 26) = .000, F(1, 26) = .016,

= .067 p = .982 p = .901

Nest building 5.56±1.33 4.84±1.43 4.98±1.43 7.94±1.33 F(1, 26) = .458, p F(1, 26) = .516, F(1, 26) = 1.43,

= .504 p = .479 p = .241

Self-groom 6.54±0.89 5.84±0.95 8.67±0.95 6.21±0.89 F(1, 26) = 2.93, p F(1, 26) = 1.84, F(1, 26) = .916,

= .099 p = .186 p = .347

Out-of-nest behaviour

Eat or drink 16.99±1.64 15.71±1.75 14.01±1.75 13.84±1.64 F(1, 26) = 0.29, p F(1, 26) = 2.37, F(1, 26) = .047,

= .597 p = .136 p = .830

Self-groom 4.34±0.64 2.14±0.69 3.71±0.69 1.30±0.64 F(1, 26) =11.96, F(1, 26) = 1.21, F(1, 26) = .027,

p = .002 p = .281 p = .870

Other 10.66±1.38 9.60±1.47 8.97±1.47 9.10±1.38 F(1, 26) =.086, p F(1, 26) = .645, F(1, 26) = .205,

= .772 p = .429 p = .655

Note: All data is reported as mean (standard error of the mean). Significant results are reported in

bold font.

Table 2.3A. Summary of results of behavioural testing battery demonstrating effects of prenatal stress and perinatal fluoxetine exposure on behaviour of male mice as adults.

Flx and Stress Behavioural Test Effect of Flx Effect of Stress Interaction Open Field

Thigmotaxis F(1, 64) = .004, p = .948 F(1, 64) = 1.95, p = .167 F(1, 64) = .17, p = .682

Speed F(1, 64) = .59, p = .444 F(1, 64) = .04, p = .844 F(1, 64) = .63, p = .432

Distance F(1, 64) = .55, p = .462 F(1, 64) = .10, p = .749 F(1, 64) = .87, p = .354 Elevated Plus Maze

Open arm time F(1, 64) = 9.48, p = .003 F(1, 64) = .02, p = .897 F(1, 64) = .02, p = .883

Open arm entry F(1, 64) = 1.69, p = .199 F(1, 64) = 1.46, p = .232 F(1, 64) = .43, p = .515

Closed arm entry F(1, 64) = 1.68, p = .199 F(1, 64) = 6.53, p = .013 F(1, 64) = .02, p = .899

Speed F(1, 64) = 1.65, p = .203 F(1, 64) = 16.01, p < .001 F(1, 64) = .43, p = .515

Distance F(1, 64) = 1.52, p = .222 F(1, 64) = 15.92, p < .001 F(1, 64) = .03, p = .865

Time active F(1, 64) = 1.82, p = .182 F(1, 64) = 10.47, p = .002 F(1, 64) = .60, p = .440

Protected stretches F(1, 64) = .105, p = .747 F(1, 64) = 2.98, p = .089 F(1, 64) = 2.71, p = .104

Head dips F(1, 64) = 5.01, p = .029 F(1, 64) = .03, p = .863 F(1, 64) = .22, p = .642 Prepulse Inhibition

PPI F(1, 64) = .000, p = .993 F(1, 64) = 1.02, p = .317 F(1, 64) = .05 p = .832 Startle response F(1, 64) = .04, p = .849 F(1, 64) = .39, p = .537 F(1, 64) = .01 p = .930 Resident Intruder

Aggressive Behaviour F(1, 63) = 14.54, p < .001 F(1, 63) = 3.81, p = .055 F(1, 63) = .84, p = .773

Social Behaviour F(1, 63) = .47, p = .498 F(1, 64) = .31, p = .577 F(1, 64) = .04 p = .837 st Latency to 1 Attack F(1, 26) = .01, p = .945 F(1, 26) = .55, p = .465 F(1, 26) = .02 p = .885 Note: Significant results are reported in bold font.

Table 2.3B: Summary of results of behavioural testing battery demonstrating effects of prenatal stress and perinatal fluoxetine exposure on behaviour of male mice as adults

Flx and Stress Effect of Time Behavioural Test Effect of Flx Effect of Stress Interaction Passive avoidance

Latency F(1, 64) = .02, p = .900 F(1, 64) = 2.52, p = .117 F(1, 64) = .03, p = .860 F(1, 64) = 586.49, p < .001 Morris Water Task Training Days

Latency F(1, 64) = .19, p = .664 F(1, 64) = .02, p = .899 F(1, 64) = 1.15, p = .288 F(3, 192) = 76.01, p < .001

Speed F(1, 64) = .42, p = .519 F(1, 64) = .96, p = .329 F(1, 64) = 1.03, p = .314

Thigmotaxis F(1, 64) = .36, p = .552 F(1, 64) = 2.25, p = .137 F(1, 64) = .50, p = .480 Probe Trial

Latency F(1, 64) = .52, p = .472 F(1, 64) = .50, p = .483 F(1, 64) = .78, p = .380

Time Crossed F(1, 64) = .14, p = .707 F(1, 64) = .01, p = .962 F(1, 64) = 1.02, p = .316 Note: Significant results are reported in bold font.

Figure 2-1. Serotonin concentration in the brain

In the male offspring whose mothers were exposed to stress, fluoxetine, or their combination, only maternal exposure to fluoxetine (regardless of stress) decreased the average concentration of serotonin in brains of pups at 12 days of age. *p < 0.05. All data are presented as mean ± SEM.

180 * 160

140 Cortex

120

100 Thalamus/ Midbrain 80

40 Cerebellum/ Serotonin Concentration(ng/g) Serotonin 20 Hindbrain

0 Control Stress Fluoxetine Stress + Fluoxetine

Figure 2-2. Performance on the elevated plus maze.

Maternal exposure to fluoxetine decreased anxiety-like behaviour in adult male offspring as seen by % time in open arm (A), and maternal stress resulted in increased activity

(speed and distance traveled) of adult male offspring (B,D) in the elevated plus maze

(EPM). Offspring of Flx-exposed mice spend more time on the open arms of the EPM

(A). Offspring of mice exposed to chronic variable stress show increased entry into the closed arms of the EPM (B). Offspring of mice exposed to chronic variable stress travel with greater speed in the EPM (C). Offspring of mice exposed to chronic variable stress travel a greater distance in the EPM (D). *p < 0.05. All data are presented as mean ±

SEM.

Figure 2-3. Behaviour of male mice in the resident intruder test

A. Compared to control mice, more Flx-exposed mice, and fewer perinatally-stressed mice attacked the intruder. B. Perinatal exposure to fluoxetine increased, while perinatal exposure to stress tended to decrease the time mice spent in aggressive behaviours towards intruders. *p < 0.05, ^ p = 0.055. All data are presented as mean ± SEM.

Figure 2-4. BDNF levels in frontal cortex

Adult male offspring of dams subjected to chronic variable stress show decreased frontal cortex concentration of brain derived neurotropic factor. *p < 0.05. All data are presented as mean ± SEM.

Behavioural outcomes of adult female offspring following maternal stress and perinatal fluoxetine exposure

The work contained within this Chapter is currently submitted for publication:

Kiryanova, V., Meunier, S., & Dyck, R. H. (2017). Behavioural outcomes of adult female offspring following maternal stress and perinatal fluoxetine exposure. Behavioural Brain

Research

The author designed the study, performed the stress and fluoxetine manipulations, performed behavioural assessments, assisted with tissue collection, conducted statistical analysis, and wrote the manuscript. Meunier, S contributed to study design and assisted with behavioural assessments. Dr. Dyck contributed to study design, performed tissue dissection for LC/MS and contributed to revisions of the manuscript.

3.1 Introduction

Stress, depression, and anxiety during pregnancy can lead to adverse obstetric outcomes and affect fetal and neonatal development and behaviour (Alder et al. 2007;

Dunkel Schetter and Tanner 2012). Stress-related disorders such as depression and anxiety are common in pregnant women: 10 - 18% of pregnant women present with symptoms of depression, and 6-14% present with symptoms of anxiety disorders

(Andersson et al. 2003; Gavin et al. 2005; Kitamura et al. 1993; Ross and McLean 2006).

This prevalence is even higher in pregnant women with lower socioeconomic status due to, in part, increased frequency of stressful life events (Borri et al. 2008; Hobfoll et al.

1995; McKee et al. 2001; Wenzel et al. 2005). Primary pharmacological treatments for anxiety and depression are selective serotonin reuptake inhibitors (SSRIs) (Mandrioli et al. 2012). Out of the 6% of pregnant women who are prescribed an SSRI at some point during their pregnancy, between 20-25% will receive fluoxetine (Flx; brand names

Prozac, Sarafem, Rapiflux) (Andrade et al. 2016).

Maternal intake of antidepressants and maternal anxiety, depression, and stress can affect obstetric outcomes and child’s development and behaviour. Early exposure to these environmental events are linked with a decrease in gestational length and a reduction in birth weight (Chambers et al. 1996; Grote et al. 2010; Hendrick et al. 2003), and may lead to changes in emotional behaviour, including anxiety, in children (Hanley et al. 2015; Van den Bergh and Marcoen 2004). Beyond the childhood years, effects of maternal anxiety, depression, and stress and maternal Flx exposure are not yet fully

98 understood. Animal studies have been essential in uncovering these effects (for a review see Kiryanova et al. 2013a; Olivier et al. 2013).

Animal studies utilize maternal stress as a model of maternal depression and anxiety. Animal studies show that maternal stress and maternal exposure to Flx both have long-term effects on the offspring. These maternal experiences alter offspring’s learning and memory (stress: (Bustamante et al. 2010; Lehmann et al. 2000; Nishio et al. 2001;

Stohr et al. 1998; Vallee et al. 1999; Vallee et al. 1997b); Flx: (Kiryanova and Dyck

2014; Olivier et al. 2011b; Rebello et al. 2014)), aggression levels (stress: (Kinsley and

Svare 1986; Kiryanova et al. 2016a; Patin et al. 2005; Tsuda et al. 2011); Flx: (Kiryanova and Dyck 2014; Kiryanova et al. 2016a; Singh et al. 1998; Svirsky et al. 2016)), circadian behaviours (stress: (Kiryanova et al. 2016b); Flx:(Kiryanova et al. 2013b)), and depressive- and anxiety-like behaviours (stress: (Bosch et al. 2006; Miyagawa et al. 2011;

Morley-Fletcher et al. 2011; Stohr et al. 1998); Flx: (Karpova et al. 2009; Kiryanova and

Dyck 2014; Lisboa et al. 2007; Mendes-da-Silva et al. 2002; Noorlander et al. 2008;

Olivier et al. 2011b; Rebello et al. 2014)).

While necessary, examining the offspring of healthy animals is of minor ethological validity when attempting to draw inferences about exposed humans, because, in humans, Flx exposure does not typically happen in isolation, it is concurrent with maternal stress, anxiety, and/or depression. Animal studies are beginning to examine combined effects of perinatal stress and Flx exposure on adult offspring outcomes. Some studies demonstrate that Flx and stress have specific long-term effects on the offspring.

They have distinct effects on reproductive behaviour (Rayen et al. 2013; 2014), sexual brain differentiation (Rayen et al. 2013), anxiety-like behaviour (Boulle et al. 2016;

Kiryanova et al. 2016a), depressive-like behaviour (Boulle et al. 2016) and hippocampal and cortical BDNF signaling (Boulle et al. 2016; Kiryanova et al. 2016a). Other studies demonstrate that while maternal exposure to stress and Flx can have distinct effects, treatment with Flx early in life can counteract some of the effects of maternal stress, including alterations in hippocampal morphology (Ishiwata et al. 2005; Rayen et al.

2015), spatial learning (Ishiwata et al. 2005), HPA-axis reactivity (Salari et al. 2016), aggressive behaviours (Kiryanova et al. 2016a), circadian behaviours (Kiryanova et al.

2016b), and sensitivity to post-operative pain (Knaepen et al. 2013). However, most behavioural studies were conducted in male offspring; behaviours of adult female offspring have not yet been examined aside from reproductive (Rayen et al. 2014) and depressive-like behaviours (Boulle et al. 2016). A thorough assessment of outcomes in female offspring is warranted. Past studies provided indications that outcomes of female offspring may differ from that of males. First, behavioural baselines show sexual dimorphism (Alonso et al. 1991; Dalla and Shors 2009; Kokras and Dalla 2014). Second, male and female animals are differently affected by stress (Babb et al. 2013; Greenberg et al. 2013; Steinman et al. 2015; Trainor et al. 2011) and Flx administration (Fernandez-

Guasti et al. 2016; Gomez et al. 2014; Lebron-Milad et al. 2013). And, most importantly, male and female mice show different patterns of behavioural changes following maternal stress (Behan et al. 2011; Brunton and Russell 2010; Bustamante et al. 2010; Mueller and

Bale 2007; 2008; Nishio et al. 2001; Pawluski et al. 2011) and perinatal Flx administration (Favaro et al. 2008; Lisboa et al. 2007; Pawluski et al. 2011).

The goal of the present study was to investigate the effects of prenatal stress and effects of perinatal exposure to Flx, separately and in combination, on the behaviour of

100 the adult female offspring. This study sought to provide a more complete insight by conducting an in-depth behavioural analysis of the offspring’s cognitive ability, memory, anxiety, sensorimotor information processing, and exploratory and risk assessment behaviours.

3.2 Methods

3.2.1 Animals

All mice were kept on a 12:12-h light/dark (LD, 1,500 lx/0 lx) and were provided ad libitum access to food (LabDiet Mouse Diet 9F, #5020) and water throughout the experiment with the exception of stress manipulation measures (see below). Animal treatment and husbandry were performed in accordance with the Canadian Council on

Animal Care. All experimental procedures were approved by the LESARC at the

University of Calgary.

C57BL/6J breeders were obtained from the LESARC breeding facility (Calgary,

AB, Canada) and the Charles River animal facility (Wilmington, MA, USA; equally dispersed between treatment groups). At 3 months of age, male and female mice were paired for duration of 4 days. The day the seminal (copulation) plug was first observed was considered embryonic (E) day zero. The day of birth was considered to be postnatal

(P) day 0.

Pregnant dams were randomly assigned into four groups: (I) dams untreated (CON; n=6); (II) dams subjected to chronic unpredictable stress (PS; n=6); (III) dams administered Flx (FLX; n=5); (IV) dams subjected to PS and administered Flx (PS+FLX;

101 n=6). One day following parturition litters were culled to 8 pups (pups that were culled were picked randomly). Litters were housed together with their mother until weaning at

P21 after which they were housed with same sex littermates in groups of 3-5. Final groups for behavioural testing consisted of 9 female mice per group; no more than 2 female pups were used from each litter. Male offspring were used in a different set of experiments.

3.2.2 Chronic Unpredictable Stress Paradigm

From E4 to E18, pregnant dams were subjected to a regimen of chronic unpredictable stressors (PS). The PS paradigm was modified from that used by Grippo and colleagues (Grippo et al. 2003) and used as described in (Kiryanova et al. 2016a) and

(Kiryanova et al. 2016b). Stressors included restricted access to food (5- and 6-hour food deprivation; delivered during the day and overnight), continuous lighting overnight, cage tilt (home cage tilted 30⁰ ; delivered overnight or for 7 hours during the day), paired housing (animals were paired with another pregnant dam in either their home-cage or the other dam’s cage, assigned in a counterbalanced fashion; delivered overnight), foreign object in cage (a novel plastic or glass object; overnight), soiled cage (100ml of clean water spilled on bedding; overnight), irregular 16kHz tones (played at 80dB; delivered for one hour during the day), white noise (played at 80dB; delivered for 3 hours during the day), and restraint (for the duration of two hours; delivered three times during the stress regimen). At least one and at most four stressors were delivered each day.

3.2.3 Drug Treatment

Between E15 and P12, pregnant dams were administered fluoxetine hydrochloride

(Flx; Sigma-Aldrich, Saint Louis, MO, USA) in their drinking water at a dose of

102

25mg/kg/day as previously described (Kiryanova and Dyck 2014). The Flx concentration in the water was based on the mouse’s weight at the time and the mouse’s water consumption for the preceding 48 hours. This concentration was re-calculated every 48h to control for weight gain during the gestation period. This treatment protocol has been demonstrated to lead to pup brain levels of Flx and its metabolite norfluoxetine that fall within the range observed in post-mortem brain tissue of humans who took this medication (Kiryanova and Dyck 2014).

3.2.4 Measurement of Fluoxetine and Norfluoxetine in Pup Brains

3.2.4.1 Sample collection.

Pup brains were collected at P12 (FLX: n=4, from 3 litters; PS+FLX: n=5, from 4 litters). After decapitation the brain was removed, the spinal cord was severed posterior to the cerebellum, and the olfactory bulbs were removed. Cortical structures (cortex and hippocampus) were peeled away from the thalamus and the subcortical portion was bisected between the cerebellum and inferior colliculus. The three resulting brain areas were separately frozen on dry ice and analyzed as: i. cortex and hippocampus, ii. thalamus/midbrain, and iii. hindbrain/cerebellum.

3.2.4.2 Sample analysis.

103

3.2.5 Behavioural Analysis

A battery of well-validated behavioural tests was used to assess various patterns of adult behaviour in mice. The behavioural test battery we used was based upon previous reports assessing long term behavioural consequences of both stress and Flx treatments.

Starting at 2 months of age, the offspring were administered behavioural tests assessing exploratory behaviour and locomotion, anxiety-related behaviours, sensorimotor gating and acoustic startle response, and spatial and fear memory.

Tests were performed in the following order: forced swim, open field and the elevated plus maze administered to all groups. The next three tests (Morris water test, passive avoidance, and prepulse inhibition) were conducted in a counterbalanced fashion, in that equal number of animals from each group received these tests in a different order.

All testing was conducted during the light phase of the light-dark cycle, between 9am and

5pm. Tests were conducted five to seven days apart.

3.2.5.1 Open Field

The open field task assesses an animal’s movement in a large brightly lit, walled arena. By analyzing speed and distance travelled, differences in locomotor activity between groups can be measured and a comparison of time spent adjacent to the arena walls (thigmotaxis) and time spent in the arena’s center provide a relative measure of anxiety (Archer 1973).

In the current experiment a 1.2m diameter brightly lit (170±30lux) white Plexiglas arena surrounded by a 35cm high wall was used. Mice were placed individually in the arena’s center and allowed to explore for 5 min. Locomotor activity was recorded using an overhead mounted camera and HVS Image 2020 Plus software (HVS Image Ltd,

104

Twickenham, Middlesex, UK). Thigmotaxis (percentage of time spent in the outer third of the arena), total distance traveled, and speed were measured. Following each trial the arena was cleaned using a 70% ethanol solution to remove olfactory cues.

3.2.5.2 Elevated Plus Maze

The elevated plus maze test was conducted as previously described (Handley and Mithani

1984; Kiryanova and Dyck 2014; McAllister et al. 2012). The elevated plus maze (EPM) test is a well-validated measure of anxiety-like behaviour in rodents (Hogg 1996). The plus-shaped platform consists of two opposing enclosed arms (5cm x 28cm) and two opposing open arms (5cm x 28cm) extending outward, at right angles, from a central platform (5cm x 5cm) elevated 28cm above the floor; the platform was illuminated evenly by an overhead light (75±8 lux). Animals were placed individually in the maze center facing an open arm then allowed to freely explore for 5 min.

The percent of total time a mouse spent on the open arms, in the center or on closed arms, as well as the number of entries into open and closed arms, speed and distance travelled were measured using ANY-maze software version 4.73 (Stoelting

Company, Wood Dale, Illinois, USA). Arm entry was operationally defined as 4 paws within an arm, or 95% of animal within an arm. Scanning behaviour (head dip), instances on the open arms when the animal looked over the edge towards the floor, and risk assessment behaviours (protective stretch), instances in which the animal stretched its head and forepaws into an open arm from a closed arm or the center space without making a full entry into the open arm were scored manually by the researcher (Cruz et al.

1994). The number of entries into open and closed arms, speed, distance, and time spent active were also taken as a measure of locomotor activity (Rodgers and Johnson 1995).

105

3.2.5.3 Morris Water Task

The Morris water task was conducted as previously described (Kiryanova 2016).

Briefly, MWT pool was white in color, 1.2 m in diameter and filled with water (19.5 ±

0.5° C) to a depth of 20 cm. A clear plexiglas, square platform (20 x 16) was positioned in the center of one quadrant with the surface 1.5cm below the water’s surface. The water was made opaque by adding skim milk powder. Animals were video recorded from overhead using HVS Image 2020 Plus software (HVS Image Ltd, Twickenham,

Middlesex, UK).

During the first four training days, the mice were subjected to four trials each day, where they were placed into the pool facing the wall at one of the cardinal compass points, chosen in a pseudo-random order (N/S/E/W). Each trial lasted 60s and was followed by a 15s learning period where the mouse stayed atop the platform. Trials were separated by a 7-minute inter-trial interval. Trials were analyzed for speed, distance travelled, and latency to find the platform.

On the fifth day (probe trial) the platform was removed from the pool and animals were placed in a novel start location and given 60s to swim freely. The initial latency to locate where the platform had been on training days was recorded. Furthermore, the number of times the mouse swam through the area of platform’s previous location (across or within one body space) was counted and analyzed.

3.2.5.4 Passive Avoidance

Animals were placed individually in a white Plexiglas chamber with a metal grate floor (20.32cm x 25.4cm x 35.71cm), part of the dual-chamber LM1000-B avoidance system (Hamilton-Kinder LLC, San Diego, CA). Following acclimatization (2 min) the

106 chamber door opened, allowing animals to enter a second dark chamber (black walls and roof) with the same metal grate floor. When the mouse had all four paws within the dark chamber, it was administered a mild foot shock (0.5mA, duration 1s) through the metal floor. Twenty-four hours later the animals were placed individually within the white chamber with the door to the dark chamber already opened. Latency to enter the dark chamber was recorded for a maximum of 3 min.

3.2.5.5 Prepulse Inhibition

Prepulse inhibition (PPI) is a measure of the magnitude of acoustic startle response to a stimulus when it is preceded by a weaker, sub-threshold stimulus

(prepulse). PPI is a well validated measure of attentional impairments, sensory processing, and sensorimotor gating, known to be disrupted in various forms of psychopathology (Crawley, 2007). PPI and acoustic startle response were analyzed using the SM100SP Startle Monitor system (Hamilton-Kinder LLC; San Diego, CA, USA).

The apparatus consisted of a sound-attenuated chamber (27.6cm x 35.6cm x 49.5cm) housing a clear plexiglas chamber (10cm x 3.8cm) with a piezoelectric motion monitor.

Mice were placed into the chamber, provided a 5 min acclimatization period with a 65 dB steady ambient noise presented. Following this acclimatization period, a habituation phase took place in which a sound of 120dB (duration 40ms) was delivered 10 times every 5-20s. Following habituation, the testing phase occurred where 3 types of trials were each presented 10 times separated by 5-20s intervals. The trials consisted of (i) no pulse, (ii) pulse alone (120dB, duration 40ms), and (iii) prepulse (80dB, duration 20ms) followed by a pulse (120dB, duration 40ms; 100ms interval). Percent PPI was calculated using the formula: 100-(100 x startle amplitude on prepulse trial)/startle amplitude on

107 pulse alone trial. The animal’s average startle response to a pulse, as well as percent PPI, were analyzed.

3.2.5.6 Fear Conditioning

Fear conditioning paradigms based on Pavlovian conditioning were used to assess learning and memory of a negative stimulus (foot shock). Mice experienced the pairing of a novel stimulus (tone) and context (chamber) with an adverse event (foot shock).

Contextual and cued fear conditioned responses were assessed using a dual-chamber

LM1000-B avoidance system (Hamilton-Kinder LLC, San Diego, CA) following a testing procedure modified from that used by Saxe et al. (2006), as detailed below.

Experiments took place across 3 days and consisted of a conditioning day, a cued fear memory testing day, and a contextual fear memory testing day.

On the conditioning day, mice were placed within the conditioning chamber

(20.32cm x 25.4cm x 35.71cm) for a 2-min habituation period. They then received 3 pairings, at 2min intervals, of 80dB tones (duration 20s; conditioned stimulus) that terminated with a mild foot shock (0.5mA, duration 1s; unconditioned stimulus). The following day, contextual fear conditioning was assessed. On this day the mice were placed back into the chamber in which they had experienced the initial pairings of shock and tone for 4min, and freezing behaviour (absence of motor movement aside from breathing) in response to the original conditioning context was assessed across the entire session. The mice experienced neither tone nor foot shock on the contextual fear conditioning day. On the third day mice were placed in an environmentally altered chamber (color of walls (black to white), scent of environment (neutral to coconut), disinfectant used (70% ethanol to Virkon), experimenter glove material (latex to nitrile),

108 floor of chamber (from metal to plastic) to reduce contextual cues. Following a 2min habituation period, mice were exposed to an 80dB tone (duration 40s) that was not followed by a foot shock. Freezing behaviour in response to the conditioned stimulus

(tone) was assessed one minute before the tone through the 40s duration of the tone. On the second and third days (contextual and cued fear conditioning) mice were recorded using an overhead camera (Sony DCR-TRV10), which were analyzed for freezing behaviour using ANY-maze software version 4.73 (Stoelting Company, Wood Dale,

Illinois, USA).

3.2.6 Data Analysis

Protected t-tests using the Bonferroni correction were used for multiple comparisons when following up main effects in repeated measurements (e.g., Morris water test). To examine whether litter effects contributed to any of the significant findings, all significant treatment effects were followed up (p < 0.05) with a nested ANOVA, this assessed the effect of litter nested within group. We failed to find any significant litter effects (p >.10)

(data not shown). All statistics were two-tailed. Values of p < 0.05 were considered significant. All data and all figures are reported as means ± standard error of the mean

(SEM).

109

3.3 Results

3.3.1 Actual Dose of Fluoxetine

Increased water consumption throughout pregnancy and lactation resulted in an actual mean Flx dose of 27.42±.55 mg/kg/day, instead of intended 25 mg/kg/day.

Administered Flx dosage did not significantly differ between FLX and FLX+PS groups, and there was no significant group by day interaction.

3.3.2 Fluoxetine and Norfluoxetine in Pup Brains

In the P12 offspring that were exposed to fluoxetine, the mean brain fluoxetine level was 0.361±0.06 µg/g and the overall brain level of NorFlx was 3.73±0.33 µg/g.

There was no significant difference among brain regions in fluoxetine or NorFlx concentration.

3.3.3 Behavioural Evaluation of Adult Animals

3.3.3.1 Open Field

There was no effect of PS, Flx treatment, or PS by Flx treatment interaction on thigmotactic behaviour, speed and distance travelled in the open field (see Table 3.1A).

3.3.3.2 Elevated Plus Maze

There was no effect of PS, Flx administration, or PS by Flx interaction on any measures on the EPM (see Table 3.1A).

3.3.3.3 Passive Avoidance

It took longer for mice to enter the dark chamber on day two, compared to day one (F(1, 32) = 119.10, p < .001) indicating that all mice learned the dark chamber/shock

110 association (see Table 3.1B). The proportion of mice that entered the dark chamber on day two was not affected by perinatal Flx administration (χ2 (1, N = 36) = .423, p = .691), or by PS (χ2 (1, N = 36) = .423, p = .691).

3.3.3.4 Prepulse Inhibition

Female offspring of prenatally stressed dams had a higher PPI (44.1±9.2%) compared to offspring of non-stressed dams (29.8±14.3%; F(1, 32) = 13.00, p = .001; Fig

1). There was no effect of perinatal Flx exposure or PS by Flx interaction on PPI.

Furthermore, no effect of PS, Flx administration, or PS by Flx interaction was observed on the startle response.

3.3.3.5 Morris Water Task

Latency to reach the platform decreased with training, indicating that all mice were able to learn the task (F(3, 96) = 81.37, p < .001; Fig 2A). While there was a significant effect of Flx on latency to reach the platform during the training days (F(1, 32) = 6.13, p =

.019; Fig 2A), with Flx exposed animals reaching the platform slower than non-Flx exposed animals, after correcting for multiple comparisons, there was no significant difference between Flx exposed and non-exposed animals on latency to reach the platform on any of the training days (day1: t(34) = 2.07, p = .046; day2: t(34) = 1.58, p =

.123; day3: t(34) = 1.86, p = .071; day4: t(34) = .75, p = .460). Female offspring of stressed dams swam faster (.176±.005m/s) than offspring of dams not subjected to PS

(.161±.005m/s; F(1, 32) = 5.04, p = .032; Fig 2B). During the probe trial, mice perinatally exposed to Flx crossed the platform area significantly more times (Flx-exposed:2.7±1.4s;

111 not exposed to Flx:1.5±.92; F(1, 32) = 9.98, p = .003; Fig 2C) and found the platform faster

(Flx-exposed:17.7±16.7s; not exposed to Flx:31.5±24.1s; F(1, 32) = 4.18, p = .049; Fig 2D) than mice not exposed to Flx (see Table 3.1B).

3.4 Discussion

Here, we show that chronic unpredictable maternal stress leads to hyperactivity and alterations of PPI in the adult female offspring. We also demonstrate that perinatal maternal fluoxetine treatment appears to have little effect on female mice in the behavioural test we have used, potentially having beneficial effects on spatial memory.

We further show that the combination of prenatal stress and perinatal Flx exposure did not interact in their effects.

During early development, the brain is particularly vulnerable to maternal stress; maternal stress is known to lead to short- and long term- changes in offspring brain and behaviour. Maternal stress is linked with higher incidence of neuropsychiatric disorders

(Khashan et al. 2008; Kinney et al. 2008; Malaspina et al. 2008), as well as multiple alterations in offspring neuroanatomy and behaviour. The challenge of interpreting the long-term effects of PS is the variation of experimental methods which leads to inconclusive results. Preclinical studies offer no consistent results on the effects of maternal stress on prepulse inhibition and activity levels of adult offspring.

In this study, we found that chronic unpredictable stress administered to C57BL/6J dams from E4 to E18 led to hyperactive behaviours amongst their female offspring. Mice exposed to PS swim faster in the MWT, and tend to travel longer distances at higher speeds in the EPM. Similar findings have been reported in clinical studies where maternal

112 prenatal stress is linked to childhood attention deficit hyperactivity disorder (ADHD) in their female children (Grizenko et al. 2012; Groenink et al. 2011). Animal studies also report hyperactivity in perinatally stressed male (Bosch et al. 2006; Matrisciano et al.

2012; Vallee et al. 1997b) and female (Stohr et al. 1998) offspring. In adult animals, chronic stress exposure also leads to hyperactivity, suggesting a possibility of a common mechanism where early and late-life stress both increase activity levels, however, only male mice have been examined in this regard (Heiderstadt et al. 2000; Hill et al. 2013;

Strekalova et al. 2005).

Female mice exposed to PS exhibit increased prepulse inhibition. Lehmann

(Lehmann et al. 2000) found that prenatally stressed adult female rats similarly show increased PPI. However, the opposite effect of PS on PPI of female rats has also been reported (Kjaer et al. 2010). PPI is decreased in a number of neuropsychiatric disorders, such as schizophrenia, obsessive-compulsive disorder, and comorbid attention-deficit hyperactivity disorder (for a review see Braff et al. 2001). However, increased PPI in females (but not males) is associated with bipolar disorder (Gogos et al. 2009).

Interestingly, PS is linked to bipolar disorder in humans (Kleinhaus et al. 2013). Like the female mice in our study, human females (but not males) with bipolar disorder have increased PPI (Gogos et al. 2009).

Here, and in previous papers, we show that Flx administration to a dam leads to detectable fluoxetine and norfluoxetine levels in pup brains (Kiryanova and Dyck 2014).

Perinatal exposure to Flx has a number of long-term effects on offspring. Studies of male animals show changes in circadian activity, cocaine sensitivity, depressive-like behaviour, anxiety-like behaviour, fear memory, thermal sensitivity, sexual motivation,

113 and copulatory behaviours (for a review see Kiryanova et al. 2013a). Few studies examine the effect that exposure to Flx early in development has on behaviour of adult female offspring. At this time, an increase in copulatory behaviour (Knaepen et al. 2013), increases and decreases and depressive-like behaviours (Lisboa et al. 2007; McAllister et al. 2012), and decrease or no change in anxiety-like behaviour have been reported

(Capello et al. 2011; Lisboa et al. 2007; McAllister et al. 2012).

Independent of stress, perinatal exposure to Flx had only minor effects on the offspring’s behaviour as adults. In the probe trial of MWT, Flx-exposed mice crossed the platform location more times and found the platform location faster than mice not exposed to Flx. Improved MWT performance following perinatal Flx exposure was previously demonstrated in male mice (Kiryanova and Dyck 2014), and adolescent male and female rats (Bairy et al. 2007). Because spatial memory performance is correlated with hippocampal neurogenesis (for a review see Zhao et al. 2008), the enhancement in the MWT performance may be related to Flx-induced alterations in hippocampal neurogenesis (Gobinath et al. 2016; Malberg et al. 2000; Rayen et al. 2011). Maternal Flx treatment had no effect on female offspring’s cognitive ability, anxiety, sensorimotor information processing, and exploratory and risk assessment behaviours.

The comparison of our findings to those of males is imperative. The optimal benchmark is our earlier studies in males, as identical stress and Flx treatment protocols were used. Some behavioural changes appear to be sex-dependent. For example, PS has disparate effects on PPI; unlike in males, PPI of female mice is altered by PS (Kiryanova and Dyck 2014; Kiryanova et al. 2016a). Flx also has sexually-dimorphic effects on anxiety behaviour, having an anxiolytic effect in male, but not female mice (Kiryanova

114 and Dyck 2014; Kiryanova et al. 2016a). While sex-differences in the effects of stress and Flx are observed, some similarities also exist. PS causes hyperactivity, while Flx has the potential to improve spatial memory in mice of both sexes (Kiryanova and Dyck

2014; Kiryanova et al. 2016a; Kiryanova et al. 2016b). At present, not all behaviours have been studied in mice of both sexes. For example, aggression and circadian behaviours have not yet been examined in female mice exposed to PS and Flx. In males,

PS and Flx interact in their effect on these behaviours (Kiryanova et al. 2016a; Kiryanova et al. 2016b), therefore, examination of aggression and circadian behaviours in females is needed.

While it is becoming more clear that PS, Flx, and their combination lead to different behavioural changes in males and females, the mechanism of such sexually dimorphic changes is not yet understood. A combination of stress-induced changes in maternal glucocorticoids, opioid peptides, and catecholamines may have distinct effects on the development of male vs female offspring brain (Weinstock 2007) and may also have the ability to directly alter sexually dimorphic brain areas (Rayen et al. 2013) explaining different outcomes in female and male animals exposed to PS. Furthermore, alterations in the serotonergic system may underlie sex-dependent changes that follow

Flx exposure (Favaro et al. 2008; Kiryanova et al. 2016a; Nagano et al. 2012). More research is needed to fully understand the mechanism of sexually dimorphic behavioural changes that follow exposure to PS, Flx, and their combination.

3.5 Conclusion

Due to the high percentage of pregnant women that take Flx, it is important to understand the effect this medication alone, and in combination with maternal stress and

115 depression, has on the offspring. Few studies examine combined effects of stress and Flx, and most of the studies that exist examine only the outcomes of male offspring. In the present study, we report that maternal stress has a number of long-lasting, potentially negative, effects on female offspring. We also report that fluoxetine has very few effects on female offspring, and may even be beneficial due to its potential to improve spatial memory. We further show that, in female offspring, Flx did not worsen nor reverse the effects of maternal stress. Our findings indicate that maternal intake of Flx may be safe for female offspring, however more research is necessary to better understand the mechanism of such effects and its translation to humans.

116

Table 3.1A. Summary of results of behavioural testing battery demonstrating effects of prenatal stress and perinatal fluoxetine exposure on behaviour of female mice as adults.

Flx and Stress

Behavioural Test Effect of Flx Effect of Stress Interaction

Open Field

Thigmotaxis F(1, 32) = 1.49, p = .231 F(1, 32) = 3.61, p = .066 F(1, 32) = .26, p = .613

Speed F(1, 32) = 1.42, p = .242 F(1, 32) = 3.20, p = .083 F(1, 32) = 1.15, p = .291

Distance F(1, 32) = 1.75, p = .231 F(1, 32) = 3.06, p = .090 F(1, 32) = .828, p = .370

Elevated Plus Maze

Open arm time F(1, 32) = .12, p = .730 F(1, 32) = 1.67, p = .205 F(1, 32) = .08, p = .776

Open arm entry F(1, 32) = .67, p = .421 F(1, 32) = .51, p = .481 F(1, 32) = .04, p = .840

Closed arm entry F(1, 32) = 1.49, p = .231 F(1, 32) = 2.46, p = .126 F(1, 32) = .27, p = .605

Speed F(1, 32) = .12, p = .731 F(1, 32) = 3.22, p = .082 F(1, 32) = .75, p = .392

Distance F(1, 32) = .12, p = .728 F(1, 32) = 3.27, p = .080 F(1, 32) = .63, p = .435

Time active F(1, 32) = .01, p = .941 F(1, 32) = 2.65, p = .113 F(1, 32) = .43, p = .517

Protected stretches F(1, 32) = 1.15, p = .292 F(1, 32) = .315, p = .578 F(1, 32) = .315, p = .578

Head dips F(1, 32) = .01, p = .936 F(1, 32) = .80, p = .379 F(1, 32) = .000, p > .999

Prepulse Inhibition

PPI F(1, 32) = 1.75, p = .195 F(1, 32) = 13.00, p = .001 F(1, 32) = .918, p = .345

Startle response F(1, 32) = 1.97, p = .170 F(1, 32) = 2.88, p = .099 F(1, 32) = 1.59, p = .217

Note: Significant results (p < 0.05) are reported in bold font.

117

Table 3.1B. Summary of results of behavioural testing battery demonstrating effects of prenatal stress and perinatal fluoxetine exposure on behaviour of female mice as adults.

Flx and Stress Effect of Time

Behavioural Test Effect of Flx Effect of Stress Interaction

Passive avoidance

Latency F(1, 32) = .91, p = .347 F(1, 32) = 1.20, p = .282 F(1, 32) = 3.24, p = .081 F(1, 32) = 119.10, p < .001

Morris Water Task

Training Days

Latency F(1, 32) = 6.13, p = .019 F(1, 32) = 1.01, p = .323 F(1, 32) = .002, p = .967 F(3, 96) = 81.37, p < .001

Speed F(1, 32) = .03, p = .865 F(1, 32) = 5.04, p = .032 F(1, 32) = .34, p = .562

Thigmotaxis F(1, 32) = 1.63, p = .211 F(1, 32) = 1.46, p = .235 F(1, 32) = .06, p = .804

Probe Trial

Latency F(1, 32) = 4.18, p = .049 F(1, 32) = 0.96, p = .333 F(1, 32) = .33, p = .572

Time Crossed F(1, 32) = 9.98, p = .003 F(1, 32) = .17, p = .683 F(1, 32) = .17, p = .683

Note: Significant results (p < 0.05) are reported in bold font.

118

Figure 3-1. Prepulse Inhibition

Adult female offspring of dams subjected to chronic variable stress show enhanced prepulse inhibition; # denotes significant main effect of stress, p < 0.05. All data are presented as mean ± SEM.

119

Figure 3-2. Performance in the Morris Water Task

Mean latency to reach the platform across 4 days of testing in the MWT (A). Offspring of mice exposed to chronic variable stress traveled with greater speed in the Morris water test (B). Maternal exposure to fluoxetine enhances spatial memory in adult female offspring. In the probe trial, Flx exposure led to an increase in number of crosses of platform’s location (C), and lead to a shorter latency to find platform’s location (D). # denotes significant main effect of stress; * denotes a significant main effect of fluoxetine;

# and * p < 0.05. All data are presented as mean ± SEM.

120

Circadian Behavior of Adult Mice Exposed to Stress and Fluoxetine During Development

The work contained within this Chapter was previously published:

Kiryanova, V; Smith, V; Dyck, R. H; Antle, M. (2016) Circadian Behavior of Adult Mice

Exposed to Stress and Fluoxetine During Development. Psychopharmacology, 234 (5), 793-

804. PMID: 28028599

The author designed the study, performed the stress and fluoxetine manipulations, performed behavioural assessments, conducted statistical analysis, and wrote the manuscript. Smith, V contributed to study design and assisted with planning the behavioural assessments. Dr. Dyck contributed to study design and contributed to revisions of the manuscript. Dr. Antle contributed to study design, figure generation and revisions of the manuscript.

121

4.1 Introduction

Maternal stress during gestation and after birth can affect the development of infants and children, and can increase a child’s risk for developing affective and psychiatric disorders such as schizophrenia and autism (for a review see Kinney et al.

2008; Talge et al. 2007). Stress can precipitate depressive episodes, which may occur during pregnancy (for a review see Monroe and Hadjiyannakis 2002; Tennant 2002). The prevalence of depression among pregnant women is between 10 and 18% (Andersson et al. 2003; Gavin et al. 2005; Kitamura et al. 1993), and can be as high as 51% in low- income ethnic minorities (Hobfoll et al. 1995; McKee et al. 2001). Selective serotonin reuptake inhibitors (SSRIs) are the primary pharmacological treatment for depression

(Mandrioli et al. 2012) and about 6% of pregnant women in the U.S. are prescribed an

SSRI at some point during their pregnancy (Andrade et al. 2008; Andrade et al. 2016). At one time, fluoxetine (Flx) was the most commonly prescribed SSRI during pregnancy

(Andrade et al. 2008). While sertraline has overtaken Flx in recent years for treatment of depression during pregnancy, more than 1% of pregnant women are still prescribed Flx at some point during their pregnancy (Andrade et al. 2016). Of those prescribed an antidepressant, between 20-25% will receive Flx (Andrade et al. 2016).

Little is known about the effects of maternal stress and maternal intake of antidepressants on circadian system function of their offspring. The circadian clock, located in the suprachiasmatic nucleus (Antle and Silver 2005), regulates daily patterns in physiology and behavior (Antle and Silver 2016; Kyriacou and Hastings 2010; Portaluppi et al. 1996; Saper et al. 2005). These rhythms persist in constant conditions, but are synchronized to environmental cycles by stimuli that provide time cues. While light is the

122 main cue for regulating the phase of the circadian clock and thus synchronizing it to environmental cycles, other so-called non-photic stimuli may also affect clock phase

(Webb et al. 2014; Yamakawa et al. 2016). Disruption of the circadian clock can contribute to development of a systemic illnesses (Green et al. 2008; Takahashi et al.

2008) and increase the risk of affective, psychiatric and mood disorders (Barnard and

Nolan 2008; Salgado-Delgado et al. 2011; Takahashi et al. 2008).

The function of the circadian clock following gestational stress has not yet been examined. However, it has been demonstrated that the circadian system and its outputs are vulnerable to various other developmental insults. Male rats whose mothers were exposed to hypoxia from embryonic (E) day 5 to E20 have altered circadian function as adults, including an altered phase angle of entrainment, reduced phase shifts to phase- delaying light pulses, and impaired resynchronization to a 6-hour delay of their light-dark cycle (Joseph et al. 2002). Mice exposed to inflammation in utero show a decrease in time spent awake during the dark phase of the circadian cycle. Sleep microstructure of these mice is also altered, as demonstrated by an increase in the average length of non-

REM sleep bouts during the dark cycle (Adler et al. 2014). Maternal nutrient restriction

(Orozco-Solis et al. 2011) and alcohol exposure (Chen et al. 2006) can alter the rhythmic expression of circadian genes in an offspring’s hypothalamus. Therefore, it is possible that the developing circadian system may also be vulnerable to the effects of maternal stress.

Perinatal exposure to Flx can alter circadian rhythms. Such exposure leads to larger phase advances in response to a light-pulse, a shortened free-running circadian period in constant darkness, and a decrease in the phase-shifting response to the 5-HT1A/7

123 agonist 8-OH-DPAT (Kiryanova et al. 2013b). Recent research demonstrates that early exposure to Flx can in some cases prevent and in other cases augment some effects of gestational stress on an offspring’s behavior and physiology (Ishiwata et al. 2005;

Knaepen et al. 2013; Ordian et al. 2010; Rayen et al. 2015; Rayen et al. 2013; Rayen et al. 2011). However, no study has examined the effect of stress and Flx exposure on circadian system function in the offspring. We have previously demonstrated that some behavioral alterations caused by stress can be ameliorated by subsequent administration of fluoxetine during early development (Kiryanova et al. 2016a). Therefore, we hypothesize that fluoxetine will be able to partially reverse the effects of maternal stress on circadian behavior of the offspring.

The goals of this study were three-fold; first, we sought to delineate the effects of maternal stress on the circadian system of the adult offspring. Second, we sought to expand our previous research on the effects of early exposure to Flx by examining phase- shifting behavior of animals to an 8-hour phase advance of the light-dark cycle. Finally, we sought to assess the combined effects of maternal exposure to stress and maternal exposure to Flx on circadian behavior of adult male offspring.

4.2 Materials and Methods

4.2.1 Animals

All animals (C57BL/6J mice) were housed in a temperature- and humidity- controlled room, were kept on a 12h light - 12h dark cycle, and given ad libitum access to food and water (LabDiet Mouse Diet 9F, #5020) throughout the experiment, apart from the manipulations described below. Animal treatment and husbandry were performed in accordance with the guidelines from the Canadian Council on Animal Care. All

124 experimental procedures were approved by the University of Calgary’s Life and

Environmental Sciences Animal Care Committee.

Breeder mice were obtained from the University of Calgary Life and

Environmental Sciences Animal Resource Center’s breeding colony. Eight-week old dams were paired with a male breeder (in dyads or triads) for a period of 6 days; following this period the dams were single-housed. The day the seminal (copulation) plug was first observed was considered embryonic (E) day zero. The day of birth was considered postnatal (P) day 0. Litter sizes were standardized by culling each litter to eight pups on the first day after birth. Given the problem of sexing animals on P1, no attempt was made to standardize the ratio of males to females in each litter. This approach produced an average ratio of male: female pups of 1.16:1.

Pregnant dams were randomly assigned into four groups: (i) dams subjected to chronic unpredictable mild stress (PS; n=5); (ii) dams administered Flx (FLX; n=4); (iii) dams that were subjected to chronic unpredictable mild stress and were administered Flx

(PS+FLX; n=4); or (iv) untreated dams (CON; n=4). Litters were housed together with their mother until weaning at P21 after which they were separated and housed with same sex littermates in groups of 3-5. Only male mice were used for the present study. Only one or two male pups from each litter were used, yielding a total of seven mice per group for circadian testing. The female offspring and the male offspring not used for this experiment were used in a different set of experiments.

4.2.2 Chronic Unpredictable Stress Paradigm

The chronic unpredictable stress paradigm used was modified from that used by

Grippo and colleagues (Grippo, Beltz, & Johnson, 2003) and has previously been used by

125 our group (Kiryanova et al. 2016a). This modified protocol was intended to maximize the unpredictable nature of the stressors. The chronic unpredictable stress paradigm has been shown to produces neurobiological changes consistent with what is seen in depression, including downregulation of hippocampal glucocorticoid and 5-HT1A receptors, upregulation of cortical cannabinoid CB1 and β-adrenergic receptors, a reduction in the protein levels of brain derived neurotrophic factor in both the cortex and hippocampus, and a reduction in the adenylyl cyclase / protein kinase A signaling in the cortex (Hill and

Tasker 2012). Beginning on E7 animals were administered a regimen of chronic unpredictable stressors; E18 was the last day stressors were administered. Stressors included: restricted access to food (food was removed from the animal’s home cage for a maximum of 6 hours, the remainder of the time the animals were fed ad libitum), continuous lighting overnight, cage tilt (home cage tilted 30⁰), paired housing (animals were paired with another pregnant dam in either their home-cage or the other dam’s cage, assigned in a counterbalanced fashion), 5 minutes of forced swimming, foreign object in cage (a novel plastic or wooden object), soiled cage (100ml of clean water spilled on bedding), irregular 16kHz tones (played at 80dB), and white noise (played at 80dB).

Additionally, all animals were subjected to 2-hours of restraint stress administered three times during their pregnancy: on E10, E14, and E16. Restraint stress was conducted during the day in the animal’s home cage.

4.2.3 Drug Treatment

Pregnant dams were administered fluoxetine hydrochloride (Sigma-Aldrich, Saint

Louis, MO, USA) in their drinking water at a dose of 25mg/kg/day. The concentration of

Flx in the drinking water was adjusted every 48h based on the animal’s water

126 consumption and their current weight. Fluoxetine treatment was administered from E15 to P12, a time intended to approximate the second and third trimesters of human cortical development (Clancy et al. 2007; Romijn et al. 1991). While we were not able to assess

Flx levels in the pups used in this study, as such sampling can only be done post-mortem, which precludes studying behavior later in life, this treatment protocol has been demonstrated in our lab to lead to pup brain levels of Flx and its metabolite norfluoxetine that fall within the range observed in post-mortem human brain tissue (Kiryanova and

Dyck 2014). Additionally, this protocol leads to detectable behavioral changes in adult offspring (Kiryanova and Dyck 2014; Kiryanova et al. 2013b; McAllister et al. 2012).

4.2.4 Behavioral Testing

All animals were housed in a temperature- and humidity-controlled room, with ad libitum access to food and water. At 9 weeks of age, the male offspring (N=28; 7 mice in each group) were placed in individual, clear polycarbonate cages (Nalgene Type L; 30.3 cm long x 20.6 cm wide x 26 cm high; Nalg Nunc International, Rochester, NY) equipped with a 24.2-cm-diameter stainless steel running wheel. Cages were changed approximately every 2.5 weeks (7-10 days prior to and following a manipulation).

Running wheels were equipped with magnetic switches connected to a computer, which enabled monitoring of daily wheel running activity (Clocklab data collection software package; Coulbourn Instruments, Allentown, PA, USA). Animals were entrained to a

12:12-h light-dark (LD, 1500 lx/0 lx) cycle for a 3-week period. After this 3-week period, the LD cycle was advanced by 8 hours. Due to a computer program malfunction, we were unable to analyze the re-entrainment data for this period, therefore, this 8-hour LD cycle advance was repeated 4 weeks later. Animals were maintained for 3 weeks in the new LD

127 cycle before the lighting schedule was changed to constant darkness (DD, 0 lx) for 14 weeks during which they received phase shifting light pulse and 8-OH-DPAT treatments.

After the phase shifting experiments in DD were completed (30 weeks of age), the animals were placed in constant light (LL) for two weeks (Fig.1).

All graphical representations of wheel-running activity (actograms) were generated and analyzed by Clocklab analysis software. Activity onsets on manipulation days were predicted by using a regression line fit to the activity onsets for the 7-10 days prior to manipulation. The phase shifts of the behavioral activity rhythms following each manipulation were calculated using Clocklab-generated actograms. Briefly, a regression line was fit to the activity onsets for the 7-10 days prior to the manipulation, and another regression line was fit for the activity onsets for 7-10 days following the treatment

(excluding the 3 days immediately following the treatment so that transient activity onsets would not influence the regression line). Phase shifts of wheel running activity were calculated using the horizontal difference between the two regression lines on the day after the manipulation.

4.2.5 Circadian behavior parameters

Patterns of activity were analyzed in all three lighting conditions: LD (before the

LD was shifted), DD, and LL. In LD, activity counts were summed into six 4-h time blocks starting at lights-on. The activity levels in these time-blocks were averaged over 2 weeks. Phase angle of entrainment was also determined in LD by calculating the difference between the time of dark-onset and the time of activity onset. In DD (first 10 days) and in LL (last 10 days) locomotor activity duration (alpha) and differences in the period of the free-running rhythms (tau) were evaluated.

128

4.2.5.1 Re-entrainment to an 8-hour advance of the light dark cycle

At 16 weeks of age, mice entrained to a 12:12-h LD cycle were subjected to an 8- hour LD cycle advance. This mimics the light cycle change associated with eastward travel across 8 time-zones. To shift the LD cycle, the dark phase was advanced by 8 hours in a single day. The average phase angle of entrainment (time of activity onset relative to time of dark onset) was determined for the 10 days prior to the shift. Animals were considered to be re-entrained to the new LD cycle once their phase angle of entrainment was within 30 minutes of their baseline phase angle of entrainment, and this phase angle was maintained for at least 3 consecutive days.

4.2.5.2 Phase shifts to short-duration light pulses

At 22 weeks of age, phase shifting in response to dim light pulses was examined.

The animal’s cage was transferred to a light-sealed box where a 40-lux, 15-min light pulse was delivered. The animals received light pulses at two time points in their circadian cycle: in the early subjective night (at circadian time (CT) 16; or 4 h after predicted activity onset, where activity onset is defined as CT12 by convention) and in the late subjective night (CT22; or 10h after their predicted activity onset). These manipulations were delivered 2 weeks apart in a counterbalanced fashion.

4.2.5.3 Phase shifts to 8-OH-DPAT

At 26 weeks of age, half of the animals were administered the 5-HT1A/7 receptor agonist 8-OH-DPAT (5 mg/kg intraperitoneal, Sigma-Aldrich) while the other half received the corresponding volume of vehicle (sterile saline), at mid-subjective day

(CT6). Two weeks later, the animals received the opposite treatment (vehicle or 8-OH-

DPAT). The phase shift of the behavioral activity rhythms of each animal was calculated

129 as described above. 8-OH-DPAT phase shifts the clock in a non-photic manner with large phase advances during the circadian day (Smith et al., 2008), and it is thought that serotonin contributes to other non-photic phase shifts (Webb et al. 2014), so this treatment would probe if sensitivity to this serotonergic agent had changed and if non- photic phase shifts to this drug were altered.

4.3 Data Analysis

Two-way (Flx x stress) factorial analysis of variance (ANOVA) tests, followed by

Bonferroni post hoc tests, were conducted to determine whether there were significant differences between groups on the following measures: alpha in each of the light conditions - LD, DD, and LL; free-running period in each of DD and LL; phase angle of entrainment in LD; time to re-entrain to an 8-hour advance of the LD cycle; and the magnitude of behavioral phase shifts after the administration of short-duration light pulses in the early and late subjective night. A mixed three-way ANOVA (injection type x stress x Flx) followed by Bonferroni post hoc tests was used to examine differences in phase shifts to saline or 8-OH-DPAT. To determine the difference in daily activity between the control and Flx-treated animals in LD, a 2 (perinatal Flx, no perinatal Flx) by

2 (prenatal stress, no prenatal stress) by 6 (the six 4 h-time blocks) split plot ANOVA was conducted. To examine the effect of treatment on the phase of activity onsets, a two- way repeated measure ANOVA was conducted.

To examine whether this study replicated our previous findings, planned one- tailed t-tests were conducted between CON and FLX groups where appropriate. Outliers, defined as values that differed from the mean by at least 3 standard deviations, were excluded from statistical analysis. All other statistics were two-tailed. Values of p < 0.05

130 were considered significant. All data and all figures are reported as means ± standard error of the mean (SEM).

4.4 Results

4.4.1 Circadian behavior parameters

In LD, as expected, all animals were significantly more active at night than during the day (main effect of time of day, F(5, 120) =179.07, p<0.001). Furthermore, there was a significant time of day x stress interaction (F(5, 120) =4.41, p=0.001). As predicted, animals exposed to prenatal stress tended to be more active. This activity increase was evident in the first two-thirds of the night, between CT12-16 (no stress: 16.48±3.43 activity counts/min; prenatal stress: 19.0±2.95 activity counts/min: p = 0.026) and between CT16 and 20 (no prenatal stress: 10.18±4.88 activity counts/min; prenatal stress: 13.94±4.62 activity counts/min: p = 0.024; Fig. 2). There were no significant effects of either stress or fluoxetine (p > 0.05). Nor were there any significant stress x fluoxetine or time x stress x fluoxetine interactions (p > 0.148). No significant differences were detected in any of the following: phase angle of entrainment in LD, duration of the active phase (alpha) in

LD, DD, or LL, differences in the expressed rhythm of free-running period (tau) in DD or

LL (Table 4.1).

4.4.2 Re-entrainment to 8-hour light dark cycle advance

Perinatal Flx exposure was associated with a significant increase in the number of days animals required in order to re-entrain to the new LD cycle (Flx-exposed: 8.37±.33 days; not exposed to Flx: 7.14±.32 days; F(1, 23) = 7.20, p = 0.013; Fig. 3). There was no main effect of stress (F(1, 23) = 3.05, p = 0.094), nor a significant prenatal stress x Flx

131 interaction (F(1, 23) = 3.05, p = 0.094). One outlier (from PS+FLX group) was excluded from this analysis.

The phase of activity onset of the PS+FLX group was significantly delayed relative to the other groups on a number of days during re-entrainment (significant treatment x day interaction; F(60, 460) = 2.808, p < .001). Beginning on day 3 after the light-dark cycle was advanced, onsets of the PS+FLX group were significantly delayed in comparison to the CON group. Beginning on day 4, the PS+FLX group was significantly delayed compared to both CON and PS groups. On day 5 the onsets of the PS+FLX group were significantly delayed relative to all 3 of the other groups. This difference persisted until day 7. On day 8, PS+FLX group was still delayed in comparison to CON and FLX groups, and on day 9 in comparison with only the FLX group. Furthermore, on days 4 and 5, the phase of activity onset of the FLX group was delayed in comparison with the PS group (Fig. 3).

4.4.3 Phase shifts to short-duration light

Light pulses at CT22 yielded phase-advances in all groups, but the sizes of these shifts were altered by the treatments (significant prenatal stress x Flx interaction; F(1, 23) =

18.84, p < 0.001). While the magnitude of the phase advances was significantly larger for the PS (p=0.007) and FLX (p=0.049) groups than for the CON group, phase advance of the PS+FLX group did not significantly differ from that of the CON group (p > 0.999).

The magnitude of the phase advances was also significantly different between PS and

PS+FLX animals (p=0.022; Fig. 4). One outlier (from the PS group) was excluded from this analysis. There were no main effects of either PS or Flx (p > 0.322).

132

Phase-delays to a 15-min light pulse during the early subjective night (CT16) were significantly smaller in prenatally stressed (PS and PS+FLX: -1.29±0.14 h) than in non-stressed animals (CON and FLX: -1.82±0.14 h; main effect of stress, F(1, 24) = 6.90, p

= 0.015; Fig. 5). There was no main effect of Flx (F(1, 24) = 1.97, p = 0.173), nor was there a stress x Flx interaction (F(1, 24) = .817, p = 0.375). To examine whether this study replicated our previous findings, a planned comparison was conducted between CON and

FLX groups; as predicted, there was no significant difference between these groups (p =

0.116).

4.4.4 Phase shifts to 8-OH-DPAT

Administration of the 5-HT1A/7 agonist 8-OH-DPAT produced significantly larger phase shifts than injections of saline (main effect of injection, F(1, 20) = 38.22, p < 0.001).

Injections of 8-OH-DPAT induced significantly smaller phase advances in the PS group

(stress x Flx by injection type interaction; F(1, 20) = 4.74, p = 0.048) than in CON

(p<0.001), FLX (p=0.019), and in PS+FLX groups (p=0.004; Fig. 6). To examine whether this study replicated our previous findings, a separate planned comparison was conducted between CON and FLX groups. As predicted, there was no significant difference between groups with saline administration, while FLX animals showed significantly smaller phase-shifts than did CON animals following 8-OH-DPAT administration (p=0.018).

4.5 Discussion

This is the first study that examines the effects of perinatal exposure to Flx and to maternal stress on photic and non-photic responses of the circadian system in adult mice.

In the present study, we show that prenatal exposure to chronic stress and perinatal

133 exposure to Flx have several effects on the functioning of the circadian system of adult male offspring. Mice exposed to prenatal stress had higher activity levels during the first two-thirds of the subjective night under LD conditions. These mice also showed smaller phase shifts to 8-OH-DPAT administered during the mid-subjective day. While mice exposed to prenatal stress showed phase shifts to early- and late- subjective night light pulses, these shifts differed in their magnitude from those of control mice; phase shifts to light pulses administered at CT16 were decreased, while phase shifts to light pulses administered at CT22 were augmented. Like mice exposed to prenatal stress, mice exposed to Flx showed increased phase shifts to a light pulse administered at CT22 and decreased phase shifts to 8-OH-DPAT administration at CT6. However, unlike animals exposed to prenatal stress, mice exposed to Flx were slower to re-entrain to an 8-hour LD advance. Importantly, Flx treatment partially reversed the effect of PS as, unlike exposure to stress or Flx separately, animals exposed to both prenatal stress and Flx did not differ from controls in their responses to either CT22 light pulses or CT6 8-OH-DPAT administration. Finally, the current study replicates our previous findings of the effects of perinatal Flx administration on phase-shifts to both photic (i.e., light pulses) and non- photic (i.e., 8-OH-DPAT administration) treatments (Kiryanova et al. 2013).

The precise mechanisms underlying the observed changes following maternal Flx and stress exposure are not yet known. However, the involvement of the serotonergic system is likely. Earlier studies discovered that perinatal exposure to stress and perinatal exposure to Flx can alter the activity of the serotonergic system, including serotonin concentrations and serotonin receptor density and function during development (Cabrera-

Vera et al. 1997; Gemmel et al. 2016; Kiryanova and Dyck 2014; Peters 1982),

134 adolescence, and adulthood (Cabrera-Vera and Battaglia 1998; Cabrera-Vera et al. 1997;

Miyagawa et al. 2015; Peters 1982). These changes are complex; they cannot be generalized as simple up- or down-regulation of the serotonergic system. These changes are also unique to each type of exposure (i.e., stress or fluoxetine). Serotonin is a major modulator of the circadian system (Mistlberger et al. 2000; Morin 1999; Morin and Allen

2006). Serotonin modulates the response of the circadian clock both to photic stimuli by inhibiting phase shift responses to light, and to non-photic stimuli, by being involved in the non-photic response directly (Abrahamson and Moore 2001; Mistlberger et al. 2000;

Moga and Moore 1997; Morin and Allen 2006). The SCN receives serotonergic innervation from the raphe nuclei (Meyer-Bernstein and Morin 1996; Yamakawa and

Antle 2010) and at least six serotonin receptor subtypes can be found within the SCN: 5-

HT1A, 5-HT1B, 5-HT2A, 5-HT2C, 5-HT5A and 5-HT7 (Belenky and Pickard 2001; Duncan et al. 2000; Duncan et al. 1999; Moyer and Kennaway 1999; Oliver et al. 2000; Prosser et al. 1993).

It is possible that our treatments may have produced a change in the density or activity of 5-HT receptors that modulate circadian function. Many of the behavioral changes observed here are like those observed with 5-HT1A knockout animals (Smith et al. 2008). However, the role of the 5-HT1A receptor is complex, as it functions both as an autoreceptor in the raphe nuclei and as a postsynaptic receptor in the circadian network

(Morin 1999). Given the significant role of serotonin in the regulation of the circadian system, alteration in serotonergic system function is of particular interest in our efforts to understand the mechanisms underlying the effects of these perinatal experiences.

135

The mechanisms by which prenatal stress might alter the circadian system is unknown. The circadian system is rather impervious to acute stress (Mistlberger and

Antle 2006) or acute activation of glucocorticoid receptors (Balsalobre et al. 2000).

However, it is well known that exposure to early stress can lead to dramatic behavioral changes in adulthood through epigenetic modification of genes (Francis et al. 1999).

Prenatal stress has been found to change epigenetic marks in mice, and alterations of the serotonergic systems can interact with prenatal stress to alter these epigenetic effects

(Schraut et al. 2014).

The circadian clock is synchronized to the light-dark cycle by daily advances and delays of its phase by dawn and dusk light exposure, respectively. These phase resetting responses to light were altered by our perinatal treatments. Specifically, mice exposed to prenatal stress and mice exposed to perinatal Flx both demonstrated larger phase advances to late subjective night light pulses. Several alterations in the functioning of the serotonin system could account for these changes. First, it is possible that PS and/or Flx lead to changes in the density or activity of some 5-HT receptors; candidate receptors are

5-HT1A and 5-HT7. Mice lacking these receptors from conception show enhanced photic phase shifts (Gardani and Biello 2008; Smith et al. 2008) similar to those observed in our experiment. Changes in other serotonin receptors may also contribute. Activation of the

5-HT1B receptor decreases phase shift to light (Pickard et al. 1996). Chronic Flx exposure in adulthood decreases 5-HT1B receptor binding in the SCN at night (Duncan et al. 2010).

If perinatal fluoxetine leads to similar changes that persist into adulthood, this might underlie the enhanced phase advances observed in the FLX and PS groups. Furthermore, a decrease in the number and size of serotonergic neurons in the raphe nuclei (Cabrera-

136

Vera et al. 1997; da Silva et al. 2010), and a decrease in serotonergic terminals (Cabrera-

Vera et al. 1997; da Silva et al. 2010) may also contribute to the observed differences.

Interestingly, the combination of prenatal stress and perinatal Flx exposure ameliorated the effect of each individual treatment on late-night photic phase shifts. We do not yet understand the mechanism by which early adversity and Flx exposure interact in their long-term impact on the offspring. Serotonin is known to play an inhibitory role in the normal light response. The same Flx exposure as was used in the present study has been shown to reduce serotonin levels in mice during development (at P12; Kiryanova et al.

2016a). If such reduction in serotonin persists into adulthood, it could contribute to the enhanced response to light observed in the Flx -exposed group. Animals exposed to PS may experience a different change in their serotonergic system, for example a change in receptor distribution in the SCN or along the SCN inputs and outputs. It is possible that a combination of such alterations could compensate for each other, normalizing the animal’s response to light.

We found that prenatal stress reduced phase delays to an early-night light pulse.

This finding is consistent with an impairment of serotonergic transmission in the SCN. A similar attenuation of phase-delays was observed with pharmacological blockade of the

5-HT7 receptor in adult mice (Shelton et al. 2015), suggesting that these receptors may be compromised by prenatal stress. This finding is also consistent with behavioral changes observed because of both developmental enhancement and developmental suppression of the activity of the serotonergic system. An increase in extracellular serotonin in mice lacking the serotonin transporter (Pang et al. 2012), and a decrease in the number of serotonergic cell bodies in Pet-1 knockout mice (Paulus and Mintz 2013), both lead to an

137 attenuated response to light during the early subjective night. Therefore, developmental changes in serotonin concentration may be involved in the alterations of behavior observed in our animals.

In this study, we showed that mice exposed to prenatal stress had higher activity levels during the first two-thirds of the night under LD conditions. Hyperactivity of the offspring is a well-established consequence of maternal stress during pregnancy (Bosch et al. 2006; Matrisciano et al. 2012; Stohr et al. 1998; Vallee et al. 1997b). Additionally, clinical research has reported a link between prenatal stress and the risk of the offspring developing attention deficit hyperactivity disorder, particularly in males (Rodriguez and

Bohlin 2005; Ronald et al. 2010). Considering the role of serotonin in modulating movement and sensory-motor function (Carey 2010), alterations of the serotonergic system may underlie the observed changes in activity levels in mice exposed to prenatal stress.

Serotonin is implicated in non-photic regulation of the circadian system (Edgar et al. 1993; Mistlberger et al. 2000; Wollnik 1992). Like other non-photic stimuli, administration of 5-HT1A agonists such as 8-OH-DPAT or buspirone leads to a phase advance during the mid-subjective day (Edgar et al. 1993; Lovenberg et al. 1993; Smith et al. 2014; Smith et al. 2008). The phase advances in FLX mice and in PS mice to 8-OH-

DPAT are attenuated in this study. Interestingly, in animals that received a combination of PS and Flx, 8-OH-DPAT-induced phase advances were similar to those of CON mice.

It is known that 8-OH-DPAT acts on the circadian system through its action on the 5-

HT1A and 5-HT7 receptors; 5-HT1A and 5-HT7 receptor knockout mice both show essentially no behavioral shifts to 8-OH-DPAT (Gardani and Biello 2008; Smith et al.

138

2008). The attenuation of phase shifts observed in both the FLX mice and the PS mice is consistent with the possibility of a down-regulation of 5-HT1A and/or 5-HT7 receptors. It is not yet known how Flx can normalize some alterations brought on by PS; the difference in distribution of 5-HT1A and/or 5-HT7 receptors in the SCN and other components of the circadian system, and the heterogeneity of the effect of each of PS and

Flx treatments on these receptors along with the subsequent functions they modulate may be responsible for such a functional rescue.

When subjected to an 8-hour advance of the LD cycle, mice exposed to Flx, particularly those exposed to PS+ FLX, were slower to re-entrain than all other groups.

The delayed re-entrainment response is similar to what is observed with 5-HT1A knockout mice (Smith et al. 2015) suggesting that altered serotonin signaling may underlie this change. The free-running periods and phase advances to discrete light pulses observed with PS+FLX animals were not significantly different from the other groups, suggesting that neither of these features could have contributed to the delayed re-entrainment. It is possible that while these mice have larger advances to brief light exposure, they may have smaller responses to longer light exposure (Antle et al. 2007) during their sensitive phases such as would be experienced during the initial days following the shift in the LD cycle. If this finding translates to humans, this would be equivalent to requiring more time to adjust to new shifts in a rotating shiftwork workplace, or more time to adjust when traveling eastward across 8 time zones, such as travel from Western North America to Europe.

In conclusion, the present study suggests that perinatal exposure to Flx and prenatal stress have long-lasting effects on the circadian system of the offspring. Prenatal

139 stress leads to smaller phase shifts when mice are exposed to light in the early night, but larger phase shifts when the mice are exposed to light in the late subjective night.

Perinatal Flx leads to an increase in re-entrainment time to an 8-hour phase advance, and an increase in light-induced phase-advances during the late subjective night. Most strikingly, our results suggest that in some cases, Flx may mitigate some of the effects of stress on the developing fetus; administration of Flx to dams that were also exposed to stress partially reversed the effects of stress or Flx alone: it normalized behavioral phase shifts to late-night light exposure and to 8-OH-DPAT injections at mid-day. The mechanism of such an interaction has yet to be elucidated, however a combination of serotonergic system alterations that compensate for each other could underlie such interaction. Further investigation into molecular mechanisms that underlie such changes is warranted. These findings are important, particularly those focused around prenatal stress leading to long term changes in circadian responses later in life. If humans exhibit similar changes in circadian responses, this might lead to altered sleep-wake behaviors, and altered physiological responses that might contribute to increased risk of disease

(Smolensky et al. 2016). Future studies should follow populations at risk for prenatal stress, such as those with low socioeconomic status, to determine if circadian alteration are observed there, and if so, interventions might be implemented to help mitigate any adverse consequences of the prenatal stress.

140

Table 4.1. Average phase angle of entrainment, locomotor activity duration (alpha), and free-running periods (tau), for animals exposed to prenatal stress and/or perinatal Flx

LD light–dark, DD constant darkness, LL constant light

141

Figure 4-1. Experimental timeline

Experimental timeline representing the sequence of the experimental treatments and behavioral testing. Animals were exposed to chronic unpredictable stress (embryonic

(E) day 7 to E18), fluoxetine (E15 to postnatal (P) day 12), a combination of stress and fluoxetine, or left untreated. Lighting conditions: light–dark (LD), constant darkness

(DD), constant light (LL)

142

Figure 4-2. Average waveforms activity in LD

Average waveforms of wheel running behavior during the last 14 days of LD for control animals (CON), animals perinatally exposed to Flx (FLX), animals prenatally exposed to stress (PS), and animals exposed to both stress and Flx (PS + FLX).

Waveforms were calculated by breaking each day into 144 10-min bins and then averaging the activity counts in each of those bins with the same corresponding bin (top figure) or summed into six 4-h time blocks starting at lights-on (bottom figure) and averaged over the last 14 days of LD. The individual average waveforms or time blocks were then averaged over each of the animals within a treatment group. Gray shading behind the graphs denotes times of darkness. Asterisks represent a significant

(p < 0.05) difference between groups that were exposed to prenatal stress and those that were not

143

Figure 4-3. Representative actogram and average magnitude of phase shifts to 8-h

LD cycle advance

Actograms from representative control animals (CON), animals perinatally exposed to Flx (FLX), animals prenatally exposed to stress (PS), and animals exposed to both stress and Flx (PS + FLX) that were subjected to an 8-h LD cycle advance. Each row represents a 24-h day, with the subsequent day plotted below the previous day.

Activity, in the form of wheel revolutions, is represented by black vertical marks on each horizontal row, with the height of the vertical mark being directly proportional to the amount of activity in that 10-min bin. The number of days required for each group to re- entrain is represented below. Asterisks represent a significant (p < 0.05) difference between groups that received Flx or vehicle

144

145

Figure 4-4. Representative actogram and average magnitude of phase shifts to late- night short duration light

Representative actograms depicting phase shifts to a 15-min 40-lx light pulse given at CT22 to animals exposed to prenatal stress and perinatal Flx. Actograms are plotted according to the same convention as in Fig. 4.3. Time of light pulse administration is represented by the black ring. Mean phase shifts to a 15-min 40-lx light pulse presented at CT22 in control animals (CON), animals perinatally exposed to Flx

(FLX), animals prenatally exposed to stress (PS), and animals exposed to both stress and

Flx (PS + FLX). Asterisk represents a significant (p < 0.05) difference from CON animals

146

147

Figure 4-5. Representative actogram and average magnitude of phase shifts to early-night short duration light

Representative actograms depicting phase shifts to a 15-min 40-lx light pulse given at CT16 to animals exposed to prenatal stress and Flx. Actograms are plotted according to the same convention as in Fig. 4.3. Time of light pulse administration is represented by the black ring. Mean phase shifts to a 15-min 40-lx light pulse presented at CT16 in control animals (CON), animals perinatally exposed to Flx (FLX), animals prenatally exposed to stress (PS), and animals exposed to both stress and Flx (PS +

FLX). Asterisks represent a significant (p < 0.05) difference between animals exposed to prenatal stress from those not exposed to prenatal stress

148

149

Figure 4-6. Representative actogram and average magnitude of phase shifts to 8-

OH-DPAT

Representative actograms depicting phase shifts to administration of 8-OH-DPAT

(5 mg/kg intraperitoneal) in control animals (CON), animals perinatally exposed to Flx

(FLX), animals prenatally exposed to stress (PS), and animals exposed to both stress and

Flx (PS + FLX). Actograms are plotted according to the same convention as in Fig.

4.3. Black rings on the actograms indicate the time of injection. Mean phase shifts to injections of vehicle (saline) or 8-OH-DPAT at CT6 (bottom figure). Asterisks represent a significant (p < 0.05) difference between PS and all other groups. The number sign denotes a significant (p < 0.05) difference following a planned comparison test between CON and FLX groups

150

151

Behaviour of adult 5-HT1A receptor knockout mice exposed to stress during development

The work contained within this Chapter is currently submitted for publication:

Kiryanova, V; Smith, V; Dyck, R. H; Antle, M. Behavioural outcomes of adult female offspring following maternal stress and perinatal fluoxetine exposure. Neuroscience

The author designed the study, genotyped 1/4 of the animals, performed stress manipulations, performed behavioural assessments, conducted statistical analysis, and wrote the manuscript. Smith, V genotyped ¾ of the animals and assisted with maternal behaviour assessments. Dr. Dyck contributed to study design and manuscript revisions.

Dr. Antle, M provided genetically modified mice, contributed to study design and manuscript revisions.

Authors would like to thank Vini Nagesh for technical assistance with behavioural tests and Sarah Susan Bryden for technical assistance with data management.

152

5.1 Introduction

Early life stress, both pre- and post-natal, can have detrimental consequences that persist into adulthood. Clinical studies show that maternal stress affects development of infants and children, and increases a child’s risk for developing affective and psychiatric disorders such as schizophrenia and autism (for a review see Kinney et al. 2008; Talge et al. 2007). Animal studies show that early-life stress affects the function of the stress regulatory hypothalamic-pituitary-adrenal axis (but see Behan et al. 2011; Dugovic et al.

1999; Koenig et al. 2005; Vallee et al. 1999; Vallee et al. 1997b). Early-life stress also affects animal behaviour, leading to alterations in activity levels (Matrisciano et al. 2012;

Miyagawa et al. 2011; Vallee et al. 1997b), depressive- and anxiety-like behaviours

(Bosch et al. 2006; Miyagawa et al. 2011; Morley-Fletcher et al. 2011; Stohr et al. 1998) and learning and memory (Bustamante et al. 2010; Lehmann et al. 2000; Nishio et al.

2001; Stohr et al. 1998; Vallee et al. 1999; Vallee et al. 1997b). Among other neurotransmitter systems, the serotonergic system integrity can also be altered by early stress (Holloway et al. 2013).

Serotonin is important for normal brain development: it regulates the growth of neuronal and glial cells, plays a role in synapse formation and cell survival (Chubakov et al. 1986; Gaspar et al. 2003; Lauder and Krebs 1978; McCobb et al. 1988; Vitalis and

Parnavelas 2003). Changes in serotonin levels alters the organization of the brain, as well as animal’s behaviour later in life (Nordquist and Oreland 2010). Serotonergic receptors are also involved in brain development; one of such receptors is the serotonin 1A receptor

(5-HT1AR). 5-HT1AR is detected in the cranial neural crest cells at E9, where it helps

153 mediate cell migration (Moiseiwitsch and Lauder 1995). 5-HT1AR appears in rat brain stem at E12 (Héry et al. 1999; Hillion et al. 1994). 5-HT1AR expression changes throughout brain development achieving adult-like pattern during post-natal week three

(Daval et al. 1987; Dori et al. 1996). One of the developmental roles of the 5-HT1AR is to stimulate cell differentiation, this is achieved by 5-HT1AR – controlled establishment of cytoskeletal stability, which leads to the cessation of proliferation (for a review see

Azmitia 2001). Another developmental role of 5-HT1AR is neuroprotection (Lee et al.

2009; Yan et al. 1997); however, the role of 5-HT1AR is neuroprotection is not limited to development, but is also maintained in mature brains (Bode-Greuel et al. 1990).

Knocking out 5-HT1AR does not lead to major developmental abnormalities (Parks et al.

1998), but does have several effects, including an increase in serotonergic levels during development (Deng et al. 2007) and later in life (Parsons et al. 2001) owing to the 5-

HT1AR as a somatodendritic autoreceptor in the raphe nuclei.

Chronic stress can affect 5-HT1AR expression and function. Chronic stress and chronic stress models (e.g. adrenal steroid administration) administered to adult animals trigger a downregulation of 5-HT1AR expression and binding in the hippocampus and the prefrontal cortex (Lopez et al. 1998; Meijer and de Kloet 1994; Szewczyk et al. 2014;

Watanabe et al. 1993). Chronic stress exposure early in life also affects 5-HT1AR, this effect is immediate and long-lasting. For example, immediately following maternal separation, 5-HT1AR levels are enhanced in the hippocampus and the cortex of rodent pups (Vazquez et al. 2002; Vazquez et al. 2000; Ziabreva et al. 2003). Even when months pass following early chronic stress, 5-HT1ARs remain altered. Following prenatal and early postnatal stress, changes in 5-HT1AR expression and function have been reported in

154 the cortex, hippocampus, amygdala, and raphe nuclei of adult animals (Gartside et al.

2003; Matsuzaki et al. 2009; Morley-Fletcher et al. 2004; Stamatakis et al. 2006;

Vazquez et al. 2002; Vicentic et al. 2006). These changes are not unidirectional, they are contingent upon receptor location, animal’s sex, type and timing of the stressor, and timing of assessment.

Early-life stress exposure alters 5-HT1AR across multiple brain regions. It is also known that early-life stress can have long-term behavioural effects. In this study, we sought to examine whether 5-HT1ARs are directly involved in the mechanism of long- lasting, stress-induced behavioural changes. To investigate whether 5-HT1AR mediates the effects of maternal stress on adult mice, male and female mice carrying as single functional allele for the 5-HT1AR were mated. Mouse dams were subjected to chronic variable stress during the last two weeks of pregnancy. The behaviour of wildtype (WT), heterozygous, (HET), and 5-HT1AR knockout (KO) offspring was assessed when they reached adulthood. The behaviours examined included anxiety-like behaviour, exploration, social behaviour, sensory-motor gating, gross motor function, aggressive behaviour, emotional memory, and depressive-like behaviour.

5.2 Materials and Methods

5.2.1 Animals

All animals were housed in temperature- and humidity-controlled room that was kept on a 12:12-h light/dark (1,500 lx/0 lx); animals were provided ad libitum access to food (LabDiet Mouse Diet 9F, #5020) and water throughout the experiment except for

155 some stress manipulations (see below). Animal treatment and husbandry were performed in accordance with the Canadian Council on Animal Care. All experimental procedures were approved by the Life and Environmental Sciences Animal Care Committee at the

University of Calgary.

The KO, HET, and WT mice were generated from a breeding colony established in the laboratory of Dr. M. Antle from mice originally developed by Dr. Thomas Shenk

(Princeton University, Princeton, NJ, USA), provided by Dr. Miklos Toth (Cornell

University Medical College, New York, NY, USA) and were backcrossed at least 15 times to the C57BL/6J line from the University of Calgary's (Calgary, AB, Canada) local breeding program. All dams were 5-HT1AR heterozygous, nulliparous females, 2-3 months old at the time of pairing. Dams were housed in pairs with a single HET male, for

5 days. The day the seminal (copulation) plug was first observed was considered embryonic (E) day zero; the day of birth was postnatal (P) day 0.

Pregnant dams were randomly assigned into two groups: untreated control (CON; n=20) or prenatal stress (PS; n=20). One day following parturition, litters were culled to 8 pups (chosen randomly). Litters were housed together with their mother until weaning, at

P21, after which they were housed with same sex littermates in groups of 3-5. For behavioural testing, 129 mice were used, comprising the following groups: CON: 31 males (11WT, 10HET, 10KO); 33 females (11WT, 11HET, 11KO); PS: 33 males

(11WT, 12HET, 10KO); 32 females (10WT, 11HET, 11KO).

156

5.2.2 Chronic Unpredictable Stress Paradigm

From E7 to E18 pregnant dams were subjected to a regimen of chronic unpredictable mild stressors described previously (Kiryanova et al. 2016a; Kiryanova et al. 2016b). This stress exposure model produces neurobiological changes consistent with those seen in depression (Hill et al. 2012). Stressors included restricted access to food (5- and 6-hour food deprivation), continuous lighting overnight, cage tilt (home cage tilted

30⁰), paired housing (animals were paired with another pregnant dam in either their home-cage or the other dam’s cage, assigned in a counterbalanced fashion), foreign object in cage (a novel plastic or glass object), soiled cage (100ml of clean water spilled on bedding), irregular tones (16kHz, played at 80dB), white noise (played at 80dB), and restraint (2-hour restraint conducted in animal’s home cage at E10, E14, and E16).

5.2.3 Maternal Behaviour

Maternal behaviour was assessed in 11 CON and 9 PS dams as described previously (Kiryanova et al. 2016a). Briefly, maternal behaviours were observed from P1 to P7 twice a day (once during the light and once during the dark). During each 30-min observation session, each dam’s behaviour was assessed 15 times (5-second observation every 2 min). Following behaviours were recorded: licking/grooming pups, active nursing, passive nursing, nest building, self-grooming, eating or drinking. After the final observation on P7, the pup-retrieval task was conducted as previously described

(Kiryanova et al. 2016a). During this test, the mother and the pups were removed to separate cages. Three pups were immediately returned to the home cage and placed in different corners of the cage away from the nest. The mother was returned to the home-

157 cage and the latency to approach, pick up, and fully retrieve (to the center of the nest) each pup to the nest was recorded. The test was terminated after 10 min.

5.2.4 Behavioural Analysis

Based on previous reports regarding long term behavioural consequences of both stress and 5-HT1AR receptor knockout, offspring were administered a behavioural test battery to assess exploratory behaviour and locomotion, anxiety-related behaviours, sensorimotor gating and acoustic startle response, spatial and fear memory, and territorial aggression; behavioural testing started at 2 months of age.

Tests were performed in the following order: open field, elevated plus maze, novelty-suppressed feeding test, social 3-chamber task, prepulse inhibition, fear conditioning, and resident intruder. All testing was conducted during the light phase of the light-dark cycle, between 9am and 5pm. Tests were conducted five to seven days apart, except for the resident intruder test, which was conducted after a 10-day break.

5.2.4.1 Open Field

The open field test was conducted as previously described (Kiryanova and Dyck

2014; Kiryanova et al. 2016a). The open field arena consisted of white, circular Plexiglas surface (1.2 m in diameter) surrounded by a wall (35 cm high) illuminated by an overhead light (170±30lux). Animals were placed individually in the center of the arena and allowed to explore for 5min. Activity was recorded using an overhead mounted camera and HVS Image 2020 Plus software (HVS Image Ltd, Twickenham, Middlesex,

UK). Percent of time spent in the outer 1/10 (6cm), and outer half (30cm) of the arena, as

158 well as an animal’s speed, and total distance traveled were recorded. Following each trial, the arena was cleaned using 70% ethanol.

5.2.4.2 Elevated Plus Maze

The elevated plus maze test was conducted as previously described (Kiryanova et al. 2016a). The maze is a plus-shaped arena having two walled and two open arms (5cm x

28cm), with arms of the same type opposite to each other, extending from a central platform (5cm x 5cm) mounted 28 cm above the floor; the arena was illuminated evenly by an overhead light (75±8 lux). Animals were placed individually in the maze center facing an open arm, then allowed to freely explore for 5min. Following each trial the maze was thoroughly cleaned using 70% ethanol.

The percent of total time each mouse spent on open arms and in protected stretch position, as well as the number of entries into open and closed arms, number of head dips, speed and distance travelled were evaluated using ANY-maze software version 4.73

(Stoelting Company, Wood Dale, Illinois, USA). Arm entry was operationally defined as

4 paws within an arm, or 95% of animal within an arm. Time spent active was defined as time spend moving around the apparatus and performing scanning and risk assessment behaviour. Manual scoring was done for scanning behaviour (head dip), and risk assessment behaviours (protective stretch). A head dip was defined as an instance when an animal looked over the edge towards the floor while on the open arms of the apparatus. A protective stretch was defined as an instance in which the animal stretched its head and forepaws into an open arm from a closed arm or the center space without making a full entry into the open arm (Cruz et al. 1994).

159

5.2.4.3 Novelty Suppressed Feeding

The novelty suppressed feeding was assessed using methods outlined by Samuels

(Samuels and Hen 2011). The mice were weighed, the food from their cages were removed, and the cages were changed on the evening prior to the testing day. The next morning (at 9am), 16 hours following food removal, animals were placed in new, clean, holding cage and allowed to habituate for 45 minutes. Mice were then brought in, one-at- a-time, to the testing room and placed into the testing apparatus. The testing arena consisted of a white, 40cm x 40cm x 40cm corrugated plastic box (Plaskolite Inc., Ohio) covered with fresh laboratory bedding (Aspen Chip; Nepco, Warrensburg, NY). A piece of laboratory chow attached to a piece of white corrugated plastic was placed in the center of the brightly-lit arena (630±5 lux) inside the box. After the mouse was placed into the arena, the latency to the first feeding episode was recorded. After 10 minutes or after the mouse approached and started eating the food pellet (whichever came first) the mouse was removed from the apparatus and taken to a dimly-lit room (6±1 lux) and placed into its original home-cage for 5 min, where it had access to pre-weighed piece of laboratory chow. At the end of 5 minutes the chow and the mouse were weighed.

Percentage of body weight loss, the amount of food consumed, and the latency to start eating in the home cage were measured.

5.2.4.4 Three-Chamber Social Task

The protocol designed to test social preference was modified from Yang (Yang et al. 2011). The three-chambered social task apparatus was made of 20cm-tall white corrugated plastic box divided into three interconnected chambers of equal size of 20cm

160 x 40 cm. The box was located in a dimly-lit room (8±1 lux) and the recording camera was placed above the box. The test animal was placed in the center of the box for a 5-min habituation period where the animal had access to all three compartments of the box for exploration. Following the habituation phase, a novel, previously habituated, WT

C57BL/6J adult male mouse (stranger 1) was placed under a small, weighted wire cage

(pencil holder) in one of the chambers, while an empty weighted wire cage was placed in the opposite chamber. The test mouse was allowed to explore the apparatus for 5 minutes

(phase 1). After this, a novel, previously habituated, WT C57BL/6J adult male mouse

(stranger 2) was placed under the empty wire cage, and the test mouse was allowed another 5 minutes to explore the apparatus (phase 2). Location of the novel mouse was counterbalanced across testing chambers between tests. During the habituation phase, mouse preference for a specific chamber was measured (time in right vs left chamber); during phase 1 mouse preference for a social stimulus was measured (mouse vs empty pencil-holder), and preference for a socially novel stimulus (novel vs familiar mouse) was measured during the Phase 2. Direct investigation of the pencil-holder was measured using ANY-maze software version 4.73 (Stoelting Company, Wood Dale, Illinois, USA).

An animal was considered to be exploring the object when its head was within 2cm of the wire cage.

5.2.4.5 Prepulse Inhibition

Prepulse inhibition (PPI) and startle response to acoustic stimulus were measured as previously described (Kiryanova et al. 2016a) and analyzed using the SM100SP Startle

Monitor system (Hamilton-Kinder LLC; San Diego, CA, USA). The apparatus consisted

161 of a sound-attenuated chamber (27.6cm x 35.6cm x 49.5cm) housing a clear Plexiglas chamber (10cm x 3.8cm) with a piezoelectric device located underneath. Mice were placed individually in the clear Plexiglas chamber and given a 5min acclimatization period within the chamber (65 dB background steady ambient noise). Following acclimatization, a habituation phase took place in which a noise elevation up to 120dB

(duration 40ms) was delivered 10 times every 5-20s. The testing phase occurred next, in which 3 types of trials were each presented 10 times with 5-20s intervals. The trials consisted of (i) no pulse, (ii) pulse alone (120dB, duration 40ms), and (iii) prepulse

(80dB, duration 20ms) followed by a pulse (120dB, duration 40ms; 100ms interval).

Percent PPI was calculated using the formula: 100-(100 x startle amplitude on prepulse trial)/startle amplitude on pulse alone trial. The animal’s average startle response to a pulse, as well as percent PPI, were analyzed.

5.2.4.6 Fear Conditioning

The fear conditioning paradigm, which operates on principles of Pavlovian conditioning, was used to examine emotional memory. A dual-chamber LM1000-B avoidance system (Hamilton-Kinder LLC, San Diego, CA) was used to evaluate the contextual and cued fear conditioning responses of the mice using a testing procedure modified from Saxe et al. (2006). At the start of the conditioning trial, mice were placed in to the conditioning chamber (20.32 cm x 25.40 cm, with a height of 35.71 cm) for a 2- min habituation period. Following the habituation period, mice received three pairings of sound (conditioned stimulus, 80dB 20s,) that terminated with a mild foot shock delivered

162 via the metal floor (unconditioned stimulus, US; 0.5 mA, 1 s). Two-min intervals were allowed between the tone-shock pairings.

Twenty-four hours later, the mice were returned to the conditioning chamber for four minutes in absence of both tone and foot shock. The freezing behaviour was measured during each minute in response to original conditioning context. On day three, fear conditioning to the conditioned stimulus was measured. Mice were returned to the chamber in which the environmental context was altered (color of chamber walls, experimenter glove material, scent of the environment, disinfectant used). Following a 2- min habituation period, mice were presented with a 40-second tone (80dB, 20s) in the absence of a foot shock. To account for possible differences in baseline freezing response prior to the tone, the freezing response was calculated as a difference between percent of time animals spent freezing during the tone minus the percent of time they spent freezing prior to the tone. On days two and three, mice were taped with an overhead digital camera (Sony DCR-TRV10) and analyzed for freezing behaviour (absence of movement except that necessary for breathing) using ANY-maze software version 4.73 (Stoelting

Company, Wood Dale, Illinois, USA).

5.2.4.7 Resident/Intruder Task

The resident/intruder test was conducted as previously described (Kiryanova and

Dyck 2014; Kiryanova et al. 2016a). Briefly, resident mice were isolated for 10 days in their home-cage. Intruder mice (group housed, weight-matched to the resident within 5g) were placed into the resident’s cage. Mice interacted for 10min, and the encounter was digitally recorded (Sony DCR-TRV10). The recorded video was later analyzed and

163 scored by a blinded-to-condition experimenter for the latency to first attack, duration of resident attacks, as well as the duration of aggressive behaviours. Aggressive behaviours included fighting, offensive upright, chase, aggressive groom, and on top of intruder (de

Boer et al. 1999).

5.3 Data Analysis

Behavioural test performance and patterns of behavioural changes following perinatal stress differ between male and female mice (Behan et al. 2011; Brunton and

Russell 2010; Bustamante et al. 2010; Nishio et al. 2001; Rayen et al. 2011), therefore, behavioural data for male and female mice was analyzed separately. Tests that involved a single measurement (i.e., open field, elevated plus maze, prepulse inhibition) were analyzed using a two-way (genotype x stress) factorial analysis of variance (ANOVA).

For the analysis of maternal behaviour, t-tests were used (stressed vs non-stressed dams).

For tasks that involved repeated testing of the animals (i.e., context fear conditioning) a split plot ANOVA was computed. Tukey’s post hoc test for multiple comparisons was used to assess differences between individual treatment groups. Kaplan-Meier survival curves stratified by group were used to analyze differences in both pup retrieval behaviour, and in entry latency during the novelty suppressed feeding test. When categorical variables had to be analyzed (e.g., attack behaviour) a chi-square analysis was computed. Holm’s sequential Bonferroni method was used to correct for multiple comparisons in the three-chamber social test. All statistics were two-tailed. Values of p <

0.05 were considered significant. All data and all figures are reported as means ± standard error of the mean (SEM).

164

5.4 Results

5.4.1 Assessment of Maternal Behaviour

No maternal or self-care behaviour was significantly affected by prior exposure to stress .124< p <.995. (see Table 5.1)

5.4.2 Pup Retrieval

There was no difference in how long it took each group to approach the pups, latency to pick up the first pup, latency to retrieve the first and the last pup, or in the proportion of dams in each group that retrieved both their first and last pups during the 10 minute test.

5.4.3 Behavioural Evaluation of Adult Animals

5.4.3.1 Open Field

Male offspring of dams exposed to stress during pregnancy were more active in the open field compared to male offspring of dams not exposed to stress. Male mice exposed to prenatal stress travelled a greater distance (PS: 29.77±1.27m; noPS: 25.15±1.31m; F(1,

54) = 6.42, p = .014; Fig. 5.1A) with a greater speed (PS: .100±.004m/s; noPS:

.084±.004m/s; F(1, 54) = 7.01, p = .011; Fig. 5.1B) compared to male offspring of non- stressed dams.

In female mice, there was a significant interaction between stress and genotype on the measure of speed and distance travelled in the OF (speed: F(2, 60) = 4.54, p = .015;

165 distance: F(2, 60) = 4.15, p = .020). In animals not exposed to stress, KO (25.24±1.25m) mice travelled shorter distance than WT (31.64±1.46m; p = 0.006) or HET

(33.76±1.29m; p < 0.001) mice. Similarly, in animals not exposed to stress, KO

(.085±.004m/s) mice travelled at a slower speed than WT (.105±.004m/s; p = 0.007) or

HET (.097±.004m/s; p < 0.001) mice.

In males and females there was no effect of prenatal stress, genotype, nor an interaction of the two, on time spent in the outer arena of the apparatus.

5.4.3.2 Elevated Plus Maze

Male mice exposed to PS demonstrated an increased number of arm crossings

(PS: 13.79±.79; noPS: 11.41±.80; F(1, 61) = 4.46, p = .039). There was no significant effect of genotype, but KO animals (18.70±4.23%) tended to spend less time performing protected stretch and on the open arms of the elevated plus apparatus than WT

(32.21±4.04%; p = 0.069) and HET (32.40±4.07%; p = 0.056) animals (ME of genotype:

F(2, 61) = 4.54, p = .035). There were no differences among female mice, across all groups, in the elevated plus maze (Fig. 5.2)

5.4.3.3 Novelty Suppressed Feeding

In male or female mice, there was no effect of prenatal stress or genotype, nor an interaction, on latency to begin eating the food pellet in this task, percentage of body weight loss, and the amount of food consumed, and latency to start eating in the home cage.

166

5.4.3.4 Three-Chamber Social Task

Male mice had no preference for a specific chamber in the apparatus (p = .103).

Holm’s sequential Bonferroni method was used to determine statistical significance. In phase 2, overall, male mice spent significantly more time exploring a wire mesh enclosure that contained a mouse (65.42±2.06% of the total exploration time) vs. an empty wire mesh enclosure t(65) = 7.49, p < .001. All groups of mice showed a preference for the wire mesh enclosure containing a mouse (p < .025) except for the KO mice exposed to PS (p = .564) (Fig. 5.3A).

In phase 3, male mice spent significantly more time exploring the novel mouse

(64.84±1.66% of the total exploration time) compared to the enclosure with a familiar mouse (t(65) = 8.91, p < .001). All groups of mice showed a preference for a novel over a familiar mouse (p < .006) except for the KO mice exposed to PS (p = .119) (Fig. 5.3B)

Female mice had no preference for a specific side chamber in the apparatus (p =

.493). In phase 2, overall, female mice spent significantly more time exploring a wire cage that contained a mouse (65.56±1.35% of the total exploration time) vs. an empty wire cage (t(67) = 11.45, p < .001). All groups of mice showed such preference (p < .005) except for the CON mice exposed to PS, who still showed a statistical trend in the same direction (p = .053) (Fig. 5.3C).

In phase 3, female mice spent significantly more time exploring the wire mesh enclosure containing a novel mouse (61.97±1.71% of the total exploration time) vs a familiar mouse (t(67) = 6.96, p < .001). However, when groups were analyzed separately,

167

WT CON mice showed no preference for the novel or familiar conspecific (p = .246).

Therefore, this test was excluded from the statistical analysis.

5.4.3.5 Prepulse Inhibition

There was no effect of prenatal stress, genotype, nor was there a stress x genotype interaction on startle response or PPI of male offspring.

In female offspring, there was a significant effect of genotype on PPI (ME of genotype: F(2, 59) = 3.56, p = .035). KO animals (45.36±3.07) had higher PPI than WT animals (34.02±3.01; p = 0.021). Furthermore, there was also an effect of stress (ME of stress: F(1, 59) = 5.52, p = .022), whereby mice exposed to PS (43.29±2.49) had a significantly higher PPI than mice not exposed to PS (35.08±2.46) (Fig. 5.4)

5.4.3.6 Fear Conditioning

In contextual fear conditioning (day 2), there was no effect of PS, genotype, nor an interaction between the two on the freezing response of male animals. There was an effect of time on freezing behaviour of male animals (F(3, 174) = 16.95, p < .001), animals froze significantly more during minutes two (74.69±2.43%), three (73.50±2.78%), and four (67.59±3.35%) than during the first minute of testing (56.30±2.53%; p< .010).

During cued fear conditioning (day 3), male mice exposed to PS showed an enhanced freezing response to a cue compared to mice not exposed to stress (PS:

45.63±2.54%, noPS: 37.25±2.70%, F(1,58) = 5.12, p = .027) (Fig. 5.5A)

In female mice, there was no effect of PS, genotype, nor an interaction, on the

168 freezing response in contextual fear conditioning. Similar to male mice, there was an effect of time on freezing behaviour (F(3, 177) = 33.78, p < .001), female mice froze significantly more during the second (65.68±2.50%), third (66.94±2.46%), and fourth minute (69.77±2.42%), than during the first minute of testing (47.60±2.50%; p< .001).

There was a main effect of genotype on the freezing response of female mice during the test of cued fear conditioning (F(2,59) = 5.19, p = .008). Compared to WT mice

(51.18±3.43%), KO animals show a decreased freezing response to the tone

(35.37±3.50%; p = .005) (Fig 5.5B).

5.4.3.7 Resident/Intruder Task

There was no effect of prenatal stress, genotype, nor an interaction, on any of the measurements of aggressive behaviour of male offspring.

5.5 Discussion

To our knowledge, this is the first study to evaluate behavioural outcomes of 5-

HT1AR KO, HET, and WT male and female mice exposed to PS. We found that, in males,

KO animals tended to be more anxious than WT and HET mice. Furthermore, PS led to hyperactivity and emotional memory deficits regardless of the offspring’s genotype.

However, genotype moderated the effect of PS on social behaviour. Specifically, while prenatal stress did not affect social behaviour in WT and HET male mice, social preference was abolished in KO male mice exposed to prenatal stress. In female mice, prenatal stress led to an increased prepulse inhibition response. The genotype of the

169 female offspring also had an effect on fear memory and prepulse inhibition response: compared to WT mice, KO female mice exhibited a decreased freezing response to a tone in the cued fear conditioning test, and showed a greater prepulse inhibition response. KO female mice were also hypo-active in comparison to WT and HET animals, but only when not exposed to maternal stress.

5.5.1 Stress

In this experiment, we demonstrated that PS lead to an increase in activity in adult male animals, mirroring our previous findings in C57BL/6J mice (Kiryanova et al. 2016a;

Kiryanova et al. 2016b). Hyperactivity in animals and in humans is a known long-term outcome of maternal stress (Bosch et al. 2006; Matrisciano et al. 2012; Rodriguez and

Bohlin 2005; Ronald et al. 2010; Stohr et al. 1998; Vallee et al. 1997b). One of the roles of the serotonergic system is to modulate movement and sensorimotor function (Carey

2010). Alterations of the serotonergic system development and/or function may serve as a foundation for the observed changes in activity levels in mice exposed to prenatal stress, however, it is unlikely that such modulation is due to 5-HT1AR, as in our experiment hyperactivity was observed in all three 5-HT1AR genotypes.

Sex-specific alterations in the fear conditioning response is a frequently reported outcome of early-life stress (Kosten et al. 2005; Lee et al. 2011; Markham et al. 2010;

Sadler et al. 2011). In the current study, we observed that, in adult male mice, prenatal stress exposure leads to an increase in the fear response (freezing) to a cue in the fear conditioning test. Similar enhancement in the freezing response to a tone has been previously demonstrated in male rats (Sadler et al. 2011). Such a change in the fear

170 response is not surprising, considering the well-established effect of PS on corticolimbic circuits and the hypothalamic-pituitary-adrenal response (Dugovic et al. 1999; Koenig et al. 2005; Sadler et al. 2011; Vallee et al. 1999; Vallee et al. 1997b).

Assessing PPI is a way to measure brain’s ability to filter irrelevant information.

In humans, disruption in PPI is associated with psychiatric disorders, including schizophrenia, autism, and bipolar disorder. Maternal stress can lead to both; it can lead to changes in PPI and to an increased likelihood of developing psychiatric disorders

(Koenig et al. 2005; Lehmann et al. 2000; Matrisciano et al. 2012). In this study, we observed that prenatal stress exposure leads to an increase in PPI response of adult female mice. Such PPI abnormalities can indicate alterations in brain function; in fact, similar increase in PPI has been reported in adult human females diagnosed with bipolar disorder

(Gogos et al. 2009).

5.5.2 Genotype

Mice lacking the 5-HT1AR appear to be more anxious than their WT and HET counterparts, as they tend to spend less time on the open arms of the elevated plus maze and in the protected stretch posture. Elevated anxiety-like phenotype of 5-HT1AR KO mice has been previously extensively described; 5-HT1AR KO animals consistently show increased anxiety-like behaviour (Heisler et al. 1998; Parks et al. 1998; Ramboz et al.

1998).

Our study also shows that female 5-HT1AR KO mice show a decreased freezing response to a tone in the fear conditioning test, indicating an impairment in fear memory.

While cued fear conditioning behaviour of 5-HT1AR KO mice has not been previously

171 described, alteration of fear-related behaviours, though generally in the direction of an increased fear response, have previously been reported (Gross et al. 2000; Klemenhagen et al. 2006; Parks et al. 1998).

Female KO mice show an increase in prepulse inhibition response. Previous studies of 5-HT1AR KO mice show no effect of genotype on PPI; however, C57BL/6J mice have not been previously examined in this regard (Dirks et al. 2001; Dulawa et al.

2000; Groenink et al. 2011). Nevertheless, pharmacological studies implicate 5-HT1AR in

PPI modulation (Nanry and Tilson 1989; Rigdon and Weatherspoon 1992; Sipes and

Geyer 1995). More specifically, activation of 5-HT1AR blocks or reduces PPI response, indicating an inhibitory role of this receptor in PPI response (Rigdon and Weatherspoon

1992; Sipes and Geyer 1995). Therefore, lack of 5-HT1AR could lead to enhanced PPI response, which is what we observe in 5-HT1AR KO mice.

5.5.3 Interaction

Our aim was to investigate whether the availability of the 5-HT1AR mediates the effects of maternal stress on adult mice. It appears that 5-HT1AR availability does not play a role in the effect of PS on activity levels and emotional memory in males, or PPI in females, as these effects of stress were observed in mice regardless of their genotype.

However, genotype did moderate the effects of stress on social behaviour of male mice and on activity levels in females.

In the 3-chamber social task, both, WT and HET mice, regardless of PS exposure, showed a preference for a social over an inanimate object, and for the novel over a familiar social stimulus. Similarly, KO animals not exposed to PS, showed a social

172 preference in these tasks, however, KO animals exposed to PS demonstrated no preference for a social object or a socially novel object. These results suggest that absence of 5-HT1ARs makes mice vulnerable to the effect of PS, and that full and partial availability of 5-HT1AR may protect against the effects of PS on social behaviour.

Among female mice that were not exposed to PS, KO mice travelled a significantly shorter distance and at slower speed during the open field test. This finding is in agreement with previous research that found that 5-HT1AR KO female mice show reduced exploratory activity (Ramboz et al. 1998). Interestingly, mice that were exposed to PS did not differ in their activity levels in the open field test. We, and others, have previously demonstrated that maternal stress can lead to hyperactivity in the offspring

(Bosch et al. 2006; Kiryanova et al. 2016a; Matrisciano et al. 2012; Stohr et al. 1998;

Vallee et al. 1997b). It is possible, that PS increased the inherently low activity levels of

KO female mice, normalizing them.

5.5.4 Limitations

One of the limitations of this study is common to all studies that use germ-line knockout models: the possibility that compensatory mechanisms can change the molecular and behavioural profile of the animal during development and across the lifespan. For example, 5-HT1AR KO mice bred on 129/Sv background appear to have more sensitive 1B autoreceptors (Boutrel et al. 2002; Ramboz et al. 1998). 5-HT1A and 5-

HT1B autoreceptors have a similar role in the negative feedback loop of regulating serotonin release. It is possible that increased activity of the 5-HT1B receptor can partially compensate for the loss of 5-HT1A receptor function. However, such compensation may

173 not have been present in our animals, as it is not seen in 5-HT1AR KO mice having a

C57BL/6 background (Bortolozzi et al. 2004). Which brings up the other limitation to our study. The behavioural and molecular phenotype resulting from 5-HT1AR KO could be manifested differently in different background strains. For example, while 5-HT1AR

KO animals on the C57BL/6J background exhibit elevated levels of 5-HT in cortex and hippocampus, these aren’t seen on other backgrounds (He et al. 2001; Parsons et al.

2001).

5.6 Conclusion

This study investigated behavioural alterations in adult 5-HT1AR KO and WT animals having been exposed to stress prenatally. Independent of genotype, prenatal stress resulted in a change in locomotor activity and fear memory in male mice and a change in prepulse inhibition in female animals. 5-HT1AR KO affected anxiety in male mice and fear memory and prepulse inhibition in female mice. Genotype moderated the effects of stress on social behaviour of male mice and on activity levels of females. These finding point toward a specific role for 5-HT1ARs in modulating the effects of prenatal stress.

174

Table 5.1. Behaviour of mouse dams. Observations were collapsed across seven days (P1-P7). Behaviours are represented as percent of total observations for each group. Behaviour Control Stress Statistics In-nest behaviour

Licking/grooming pups 8.28±1.53 8.04±1.01 t12 = 0.13, p = .898

Nursing 36.70±4.69 41.57±2.97 t12= 0.92, p = .377

Nest building 3.69±1.03 3.85±0.78 t12= 0.12, p = .903

Self-groom 2.15±1.09 2.92±0.86 t12= 0.55, p = .590

Out-of-nest behaviour

Eat or drink 22.73±3.71 21.04±1.28 t12= 0.48, p = .637

Self-groom 3.91±1.01 5.92±1.33 t12 =1.14, p = .278

Other 22.53±3.83 16.69±1.80 t12=1.50, p = .159

Note: All data is reported as mean (standard error of the mean).

175

Figure 5-1. Performance in the Open Field

Maternal stress led to an increase in activity of adult male offspring, as seen by increased distance (A), and speed (B) travelled in the open field test. In female offspring, KO animals travelled a shorter distance (C) with a slower speed (D), but only in offspring not exposed to maternal stress. *p < 0.05. # denotes significant main effect of stress p < 0.05.

All data are presented as mean ± SEM.

Male Female 35 ______# 40 * A Control C * 30 35 Control PS 30 25 25 PS 20 20 15 15 Distance (meters) Distance (meters) 10 10

5 5 0 0 WT HET KO WT HET KO Genotype Genotype

B 0.12 ______# D 0.14 * * 0.12 0.1 Control Control 0.1 0.08 PS PS 0.08 0.06 0.06 0.04 0.04 Speed (meters/second) Speed (meters/second) 0.02 0.02

0 0 WT HET KO WT HET KO Genotype Genotype

176

Figure 5-2. Performance in the Elevated Plus Maze

Maternal exposure to stress increased the number of arm crosses in the male offspring

(A). Compared to WT and HET, KO male offspring tended to spend less time performing protected stretch and on the open arms of the elevated plus apparatus, indicating a trend to increased anxiety-like behaviour (B). *p < 0.05 or p as indicated. All data are presented as mean ± SEM

177

Figure 5-3. Performance in the Three-Chamber Social Task

In male offspring, all but KO mice exposed to prenatal stress showed a preference for the social stimulus (the wire mesh enclosure containing a novel mouse vs. an empty wire mesh enclosure) (A) and for the novel social stimulus (wire mesh enclosure containing a novel mouse vs. an enclosure containing a familiar mouse) (B). In female offspring, all mice showed a statistically significant preference for the for the wire mesh enclosure containing a novel mouse vs. an empty wire mesh enclosure except for the CON mice exposed to PS, who tended to show same preference. * denotes significant difference between each group and a baseline of 50%, p < .0083 - 0.05 as per Holm’s sequential

Bonferroni method; +p = 0.053. All data are presented as mean ± SEM

178

80 A * * * * * Control 75 PS 70 65 Male 60 Stimulus(%) 55 Preference SocialPreference a for 50 WT HET KO Genotype B 75 * * * * * Control 70 PS 65 Male 60

Stimulus(%) 55

Preference Novel SocialPreference a for WT HET KO Genotype

C 75 * + * * * * Control 70 PS

60 (%) Female 55

50 WT HET KO Preference Stimulus SocialPreference a for Genotype

179

Figure 5-4. Prepulse Inhibition

In female offspring, mice exposed to prenatal stress had a significantly higher prepulse inhibition than mice not exposed to prenatal stress. Furthermore, KO mice had higher prepulse inhibition than WT mice. *p < 0.05. # denotes significant main effect of stress p

< 0.05. All data are presented as mean ± SEM.

180

Figure 5-5. Cued Fear Conditioning

Male mice exposed to prenatal stress show enhanced freezing response to a cue in the

Fear Conditioning test (A). Female KO animals show decreased freezing response to a cue in the Fear Conditioning test compared to WT mice (B). *p < 0.05. # denotes significant main effect of stress p < 0.05. All data are presented as mean ± SEM.

181

Molecular alterations

6.1 Introduction

In the previous chapters (Chapters 2-4), we demonstrated that maternal exposure to stress (PS) and fluoxetine (Flx) have long-term effects on the behavioural outcomes of their offspring. In this chapter, we will examine the integrity of the offspring’s endocannabinoid (eCB) and serotonergic systems. Both stress and Flx appear to affect the serotonergic and the eCB system. Stress and Flx have acute effects on adult animals and immediate and persistent effects when the exposure occurs during early development.

Therefore, it is possible that changes in the eCB and the serotonergic systems contribute to the long-lasting behavioural effects of PS and Flx.

In adult animals, there is a close interaction between the stress response and the serotonergic system. An increase in synthesis and release of serotonin, and an increase in the activity of the serotonin-producing dorsal raphe nuclei neurons both occur in response to stress. Stress has a particularly pronounced effect on the expression of serotonin 1A receptors (5-HT1A R), with suppression of 5-HT1A R mRNA and protein levels, leading to desensitization of the 5-HT1A R (Lanfumey et al. 2008; Lopez et al. 1998; Mendelson and

McEwen 1991).

The serotonergic system of the developing brain is vulnerable to the effects of early stress. Maternal stress increases serotonin levels in the brain of fetal and neonatal rats (Peters 1982; 1990). In the brain of adolescent and adult rats exposed to PS, serotonin levels are also altered; a decrease of serotonin levels in the hippocampus

(Hayashi et al. 1998) and an increase in hypothalamus has been reported (Peters 1982).

Furthermore, a sex-dependent decrease in the 5-HT1A R binding in the ventral

182 hippocampus of adolescent male rats exposed to PS has been observed (Van den Hove et al. 2006). Reduced serotonin turnover in multiple brain regions was also reported in adolescent and adult offspring following maternal exposure to synthetic glucocorticoids

(a model of PS)(Muneoka et al. 1997).

As discussed in Chapter 1, Section 1.1.3, regulation of the hypothalamic-pituitary- adrenal (HPA) axis is one of the roles of the eCB system (for a review see Hill and

McEwen 2010; Hill and Tasker 2012). Repeated activation of the HPA axis by chronic stress can lead to persistent alterations of the eCB system in adolescent and adult animals.

Chronic stress leads to downregulation of CB1 receptors and reduced 2-AG levels (Hill et al. 2005; Wamsteeker et al. 2010), and enhancing cannabinoid transmission reverses biochemical and behavioural effects of chronic stress (Bortolato et al. 2007; Hill et al.

2005).

Early life stress can also affect the eCB system, and changes can persevere after the discontinuation of stress. For example, PS leads to a long-lasting downregulation of cannabinoid receptor type 1 (CB1) (Llorente-Berzal et al. 2012; Lopez-Gallardo et al.

2012; Suarez et al. 2009), and an increase in CB2 receptor expression in the hippocampus

(Suarez et al. 2009); some of these changes are sex-dependent (Lopez-Gallardo et al.

2012; Suarez et al. 2009). Also, exposure to PS has been found to alter the HPA axis function, a change that could be caused by alterations of the eCB system (Dugovic et al.

1999; Koenig et al. 2005; Vallee et al. 1999; Vallee et al. 1997b)

Exposure to SSRIs in adulthood was also shown to affect the eCB system. SSRIs can alter CB1 receptor expression in the brain (Koethe et al. 2007), and chronic administration of Flx in particular, can increase CB1 receptor density (Hill et al. 2008)

183 and enhance the ability of CB1 receptors to couple with specific G protein subunits, altering the receptor’s signal transduction ability (Mato et al. 2010). Chronic Flx administration can also increase eCB levels in basolateral amygdala and the hippocampus

(Gunduz-Cinar et al. 2016). In fact, eCB are thought to take part in antidepressant effects of Flx, as blocking the CB1 receptor prevents the antidepressant effects of Flx administration (Umathe et al. 2011). At this time, the effects of perinatal exposure to

SSRIs on the eCB system function have not yet been studied.

In this experiment, the integrity of the serotonergic system will be evaluated by examining expression of the serotonin transporter and serotonin 1A receptor genes. The integrity of the eCB system will be examined by measuring the expression of cannabinoid receptor 1 (CB1) and enzymes that degrade eCBs: fatty acid amide hydrolase (FAAH) and monoacylglycerol lipase (MAG lipase). Furthermore, levels of eCBs anandamide and 2-AG will be measured. As stress is known to alter the availability of the MR and GR receptors and the overall function of the HPA system (Froger et al.

2004; Lopez et al. 1998), gene expression of MR and GR, adrenal and thalamus weights, and CORT blood levels will also be examined.

We predict that biochemical outcomes will mirror our behavioural findings

(Chapter 2 and 3): PS and Flx exposure will have a number of independent effects on the serotonergic and the eCB system, but Flx will reverse some of the effects of PS.

Furthermore, we hypothesize that any molecular changes will be less pronounced in females than in males.

184

6.2 Methods

6.2.1 Animals

For animal husbandry and the breeding protocol please see Chapter 2 section

2.2.1.

Pregnant dams were randomly assigned into one of four treatment groups: (I) untreated (CON; n=6); (II), chronic unpredictable stress (PS; n=6); (III), Flx (FLX; n=5);

(IV) PS and Flx (PS+FLX; n=6).

One day following parturition litters were culled to 8 pups (pups that were culled were picked randomly). Litters were housed together with their mother until weaning at

P21. At P21, litters were housed with same sex littermates in groups of 3-5. Final groups consisted of 8 to 9 animals per group for the eCB measures and 3 animals per group for the gene expression measures. No more than 2 male or female animals per litter were used in the same molecular analysis.

6.2.2 Chronic Unpredictable Stress Paradigm and Drug Treatment

The stress paradigm and the drug treatment were exactly as described, previously, in Chapter 2 sections 2.2.2 and 2.2.3

6.2.3 Measurement of mRNA and Endocannabinoid Levels

6.2.3.1 Sample collection for qPCR.

Mouse brains were collected at P70-80 (N=24; 3 mice per group, no more than one male and one female mice per litter was used). Animals were euthanized by cervical dislocation. The brain was removed, cortical structures (cortex and hippocampus) were peeled away from the thalamus, and hippocampal structures were peeled away from the rest of the cortex. The hippocampus was bisected in the middle to subdivide it into the

185 dorsal and ventral hippocampus. The medial prefrontal cortex (mPFC) was dissected out of the rostral 1.5 mm of the brain; mPFC included prelimbic, infralimbic, and anterior cingulate cortex. The dissected amygdala region also included parts of the adjacent piriform cortex. The hypothalamus was dissected from the subcortical portion. The five resulting brain areas that were separately frozen on dry ice and stored at −80 °C before analysis were: mPFC, dorsal hippocampus (DHPC), ventral hippocampus (VHPC), amygdala, and hypothalamus (HL).

6.2.3.2 Tissue processing for mRNA isolation and cDNA synthesis

mRNA was isolated using the RNeasy Plus Universal Mini kit (Qiagen, Toronto,

ON, Canada) according to the manufacturer’s protocols. Tissue samples were placed in

1ml QIAzol lysis reagent (Quiagen) and homogenized for 5 min at 50 Hz using 5 mm steel beads (Qiagen) with a TissueLyser LT homogenizer (Qiagen). Samples were then centrifuged at 12,000 g for 15 min at 4°C and lysate was transferred into gDNA tubes.

Ethanol was added to the lysate and the samples were centrifuged to collect RNA on the spin column membrane. The membrane was washed with 700 µL RW1 buffer once and

500 µL RPE buffer twice, and centrifuged at each step at 8,000 g for 15s. RNA was than eluted in 50 µL of RNase-free water. A260/A280 ratio was used to measure mRNA concentration and purity in a Nanodrop spectrophotometer (Thermo Fisher Scientific,

Waltham, MA, United States). A260/A280 ratio indicated high RNA purity of all samples

(value of the ratio between 1.87 and 2.13). Samples were frozen at −80°C.

To synthesize cDNA, QuantiTect Reverse Transcription Kit (Qiagen, Toronto,

ON, Canada) was used according to manufacturer’s protocols. DNA Wipeout Buffer incubation was used to remove genomic DNA contamination. RTbuffer (4 µL), RT

186

primer mix (1 µL), and RT enzyme (1 µL) were added to each tube and incubated.

Samples were diluted in nuclease-free H2O to a final concentration of 10 ng/µL and

stored at −20°C.

6.2.3.3 SyberGreen real-time PCR

Pre-validated PrimeTime assay primers were acquired from Integrated DNA

Technologies (Coralville, Iowa, USA). Quantitative PCR (qPCR) was performed using

the KAPA SYBR FAST Universal 2X qPCR Master Mix (D-MARK Biosciences,

Toronto, Ontario, Canada) on a Rotor-Gene Q (Qiagen), according to manufacturer’s

instructions. Each primer was analyzed in a serially diluted standard curve to assess

proper reaction conditions and to check for primer reaction efficiency. Primers were 92-

108% efficient. For a list of primer sequences, see below

Gene Protein Forward primer 5′-3′ Reverse primer 5′-3′

Name

HTR1A 5-HT1A, receptor CTTTTGCTCCTTACCTCCTCTAC ACTCACCTCTCACAGTATCCA

SLC6a4 serotonin transporter CATTGGCTATGCCGTGGAC ATGGCCATGATGGTGTAAGG

Cnr1 CB1 receptor ACA GGT GCC GAG GGA GCT TC GCA AGG CCG TCT AAG ATC GAC

FAAH fatty acid amide hydrolase GATAGGAGGTCACACAGTTGG CTGGTACAGAAGTTACAGAGTGG

MGLL monoacylglycerol lipase ATGATTCCAGCAGGTAGG TGTCCTGCCAAATATGACCTT

NR3C2 mineralocorticoid receptor AGTCATTTCTTCCAGCACACA GATCCTCAAGACCTTCCAAGA

NR3C1 glucocorticoid receptor AGGAGAACTCACATCTGGTCT AACTGGAATAGGTGCCAAGG

ACTB beta actin GTACGACCAGAGGCATACAG CTGAACCCTAAGGCCAACC

All samples were assayed in triplicate, with each well containing 2XKappaSYBR

(10 µL), primer (1 µL), template cDNA (1 µL), and nuclease-free H2O (8 µL). All qPCR

187 assays were assayed using the following specifications: 1 min at 90°C, 40 cycles of 95°C for 5 sec and 55°C (or 64.1°C for SLC primers) for 30 sec followed by a dissociation curve analysis. Each assay contained a sample from the CON, FLX, PS, and PS+FLX groups. The Ct value was assessed for each well and the value was averaged across replicated samples.

6.2.3.4 Sample collection and endocannabinoid quantification.

Mouse brains were collected at P70-80 (N=68; 8 or 9 per group; no more than 2 mice per litter). Animals were euthanized by cervical dislocation. Dissection was conducted same as described above (section 6.2.3.1), except that the hippocampus was not bisected. The four resulting brain areas were separately frozen on dry ice, stored at

−80 °C, and later analyzed: i. mPFC, ii. hippocampus iii. amygdala, and iiii hypothalamus. The lipid extraction process and the anandaminde (AEA) and 2-

Arachidonoylglycerol (2-AG) liquid chromatography mass spectrometry analysis were performed as previously described (Dincheva et al. 2015).

6.2.3.5 CORT measurement; adrenal glands and thymus collection

Trunk blood was collected immediately following cervical dislocation described above (Male: N=47: 8 CON, 8 FLX, 15 PS, 10 PS+FLX; Female: N=41: 9 CON, 9 FLX,

11 PS, 12 PS+FLX). If more than one animal was used per cage, CORT was only collected from animals removed from the cage first (animals were removed from the cage in random order). The adrenal glands and thymus were dissected and weighed immediately following the blood collection. Blood samples were centrifuged for 20 min

(at 10,000 rpm at 4°C) and stored at -20°C. ELISA CORT kit (Cayman Chemical,

188

#500655) was used for sample analysis. Assay detection limit was 30 pg/ml at 80% binding. All samples were tested in duplicate.

6.3 Data Analysis

Relative Expression Software Tool (REST) version 1.9.12 software with 50000 randomizations was used to calculate fold enrichment and p-values for gene expression analysis (Pfaffl et al. 2002). The expression of beta actin was used as the normalizing gene. Tests that involved a single measurement (i.e., AEA and 2-AG) were analyzed using a two-way (fluoxetine x stress) factorial analysis of variance (ANOVA). All statistics were two-tailed. Values of p < 0.05 were considered significant. All data and all figures are reported as means ± standard error of the mean (SEM).

6.4 Results

6.4.1 Effect of Treatment on Gene Expression Levels

Flx treatment led to an upregulation of MGLL in mPFC (p < .001) and DHPC (p =

.024) of male mice, and downregulation of FAAH in amygdala (p < .001) and NR3C2 in mPFC of females (p < .001).

PS led to SLC6A4 downregulation in the mPFC (p < .001) and VHPC (p = .036) and upregulation in the hypothalamus of male mice (p < .001).

The combination of PS and Flx treatment lead to FAAH upregulation in DHPC of male mice (p = .024) and FAAH downregulation in VHPC (p =.036) and amygdala (p <

.001) of females.

All 3 treatments lead to NR3C2 upregulation in VHPC of males (.016 ≤ p < .001) and HTR1A downregulation in VHPC of female mice (.022 ≤ p < .001) (see Figures 1-7).

189

Gene Name Avg. Cycles to detection +/- SEM

HTR1A 24.2 +/- 0.08 SLC6a4 35.58 +/- 0.11 Cnr1 23.46 +/- 0.09

FAAH 24.16 +/- 0.08

MGLL 22.10 +/- 0.22 NR3C2 23.31 +/- 0.15

NR3C1 22.64 +/- 0.09 ACTB 18.01 +/- 0.09

6.4.2 Effect of Treatment on Endocannabinoid Levels

6.4.2.1 AEA

AEA levels were increased in the mPFC of female mice exposed to stress F(1, 28)

= 12.61, p = .001; no stress = 5.00 +/- .70 pmol/g; PS= 8.53 +/- .71 pmol/g; Fig. 8)

There was a statistical trend to increased AEA levels in the AMY of female mice exposed to prenatal stress F(1, 28) = 3.99, p = .055; no prenatal stress = 7.95 +/- 3.19 pmol/g; PS= 16.96 +/- 3.19 pmol/g; Fig. 9)

There was no effect of PS, Flx treatment, nor an interaction of the two, on AEA levels in the mPFC or the AMY of male mice (.237£ p £ .938).

6.4.2.2 2-AG

2-AG levels were increased in the AMY of male mice exposed to fluoxetine F(1,

28) = 4.30, p = .047; no fluoxetine= 8.85 +/- .59 nmol/g; FLX= 10.61 +/- .59 nmol/g; Fig.

10).

190

2-AG levels were increased in the mPFC of female mice exposed to prenatal stress F(1, 28) = 10.53, p = .003; no prenatal stress = 4.48 +/- .36 nmol/g; PS= 6.16 +/- .37 nmol/g; Fig. 11).

There was a stress by Flx interaction in AMY levels of 2-AG in female mice (F(1,

28) = 6.48, p = .017). In mice not exposed to stress, Flx did not affect 2-AG levels (p =

.608); however, in those exposed to stress, Flx increased 2-AG levels (p < .001; PS:

7.33±0.56 nmol/g; PS+FLX: 9.83±0.64 nmol/g; Fig. 12).

6.4.3 Effect of Treatment on Levels of CORT and on Thymus and Adrenal Weights.

Male mice exposed to prenatal stress (41.65±5.10 ng/ml) had higher CORT levels than those not exposed to prenatal stress (23.65±4.98 ng/ml; F(1, 37) = 6.52, p = .015; Fig.

13). Adrenal and thalamus weight of male mice was not significantly affected by Flx or

PS exposure (.391£ p £ .992).

There was no effect of PS, Flx treatment, nor an interaction of the two, on baseline CORT levels, adrenal and thalamus weight of female mice (.241£ p £ .976).

6.5 Discussion

In this chapter, we report that all treatments had an effect on the serotonergic, the eCB systems, and on glucocorticoid receptor expression in the offspring, but only maternal stress affected CORT blood levels. We also observed that the sex of the offspring influenced the type of molecular changes observed.

6.5.1 The Serotonergic System

6.5.1.1 Effects of prenatal stress

Studies show that early-life stress can affect the serotonergic system of the developing brain, altering serotonergic levels and 5-HT1A R expression (Peters 1982;

191

1990) (Hayashi et al. 1998; Peters 1982; Van den Hove et al. 2006). In our study, we observe that 5-HT1A R gene expression was reduced in the VHPC of female mice exposed to PS. Similarly, a decrease in 5-HT1A R binding in the VHPC has been reported in 4- week old rats exposed to PS (Van den Hove et al. 2006). A decrease in expression and a decrease in binding may indicate 5-HT1A R impairment. In the VHPC, one of the roles of serotonin is to regulate emotional behaviour, including anxiety; decreased serotonergic function in VHPC is linked with increased anxiety-like behaviour (Schwarting et al.

1998). Decreased 5-HT1A R receptor activity in the VHPC could contribute to a change in emotional regulation following PS; increased anxiety is a frequently reported finding following gestational stress exposure (Bosch et al. 2006; Miyagawa et al. 2011; Morley-

Fletcher et al. 2011; Vallee et al. 1997b; Zimmerberg and Blaskey 1998).

In the hippocampus, in addition to emotional behaviour regulation, serotonin also regulates neurogenesis; there is a positive correlation between hippocampal neurogenesis and 5-HT1A R activity (Gould 1999). The decrease in 5-HT1A R expression observed in our study could play a role in prenatal stress-induced impairment in hippocampal neurogenesis reported by other research groups (Morley-Fletcher et al. 2011).

In our study, maternal exposure to PS led to SLC6A4 downregulation in the mPFC and VHPC, and SLC6A4 upregulation in the HL of male animals. SLC6A4 is a gene that encodes the protein for the 5-HT transporter (SERT), a plasma membrane protein that removes 5-HT from the synaptic space and transports it back to the presynaptic terminal

(Hariri and Holmes 2006). SERT changes in the mPFC, VHPC, and HL could lead to alteration in synaptic and tissue serotonin levels in these areas, particularly an increase in serotonin in the PFC and the VHPC, and its decrease in the HL. Interestingly, previous

192 research into long-term effects of prenatal stress shows the exact opposite change in serotonin levels in the HPC and the HL: a decrease of serotonin levels in the HPC was reported by Hayashi (Hayashi et al. 1998) and an increase in serotonin levels in the HL was reported by Peters (Peters 1982). However, such disparity between what is predicted by SLC6A4 mRNA changes observed in our study and previous reports of actual serotonin levels may be due to an inaccurate assumption about the effect of SERT on serotonin levels. The effect that SERT has on serotonin levels depends on the timing and the duration of change in SERT activity. In fact, life-long impairment in serotonin reuptake in adult SERT KO mice leads not to an increase in serotonin, but to a decrease in serotonin concentration in the brain (Bengel et al. 1998; Kim et al. 2005). Therefore, in our experiment, we could anticipate that a decrease in SERT activity, if present since early development, may decrease serotonin levels. Therefore, a long-term alteration in

SERT activity may, in fact, decrease mPFC and VHPC serotonin levels, while increasing them in the HL. If that is the case, then our findings align with earlier observations by

Hayashi (Hayashi et al. 1998) and Peters (Peters 1982). An examination of serotonin levels in brains of adult offspring exposed to stress prenatally is needed. Furthermore, an examination of the SERT protein in these areas are essential, as mRNA levels are (and are expected to be) low, because SERT protein is synthesized in the cell body.

As we described earlier, maternal exposure to PS led to SLC6A4 changes in the mPFC, VHPC, and the HL of male animals. Taking into account the roles these brain areas play in behaviour, including their role in the regulation of anxiety, social behaviour, and cognition (Davis 1992; Falkner et al. 2016; Kolb 1984; McGaugh 2000; for a review see Roozendaal et al. 2009), alterations in serotonin system function in these areas could

193 be tied to some of the behavioural changes previously observed in mice and rats exposed to PS, including changes in anxiety (Bosch et al. 2006; Miyagawa et al. 2011; Morley-

Fletcher et al. 2011; Vallee et al. 1997b; Zimmerberg and Blaskey 1998), object recognition (Behan et al. 2011), and social behaviour (Matrisciano et al. 2012). However, further studies are needed to explore this relationship.

6.5.1.2 Effects of perinatal fluoxetine

Perinatal exposure to Flx did not affect SLC6A4 expression in either male or female mice. This finding is surprising, because the Flx directly acts on SERT and could permanently alter SERT function. However, this finding is in agreement with reports in the existent literature that reports that while SERT density is decreased in adolescent rats exposed to Flx prenatally, outside of raphe nuclei, this difference disappears by the time animals reach adulthood (Cabrera-Vera and Battaglia 1998; Cabrera-Vera et al. 1997;

Capello et al. 2011; Forcelli and Heinrichs 2008).

Our study demonstrates that, similarly to PS, exposure to Flx reduced the levels of

5-HT1A R mRNA in VHPC. 5-HT1A R mRNA expression has not previously been measured in the VHPC following maternal exposure to Flx. As discussed above, one of the roles of serotonin in the VHPC is to regulate emotional behaviour, including anxiety

(Schwarting et al. 1998). Therefore, reduced 5-HT1A R mRNA expression in the VHPC may be linked to the anxiety behaviour alterations observed following perinatal Flx exposure. Anxiety behaviour has been thoroughly studied in adolescent and adult animals exposed to Flx perinatally. Despite these findings, there is no agreement in the literature on the effect of perinatal Flx exposure on anxiety levels later in life, as both an increase

194

(Ansorge et al. 2008; Ansorge et al. 2004; Noorlander et al. 2008; Olivier et al. 2011a;

Rebello et al. 2014; Smit-Rigter et al. 2012) and a decrease in anxiety have been reported

(Francis-Oliveira et al. 2013; Kiryanova and Dyck 2014; McAllister et al. 2012).

Therefore, the relationship between 5-HT1AR mRNA expression and anxiety alternations needs to be further examined.

6.5.2 The Endocannabinoid System

6.5.2.1 Effects of prenatal stress

The comparison of our findings regarding the eCB system to those in the literature proves challenging, as the effects of PS and perinatal Flx exposure on the eCB system have not been widely studied.

In male mice, we did not observe an effect of PS on endocannabinoid levels, cannabinoid receptor 1 expression or the expression of enzymes that degrade eCBs.

Several studies that examine the effect of early post-natal stress reported a long-lasting downregulation of cannabinoid receptor type 1 (CB1) following exposure to early-life stress (Llorente-Berzal et al. 2012; Lopez-Gallardo et al. 2012; Suarez et al. 2009).

However, these studies used a very different early stress model – a one-time, 24-hour maternal separation delivered on P9. The state of the eCB system in offspring exposed to prenatal maternal stress has not been previously described.

In females, PS enhanced AEA levels in the PFC and the amygdala. The effects of prenatal or adult exposure to chronic stress on the function of the eCB system has not been previously examined in female mice or rats.

195

6.5.2.2 Effects of perinatal fluoxetine

This study found an increase of 2-AG levels in the amygdala of male mice perinatally exposed to Flx. No studies have yet examined the effects of prenatal Flx exposure on eCB function; however, a study of chronic Flx administration in adult rats showed an upregulation of AEA in the amygdala (Gunduz-Cinar et al. 2016). AEA and 2-

AG have different effects on amygdala function, particularly on amygdala response to stress; AEA maintains amygdala tone, while 2-AG helps restore the amygdala to baseline following a stress response. Therefore, adult and perinatal chronic exposure to Flx may have differential effects on stress response: adult administration may increase stress threshold, while perinatal Flx exposure may promote stress-recovery.

In male mice, maternal exposure to Flx also led to an upregulation of MGLL in the mPFC and DHPC. MGLL encodes a MAG lipase protein, a key enzyme in the hydrolysis of 2-AG. Therefore, an upregulation of MAG lipase can lead to a decrease of

2-AG levels in the PFC and DHPC. However, we observe no change in 2-AG levels in the mPFC. Previous studies of adult Flx exposure report no changes in PFC 2-AG levels and either an upregulation or no change in 2-AG in the HPC (Gunduz-Cinar et al. 2016;

Hill et al. 2008). Therefore, it may be the case in our study that MGLL upregulation does not result in the upregulation of MAG lipase protein, however, it could also signify a change in 2-AG metabolism.

In females, perinatal Flx exposure caused downregulation in FAAH expression in the amygdala. FAAH is a gene that encodes for an AEA catabolic enzyme. Despite such

196 downregulation, AEA levels in the amygdala were not affected. The effect of prenatal or adult Flx exposure on eCB system in females has not been previously examined.

6.5.3 The Glucocorticoid System

In males, PS, FLX, and PS+FLX treatment lead to an upregulation of NR3C2

(encodes MR), without an effect on GR expression in the VHPC. In the HPC, MR mediates rapid stress-response feedback (Karst et al. 2005) and plays a role in memory formation (Diamond et al. 1992). Unlike in this study, previous studies show a decrease in MR receptor in the hippocampus of adult male rats exposed to prenatal stress; however, a more severe stressor and a shorter time-frame of stress exposure was utilized

(Barbazanges et al. 1996; Henry et al. 1994; Maccari et al. 1995).

In our study, Flx treatment downregulated NR3C2 expression in the mPFC of female mice. The loss of MR gene activity in mouse forebrain leads to spatial and working memory deficiency (Berger et al. 2006); however, such impairments are not observed in female mice perinatally exposed to Flx (McAllister et al. 2012).

We report an increase in basal plasma CORT levels in male mice exposed to prenatal stress. An increase in basal plasma CORT levels has also been documented in male mice and rats as a consequence of chronic stress exposure in adolescence (Lepsch et al. 2005) and adulthood (Araujo et al. 2003; Grippo et al. 2005), suggesting that there may be some residual effects of prenatal stress in mice which mirror the effects of chronic stress at an older age. Such change in the basal CORT level may indicate a disruption of the negative feedback loop of circulating glucocorticoids.

197

6.5.4 The combination of Perinatal Stress and Fluoxetine Exposure: Effects on Serotonergic, Endocannabinoid, and Glucocorticoid Systems

No study has previously examined the combined effects of perinatal exposure to

PS and Flx on serotonergic and eCB system function and GR and MR receptor expression of adult mice. We showed that male and female animals exposed to PS+FLX exhibited no alterations in 5-HT1A or SERT mRNA levels. They also did not have alterations in GR or MR expression or CORT levels, indicating no alterations of the glucocorticoid system function. However, the endocannabinoid system was altered in mice exposed to PS+FLX. In male mice, DHPC FAAH expression was upregulated, while in female mice, FAAH was upregulated in the VHPC and the amygdala. While male mice showed no change in AEA or 2-AG levels, in females, 2-AG levels were increased in all areas measured: the mPFC and the amygdala. More research is needed to examine whether such eCB system changes serve as a foundation for the ability of Flx to reverse some of the alterations caused by prenatal maternal stress, including depression- like and anxiety-like behaviours in adolescent (Ordian et al. 2010b; Rayen et al. 2011) and adult rats (Boulle et al. 2016), post-operative pain sensitivity (Knaepen et al. 2013), and alterations in hippocampal morphology and neurogenesis (Ishiwata et al. 2005;

Rayen et al. 2015; Rayen et al. 2011).

6.5.5 Review of the Hypothesis

Our hypothesis that stress and Flx will affect serotonergic and eCB systems was supported. However, different from our predictions, Flx administration to stressed dams did not normalize changes caused by PS in their offspring. Furthermore, these effects were not less pronounced in females; on the contrary, the eCB system of females was

198 more strongly affected. This study supported our conjecture that perinatally stressed animals may be in a state of chronic stress, as their CORT levels were chronically elevated.

6.6 Conclusion

This study demonstrates that serotonergic, the eCB, and the glucocorticoid systems are altered following exposure to perinatal stress and Flx. These alterations are long-lasting and sex-specific. Alterations in these systems are likely linked to behavioural changes observed in adult animals exposed to PS and Flx during early development.

Furthermore, the eCB system may moderate the effects of early-life exposure to Flx and

PS on the outcomes of male and female mice in adulthood. This study demonstrates a need for a more thorough examination of the eCB system in animals exposed to PS and

Flx during development, and for the exploration of potential therapeutic and protective effects of CBs against the effects of maternal stress.

199

Figure 6-1. Serotonin 1A Receptor mRNA Levels

The expression of serotonin 1A receptor (5-HT1A R) gene in the prefrontal cortex

(mPFC), dorsal hippocampus (DHPC), ventral hippocampus (VHPC), amygdala (Amy),

and hypothalamus (HL) of male and female mice exposed to stress (PS), fluoxetine

(FLX) and combination of stress and fluoxetine (PS+FLX) during development. Data

represent means obtained from 3 animals in each group. Asterix * denotes a significant (p

< 0.05) change in gene expression relative to control mice (denoted by a blue dashed

line). All data are presented as mean ± SE.

1.6 FLX PS 1.4 PS+FLX

1.2

0.8 * * *

0.6

0.4

0.2 Fold Change Relative to Control Mice to RelativeFold Control Change 0 mPFC DHPC VHPC Amy HL mPFC DHPC VHPC Amy HL Male Female

200

Figure 6-2. Levels of SERT mRNA

The expression of serotonin transporter (SLC6A4) gene in the prefrontal cortex (mPFC),

dorsal hippocampus (DHPC), ventral hippocampus (VHPC), amygdala (Amy), and

hypothalamus (HL) of male and female mice exposed to stress (PS), fluoxetine (FLX)

and combination of stress and fluoxetine (PS+FLX) during development. Data represent

means obtained from 3 animals in each group. Asterix * denotes a significant (p < 0.05)

change in gene expression relative to control mice (denoted by a blue dashed line). All

data are presented as mean ± SE

FLX 6 PS PS+FLX 5

1 Fold Change Relative to Control Mice to RelativeFold Control Change 0 mPFC DHPC VHPC Amy HL mPFC DHPC VHPC Amy HL Male Female

201

Figure 6-3. Levels of Cannabinoid Receptor 1 mRNA

The expression of cannabinoid receptor 1 (CNR1) gene in the prefrontal cortex (mPFC),

dorsal hippocampus (DHPC), ventral hippocampus (VHPC), amygdala (Amy), and

hypothalamus (HL) of male and female mice exposed to stress (PS), fluoxetine (FLX)

and combination of stress and fluoxetine (PS+FLX) during development. Data represent

means obtained from 3 animals in each group. Asterix * denotes a significant (p < 0.05)

change in gene expression relative to control mice (denoted by a blue dashed line). All

data are presented as mean ± SE.

FLX 3.5 PS PS+FLX 3

2.5

1.5

0.5

Fold Change Relative to Control Mice to RelativeFold Control Change 0 mPFC DHPC VHPC Amy HL mPFC DHPC VHPC Amy HL Male Female

202

Figure 6-4. Levels of Monoglyceride Lipase mRNA

The expression of monoglyceride lipase (MGLL) gene in the prefrontal cortex (mPFC),

dorsal hippocampus (DHPC), ventral hippocampus (VHPC), amygdala (Amy), and

hypothalamus (HL) of male and female mice exposed to stress (PS), fluoxetine (FLX)

and combination of stress and fluoxetine (PS+FLX) during development. Data represent

means obtained from 3 animals in each group. Asterix * denotes a significant (p < 0.05)

change in gene expression relative to control mice (denoted by a blue dashed line). All

data are presented as mean ± SE.

FLX 20 PS PS+FLX 18

2 Fold Change Relative to Control Mice to RelativeFold Control Change

0 mPFC DHPC VHPC Amy HL mPFC DHPC VHPC Amy HL Male Female

203

Figure 6-5. Levels of Fatty Acid Amide Hydrolase mRNA

The expression of fatty acid amide hydrolase (FAAH) gene in the prefrontal cortex

(mPFC), dorsal hippocampus (DHPC), ventral hippocampus (VHPC), amygdala (Amy),

and hypothalamus (HL) of male and female mice exposed to stress (PS), fluoxetine

(FLX) and combination of stress and fluoxetine (PS+FLX) during development. Data

represent means obtained from 3 animals in each group. Asterix * denotes a significant (p

< 0.05) change in gene expression relative to control mice (denoted by a blue dashed

line). All data are presented as mean ± SE.

2 FLX 1.8 PS 1.6 PS+FLX 1.4

1.2

0.8

0.6

0.4

0.2 Fold Change Relative to Control Mice to RelativeFold Control Change 0 mPFC DHPC VHPC Amy HL mPFC DHPC VHPC Amy HL Male Female

204

Figure 6-6. Levels of Nuclear Receptor Subfamily 3 Group C Member 1 mRNA

The expression of nuclear receptor subfamily 3 group c member 1 (NR3C1) gene in the

prefrontal cortex (mPFC), dorsal hippocampus (DHPC), ventral hippocampus (VHPC),

amygdala (Amy), and hypothalamus (HL) of male and female mice exposed to stress

(PS), fluoxetine (FLX) and combination of stress and fluoxetine (PS+FLX) during

development. Data represent means obtained from 3 animals in each group. Asterix *

denotes a significant (p < 0.05) change in gene expression relative to control mice

(denoted by a blue dashed line) All data are presented as mean ± SE.

FLX 2.5 PS PS+FLX 2

1.5

0.5 Fold Change Relative to Control Mice to RelativeFold Control Change 0 mPFC DHPC VHPC Amy HL mPFC DHPC VHPC Amy HL Male Female

205

Figure 6-7. Levels of Nuclear Receptor Subfamily 3 Group C Member 2

mRNA

The expression of nuclear receptor subfamily 3 group c member 2 (NR3C2) gene in the

prefrontal cortex (mPFC), dorsal hippocampus (DHPC), ventral hippocampus (VHPC),

amygdala (Amy), and hypothalamus (HL) of male and female mice exposed to stress

(PS), fluoxetine (FLX) and combination of stress and fluoxetine (PS+FLX) during

development. Data represent means obtained from 3 animals in each group. Asterix *

denotes a significant (p < 0.05) change in gene expression relative to control mice

(denoted by a blue dashed line) All data are presented as mean ± SE.

FLX 2.5 PS PS+FLX 2

1.5 * * *

0.5 Fold Change Relative to Control Mice to RelativeFold Control Change 0 mPFC DHPC VHPC Amy HL mPFC DHPC VHPC Amy HL Male Female

206

Figure 6-8. Anandamide Levels in the medial Prefrontal Cortex of Female Mice

Anandamide (AEA) levels in the medial prefrontal cortex of female mice exposed to

fluoxetine (Flx) and not exposed to fluoxetine (no Flx), and exposed to stress (stress) and

not exposed to stress (no stress) during early development. Asterix * denotes a significant

(p < 0.05) difference (here, a main effect of stress). All data are presented as mean ±

SEM

12 * no Flx 10 Flx

4 AEA levels (pmol/g tissue) (pmol/glevels AEA

0 no stress stress

207

Figure 6-9. Anandamide Levels in the Amygdala of Female Mice

Anandamide (AEA) levels in the amygdala of female mice exposed to fluoxetine (Flx) and not exposed to fluoxetine (no Flx), and exposed to stress (stress) and not exposed to stress (no stress) during early development. All data are presented as mean ± SEM

25 p=0.055 no Flx Flx 20

10 AEA levels (pmol/g tissue) (pmol/glevels AEA 5

0 no stress stress

208

Figure 6-10. 2-Arachidonoylglycerol Levels in the Amygdala of Male Mice

Levels of 2-Arachidonoylglycerol (2-AG) in the amygdala of male mice exposed to fluoxetine (Flx) and not exposed to fluoxetine (no Flx), and exposed to stress (stress) and not exposed to stress (no stress) during early development. Asterix * denotes a significant

(p < 0.05) difference (a significant difference in mice exposed and not exposed to Flx).

All data are presented as mean ± SEM

14 *

no 12 stress

stress 10

6 AG levels (nmol/glevels tissue) AG -

2 4

0 no Flx Flx

209

Figure 6-11. 2-Arachidonoylglycerol Levels in the Medial Prefrontal Cortex of

Female Mice

Levels of 2-Arachidonoylglycerol (2-AG) in the medial prefrontal cortex of female mice exposed to fluoxetine (Flx) and not exposed to fluoxetine (no Flx), and exposed to stress

(stress) and not exposed to stress (no stress) during early development. Asterix * denotes a significant (p < 0.05) difference (a significant main effect of stress). All data are presented as mean ± SEM

8 * no Flx 7 Flx

3 AG levels (nmol/glevels tissue) AG - 2 2

0 no stress stress

210

Figure 6-12. 2-Arachidonoylglycerol Levels in the Amygdala of Female Mice

Levels of 2-Arachidonoylglycerol (2-AG) in the amygdala of female mice exposed to fluoxetine (Flx) and not exposed to fluoxetine (no Flx), and exposed to stress (stress) and not exposed to stress (no stress) during early development. Asterix * denotes a significant

(p < 0.05) difference (a significant difference in 2-AG concentration in mice not exposed and exposed to Flx, but only when these mice were also exposed to stress). All data are presented as mean ± SEM

* 16 no Flx

14 Flx

6 AG levels (nmol/glevels tissue) AG -

2 4

0 no stress stress

211

Figure 6-13. Basal Corticosterone Levels

Basal corticosterone (CORT) levels of male (A) and female (B) mice exposed to stress and fluoxetine during development. Asterix * denotes a significant (p < 0.05) difference

(a significant main effect of stress). All data are presented as mean ± SEM

70 A * no 60 Flx 50 Flx

20 CORT levels (ng/ml) levels (ng/ml) CORT 10

0 no stress stress

120 B no 100 Flx Flx 80

CORT levels (ng/ml) levels (ng/ml) CORT 20

0 no stress stress

212

General Discussion

7.1 Main Findings

The experiments conducted in this thesis explored and expanded upon our knowledge of the long-term behavioural outcomes and molecular underpinnings of exposure to prenatal (before birth) stress (PS) and perinatal (before and after birth) fluoxetine (Flx). In this thesis, we examined the behaviour of male and female mice and the biochemical integrity of the endocannabinoid (eCB) and serotonergic systems exposed to PS and Flx. With the use of the serotonin 1A receptor (5-HT1AR) knockout

(KO) mice, we further examined the role of the 5-HT1AR in the long-term effect of PS.

We showed that maternal exposure to stress and Flx had a number of sustained effects on the behaviour of adult male offspring. While perinatal exposure to Flx increased aggressive behaviour, PS decreased aggressive behaviour. Interestingly, the combined effects of PS and Flx normalized aggressive behaviour. Furthermore, perinatal

Flx treatment led to a decrease in anxiety-like behaviour in male offspring. PS led to hyperactivity. In addition to altering behaviour, PS led to a decrease in brain derived neurotropic factor (BDNF) levels in the frontal cortex regardless of Flx exposure. Neither

PS nor fluoxetine altered offspring performance in tests of cognitive abilities, memory, sensorimotor information processing, or risk assessment behaviours.

Further, we examined the circadian system in male mice exposed to PS and Flx.

We demonstrated that male mice exposed to PS had smaller light-induced phase-delays.

Mice exposed to perinatal Flx required more days to re-entrain to an 8-hour phase advance of their light-dark cycle. Mice subjected to either perinatal Flx or to PS had

213 larger light-induced phase-advances and smaller phase advances to 8-OH-DPAT. Flx treatment partially reversed the effect of PS on phase shifts to late-night light exposure and to 8-OH-DPAT. These results suggest that, in mice, perinatal exposure to either Flx or PS, or their combination, leads to persistent changes in their circadian systems as adults.

We demonstrated that PS led to hyperactivity and alterations of prepulse inhibition in adult female offspring. Maternal treatment with Flx had a potentially beneficial effect on spatial memory. These results suggest that gestational Flx exposure may be harmless for female offspring.

We directly assessed the biochemical integrity of the eCB and serotonergic systems in multiple brain areas of the offspring. We demonstrated that both systems were altered following prenatal manipulations. We found that eCBs may moderate effects of early-life exposure to Flx and PS on the outcomes of male and female mice in adulthood. eCB alterations caused by prenatal exposure to Flx may be the underlying reason for the positive effects of Flx on offspring outcomes in both males and females. Contrary to our prediction that eCB system of female mice will not be affected, the eCB system in female mice was affected after all treatments. We further show that PS may have an effect on the serotonergic system in male animals, which could be linked to alterations of aggressive behaviour of these mice.

We previously hypothesized that Flx may exert its long-lasting behavioural effects by permanently reducing the sensitivity of the 5-HT1AR in the brain (Kiryanova et al. 2013b). To test this hypothesis, we examined whether outcomes of 5-HT1AR KO or

HET mice would mimic the outcomes of perinatal Flx exposure. We found that 5-HT1AR

214

KO was not an appropriate model of perinatal Flx exposure because behavioural outcomes of 5-HT1AR KO and HET mice differed from those of Flx-exposed offspring.

Concurrently, we examined whether the 5-HT1AR moderated the long-term effects of PS.

We found that 5-HT1AR genotype moderated the effects of PS on offspring outcomes, including social behaviour of male mice and activity levels in female mice. Similar to our earlier findings, PS resulted in an increase in locomotor activity and fear memory in male mice and a change in prepulse inhibition in female animals.

7.2 Interpretation and Integration of our Findings

7.2.1 Memory

The finding of changes in eCB system function (Chapter 6) may explain the memory alterations in male and female mice (Chapter 2 and 3). Interaction among many regions of the brain is required for proper memory formation and consolidation. One of the brain regions involved is the amygdala. One of the roles of the amygdala is to mediate the effect of stress on memory consolidation. Experiencing a stressful or arousing situation enhances amygdala activity through noradrenergic and glucocorticoid inputs

(for a review see McGaugh 2000; Roozendaal et al. 2009). The amygdala, in turn, activates multiple brain regions involved in learning and memory, including the PFC, the hippocampus, and the caudate nucleus, thereby facilitating memory consolidation (for a review see McGaugh 2000; Roozendaal et al. 2009). We demonstrated that perinatal Flx exposure leads to increased 2-arachidonylglycerol (2-AG) levels in the amygdala of male mice. We also observed a downregulation of FAAH expression in the amygdala of female

215 mice exposed to Flx. Since FAAH metabolizes anandamide (AEA), reduction in FAAH could indicate an increase in AEA activity in this area. Cannabinoids are known to affect memory, and while the effect of external cannabinoids is memory impairment, the effect of endocannabinoids appears to be more complex – both impairment and enhancement of memory have been reported (for a review see Morena and Campolongo 2014). In the amygdala, eCBs are known to enhance memory consolidation via their action in the basolateral complex (Campolongo et al. 2009), possibly due to their inhibitory effect on

GABAergic activity (for a review see Hill et al. 2010). Therefore, increased 2-AG levels in the amygdala of male mice and the potential increase in AEA activity in the amygdala of Flx-exposed females may be the mechanism underlying enhanced spatial memory performance previously observed in these groups of mice (Chapter 3) (Kiryanova and

Dyck 2014). However, as we did not observe a change in AEA level in the tissue collected from the whole amygdala of female mice, it is possible that such a change, if present, is region-specific, most likely occurring only in the basolateral complex.

In the hippocampus, eCBs have an inhibitory effect on memory formation.

Activation of CB1 receptors in the hippocampus impairs long-term potentiation (Stella et al. 1997; Terranova et al. 1995) and decreases long-term memory formation, including the formation of spatial memory (Clarke et al. 2008; Robinson et al. 2008). It was proposed that suppressing the activation of CB1 receptors may have a memory enhancing effect (Robinson et al. 2008). Perhaps, this is what we observe in male Flx-exposed animals in our study. Male Flx-exposed animals had upregulated MGLL expression in the

“memory centers” of the brain: the medial prefrontal cortex (mPFC) and the dorsal hippocampus (DHPC). Monoacylglycerol lipase (MAG lipase) metabolizes 2-AG;

216 therefore, increased levels of MGLL mRNA may indicate increased levels of MAG lipase protein, which would lead to decreased levels of 2-AG. Therefore, an enhancement of spatial memory in these animals may in part be due to reduced eCB activity in the DHPC.

A more thorough investigation of the eCB system function, including AEA and 2-AG measurement in the DHPC, the measurement of the CB1 binding, and MAG lipase and

FAAH protein level quantification in the DHPC and mPFC, is needed to support this hypothesis.

7.2.2 Anxiety

We observe that perinatal Flx exposure leads to increased 2-AG levels in the amygdala in male mice and to downregulated expression of FAAH in the amygdala of females. The amygdala plays an important role in the modulation of anxiety, with amygdala activation being positively correlated with anxiety levels (Davis 1992). AEA maintains steady-state amygdala activity. During the stress response, FAAH levels rise, causing a decrease in AEA levels and disinhibiting amygdala activity. Following stress,

2-AG levels increase, returning the amygdala to a pre-stress state and facilitating stress- recovery (Hill et al. 2010; Hill and Tasker 2012; Roberto et al. 2010). In our current experiment, an increase in 2-AG levels in males, and a decrease in FAAH expression in females (which can lead to enhanced AEA signaling), in the amygdala would be predicted to lower anxiety levels in these animals. Interestingly, this is precisely what we observed during behavioural assessments of these animals: male and female mice exposed to Flx perinatally exhibited lower anxiety levels (Chapter 2)(Kiryanova and

Dyck 2014; McAllister et al. 2012). Furthermore, these molecular changes, through their

217 effect on anxiety, may also contribute to the enhanced spatial memory observed in these mice, as memory enhancing effects of eCBs have been proposed to be due, in part, to their anxiolytic effects (Robinson et al. 2008).

7.2.3 Aggressive Behaviour

Our finding that PS upregulates serotonin transporter (SERT) mRNA levels in the hypothalamus and downregulates SERT mRNA in mPFC and ventral hippocampus

(VHPC; Chapter 6) may be related to our previous finding that PS decreases aggressive behaviour of male mice (Chapter 2).

SERT is a plasma membrane protein that removes serotonin from the synaptic space and transports it back to the presynaptic terminal (Hariri and Holmes 2006); SERT mRNA changes could lead to alteration in synaptic and tissue serotonin levels. Serotonin is known to regulate aggression; however, the exact relationship between different elements of the serotonergic system and aggression are not yet understood (Olivier 2004).

The hypothalamus is directly involved in inter-male aggression (Lammers et al.

1988; Lipp and Hunsperger 1978; Siegel et al. 1999), the PFC is involved in impulse control and the control of social aggression (Kolb 1984), and the VHPC is involved in emotional regulation (Schwarting et al. 1998). Changes in serotonin tone could alter the activity of these brain areas, thereby affecting aggressive behaviour (Falkner et al. 2016).

SERT mRNA changes observed in this study may lead to increased removal of serotonin from the synaptic space in the hypothalamus and reduced clearance in the mPFC and DHPC. This change in the rate of serotonin removal would reduce the synaptic concentration of serotonin in the former and increase it in latter regions, which

218 could alter aggressive behaviour. However, further investigation is required to confirm that the changes of SERT mRNA levels in the hypothalamus, mPFC, and VHPC are causally related to the decrease in aggressive behaviours of male mice exposed to PS.

7.2.4 CORT levels

We report an increase in basal plasma CORT levels in male mice exposed to PS

(Chapter 6). Such a change in the basal CORT level may indicate a disruption of the negative feedback loop of circulating glucocorticoids. An examination of the CORT stress-response curve is needed, together with a more thorough examination of GR receptors in the PFC, the hippocampus and the basolateral amygdala, as these are essential components of the negative feedback loop that could sustain long-term alterations following stress (Isgor et al. 2004).

7.2.5 BDNF

Increased CORT levels may also partially contribute to the reduced BDNF levels we previously observed in adult male mice exposed to PS (Chapter 2), as glucocorticoids are known to be part of the mechanism that leads to BDNF depletion following chronic and acute stress (Smith et al. 1995).

7.2.6 Hyperactivity

We found that PS led to increased activity, especially in male mice; hyperactivity in male mice was evident across multiple behavioural tests (Chapters 2 and 5) and during cage-activity monitoring (Chapter 4). Hyperactivity is observed in adult mice when they

219 are exposed to chronic stress (Gronli et al. 2005). Therefore, persistent CORT elevation, which may indicate a state of chronic stress and arousal, may underlie the persistent increase in locomotor activity exhibited by PS-exposed mice.

The change in serotonergic system function may also contribute to PS-induced hyperactivity. Serotonergic neuron activity regulates motoric function; serotonergic system over-activity in the hypothalamus can generate locomotor hypermotility (Jacobs

1976; Jacobs et al. 2002). The change in SERT expression observed in the hypothalamus of male mice exposed to PS (Chapter 6) could lead to increased serotonergic tone, leading to the increased locomotor activity we observe in these animals.

7.2.7 Prepulse Inhibition

We observed an increase in PPI in female mice exposed to PS (Chapters 3 and 5).

The HPC, mPFC and amygdala are essential parts of the neural circuitry of the PPI response (Swerdlow et al. 2001). While dopamine plays a major role in PPI regulation in those brain areas, serotonin has also been demonstrated to serve as an important substrate for PPI modulation (Braff et al. 2001). However, we did not observe any serotonergic changes in the brain that are unique to the PS group of female mice. Since activity of the

HPC, mPFC and the amygdala are positively correlated with PPI, we could anticipate that an increase in activity in one or more of those areas could be the reason for the PPI increase. However, we see an increase in AEA levels in the PFC and the amygdala of female mice exposed to PS. An increase in AEA would, in general, decrease the excitability of a specific area unless it is acting on GABAergic CB1-expressing neurons.

Therefore, based on the results of our studies, we are unable to explain the mechanism of

220

PPI increase in female mice exposed to PS. Further studies are needed to elucidate the underlying mechanisms.

7.2.8 Circadian Behaviour

The hypothalamus contains the suprachiasmatic nucleus (SCN); the circadian clock of the brain. The circadian system relies on serotonergic transmission for proper function; the SCN contains afferent serotonergic fibers and serotonin receptors (discussed in Chapter 4). SERT is also expressed in the SCN (Amir et al. 1998; Legutko and Gannon

2001). We observed an upregulation of SERT mRNA levels in the hypothalamus of male mice following exposure to PS (Chapter 6). As discussed in section 6.5.1.1, increased

SERT may alter serotonergic levels throughout the brain, including in the hypothalamus.

Serotonin has an inhibiting effect on the circadian response to light. Therefore, the change in SERT mRNA in the hypothalamus may be linked to the decrease in the early- night light response or the increase in the late-night light response exhibited by our PS mice, depending on the direction of serotonergic alteration (Chapter 4). Further studies are needed to explore the integrity of the serotonergic system in the SCN following prenatal exposure to stress.

7.2.9 Sexual Dimorphism of the Behavioural Findings

While it is becoming clear that PS, Flx, and their combination lead to different behavioural changes in males and females, the mechanism of such sexually dimorphic changes is not yet understood. A combination of stress-induced changes in maternal glucocorticoids, opioid peptides, and catecholamines may have distinct effects on the development of the brains of male versus female offspring (Weinstock 2007) and may

221 also have the ability to directly alter sexually dimorphic brain areas (Rayen et al. 2013) explaining different outcomes in female and male animals exposed to PS. Furthermore, alterations in the serotonergic system may underlie sex-dependent changes that follow

Flx exposure (Favaro et al. 2008; Kiryanova et al. 2016a; Nagano et al. 2012). More research is needed to fully understand the mechanisms of sexually dimorphic behavioural changes that follow exposure to PS, Flx, and their combination.

7.2.10 Protective Effect of Endocannabinoids

Female mice exposed to PS had better outcomes than males. Unlike males, the basal CORT level of females was not altered, and the animals' activity levels were only mildly increased (Chapter 3). Furthermore, in females, the combination PS+FLX did not affect behaviour (Chapter 3). Such behavioural outcomes were accompanied by increased overall levels of AEA in PS and 2-AG in PS+FLX female mice (Chapter 6). Considering the positive effects of eCBs on many behavioural outcomes, including depression-like and anxiety-like behaviours, and the role eCBs play in HPA axis regulation, it is plausible that the AEA and 2-AG increase in the brains of female mice play a protective role against the effects of PS and Flx.

7.3 Considerations, Limitations and Future Directions

The genomic analysis was successful in identifying several genes the expression of which was altered by perinatal PS or Flx exposure. However, the analyses used here by no means provide a comprehensive picture of the biochemical processes that are

222 differentially active in PS and Flx exposed mice. Myriad dynamic, linked processes regulate protein abundance; transcriptional regulation is only the first of many steps.

Protein concentration is affected by post-transcriptional regulation, translation, and post- translational regulation as well as degradation. The percent of variation in protein levels that can be explained by mRNA levels can be as low as 40% (Tian et al. 2004).

Therefore, an examination of protein levels, protein activity, and the resultant function is necessary prior to making any conclusions.

Special considerations arise because stress manipulations are directed at the mother. Maternal behaviour can have a confounding effect, if altered. Evidence suggests that maternal stress can alter the behaviour of rat dams (Patin et al. 2002). This is an important finding as changes in maternal behaviour are associated with long-term changes in the physiological response to stress as well as alterations in anxiety-related behaviours (for a review see Meaney et al. 1994). In our set of experiments, we did not observe an effect of stress or Flx exposure on maternal behaviour. We assessed maternal behaviour with two daily half-hour long observations between P1 and P7. While currently this is one of the more thorough maternal behavioural assessments following maternal Flx exposure in rodents, and the only assessment following chronic variable stress in mice, our observation protocol may have been insufficient to detect subtle alterations in maternal behaviour. A more thorough examination that takes advantage of multiple daily observations may be necessary to reveal maternal behaviour changes, if they are subtle. Furthermore, a cross-fostering procedure could be utilized to eliminate the potential confounding effects of maternal behaviour.

223

An important issue that needs to be addressed in the field of research on maternal stress is the stress procedures used for stress modeling. In reviewing the literature, it quickly becomes apparent that methodology represents a source of considerable variance between studies of developmental exposure to maternal stress. It is known that the nature of the stressor can have an effect on long-term offspring outcomes (Velazquez-

Moctezuma et al. 1993); therefore, it is not surprising that these is no solid understanding of the effects of perinatal stress. The chronic variable stress procedure used in our series of experiments was selected due to its high naturalistic relevancy for mice and ecological validity as a model of human stress and depression. However, it is more difficult to control, quantify, and standardize the chronic variable stress procedure compared to some other protocols such as, for example, glucocorticoid administration to the dam. But glucocorticoid administration to the dam is also not a perfect proxy for the experience of stress, as in addition to glucocorticoid alterations, stress administered to a pregnant rat increases maternal plasma levels of ACTH, catecholamines (Matthews 2002), oxytocin

(Neumann et al. 1998) and free tryptophan (Peters 1990). Stress can also increase maternal sympathetic activity, leading to the diversion of maternal blood flow away from the uterus and the fetus and causing fetal hypoxia (Myers 1977). Therefore, a model of stress that is easy to control, quantify, and standardize, and is ecologically valid is urgently needed to be able to enhance the advancement of the perinatal stress research field. Furthermore, an examination of how different stressors and different components of stress affect the offspring could help the understanding of the effects of early stress.

A fundamental limitation of the present experiments is that they only add to the speculation concerning the involvement of the 5-HT1AR receptor in the effects of PS and

224

Flx. We previously hypothesized that the long-term behavioural effects of perinatal Flx may be due to long-term downregulation of the 5-HT1AR; therefore, genetic elimination

(full KO) or downregulation (HET) of 5-HT1AR would produce similar behavioural effects. The gene expression data, while showing 5-HT1AR receptor changes, did not serve well to explain behavioural alterations. Furthermore, while the study of the 5-

HT1AR KO mice demonstrated 5-HT1AR involvement in the effects of PS, it did not result in behavioural alterations like those observed in Flx-exposed mice, therefore not supporting the role of the 5-HT1AR in long-term effects of perinatal fluoxetine exposure.

A further investigation of 5-HT1AR involvement is needed. An examination of receptor binding and receptor function across the brain, especially in the areas that our experiments show may be more vulnerable (the mPFC, the amygdala and the HPC) is needed following perinatal exposure to PS and Flx. Experiments using a transient 5-

HT1AR knockdown model would assist in ascertaining the role of the 5-HT1AR in the long-term effects of PS and Flx.

In our set of experiments, we discovered that in female mice PS has a smaller impact on behaviour compared to males. This behavioural observation was accompanied by the discovery that the eCB system is substantially upregulated in the female brain following exposure to PS. This may signify that the eCB system protects female mice from the negative effects of PS. This idea needs to be further explored. A potential avenue for experimentation is an administration of eCB-enhancing drugs (for example

MAG lipase or FAAH inhibitors) to male mice during development and/or later in life.

Such research may help understand the therapeutic and protective effects of CBs against the effects of PS.

225

Maternal stress may serve as a predictor of the environment the organism is born into. It is possible that early life stress signals adversity of the environment; in this view, the molecular and behavioural changes observed in the offspring would be adaptive changes that prepare the organism for such harsh environments (i.e., the mismatch hypothesis)(Schmidt 2011). However, it is also possible that early life stress puts one at risk of psychopathology and other adverse outcomes only when the stressful environment is again encountered in adulthood, as the build-up of allostatic load following each stressor may increase the chance of psychopathology onset (i.e., the cumulative hypothesis)(Maynard et al. 2001; Nederhof and Schmidt 2012). A more recent hypothesis suggests that both the cumulative and mismatch hypothesis may be true under certain conditions (Nederhof and Schmidt 2012). One such condition is the ease by which an organism can be “programmed” by its early environment. Susceptibility to this programming is thought to be genetically controlled (Nederhof and Schmidt 2012), and may be dependent on the activity of the serotonergic system. However, no study examines whether exposure to antidepressants such as Flx may be a factor that sensitizes

(or de-sensitizes) the developing organism to the effects of maternal stress. In fact, Flx

(and other SSRIs), via its ability to increase neuronal plasticity, is postulated to create a state of “openness to change”. Such a state allows the environment to affect the brain to a greater extent, therefore sensitizing the brain to the effects of the environment (Branchi

2011). Such “sensitizing effects” of Flx have recently been demonstrated in adult mice exposed to chronic stress (Alboni et al. 2017). Fluoxetine administration improved the outcomes of mice only if exposed to an enriched (“good”) environment during the 3- week Flx administration, while mouse outcomes were worsened if Flx administration was

226 concurrent with an exposure to a stressful (“bad”) environment. Future studies are needed to examine whether exposure to antidepressants, including Flx, modulates “environment sensitivity” when the antidepressant exposure is perinatal. Furthermore, the outcomes of perinatally Flx-exposed mice or rats following an exposure to a second stressor during adolescence or adulthood is needed to better understand the long-term effects of maternal stress, maternal Flx exposure, and their interaction. Such research will address questions of programming effects of SSRIs, the ways that SSRIs modify offspring outcomes following stress, and help answer the question of how stress, later in life, affects individuals that were exposed to maternal stress, maternal SSRIs and their combination.

This research would have strong clinical application because it would help identify (and therefore provide appropriate care to) populations at higher risk of psychopathology.

7.4 Conclusion

During prenatal development, the fetus is especially vulnerable to environmental stressors. Factors that have only temporary and reversible effects in adulthood may have irreversible, long-lasting effects on fetal development, and lead to behavioural and molecular changes that last throughout life. The results of this thesis further demonstrate that the exposure to maternal stress and maternal antidepressant intake leads to considerable alterations in brain biochemistry and behaviour of male and female offspring. These findings add to the rich literature that has shown clear physiological and behavioural effects of early-life experience. Although the precise mechanism of such changes remains unknown, it appears that the endocannabinoid and the serotonergic system is an important component for early-life experience-driven offspring outcomes.

227

References

Abrahamson EE, Moore RY (2001) Suprachiasmatic nucleus in the mouse: retinal innervation, intrinsic organization and efferent projections. Brain Research 916: 172-191 Adler DA, Ammanuel S, Lei J, Dada T, Borbiev T, Johnston MV, Kadam SD, Burd I (2014) Circadian cycle-dependent EEG biomarkers of pathogenicity in adult mice following prenatal exposure to in utero inflammation. Neuroscience 275: 305-13 Alboni S, van Dijk RM, Poggini S, Milior G, Perrotta M, Drenth T, Brunello N, Wolfer DP, Limatola C, Amrein I, Cirulli F, Maggi L, Branchi I (2017) Fluoxetine effects on molecular, cellular and behavioral endophenotypes of depression are driven by the living environment. Mol Psychiatry 22: 552-561 Alder J, Fink N, Bitzer J, Hosli I, Holzgreve W (2007) Depression and anxiety during pregnancy: a risk factor for obstetric, fetal and neonatal outcome? A critical review of the literature. J Matern Fetal Neonatal Med 20: 189-209 Alonso SJ, Castellano MA, Afonso D, Rodriguez M (1991) Sex differences in behavioral despair: relationships between behavioral despair and open field activity. Physiol Behav 49: 69-72 Alonso SJ, Navarro E, Rodriguez M (1994) Permanent dopaminergic alterations in the n. accumbens after prenatal stress. Pharmacology, biochemistry, and behavior 49: 353-8 Alwan S, Friedman JM (2009) Safety of selective serotonin reuptake inhibitors in pregnancy. CNS Drugs 23: 493-509 Amir S, Robinson B, Ratovitski T, Rea MA, Stewart J, Simantov R (1998) A role for serotonin in the circadian system revealed by the distribution of serotonin transporter and light-induced Fos immunoreactivity in the suprachiasmatic nucleus and intergeniculate leaflet. Neuroscience 84: 1059-73 Andersson L, Sundström-Poromaa I, Bixo M, Wulff M, Bondestam K, åStröm M (2003) Point prevalence of psychiatric disorders during the second trimester of pregnancy: a population-based study. American Journal Of Obstetrics And Gynecology 189: 148-154 Andrade SE, Raebel MA, Brown J, Lane K, Livingston J, Boudreau D, Rolnick SJ, Roblin D, Smith DH, Willy ME, Staffa JA, Platt R (2008) Use of antidepressant medications during pregnancy: a multisite study. American Journal Of Obstetrics And Gynecology 198: 194.e1-5 Andrade SE, Reichman ME, Mott K, Pitts M, Kieswetter C, Dinatale M, Stone MB, Popovic J, Haffenreffer K, Toh S (2016) Use of selective serotonin reuptake inhibitors (SSRIs) in women delivering liveborn infants and other women of child-bearing age within the U.S. Food and Drug Administration's Mini-Sentinel program. Arch Womens Ment Health Andrews N, File SE (1993) Handling history of rats modifies behavioural effects of drugs in the elevated plus-maze test of anxiety. European Journal of Pharmacology 235: 109-12

228

Ansorge MS, Morelli E, Gingrich JA (2008) Inhibition of serotonin but not norepinephrine transport during development produces delayed, persistent perturbations of emotional behaviors in mice. The Journal Of Neuroscience: The Official Journal Of The Society For Neuroscience 28: 199-207 Ansorge MS, Zhou M, Lira A, Hen R, Gingrich JA (2004) Early-Life Blockade of the 5- HT Transporter AltersEmotional Behavior in Adult Mice. Science 306: 879-881 Antle MC, Silver R (2005) Orchestrating time: arrangements of the brain circadian clock. Trends Neurosci 28: 145-51 Antle MC, Silver R (2016) Circadian Insights into Motivated Behavior. Curr Top Behav Neurosci 27: 137-69 Antle MC, Sterniczuk R, Smith VM, Hagel K (2007) Non-photic modulation of phase shifts to long light pulses. Journal of Biological Rhythms 22: 524-533 Araujo AP, DeLucia R, Scavone C, Planeta CS (2003) Repeated predictable or unpredictable stress: effects on cocaine-induced locomotion and cyclic AMP- dependent protein kinase activity. Behav Brain Res 139: 75-81 Archer J (1973) Tests for emotionality in rats and mice: a review. Anim Behav 21: 205- 35 Azmitia EC (2001) Modern views on an ancient chemical: serotonin effects on cell proliferation, maturation, and apoptosis. Brain Research Bulletin 56: 413-424 Babb JA, Masini CV, Day HE, Campeau S (2013) Sex differences in activated corticotropin-releasing factor neurons within stress-related neurocircuitry and hypothalamic-pituitary-adrenocortical axis hormones following restraint in rats. Neuroscience 234: 40-52 Bairy KL, Madhyastha S, Ashok KP, Bairy I, Malini S (2007) Developmental and behavioral consequences of prenatal fluoxetine. Pharmacology 79: 1-11 Balsalobre A, Brown SA, Marcacci L, Tronche F, Kellendonk C, Reichardt HM, Schutz G, Schibler U (2000) Resetting of circadian time in peripheral tissues by glucocorticoid signaling. Science 289: 2344-7 Barbazanges A, Piazza PV, Le Moal M, Maccari S (1996) Maternal glucocorticoid secretion mediates long-term effects of prenatal stress. J Neurosci 16: 3943-9 Barnard AR, Nolan PM (2008) When clocks go bad: neurobehavioural consequences of disrupted circadian timing. Plos Genetics 4: e1000040-e1000040 Bauer S, Monk C, Ansorge M, Gyamfi C, Myers M (2010) Impact of antenatal selective serotonin reuptake inhibitor exposure on pregnancy outcomes in mice. American Journal Of Obstetrics And Gynecology 203: 375.e1-4 Behan AT, van den Hove DL, Mueller L, Jetten MJ, Steinbusch HW, Cotter DR, Prickaerts J (2011) vidence of female-specific glial deficits in the hippocampus in a mouse model of prenatal stress. Eur Neuropsychopharm 21: 71-9 Belenky MA, Pickard GE (2001) Subcellular distribution of 5-HT(1B) and 5-HT(7) receptors in the mouse suprachiasmatic nucleus. J Comp Neurol 432: 371-88 Belkacemi L, Jelks A, Chen CH, Ross MG, Desai M (2011) Altered placental development in undernourished rats: role of maternal glucocorticoids. Reproductive biology and endocrinology : RB&E 9: 105 Benediktsson R, Lindsay RS, Noble J, Seckl JR, Edwards CR (1993) Glucocorticoid exposure in utero: new model for adult hypertension. Lancet 341: 339-41

229

Bengel D, Murphy DL, Andrews AM, Wichems CH, Feltner D, Heils A, Mössner R, Westphal H, Lesch KP (1998) Altered brain serotonin homeostasis and locomotor insensitivity to 3, 4-methylenedioxymethamphetamine ("Ecstasy") in serotonin transporter-deficient mice. Molecular Pharmacology 53: 649-655 Berger S, Wolfer DP, Selbach O, Alter H, Erdmann G, Reichardt HM, Chepkova AN, Welzl H, Haas HL, Lipp HP, Schutz G (2006) Loss of the limbic mineralocorticoid receptor impairs behavioral plasticity. Proc Natl Acad Sci U S A 103: 195-200 Bergman K, Sarkar P, O'Connor TG, Modi N, Glover V (2007) Maternal stress during pregnancy predicts cognitive ability and fearfulness in infancy. Journal of the American Academy of Child and Adolescent Psychiatry 46: 1454-63 Berman ME, McCloskey MS, Fanning JR, Schumacher JA, Coccaro EF (2009) Serotonin augmentation reduces response to attack in aggressive individuals. Psychological Science 20: 714-20 Beydoun H, Saftlas AF (2008) Physical and mental health outcomes of prenatal maternal stress in human and animal studies: a review of recent evidence. Paediatric and Perinatal Epidemiology 22: 438-66 Biala YaN, Bogoch Y, Bejar C, Linial M, Weinstock M (2011) Prenatal stress diminishes gender differences in behavior and in expression of hippocampal synaptic genes and proteins in rats. Hippocampus 21: 1114-25 Bloom SL, Sheffield JS, McIntire DD, Leveno KJ (2001) Antenatal dexamethasone and decreased birth weight. Obstetrics and Gynecology 97: 485-90 Bode-Greuel KM, Klisch J, Horváth E, Glaser T, Traber J (1990) Effects of 5- hydroxytryptamine1A-receptor agonists on hippocampal damage after transient forebrain ischemia in the Mongolian gerbil. Stroke 21: IV164-IV166 Borri C, Mauri M, Oppo A, Banti S, Rambelli C, Ramacciotti D, Montagnani MS, Camilleri V, Cortopassi S, Bettini A, Ricciardulli S, Rucci P, Montaresi S, Cassano GB (2008) Axis I psychopathology and functional impairment at the third month of pregnancy: Results from the Perinatal Depression-Research and Screening Unit (PND-ReScU) study. J Clin Psychiatry 69: 1617-24 Bortolato M, Mangieri RA, Fu J, Kim JH, Arguello O, Duranti A, Tontini A, Mor M, Tarzia G, Piomelli D (2007) Antidepressant-like activity of the fatty acid amide hydrolase inhibitor URB597 in a rat model of chronic mild stress. Biol Psychiatry 62: 1103-10 Bortolozzi A, Amargos-Bosch M, Toth M, Artigas F, Adell A (2004) In vivo efflux of serotonin in the dorsal raphe nucleus of 5-HT1A receptor knockout mice. J Neurochem 88: 1373-9 Bosch OJ, Kromer SA, Neumann ID (2006) Prenatal stress: opposite effects on anxiety and hypothalamic expression of vasopressin and corticotropin-releasing hormone in rats selectively bred for high and low anxiety. Eur J Neurosci 23: 541-51 Boulle F, Pawluski JL, Homberg JR, Machiels B, Kroeze Y, Kumar N, Steinbusch HW, Kenis G, Van den Hove DL (2016) Prenatal stress and early-life exposure to fluoxetine have enduring effects on anxiety and hippocampal BDNF gene expression in adult male offspring. Dev Psychobiol 58: 427-38

230

Boutrel B, Monaca C, Hen R, Hamon M, Adrien J (2002) Involvement of 5-HT1A receptors in homeostatic and stress-induced adaptive regulations of paradoxical sleep: studies in 5-HT1A knock-out mice. J Neurosci 22: 4686-92 Boyce WT (2014) The lifelong effects of early childhood adversity and toxic stress. Pediatric Dentistry 36: 102-8 Braff DL, Geyer MA, Swerdlow NR (2001) Human studies of prepulse inhibition of startle: normal subjects, patient groups, and pharmacological studies. Psychopharmacology (Berl) 156: 234-58 Branchi I (2011) The double edged sword of neural plasticity: increasing serotonin levels leads to both greater vulnerability to depression and improved capacity to recover. Psychoneuroendocrinology 36: 339-51 Brent NB, Wisner KL (1998) Fluoxetine and carbamazepine concentrations in a nursing mother/infant pair. Clinical Pediatrics 37: 41-4 Brunner HG, Nelen M, Breakefield XO, Ropers HH, van Oost BA (1993) Abnormal behavior associated with a point mutation in the structural gene for monoamine oxidase A. Science (New York, NY) 262: 578-580 Brunton PJ, Russell JA (2010) Prenatal social stress in the rat programmes neuroendocrine and behavioural responses to stress in the adult offspring: sex- specific effects. J Neuroendocrinol 22: 258-71 Bustamante C, Bilbao P, Contreras W, Martinez M, Mendoza A, Reyes A, Pascual R (2010) Effects of prenatal stress and exercise on dentate granule cells maturation and spatial memory in adolescent mice. Int J Dev Neurosci 28: 605-9 Byrd RA, Markham JK (1994) Developmental toxicology studies of fluoxetine hydrochloride administered orally to rats and rabbits. Fundamental And Applied Toxicology: Official Journal Of The Society Of Toxicology 22: 511-518 Cabrera TM, Battaglia G (1994) Delayed decreases in brain 5-hydroxytryptamine2A/2C receptor density and function in male rat progeny following prenatal fluoxetine. The Journal Of Pharmacology And Experimental Therapeutics 269: 637-645 Cabrera-Vera TM, Battaglia G (1998) Prenatal exposure to fluoxetine (Prozac) produces site-specific and age-dependent alterations in brain serotonin transporters in rat progeny: evidence from autoradiographic studies. The Journal Of Pharmacology And Experimental Therapeutics 286: 1474-1481 Cabrera-Vera TM, Garcia F, Pinto W, Battaglia G (1997) Effect of prenatal fluoxetine (Prozac) exposure on brain serotonin neurons in prepubescent and adult male rat offspring. J Pharmacol Exp Ther 280: 138-45 Cagiano R, Flace P, Bera I, Maries L, Cioca G, Sabatini R, Benagiano V, Auteri P, Marzullo A, Vermesan D, Stefanelli R, Ambrosi G (2008) Neurofunctional effects in rats prenatally exposed to fluoxetine. European Review For Medical And Pharmacological Sciences 12: 137-148 Campolongo P, Roozendaal B, Trezza V, Hauer D, Schelling G, McGaugh JL, Cuomo V (2009) Endocannabinoids in the rat basolateral amygdala enhance memory consolidation and enable glucocorticoid modulation of memory. Proc Natl Acad Sci U S A 106: 4888-93

231

Capello CF, Bourke CH, Ritchie JC, Stowe ZN, Newport DJ, Nemeroff A, Owens MJ (2011) Serotonin transporter occupancy in rats exposed to serotonin reuptake inhibitors in utero or via breast milk. J Pharmacol Exp Ther 339: 275-85 Carey R (2010) Serotonin and Basal Sensory–Motor Control. Academic Press, San Diego Carlson AD, Obeid JS, Kanellopoulou N, Wilson RC, New MI (1999) Congenital adrenal hyperplasia: update on prenatal diagnosis and treatment. The Journal of steroid biochemistry and molecular biology 69: 19-29 Carmichael SL, Shaw GM, Ma C, Werler MM, Rasmussen SA, Lammer EJ (2007) Maternal corticosteroid use and orofacial clefts. American Journal of Obstetrics and Gynecology 197: 585 e1-7; discussion 683-4, e1-7 Carr CP, Martins CM, Stingel AM, Lemgruber VB, Juruena MF (2013) The role of early life stress in adult psychiatric disorders: a systematic review according to childhood trauma subtypes. The Journal of nervous and mental disease 201: 1007- 20 Carrillo M, Ricci LA, Coppersmith GA, Melloni RH, Jr. (2009) The effect of increased serotonergic neurotransmission on aggression: a critical meta-analytical review of preclinical studies. Psychopharmacology (Berl) 205: 349-68 Carson SH, Taeusch HW, Jr., Avery ME (1973) Inhibition of lung cell division after hydrocortisone injection into fetal rabbits. Journal of Applied Physiology 34: 660- 3 Cases O, Seif I, Grimsby J, Gaspar P, Chen K, Pournin S, Müller U, Aguet M, Babinet C, Shih JC (1995) Aggressive behavior and altered amounts of brain serotonin and norepinephrine in mice lacking MAOA. Science (New York, NY) 268: 1763- 1766 Casper RC, Fleisher BE, Lee-Ancajas JC, Gilles A, Gaylor E, DeBattista A, Hoyme HE (2003) Follow-up of children of depressed mothers exposed or not exposed to antidepressant drugs during pregnancy. The Journal Of Pediatrics 142: 402-408 Chambers CD, Johnson KA, Dick LM, Felix RJ, Jones KL (1996) Birth outcomes in pregnant women taking fluoxetine. The New England Journal Of Medicine 335: 1010-1015 Chen CP, Kuhn P, Advis JP, Sarkar DK (2006) Prenatal ethanol exposure alters the expression of period genes governing the circadian function of beta-endorphin neurons in the hypothalamus. J Neurochem 97: 1026-33 Chourbaji S, Hoyer C, Richter SH, Brandwein C, Pfeiffer N, Vogt MA, Vollmayr B, Gass P (2011) Differences in mouse maternal care behavior - is there a genetic impact of the glucocorticoid receptor? PLoS ONE 6: e19218 Chubakov AR, Gromova EA, Konovalov GV, Sarkisova EF, Chumasov EI (1986) The effects of serotonin on the morpho-functional development of rat cerebral neocortex in tissue culture. Brain Research 369: 285-297 Clancy B, Kersh B, Hyde J, Darlington RB, Anand KJ, Finlay BL (2007) Web-based method for translating neurodevelopment from laboratory species to humans. Neuroinformatics 5: 79-94 Clarke JR, Rossato JI, Monteiro S, Bevilaqua LR, Izquierdo I, Cammarota M (2008) Posttraining activation of CB1 cannabinoid receptors in the CA1 region of the

232

dorsal hippocampus impairs object recognition long-term memory. Neurobiol Learn Mem 90: 374-81 Cleare AJ, Bond AJ (1995) The effect of tryptophan depletion and enhancement on subjective and behavioural aggression in normal male subjects. Psychopharmacology 118: 72-81 Cleare AJ, Bond AJ (1997) Does central serotonergic function correlate inversely with aggression? A study using D-fenfluramine in healthy subjects. Psychiatry Research 69: 89-95 Cohen LS, Heller VL, Bailey JW, Grush L, Ablon JS, Bouffard SM (2000) Birth outcomes following prenatal exposure to fluoxetine. Biological Psychiatry 48: 996-1000 Cole TJ, Blendy JA, Monaghan AP, Schmid W, Aguzzi A, Schutz G (1995) Molecular genetic analysis of glucocorticoid signaling during mouse development. Steroids 60: 93-6 Consensus N (1995) Effect of corticosteroids for fetal maturation on perinatal outcomes. NIH Consensus Development Panel on the Effect of Corticosteroids for Fetal Maturation on Perinatal Outcomes. JAMA : the journal of the American Medical Association 273: 413-8 Cooper WO, Willy ME, Pont SJ, Ray WA (2007) Increasing use of antidepressants in pregnancy. American Journal of Obstetrics and Gynecology 196: 544.e1-5 Costa A, Rocci MP, Arisio R, Benedetto C, Fabris C, Bertino E, Botta G, Marozio L, Mostert M, Urbano D, Emanuel A (1996) Glucocorticoid receptors immunoreactivity in tissue of human embryos. Journal of Endocrinological Investigation 19: 92-8 Côté F, Fligny C, Bayard E, Launay J-M, Gershon MD, Mallet J, Vodjdani G (2007) Maternal serotonin is crucial for murine embryonic development. Proceedings Of The National Academy Of Sciences Of The United States Of America 104: 329- 334 Croen LA, Grether JK, Yoshida CK, Odouli R, Hendrick V (2011) Antidepressant use during pregnancy and childhood autism spectrum disorders. Archives of General Psychiatry 68: 1104-12 Crowther CA, Harding JE, Middleton PF, Andersen CC, Ashwood P, Robinson JS, Group ASS (2013) Australasian randomised trial to evaluate the role of maternal intramuscular dexamethasone versus betamethasone prior to preterm birth to increase survival free of childhood neurosensory disability (A*STEROID): study protocol. BMC pregnancy and childbirth 13: 104 Cruz AP, Frei F, Graeff FG (1994) Ethopharmacological analysis of rat behavior on the elevated plus-maze. Pharmacology, Biochemistry and Behavior 49: 171-176 da Silva CM, Gonçalves L, Manhaes-de-Castro R, Nogueira MI (2010) Postnatal fluoxetine treatment affects the development of serotonergic neurons in rats. Neurosci Lett 483: 179-183 da-Silva VA, Altenburg SP, Malheiros LR, Thomaz TG, Lindsey CJ (1999) Postnatal development of rats exposed to fluoxetine or venlafaxine during the third week of pregnancy. Brazilian Journal Of Medical And Biological Research = Revista

233

Brasileira De Pesquisas Médicas E Biológicas / Sociedade Brasileira De Biofísica [Et Al] 32: 93-98 Dahlof LG, Hard E, Larsson K (1978) Influence of maternal stress on the development of the fetal genital system. Physiology and Behavior 20: 193-5 Dalla C, Shors TJ (2009) Sex differences in learning processes of classical and operant conditioning. Physiol Behav 97: 229-38 Daval G, Vergé D, Becerril A, Gozlan H, Spampinato U, Hamon M (1987) Transient expression of 5-HT1A receptor binding sites in some areas of the rat CNS during postnatal development. Int J Dev Neurosci 5: 171-180 Dave-Sharma S, Wilson RC, Harbison MD, Newfield R, Azar MR, Krozowski ZS, Funder JW, Shackleton CH, Bradlow HL, Wei JQ, Hertecant J, Moran A, Neiberger RE, Balfe JW, Fattah A, Daneman D, Akkurt HI, De Santis C, New MI (1998) Examination of genotype and phenotype relationships in 14 patients with apparent mineralocorticoid excess. The Journal of clinical endocrinology and metabolism 83: 2244-54 Davis M (1992) The role of the amygdala in fear and anxiety. Annu Rev Neurosci 15: 353-75 de Boer SF, Lesourd M, Mocaer E, Koolhaas JM (1999) Selective antiaggressive effects of alnespirone in resident-intruder test are mediated via 5-hydroxytryptamine1A receptors: A comparative pharmacological study with 8-hydroxy-2- dipropylaminotetralin, ipsapirone, buspirone, eltoprazine, and WAY-100635. Journal of Pharmacology and Experimental Therapeutics 288: 1125-33 de Kloet ER, Joels M, Holsboer F (2005) Stress and the brain: from adaptation to disease. Nat Rev Neurosci 6: 463-75 Deng DR, Djalali S, Holtje M, Grosse G, Stroh T, Voigt I, Kusserow H, Theuring F, Ahnert-Hilger G, Hortnagl H (2007) Embryonic and postnatal development of the serotonergic raphe system and its target regions in 5-HT1A receptor deletion or overexpressing mouse mutants. Neuroscience 147: 388-402 Diamond DM, Bennett MC, Fleshner M, Rose GM (1992) Inverted-U relationship between the level of peripheral corticosterone and the magnitude of hippocampal primed burst potentiation. Hippocampus 2: 421-30 Diav-Citrin O, Shechtman S, Weinbaum D, Wajnberg R, Avgil M, Di Gianantonio E, Clementi M, Weber-Schoendorfer C, Schaefer C, Ornoy A (2008) Paroxetine and fluoxetine in pregnancy: a prospective, multicentre, controlled, observational study. British Journal Of Clinical Pharmacology 66: 695-705 Diaz R, Brown RW, Seckl JR (1998) Distinct ontogeny of glucocorticoid and mineralocorticoid receptor and 11beta-hydroxysteroid dehydrogenase types I and II mRNAs in the fetal rat brain suggest a complex control of glucocorticoid actions. The Journal of neuroscience : the official journal of the Society for Neuroscience 18: 2570-80 Diaz R, Fuxe K, Ogren SO (1997) Prenatal corticosterone treatment induces long-term changes in spontaneous and apomorphine-mediated motor activity in male and female rats. Neuroscience 81: 129-40 Dickmeis T (2009) Glucocorticoids and the circadian clock. The Journal of endocrinology 200: 3-22

234

Dincheva I, Drysdale AT, Hartley CA, Johnson DC, Jing D, King EC, Ra S, Gray JM, Yang R, DeGruccio AM, Huang C, Cravatt BF, Glatt CE, Hill MN, Casey BJ, Lee FS (2015) FAAH genetic variation enhances fronto-amygdala function in mouse and human. Nat Commun 6: 6395 Dirks A, Pattij T, Bouwknecht JA, Westphal TT, Hijzen TH, Groenink L, van der Gugten J, Oosting RS, Hen R, Geyer MA, Olivier B (2001) 5-HT1B receptor knockout, but not 5-HT1A receptor knockout mice, show reduced startle reactivity and footshock-induced sensitization, as measured with the acoustic startle response. Behav Brain Res 118: 169-78 Dolan M, Anderson IM, Deakin JF (2001) Relationship between 5-HT function and impulsivity and aggression in male offenders with personality disorders. The British journal of psychiatry : the journal of mental science 178: 352-9 Dori I, Dinopoulos A, Blue ME, Parnavelas JG (1996) Regional differences in the ontogeny of the serotonergic projection to the cerebral cortex. Experimental Neurology 138: 1-14 Doyle LW, Ford GW, Davis NM, Callanan C (2000) Antenatal corticosteroid therapy and blood pressure at 14 years of age in preterm children. Clinical science (London, England : 1979) 98: 137-42 Dugovic C, Maccari S, Weibel L, Turek FW, Van Reeth O (1999) High corticosterone levels in prenatally stressed rats predict persistent paradoxical sleep alterations. J Neurosci 19: 8656-8664 Duke AA, Begue L, Bell R, Eisenlohr-Moul T (2013) Revisiting the serotonin-aggression relation in humans: a meta-analysis. Psychological Bulletin 139: 1148-72 Dulawa SC, Gross C, Stark KL, Hen R, Geyer MA (2000) Knockout mice reveal opposite roles for serotonin 1A and 1B receptors in prepulse inhibition. Neuropsychopharmacol 22: 650-9 Duncan MJ, Hester JM, Hopper JA, Franklin KM (2010) The effects of aging and chronic fluoxetine treatment on circadian rhythms and suprachiasmatic nucleus expression of neuropeptide genes and 5-HT1B receptors. Eur J Neurosci 31: 1646-54 Duncan MJ, Jennes L, Jefferson JB, Brownfield MS (2000) Localization of serotonin(5A) receptors in discrete regions of the circadian timing system in the Syrian hamster. Brain Res 869: 178-85 Duncan MJ, Short J, Wheeler DL (1999) Comparison of the effects of aging on 5-HT7 and 5-HT1A receptors in discrete regions of the circadian timing system in hamsters. Brain Res 829: 39-45 Dunkel Schetter C, Tanner L (2012) Anxiety, depression and stress in pregnancy: implications for mothers, children, research, and practice. Curr Opin Psychiatry 25: 141-8 Edgar DM, Miller JD, Prosser RA, Dean RR, Dement WC (1993) Serotonin and the mammalian circadian system: II. Phase-shifting rat behavioral rhythms with serotonergic agonists. Journal Of Biological Rhythms 8: 17-31 Epperson CN, Jatlow PI, Czarkowski K, Anderson GM (2003) Maternal fluoxetine treatment in the postpartum period: effects on platelet serotonin and plasma drug levels in breastfeeding mother-infant pairs. Pediatrics 112: e425

235

Falkner AL, Grosenick L, Davidson TJ, Deisseroth K, Lin D (2016) Hypothalamic control of male aggression-seeking behavior. Nat Neurosci 19: 596-604 Favaro PdN, Costa LC, Moreira EG (2008) Maternal fluoxetine treatment decreases behavioral response to dopaminergic drugs in female pups. Neurotoxicology And Teratology 30: 487-494 Fernandez-Guasti A, Olivares-Nazario M, Reyes R, Martinez-Mota L (2016) Sex and age differences in the antidepressant-like effect of fluoxetine in the forced swim test. Pharmacol Biochem Behav Forcelli PA, Heinrichs SC (2008) Teratogenic effects of maternal antidepressant exposure on neural substrates of drug-seeking behavior in offspring. Addiction Biology 13: 52-62 Fornaro E, Li D, Pan J, Belik J (2007) Prenatal exposure to fluoxetine induces fetal pulmonary hypertension in the rat. American Journal Of Respiratory And Critical Care Medicine 176: 1035-1040 Francis DD, Champagne FA, Liu D, Meaney MJ (1999) Maternal care, gene expression, and the development of individual differences in stress reactivity. Ann N Y Acad Sci 896: 66-84 Francis-Oliveira J, Ponte B, Barbosa AP, Verissimo LF, Gomes MV, Pelosi GG, Britto LR, Moreira EG (2013) Fluoxetine exposure during pregnancy and lactation: Effects on acute stress response and behavior in the novelty-suppressed feeding are age and gender-dependent in rats. Behav Brain Res 252: 195-203 French NP, Hagan R, Evans SF, Godfrey M, Newnham JP (1999) Repeated antenatal corticosteroids: size at birth and subsequent development. American Journal of Obstetrics and Gynecology 180: 114-21 Fride E, Dan Y, Feldon J, Halevy G, Weinstock M (1986) Effects of prenatal stress on vulnerability to stress in prepubertal and adult rats. Physiology and Behavior 37: 681-7 Froger N, Palazzo E, Boni C, Hanoun N, Saurini F, Joubert C, Dutriez-Casteloot I, Enache M, Maccari S, Barden N, Cohen-Salmon C, Hamon M, Lanfumey L (2004) Neurochemical and behavioral alterations in glucocorticoid receptor- impaired transgenic mice after chronic mild stress. J Neurosci 24: 2787-96 Fumagalli F, Bedogni F, Perez J, Racagni G, Riva MA (2004) Corticostriatal brain- derived neurotrophic factor dysregulation in adult rats following prenatal stress. The European journal of neuroscience 20: 1348-54 Gardani M, Biello SM (2008) The effects of photic and nonphotic stimuli in the 5-HT7 receptor knockout mouse. Neuroscience 152: 245-253 Gartside SE, Johnson DA, Leitch MM, Troakes C, Ingram CD (2003) Early life adversity programs changes in central 5-HT neuronal function in adulthood. Eur J Neurosci 17: 2401-8 Gaspar P, Cases O, Maroteaux L (2003) The developmental role of serotonin: news from mouse molecular genetics. Nat Rev Neurosci 4: 1002-12 Gavin NI, Gaynes BN, Lohr KN, Meltzer-Brody S, Gartlehner G, Swinson T (2005) Perinatal depression - A systematic review of prevalence and incidence. Obstetrics and Gynecology 106: 1071-1083

236

Gemmel M, Rayen I, Lotus T, van Donkelaar E, Steinbusch HW, De Lacalle S, Kokras N, Dalla C, Pawluski JL (2016) Developmental fluoxetine and prenatal stress effects on serotonin, dopamine, and synaptophysin density in the PFC and hippocampus of offspring at weaning. Dev Psychobiol 58: 315-27 Glynn LM, Sandman CA (2012) Sex moderates associations between prenatal glucocorticoid exposure and human fetal neurological development. Developmental science 15: 601-10 Gobinath AR, Workman JL, Chow C, Lieblich SE, Galea LA (2016) Maternal postpartum corticosterone and fluoxetine differentially affect adult male and female offspring on anxiety-like behavior, stress reactivity, and hippocampal neurogenesis. Neuropharmacology 101: 165-78 Gogos A, van den Buuse M, Rossell S (2009) Gender differences in prepulse inhibition (PPI) in bipolar disorder: men have reduced PPI, women have increased PPI. Int J Neuropsychopharmacol 12: 1249-59 Gomez ML, Martinez-Mota L, Estrada-Camarena E, Fernandez-Guasti A (2014) Influence of the brain sexual differentiation process on despair and antidepressant-like effect of fluoxetine in the rat forced swim test. Neuroscience 261: 11-22 Gould E (1999) Serotonin and hippocampal neurogenesis. Neuropsychopharmacol 21: 46S-51S Gouvea TS, Morimoto HK, de Faria MJ, Moreira EG, Gerardin DC (2008) Maternal exposure to the antidepressant fluoxetine impairs sexual motivation in adult male mice. Pharmacology, Biochemistry and Behavior 90: 416-9 Green CB, Takahashi JS, Bass J (2008) The meter of metabolism. Cell 134: 728-42 Greenberg GD, Laman-Maharg A, Campi KL, Voigt H, Orr VN, Schaal L, Trainor BC (2013) Sex differences in stress-induced social withdrawal: role of brain derived neurotrophic factor in the bed nucleus of the stria terminalis. Front Behav Neurosci 7: 223 Grippo AJ, Beltz TG, Johnson AK (2003) Behavioral and cardiovascular changes in the chronic mild stress model of depression. Physiology and Behavior 78: 703-10 Grippo AJ, Francis J, Beltz TG, Felder RB, Johnson AK (2005) Neuroendocrine and cytokine profile of chronic mild stress-induced anhedonia. Physiol Behav 84: 697-706 Grizenko N, Fortier ME, Zadorozny C, Thakur G, Schmitz N, Duval R, Joober R (2012) Maternal Stress during Pregnancy, ADHD Symptomatology in Children and Genotype: Gene-Environment Interaction. J Can Acad Child Adolesc Psychiatry 21: 9-15 Groenink L, Bijlsma EY, van Bogaert MJ, Oosting RS, Olivier B (2011) Serotonin1A receptor deletion does not interact with maternal separation-induced increases in startle reactivity and prepulse inhibition deficits. Psychopharmacology (Berl) 214: 353-65 Gronli J, Murison R, Fiske E, Bjorvatn B, Sorensen E, Portas CM, Ursin R (2005) Effects of chronic mild stress on sexual behavior, locomotor activity and consumption of sucrose and saccharine solutions. Physiol Behav 84: 571-7

237

Gross C, Santarelli L, Brunner D, Zhuang X, Hen R (2000) Altered fear circuits in 5- HT(1A) receptor KO mice. Biol Psychiatry 48: 1157-63 Grote NK, Bridge JA, Gavin AR, Melville JL, Iyengar S, Katon WJ (2010) A meta- analysis of depression during pregnancy and the risk of preterm birth, low birth weight, and intrauterine growth restriction. Arch Gen Psychiatry 67: 1012-24 Gunduz-Cinar O, Flynn S, Brockway E, Kaugars K, Baldi R, Ramikie TS, Cinar R, Kunos G, Patel S, Holmes A (2016) Fluoxetine Facilitates Fear Extinction Through Amygdala Endocannabinoids. Neuropsychopharmacol 41: 1598-609 Gunnar MR (1992) Reactivity of the hypothalamic-pituitary-adrenocortical system to stressors in normal infants and children. Pediatrics 90: 491-7 Gutierrez-Rojas C, Pascual R, Bustamante C (2013) Prenatal stress alters the behavior and dendritic morphology of the medial orbitofrontal cortex in mouse offspring during lactation. International journal of developmental neuroscience : the official journal of the International Society for Developmental Neuroscience 31: 505-11 Gutteling BM, de Weerth C, Willemsen-Swinkels SHN, Huizink AC, Mulder EJH, Visser GHA, Buitelaar JK (2005) The effects of prenatal stress on temperament and problem behavior of 27-month-old toddlers. European Child and Adolescent Psychiatry 14: 41-51 Handley SL, Mithani S (1984) Effects of alpha-adrenoceptor agonists and antagonists in a maze-exploration model of 'fear'-motivated behaviour. Naunyn-Schmiedeberg's Archives of Pharmacology 327: 1-5 Hanley GE, Brain U, Oberlander TF (2015) Prenatal exposure to serotonin reuptake inhibitor antidepressants and childhood behavior. Pediatr Res 78: 174-80 Hariri AR, Holmes A (2006) Genetics of emotional regulation: the role of the serotonin transporter in neural function. Trends In Cognitive Sciences 10: 182-191 Hayashi A, Nagaoka M, Yamada K, Ichitani Y, Miake Y, Okado N (1998) Maternal stress induces synaptic loss and developmental disabilities of offspring. International Journal of Developmental Neuroscience 16: 209-216 He M, Sibille E, Benjamin D, Toth M, Shippenberg T (2001) Differential effects of 5- HT1A receptor deletion upon basal and fluoxetine-evoked 5-HT concentrations as revealed by in vivo microdialysis. Brain Res 902: 11-7 Heiderstadt KM, McLaughlin RM, Wright DC, Walker SE, Gomez-Sanchez CE (2000) The effect of chronic food and water restriction on open-field behaviour and serum corticosterone levels in rats. Lab Anim 34: 20-8 Heiming RS, Jansen F, Lewejohann L, Kaiser S, Schmitt A, Lesch KP, Sachser N (2009) Living in a dangerous world: the shaping of behavioral profile by early environment and 5-HTT genotype. Front Behav Neurosci 3 Heisler LK, Chu HM, Brennan TJ, Danao JA, Bajwa P, Parsons LH, Tecott LH (1998) Elevated anxiety and antidepressant-like responses in serotonin 5-HT1A receptor mutant mice. Proc Natl Acad Sci U S A 95: 15049-54 Hendrick V, Smith LM, Suri R, Hwang S, Haynes D, Altshuler L (2003) Birth outcomes after prenatal exposure to antidepressant medication. American Journal Of Obstetrics And Gynecology 188: 812-815 Henry C, Guegant G, Cador M, Arnauld E, Arsaut J, Le Moal M, Demotes-Mainard J (1995) Prenatal stress in rats facilitates amphetamine-induced sensitization and

238

induces long-lasting changes in dopamine receptors in the nucleus accumbens. Brain Research 685: 179-86 Henry C, Kabbaj M, Simon H, Le Moal M, Maccari S (1994) Prenatal stress increases the hypothalamo-pituitary-adrenal axis response in young and adult rats. J Neuroendocrinol 6: 341-5 Héry F, Boulenguez P, Sémont A, Héry M, Becquet D, Faudon M, Deprez P, Fache MP (1999) Identification and role of serotonin 5-HT1A and 5-HT1B receptors in primary cultures of rat embryonic rostral raphe nucleus neurons. J Neurochem 72: 1791-1801 Hill MN, Hellemans KGC, Verma P, Gorzalka BB, Weinberg J (2012) Neurobiology of chronic mild stress: parallels to major depression. Neuroscience and Biobehavioral Reviews 36: 2085-117 Hill MN, Ho WS, Hillard CJ, Gorzalka BB (2008) Differential effects of the antidepressants tranylcypromine and fluoxetine on limbic cannabinoid receptor binding and endocannabinoid contents. J Neural Transm (Vienna) 115: 1673-9 Hill MN, Kumar SA, Filipski SB, Iverson M, Stuhr KL, Keith JM, Cravatt BF, Hillard CJ, Chattarji S, McEwen BS (2013) Disruption of fatty acid amide hydrolase activity prevents the effects of chronic stress on anxiety and amygdalar microstructure. Molecular Psychiatry 18: 1125-35 Hill MN, McEwen BS (2010) Involvement of the endocannabinoid system in the neurobehavioural effects of stress and glucocorticoids. Prog Neuropsychopharmacol Biol Psychiatry 34: 791-7 Hill MN, Patel S, Campolongo P, Tasker JG, Wotjak CT, Bains JS (2010) Functional interactions between stress and the endocannabinoid system: from synaptic signaling to behavioral output. J Neurosci 30: 14980-6 Hill MN, Patel S, Carrier EJ, Rademacher DJ, Ormerod BK, Hillard CJ, Gorzalka BB (2005) Downregulation of endocannabinoid signaling in the hippocampus following chronic unpredictable stress. Neuropsychopharmacol 30: 508-515 Hill MN, Tasker JG (2012) Endocannabinoid signaling, glucocorticoid-mediated negative feedback, and regulation of the hypothalamic-pituitary-adrenal axis. Neuroscience 204: 5-16 Hillion J, Catelon J, Raid M, Hamon M, De Vitry F (1994) Neuronal localization of 5- HT1A receptor mRNA and protein in rat embryonic brain stem cultures. Brain Research Developmental Brain Research 79: 195-202 Hirvikoski T, Lindholm T, Lajic S, Nordenstrom A (2011) Gender role behaviour in prenatally dexamethasone-treated children at risk for congenital adrenal hyperplasia--a pilot study. Acta Paediatrica 100: e112-9 Hirvikoski T, Nordenstrom A, Lindholm T, Lindblad F, Ritzen EM, Wedell A, Lajic S (2007) Cognitive functions in children at risk for congenital adrenal hyperplasia treated prenatally with dexamethasone. The Journal of clinical endocrinology and metabolism 92: 542-8 Hobfoll SE, Ritter C, Lavin J, Hulsizer MR, Cameron RP (1995) Depression prevalence and incidence among inner-city pregnant and postpartum women. Journal Of Consulting And Clinical Psychology 63: 445-453

239

Hogg S (1996) A review of the validity and variability of the elevated plus-maze as an animal model of anxiety. Pharmacol Biochem Behav 54: 21-30 Holloway T, Moreno JL, Umali A, Rayannavar V, Hodes GE, Russo SJ, Gonzalez-Maeso J (2013) Prenatal Stress Induces Schizophrenia-Like Alterations of Serotonin 2A and Metabotropic Glutamate 2 Receptors in the Adult Offspring: Role of Maternal Immune System. J Neurosci 33: 1088-1098 Holmes A (2001) Targeted gene mutation approaches to the study of anxiety-like behavior in mice. Neurosci Biobehav R 25: 261-273 Holmes MC, Abrahamsen CT, French KL, Paterson JM, Mullins JJ, Seckl JR (2006) The mother or the fetus? 11beta-hydroxysteroid dehydrogenase type 2 null mice provide evidence for direct fetal programming of behavior by endogenous glucocorticoids. The Journal of neuroscience : the official journal of the Society for Neuroscience 26: 3840-4 Isgor C, Kabbaj M, Akil H, Watson SJ (2004) Delayed effects of chronic variable stress during peripubertal-juvenile period on hippocampal morphology and on cognitive and stress axis functions in rats. Hippocampus 14: 636-48 Ishiwata H, Shiga T, Okado N (2005) Selective serotonin reuptake inhibitor treatment of early postnatal mice reverses their prenatal stress-induced brain dysfunction. Neuroscience 133: 893-901 Itoi K, Suda T, Tozawa F, Dobashi I, Ohmori N, Sakai Y, Abe K, Demura H (1994) Microinjection of norepinephrine into the paraventricular nucleus of the hypothalamus stimulates corticotropin-releasing factor gene expression in conscious rats. Endocrinology 135: 2177-82 Jacobs BL (1976) An animal behavior model for studying central serotonergic synapses. Life Sci 19: 777-85 Jacobs BL, Martin-Cora FJ, Fornal CA (2002) Activity of medullary serotonergic neurons in freely moving animals. Brain Res Brain Res Rev 40: 45-52 Johns JM, Joyner PW, McMurray MS, Elliott DL, Hofler VE, Middleton CL, Knupp K, Greenhill KW, Lomas LM, Walker CH (2005) The effects of dopaminergic/serotonergic reuptake inhibition on maternal behavior, maternal aggression, and oxytocin in the rat. Pharmacology, Biochemistry and Behavior 81: 769-85 Joseph V, Mamet J, Lee F, Dalmaz Y, Van Reeth O (2002) Prenatal hypoxia impairs circadian synchronisation and response of the biological clock to light in adult rats. J Physiol 543: 387-95 Karpova NN, Lindholm J, Pruunsild P, Timmusk T, Castren E (2009) Long-lasting behavioural and molecular alterations induced by early postnatal fluoxetine exposure are restored by chronic fluoxetine treatment in adult mice. Eur Neuropsychopharm 19: 97-108 Karst H, Berger S, Turiault M, Tronche F, Schutz G, Joels M (2005) Mineralocorticoid receptors are indispensable for nongenomic modulation of hippocampal glutamate transmission by corticosterone. Proc Natl Acad Sci U S A 102: 19204-7 Katz RJ, Roth KA, Carroll BJ (1981) Acute and chronic stress effects on open field activity in the rat: implications for a model of depression. Neuroscience and Biobehavioral Reviews 5: 247-51

240

Keegan CE, Herman JP, Karolyi IJ, O'Shea KS, Camper SA, Seasholtz AF (1994) Differential expression of corticotropin-releasing hormone in developing mouse embryos and adult brain. Endocrinology 134: 2547-55 Keshet GI, Weinstock M (1995) Maternal naltrexone prevents morphological and behavioral alterations induced in rats by prenatal stress. Pharmacology, biochemistry, and behavior 50: 413-9 Kessler RC (1997) The effects of stressful life events on depression. Annual Review of Psychology 48: 191-214 Khashan AS, Abel KM, McNamee R, Pedersen MG, Webb RT, Baker PN, Kenny LC, Mortensen PB (2008) Higher risk of offspring schizophrenia following antenatal maternal exposure to severe adverse life events. Arch Gen Psychiatry 65: 146-52 Kieler H, Artama M, Engeland A, Ericsson O, Furu K, Gissler M, Nielsen RB, Norgaard M, Stephansson O, Valdimarsdottir U, Zoega H, Haglund B (2012) Selective serotonin reuptake inhibitors during pregnancy and risk of persistent pulmonary hypertension in the newborn: population based cohort study from the five Nordic countries. BMJ (Clinical research ed ) 344: d8012 Kim D, Tolliver TJ, Huang S-J, Martin BJ, Andrews AM, Wichems C, Holmes A, Lesch K-P, Murphy DL (2005) Altered serotonin synthesis, turnover and dynamic regulation in multiple brain regions of mice lacking the serotonin transporter. Neuropharmacology 49: 798-810 Kim J, Riggs KW, Misri S, Kent N, Oberlander T, Grunau R, Fitzgerald C, Rurak D (2006) Stereoselective disposition of fluoxetine and norfluoxetine during pregnancy and breast-feeding. British Journal of Clinical Pharmacology 61: 155- 163 Kinney DK, Munir KM, Crowley DJ, Miller AM (2008) Prenatal stress and risk for autism. Neurosci Biobehav R 32: 1519-1532 Kinsley C, Svare B (1986) Prenatal stress reduces intermale aggression in mice. Physiol Behav 36: 783-6 Kinsley C, Svare B (1987) Genotype Modulates Prenatal Stress Effects on Aggression in Male and Female Mice. Behav Neural Biol 47: 138-150 Kiryanova V, Dyck RH (2014) Increased aggression, improved spatial memory, and reduced anxiety-like behaviour in adult male mice exposed to fluoxetine early in life. Dev Neurosci 36: 396-408 Kiryanova V, McAllister BB, Dyck RH (2013a) Long-term outcomes of developmental exposure to fluoxetine: a review of the animal literature. Dev Neurosci 35: 437-9 Kiryanova V, Meunier SJ, Vecchiarelli HA, Hill MN, Dyck RH (2016a) Effects of maternal stress and perinatal fluoxetine exposure on behavioral outcomes of adult male offspring. Neuroscience 320: 281-96 Kiryanova V, Smith VM, Dyck RH, Antle MC (2013b) The effects of perinatal fluoxetine treatment on the circadian system of the adult mouse. Psychopharmacology (Berl) 225: 743-51 Kiryanova V, Smith VM, Dyck RH, Antle MC (2016b) Circadian behavior of adult mice exposed to stress and fluoxetine during development. Psychopharmacology (Berl)

241

Kitamura T, Shima S, Sugawara M, Toda MA (1993) Psychological and Social Correlates of the Onset of Affective-Disorders among Pregnant-Women. Psychol Med 23: 967-975 Kjaer SL, Wegener G, Rosenberg R, Lund SP, Hougaard KS (2010) Prenatal and adult stress interplay--behavioral implications. Brain Res 1320: 106-13 Kleinhaus K, Harlap S, Perrin M, Manor O, Margalit-Calderon R, Opler M, Friedlander Y, Malaspina D (2013) Prenatal stress and affective disorders in a population birth cohort. Bipolar Disord 15: 92-9 Klemenhagen KC, Gordon JA, David DJ, Hen R, Gross CT (2006) Increased fear response to contextual cues in mice lacking the 5-HT1A receptor. Neuropsychopharmacol 31: 101-11 Knaepen L, Rayen I, Charlier TD, Fillet M, Houbart V, van Kleef M, Steinbusch HW, Patijn J, Tibboel D, Joosten EA, Pawluski JL (2013) Developmental Fluoxetine Exposure Normalizes the Long-Term Effects of Maternal Stress on Post- Operative Pain in Sprague-Dawley Rat Offspring. Plos One 8 Koehl M, Barbazanges A, Le Moal M, Maccari S (1997) Prenatal stress induces a phase advance of circadian corticosterone rhythm in adult rats which is prevented by postnatal stress. Brain Research 759: 317-20 Koehl M, Darnaudery M, Dulluc J, Van Reeth O, Le Moal M, Maccari S (1999) Prenatal stress alters circadian activity of hypothalamo-pituitary-adrenal axis and hippocampal corticosteroid receptors in adult rats of both gender. J Neurobiol 40: 302-15 Koenig JI, Elmer GI, Shepard PD, Lee PR, Mayo C, Joy B, Hercher E, Brady DL (2005) Prenatal exposure to a repeated variable stress paradigm elicits behavioral and neuroendocrinological changes in the adult offspring: potential relevance to schizophrenia. Behav Brain Res 156: 251-261 Koethe D, Llenos IC, Dulay JR, Hoyer C, Torrey EF, Weis S, Leiveke FM (2007) Changes of CB1 cannabinoid receptor expression following selective serotonin reuptake inhibitors (SSRI) and first generation antipsychotics (FGA) in depression and bipolar disorder. Pharmacopsychiatry 40: 211-211 Kokras N, Dalla C (2014) Sex differences in animal models of psychiatric disorders. Br J Pharmacol 171: 4595-619 Kolb B (1984) Functions of the frontal cortex of the rat: a comparative review. Brain Res 320: 65-98 Kosten TA, Miserendino MJ, Bombace JC, Lee HJ, Kim JJ (2005) Sex-selective effects of neonatal isolation on fear conditioning and foot shock sensitivity. Behav Brain Res 157: 235-44 Kretz O, Schmid W, Berger S, Gass P (2001) The mineralocorticoid receptor expression in the mouse CNS is conserved during development. Neuroreport 12: 1133-7 Kristensen JH, Ilett KF, Hackett LP, Yapp P, Paech M, Begg EJ (1999) Distribution and excretion of fluoxetine and norfluoxetine in human milk. British Journal of Clinical Pharmacology 48: 521-7 Kusserow H, Davies B, Hortnagl H, Voigt I, Stroh T, Bert B, Deng DR, Fink H, Veh RW, Theuring F (2004) Reduced anxiety-related behaviour in transgenic mice

242

overexpressing serotonin 1A receptors. Brain research Molecular brain research 129: 104-16 Kyriacou CP, Hastings MH (2010) Circadian clocks: genes, sleep, and cognition. Trends Cogn Sci 14: 259-67 Lammers JH, Kruk MR, Meelis W, van der Poel AM (1988) Hypothalamic substrates for brain stimulation-induced attack, teeth-chattering and social grooming in the rat. Brain Res 449: 311-27 Lanfumey L, Mongeau R, Cohen-Salmon C, Hamon M (2008) Corticosteroid-serotonin interactions in the neurobiological mechanisms of stress-related disorders. Neurosci Biobehav Rev 32: 1174-84 Lang UE, Gunther L, Scheuch K, Klein J, Eckhart S, Hellweg R, Danker-Hopfe H, Oehler J (2009) Higher BDNF concentrations in the hippocampus and cortex of an aggressive mouse strain. Behavioural Brain Research 197: 246-9 Lauder JM (1993) Neurotransmitters as growth regulatory signals: role of receptors and second messengers. Trends in Neurosciences 16: 233-40 Lauder JM, Krebs H (1978) Serotonin as a differentiation signal in early neurogenesis. Developmental Neuroscience 1: 15-30 Lebron-Milad K, Tsareva A, Ahmed N, Milad MR (2013) Sex differences and estrous cycle in female rats interact with the effects of fluoxetine treatment on fear extinction. Behav Brain Res 253: 217-22 Lee EJ, Son GH, Chung S, Lee S, Kim J, Choi S, Kim K (2011) Impairment of fear memory consolidation in maternally stressed male mouse offspring: evidence for nongenomic glucocorticoid action on the amygdala. J Neurosci 31: 7131-40 Lee J-H, Tajuddin NF, Druse MJ (2009) Effects of ethanol and ipsapirone on the expression of genes encoding anti-apoptotic proteins and an antioxidant enzyme in ethanol-treated neurons. Brain Research 1249: 54-60 Lee L-J (2009) Neonatal fluoxetine exposure affects the neuronal structure in the somatosensory cortex and somatosensory-related behaviors in adolescent rats. Neurotoxicity Research 15: 212-223 Lee L-J, Lee LJ-H (2012) Neonatal fluoxetine exposure alters motor performances of adolescent rats. Developmental Neurobiology 72: 1122-32 Legutko R, Gannon RL (2001) Serotonin transporter localization in the hamster suprachiasmatic nucleus. Brain Res 893: 77-83 Lehmann J, Stohr T, Feldon J (2000) Long-term effects of prenatal stress experiences and postnatal maternal separation on emotionality and attentional processes. Behav Brain Res 107: 133-44 Lepsch LB, Gonzalo LA, Magro FJ, Delucia R, Scavone C, Planeta CS (2005) Exposure to chronic stress increases the locomotor response to cocaine and the basal levels of corticosterone in adolescent rats. Addict Biol 10: 251-6 Lesage J, Del-Favero F, Leonhardt M, Louvart H, Maccari S, Vieau D, Darnaudery M (2004) Prenatal stress induces intrauterine growth restriction and programmes glucose intolerance and feeding behaviour disturbances in the aged rat. The Journal of endocrinology 181: 291-6

243

Lester BM, Cucca J, Andreozzi L, Flanagan P, Oh W (1993) Possible Association between Fluoxetine Hydrochloride and Colic in an Infant. Journal of the American Academy of Child and Adolescent Psychiatry 32: 1253-1255 Levinstein MR, Samuels BA (2014) Mechanisms underlying the antidepressant response and treatment resistance. Frontiers in Behavioral Neuroscience 8: 208 Levitt NS, Lindsay RS, Holmes MC, Seckl JR (1996) Dexamethasone in the last week of pregnancy attenuates hippocampal glucocorticoid receptor gene expression and elevates blood pressure in the adult offspring in the rat. Neuroendocrinology 64: 412-8 Lewis RJ, Johnson RD, Angier MK (2007) The Distribution of Fluoxetine and Norfluoxetine in Postmortem Fluids and Tissues. Federal Aviation Administration Civil Aerospace Medical Institute, Oklahoma City, pp 1-12 Li A, Hardy R, Stoner S, Tuckermann J, Seibel M, Zhou H (2013) Deletion of mesenchymal glucocorticoid receptor attenuates embryonic lung development and abdominal wall closure. PLoS ONE 8: e63578 Lindsay RS, Lindsay RM, Edwards CR, Seckl JR (1996a) Inhibition of 11-beta- hydroxysteroid dehydrogenase in pregnant rats and the programming of blood pressure in the offspring. Hypertension 27: 1200-4 Lindsay RS, Lindsay RM, Waddell BJ, Seckl JR (1996b) Prenatal glucocorticoid exposure leads to offspring hyperglycaemia in the rat: studies with the 11 beta- hydroxysteroid dehydrogenase inhibitor carbenoxolone. Diabetologia 39: 1299- 305 Lipp HP, Hunsperger RW (1978) Threat, attack and flight elicited by electrical stimulation of the ventromedial hypothalamus of the marmoset monkey Callithrix jacchus. Brain Behav Evol 15: 260-93 Lisboa SFS, Oliveira PE, Costa LC, Venancio EJ, Moreira EG (2007) Behavioral evaluation of male and female mice pups exposed to fluoxetine during pregnancy and lactation. Pharmacology 80: 49-56 Llorente-Berzal A, Mela V, Borcel E, Valero M, Lopez-Gallardo M, Viveros MP, Marco EM (2012) Neurobehavioral and metabolic long-term consequences of neonatal maternal deprivation stress and adolescent olanzapine treatment in male and female rats. Neuropharmacology 62: 1332-1341 Lopez JF, Chalmers DT, Little KY, Watson SJ (1998) A.E. Bennett Research Award. Regulation of serotonin1A, glucocorticoid, and mineralocorticoid receptor in rat and human hippocampus: implications for the neurobiology of depression. Biol Psychiatry 43: 547-73 Lopez-Gallardo M, Lopez-Rodriguez AB, Llorente-Berzal A, Rotllant D, Mackie K, Armario A, Nadal R, Viveros MP (2012) Maternal Deprivation and Adolescent Cannabinoid Exposure Impact Hippocampal Astrocytes, Cbi Receptors and Brain-Derived Neurotrophic Factor in a Sexually Dimorphic Fashion. Neuroscience 204: 90-103 Lovenberg TW, Baron BM, de Lecea L, Miller JD, Prosser RA, Rea MA, Foye PE, Racke M, Slone AL, Siegel BW, Danielson PE, Sutcliffe JG, Erlander MG (1993) A novel adenylyl cyclase-activating serotonin receptor (5-HT7) implicated in the regulation of mammalian circadian rhythms. Neuron 11: 449-58

244

MacArthur BA, Howie RN, Dezoete JA, Elkins J (1982) School progress and cognitive development of 6-year-old children whose mothers were treated antenatally with betamethasone. Pediatrics 70: 99-105 Maccari S, Darnaudery M, Morley-Fletcher S, Zuena AR, Cinque C, Van Reeth O (2003) Prenatal stress and long-term consequences: implications of glucocorticoid hormones. Neurosci Biobehav R 27: 119-127 Maccari S, Piazza PV, Kabbaj M, Barbazanges A, Simon H, Le Moal M (1995) Adoption reverses the long-term impairment in glucocorticoid feedback induced by prenatal stress. J Neurosci 15: 110-6 Malaspina D, Corcoran C, Kleinhaus KR, Perrin MC, Fennig S, Nahon D, Friedlander Y, Harlap S (2008) Acute maternal stress in pregnancy and schizophrenia in offspring: a cohort prospective study. BMC Psychiatry 8: 71 Malberg JE, Eisch AJ, Nestler EJ, Duman RS (2000) Chronic antidepressant treatment increases neurogenesis in adult rat hippocampus. J Neurosci 20: 9104-10 Malm H (2012) Prenatal exposure to selective serotonin reuptake inhibitors and infant outcome. Therapeutic Drug Monitoring 34: 607-14 Malm H, Artama M, Gissler M, Ritvanen A (2011) Selective serotonin reuptake inhibitors and risk for major congenital anomalies. Obstetrics and Gynecology 118: 111-20 Mandrioli R, Mercolini L, Saracino MA, Raggi MA (2012) Selective Serotonin Reuptake Inhibitors (SSRIs): Therapeutic Drug Monitoring and Pharmacological Interactions. Curr Med Chem 19: 1846-1863 Marcus SM, Flynn HA, Blow FC, Barry KL (2003) Depressive symptoms among pregnant women screened in obstetrics settings. Journal of women's health (2002) 12: 373-80 Markel AL, Kazin EM, Lur'e SB, Naumenko EV (1981) [Effect of stress in early ontogeny on the circadian rhythm of rat corticosteroid function]. Ontogenez 12: 257-65 Markham JA, Mullins SE, Koenig JI (2013) Periadolescent maturation of the prefrontal cortex is sex-specific and is disrupted by prenatal stress. The Journal of comparative neurology 521: 1828-43 Markham JA, Taylor AR, Taylor SB, Bell DB, Koenig JI (2010) Characterization of the cognitive impairments induced by prenatal exposure to stress in the rat. Front Behav Neurosci 4: 173 Mato S, Vidal R, Castro E, Diaz A, Pazos A, Valdizan EM (2010) Long-Term Fluoxetine Treatment Modulates Cannabinoid Type 1 Receptor-Mediated Inhibition of Adenylyl Cyclase in the Rat Prefrontal Cortex through 5-Hydroxytryptamine(1A) Receptor-Dependent Mechanisms. Molecular Pharmacology 77: 424-434 Matrisciano F, Tueting P, Maccari S, Nicoletti F, Guidotti A (2012) Pharmacological Activation of Group-II Metabotropic Glutamate Receptors Corrects a Schizophrenia-Like Phenotype Induced by Prenatal Stress in Mice. Neuropsychopharmacology 37: 929-938 Matsuzaki H, Izumi T, Matsumoto M, Togashi H, Yamaguchi T, Yoshida T, Watanabe M, Yoshioka M (2009) Early postnatal stress affects 5-HT1A receptor function in the medial prefrontal cortex in adult rats. Eur J Pharmacol 615: 76-82

245

Matthews SG (2002) Early programming of the hypothalamo-pituitary-adrenal axis. Trends Endocrinol Metab 13: 373-80 Maynard TM, Sikich L, Lieberman JA, LaMantia AS (2001) Neural development, cell- cell signaling, and the "two-hit" hypothesis of schizophrenia. Schizophr Bull 27: 457-76 McAllister BB, Kiryanova V, Dyck RH (2012) Behavioural outcomes of perinatal maternal fluoxetine treatment. Neuroscience 226: 356-66 McCobb DP, Haydon PG, Kater SB (1988) Dopamine and serotonin inhibition of neurite elongation of different identified neurons. J Neurosci Res 19: 19-26 McEwen BS (1998) Protective and damaging effects of stress mediators. The New England journal of medicine 338: 171-9 McEwen BS (2013) The Brain on Stress: Toward an Integrative Approach to Brain, Body, and Behavior. Perspectives On Psychological Science 8: 673-675 McGaugh JL (2000) Memory--a century of consolidation. Science 287: 248-51 McKee MD, Cunningham M, Jankowski KR, Zayas L (2001) Health-related functional status in pregnancy: relationship to depression and social support in a multi-ethnic population. Obstetrics And Gynecology 97: 988-993 Meaney MJ, Diorio J, Francis D, LaRocque S, O'Donnell D, Smythe JW, Sharma S, Tannenbaum B (1994) Environmental regulation of the development of glucocorticoid receptor systems in the rat forebrain. The role of serotonin. Annals Of The New York Academy Of Sciences 746: 260 Meek LR, Dittel PL, Sheehan MC, Chan JY, Kjolhaug SR (2001) Effects of stress during pregnancy on maternal behavior in mice. Physiology and Behavior 72: 473-9 Meijer OC, de Kloet ER (1994) Corticosterone suppresses the expression of 5-HT1A receptor mRNA in rat dentate gyrus. Eur J Pharmacol 266: 255-61 Mendelson SD, McEwen BS (1991) Autoradiographic analyses of the effects of restraint- induced stress on 5-HT1A, 5-HT1C and 5-HT2 receptors in the dorsal hippocampus of male and female rats. Neuroendocrinology 54: 454-61 Mendes-da-Silva C, de Souza SL, Barreto-Medeiros JM, de Freitas-Silva SR, Antunes DEC, Cunha ADU, Ribas VR, de França MFS, Nogueira MI, Manhães-de-Castro R (2002) Neonatal treatment with fluoxetine reduces depressive behavior induced by forced swim in adult rats. Arquivos De Neuro-Psiquiatria 60: 928-931 Meyer JS (1983) Early adrenalectomy stimulates subsequent growth and development of the rat brain. Experimental Neurology 82: 432-46 Meyer-Bahlburg HFL, Dolezal C, Baker SW, Carlson AD, Obeid JS, New MI (2004) Cognitive and motor development of children with and without congenital adrenal hyperplasia after early-prenatal dexamethasone. The Journal of clinical endocrinology and metabolism 89: 610-4 Meyer-Bernstein EL, Morin LP (1996) Differential serotonergic innervation of the suprachiasmatic nucleus and the intergeniculate leaflet and its role in circadian rhythm modulation. The Journal Of Neuroscience: The Official Journal Of The Society For Neuroscience 16: 2097-2111 Miller WL, Witchel SF (2013) Prenatal treatment of congenital adrenal hyperplasia: risks outweigh benefits. American Journal of Obstetrics and Gynecology 208: 354-9

246

Mistlberger RE, Antle MC (2006) The enigma of behavioral inputs to the circadian clock: a test of function using restraint. Physiol Behav 87: 948-54 Mistlberger RE, Antle MC, Glass JD, Miller JD (2000) Behavioral and serotonergic regulation of circadian rhythms. Biological Rhythm Research 31: 240-283 Mitchell AA, Gilboa SM, Werler MM, Kelley KE, Louik C, Hernandez-Diaz S, National Birth Defects Prevention S (2011) Medication use during pregnancy, with particular focus on prescription drugs: 1976-2008. American Journal of Obstetrics and Gynecology 205: 51.e1-8 Miyagawa K, Tsuji M, Fujimori K, Saito Y, Takeda H (2011) Prenatal stress induces anxiety-like behavior together with the disruption of central serotonin neurons in mice. Neurosci Res 70: 111-117 Miyagawa K, Tsuji M, Ishii D, Takeda K, Takeda H (2015) Prenatal stress induces vulnerability to stress together with the disruption of central serotonin neurons in mice. Behav Brain Res 277: 228-36 Moga MM, Moore RY (1997) Organization of neural inputs to the suprachiasmatic nucleus in the rat. The Journal Of Comparative Neurology 389: 508-534 Moiseiwitsch JR, Lauder JM (1995) Serotonin regulates mouse cranial neural crest migration. Proc Natl Acad Sci U S A 92: 7182-6 Monroe SM, Hadjiyannakis K (2002) The social environment and depression: focusing on severe life stress, 3 edn. Guilford, New York Moore TM, Scarpa A, Raine A (2002) A meta-analysis of serotonin metabolite 5-HIAA and antisocial behavior. Aggressive Behavior 28: 299-316 Morena M, Campolongo P (2014) The endocannabinoid system: an emotional buffer in the modulation of memory function. Neurobiol Learn Mem 112: 30-43 Morin LP (1999) Serotonin and the regulation of mammalian circadian rhythmicity. Ann Med 31: 12-33 Morin LP, Allen CN (2006) The circadian visual system, 2005. Brain Research Reviews 51: 1-60 Morley-Fletcher S, Darnaudery M, Mocaer E, Froger N, Lanfumey L, Laviola G, Casolini P, Zuena AR, Marzano L, Hamon M, Maccari S (2004) Chronic treatment with imipramine reverses immobility behaviour, hippocampal corticosteroid receptors and cortical 5-HT(1A) receptor mRNA in prenatally stressed rats. Neuropharmacology 47: 841-7 Morley-Fletcher S, Mairesse J, Soumier A, Banasr M, Fagioli F, Gabriel C, Mocaer E, Daszuta A, McEwen B, Nicoletti F, Maccari S (2011) Chronic agomelatine treatment corrects behavioral, cellular, and biochemical abnormalities induced by prenatal stress in rats. Psychopharmacology (Berl) 217: 301-13 Morrison JL, Chien C, Gruber N, Rurak D, Riggs W (2001) Fetal behavioural state changes following maternal fluoxetine infusion in sheep. Brain Research Developmental Brain Research 131: 47-56 Morrison JL, Riggs KW, Chien C, Gruber N, McMillen IC, Rurak DW (2004) Chronic maternal fluoxetine infusion in pregnant sheep: effects on the maternal and fetal hypothalamic-pituitary-adrenal axes. Pediatric Research 56: 40-46 Morrison JL, Riggs KW, Rurak DW (2005) Fluoxetine during pregnancy: impact on fetal development. Reproduction, Fertility, And Development 17: 641-650

247

Moyer RW, Kennaway DJ (1999) Immunohistochemical localization of serotonin receptors in the rat suprachiasmatic nucleus. Neurosci Lett 271: 147-50 Mueller BR, Bale TL (2007) Early prenatal stress impact on coping strategies and learning performance is sex dependent. Physiol Behav 91: 55-65 Mueller BR, Bale TL (2008) Sex-specific programming of offspring emotionality after stress early in pregnancy. J Neurosci 28: 9055-65 Muller JC, Boareto AC, Lourenco ELB, Zaia RM, Kienast MF, Spercoski KM, Morais RN, Martino-Andrade AJ, Dalsenter PR (2013) In utero and lactational exposure to fluoxetine in wistar rats: pregnancy outcomes and sexual development. Basic and Clinical Pharmacology and Toxicology 113: 132-40 Muneoka K, Mikuni M, Ogawa T, Kitera K, Kamei K, Takigawa M, Takahashi K (1997) Prenatal dexamethasone exposure alters brain monoamine metabolism and adrenocortical response in rat offspring. Am J Physiol 273: R1669-75 Murase T (1994) The effects of maternal stress on the aromatase activity in the perinatal rat brain. Nihon Naibunpi Gakkai zasshi 70: 95-104 Murmu MS, Salomon S, Biala Y, Weinstock M, Braun K, Bock J (2006) Changes of spine density and dendritic complexity in the prefrontal cortex in offspring of mothers exposed to stress during pregnancy. The European journal of neuroscience 24: 1477-87 Mychasiuk R, Gibb R, Kolb B (2012) Prenatal stress alters dendritic morphology and synaptic connectivity in the prefrontal cortex and hippocampus of developing offspring. Synapse (New York, N Y ) 66: 308-14 Myers RE (1977) Production of fetal asphyxia by maternal psychological stress. Pavlov J Biol Sci 12: 51-62 Nagano M, Liu MY, Inagaki H, Kawada T, Suzuki H (2012) Early intervention with fluoxetine reverses abnormalities in the serotonergic system and behavior of rats exposed prenatally to dexamethasone. Neuropharmacology 63: 292-300 Nanry KP, Tilson HA (1989) The role of 5HT1A receptors in the modulation of the acoustic startle reflex in rats. Psychopharmacology (Berl) 97: 507-13 Nautiyal KM, Tanaka KF, Barr MM, Tritschler L, Le Dantec Y, David DJ, Gardier AM, Blanco C, Hen R, Ahmari SE (2015) Distinct Circuits Underlie the Effects of 5- HT1B Receptors on Aggression and Impulsivity. Neuron 86: 813-26 Nederhof E, Schmidt MV (2012) Mismatch or cumulative stress: toward an integrated hypothesis of programming effects. Physiol Behav 106: 691-700 Neumann ID, Johnstone HA, Hatzinger M, Liebsch G, Shipston M, Russell JA, Landgraf R, Douglas AJ (1998) Attenuated neuroendocrine responses to emotional and physical stressors in pregnant rats involve adenohypophysial changes. J Physiol 508 ( Pt 1): 289-300 New MI, Carlson A, Obeid J, Marshall I, Cabrera MS, Goseco A, Lin-Su K, Putnam AS, Wei JQ, Wilson RC (2001) Prenatal diagnosis for congenital adrenal hyperplasia in 532 pregnancies. The Journal of clinical endocrinology and metabolism 86: 5651-7 Newnham JP, Evans SF, Godfrey M, Huang W, Ikegami M, Jobe A (1999) Maternal, but not fetal, administration of corticosteroids restricts fetal growth. The Journal of maternal-fetal medicine 8: 81-7

248

Nishio H, Kasuga S, Ushijima M, Harada Y (2001) Prenatal stress and postnatal development of neonatal rats sex-dependent effects on emotional behavior and learning ability of neonatal rats. Int J Dev Neurosci 19: 37-45 Noble RE (2005) Depression in women. Metabolism: Clinical And Experimental 54: 49- 52 Noorlander CW, Ververs FFT, Nikkels PGJ, van Echteld CJA, Visser GHA, Smidt MP (2008) Modulation of serotonin transporter function during fetal development causes dilated heart cardiomyopathy and lifelong behavioral abnormalities. Plos One 3: e2782-e2782 Nordquist N, Oreland L (2010) Serotonin, genetic variability, behaviour, and psychiatric disorders - a review. Upsala J Med Sci 115: 2-10 O'Regan D, Kenyon CJ, Seckl JR, Holmes MC (2004) Glucocorticoid exposure in late gestation in the rat permanently programs gender-specific differences in adult cardiovascular and metabolic physiology. American Journal of Physiology Endocrinology and Metabolism 287: E863-70 Oliveira M, Leao P, Rodrigues AJ, Pego JM, Cerqueira JJ, Sousa N (2011) Programming effects of antenatal corticosteroids exposure in male sexual behavior. The journal of sexual medicine 8: 1965-74 Oliver KR, Kinsey AM, Wainwright A, Sirinathsinghji DJ (2000) Localization of 5- ht(5A) receptor-like immunoreactivity in the rat brain. Brain Res 867: 131-42 Olivier B (2004) Serotonin and aggression. Ann N Y Acad Sci 1036: 382-92 Olivier JD, Akerud H, Kaihola H, Pawluski JL, Skalkidou A, Hogberg U, Sundstrom- Poromaa I (2013) The effects of maternal depression and maternal selective serotonin reuptake inhibitor exposure on offspring. Front Cell Neurosci 7: 73 Olivier JDA, Valles A, van Heesch F, Afrasiab-Middelman A, Roelofs JJPM, Jonkers M, Peeters EJ, Korte-Bouws GAH, Dederen JP, Kiliaan AJ, Martens G, Schubert D, Homberg J (2011a) Fluoxetine administration to pregnant rats increases anxiety- related behavior in the offspring. Psychopharmacology 217: 419-32 Olivier JDA, Valles A, van Heesch F, Afrasiab-Middelman A, Roelofs JJPM, Jonkers M, Peeters EJ, Korte-Bouws GAH, Dederen JP, Kiliaan AJ, Martens GJ, Schubert D, Homberg JR (2011b) Fluoxetine administration to pregnant rats increases anxiety- related behavior in the offspring. Psychopharmacology 217: 419-432 Ordian NÉ, Pivina SG, Fedotova IO, Akulova VK (2010) [Comparative efficacy of selective serotonin reuptake inhibitors in young prenatally stressed female rats]. Eksperimental'naia I Klinicheskaia Farmakologiia 73: 7-10 Orozco-Solis R, Matos RJ, Lopes de Souza S, Grit I, Kaeffer B, Manhaes de Castro R, Bolanos-Jimenez F (2011) Perinatal nutrient restriction induces long-lasting alterations in the circadian expression pattern of genes regulating food intake and energy metabolism. Int J Obes (Lond) 35: 990-1000 Palanza PL, Howdeshell KL, Parmigiani S, vom Saal FS (2002) Exposure to a low dose of bisphenol A during fetal life or in adulthood alters maternal behavior in mice. Environmental Health Perspectives 110 Suppl 3: 415-22 Pang RD, Holschneider DP, Miller JD (2012) Circadian rhythmicity in serotonin transporter knockout mice. Life Sciences 91: 365-368

249

Parks CL, Robinson PS, Sibille E, Shenk T, Toth M (1998) Increased anxiety of mice lacking the serotonin1A receptor. Proc Natl Acad Sci U S A 95: 10734-9 Parsons LH, Kerr TM, Tecott LH (2001) 5-HT(1A) receptor mutant mice exhibit enhanced tonic, stress-induced and fluoxetine-induced serotonergic neurotransmission. J Neurochem 77: 607-17 Pascual R, Ebner D, Araneda R, Urqueta MJ, Bustamante C (2010) Maternal stress induces long-lasting Purkinje cell developmental impairments in mouse offspring. European Journal of Pediatrics 169: 1517-22 Patin V, Lordi B, Vincent A, Caston J (2005) Effects of prenatal stress on anxiety and social interactions in adult rats. Brain Res Dev Brain Res 160: 265-74 Patin V, Lordi B, Vincent A, Thoumas JL, Vaudry H, Caston J (2002) Effects of prenatal stress on maternal behavior in the rat. Brain research Developmental brain research 139: 1-8 Paulus EV, Mintz EM (2013) Photic and nonphotic responses of the circadian clock in serotonin-deficient Pet-1 knockout mice. Chronobiol Int 30: 1251-1260 Pawluski JL, Brain UM, Underhill CM, Hammond GL, Oberlander TF (2012a) Prenatal SSRI exposure alters neonatal corticosteroid binding globulin, infant cortisol levels, and emerging HPA function. Psychoneuroendocrinology 37: 1019-28 Pawluski JL, Charlier TD, Fillet M, Houbart V, Crispin HT, Steinbusch HW, van den Hove DL (2012b) Chronic fluoxetine treatment and maternal adversity differentially alter neurobehavioral outcomes in the rat dam. Behav Brain Res 228: 159-68 Pawluski JL, Rayen I, Niessen NA, Kristensen S, van Donkelaar EL, Balthazart J, Steinbusch HW, Charlier TD (2012c) Developmental fluoxetine exposure differentially alters central and peripheral measures of the HPA system in adolescent male and female offspring. Neuroscience 220: 131-41 Pawluski JL, van den Hove DL, Rayen I, Prickaerts J, Steinbusch HW (2011) Stress and the pregnant female: Impact on hippocampal cell proliferation, but not affective- like behaviors. Horm Behav 59: 572-80 Pedersen CA, Vadlamudi SV, Boccia ML, Amico JA (2006) Maternal behavior deficits in nulliparous oxytocin knockout mice. Genes, Brain, and Behavior 5: 274-81 Pedersen LH, Henriksen TB, Vestergaard M, Olsen J, Bech BH (2009) Selective serotonin reuptake inhibitors in pregnancy and congenital malformations: population based cohort study. BMJ (Clinical Research Ed) 339: b3569-b3569 Peters DA (1982) Prenatal stress: effects on brain biogenic amine and plasma corticosterone levels. Pharmacol Biochem Behav 17: 721-5 Peters DA (1990) Maternal stress increases fetal brain and neonatal cerebral cortex 5- hydroxytryptamine synthesis in rats: a possible mechanism by which stress influences brain development. Pharmacol Biochem Behav 35: 943-7 Pfaffl MW, Horgan GW, Dempfle L (2002) Relative expression software tool (REST) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Res 30: e36 Pickard GE, Weber ET, Scott PA, Riberdy AF, Rea MA (1996) 5HT1B receptor agonists inhibit light-induced phase shifts of behavioral circadian rhythms and expression of the immediate-early gene c-fos in the suprachiasmatic nucleus. The Journal Of

250

Neuroscience: The Official Journal Of The Society For Neuroscience 16: 8208- 8220 Politch JA, Herrenkohl LR (1979) Prenatal stress reduces maternal aggression by mice offspring. Physiol Behav 23: 415-8 Portaluppi F, Vergnani L, Manfredini R, Fersini C (1996) Endocrine mechanisms of blood pressure rhythms. Annals Of The New York Academy Of Sciences 783: 113-131 Prosser RA, Dean RR, Edgar DM, Heller HC, Miller JD (1993) Serotonin and the mammalian circadian system: I. In vitro phase shifts by serotonergic agonists and antagonists. J Biol Rhythms 8: 1-16 Raap DK, Garcia F, Muma NA, Wolf WA, Battaglia G, van de Kar LD (1999) Sustained desensitization of hypothalamic 5-Hydroxytryptamine1A receptors after discontinuation of fluoxetine: inhibited neuroendocrine responses to 8-hydroxy-2- (Dipropylamino)Tetralin in the absence of changes in Gi/o/z proteins. J Pharmacol Exp Ther 288: 561-7 Ramboz S, Oosting R, Amara DA, Kung HF, Blier P, Mendelsohn M, Mann JJ, Brunner D, Hen R (1998) Serotonin receptor 1A knockout: an animal model of anxiety- related disorder. Proc Natl Acad Sci U S A 95: 14476-81 Rayen I, Gemmel M, Pauley G, Steinbusch HW, Pawluski JL (2015) Developmental exposure to SSRIs, in addition to maternal stress, has long-term sex-dependent effects on hippocampal plasticity. Psychopharmacology (Berl) 232: 1231-44 Rayen I, Steinbusch HW, Charlier TD, Pawluski JL (2013) Developmental fluoxetine exposure and prenatal stress alter sexual differentiation of the brain and reproductive behavior in male rat offspring. Psychoneuroendocrinology 38: 1618- 29 Rayen I, Steinbusch HW, Charlier TD, Pawluski JL (2014) Developmental fluoxetine exposure facilitates sexual behavior in female offspring. Psychopharmacology (Berl) 231: 123-33 Rayen I, van den Hove DL, Prickaerts J, Steinbusch HW, Pawluski JL (2011) Fluoxetine during development reverses the effects of prenatal stress on depressive-like behavior and hippocampal neurogenesis in adolescence. PLoS One 6: e24003 Rebello TJ, Yu Q, Goodfellow NM, Caffrey Cagliostro MK, Teissier A, Morelli E, Demireva EY, Chemiakine A, Rosoklija GB, Dwork AJ, Lambe EK, Gingrich JA, Ansorge MS (2014) Postnatal day 2 to 11 constitutes a 5-HT-sensitive period impacting adult mPFC function. J Neurosci 34: 12379-93 Reichardt HM, Schutz G (1996) Feedback control of glucocorticoid production is established during fetal development. Molecular Medicine 2: 735-44 Reinisch JM, Simon NG, Karow WG, Gandelman R (1978) Prenatal exposure to prednisone in humans and animals retards intrauterine growth. Science 202: 436-8 Reis M, Kallen B (2010) Delivery outcome after maternal use of antidepressant drugs in pregnancy: an update using Swedish data. Psychological Medicine 40: 1723-33 Rhees RW, Al-Saleh HN, Kinghorn EW, Fleming DE, Lephart ED (1999) Relationship between sexual behavior and sexually dimorphic structures in the anterior hypothalamus in control and prenatally stressed male rats. Brain Research Bulletin 50: 193-9

251

Rigdon GC, Weatherspoon JK (1992) 5-Hydroxytryptamine 1a receptor agonists block prepulse inhibition of acoustic startle reflex. J Pharmacol Exp Ther 263: 486-93 Roberto M, Cruz M, Bajo M, Siggins GR, Parsons LH, Schweitzer P (2010) The endocannabinoid system tonically regulates inhibitory transmission and depresses the effect of ethanol in central amygdala. Neuropsychopharmacol 35: 1962-72 Robinson L, McKillop-Smith S, Ross NL, Pertwee RG, Hampson RE, Platt B, Riedel G (2008) Hippocampal endocannabinoids inhibit spatial learning and limit spatial memory in rats. Psychopharmacology (Berl) 198: 551-63 Rodgers RJ, Johnson NJ (1995) Factor analysis of spatiotemporal and ethological measures in the murine elevated plus-maze test of anxiety. Pharmacology, Biochemistry and Behavior 52: 297-303 Rodriguez A, Bohlin G (2005) Are maternal smoking and stress during pregnancy related to ADHD symptoms in children? J Child Psychol Psychiatry 46: 246-54 Rodriguez-Porcel F, Green D, Khatri N, Harris SS, May WL, Lin RCS, Paul IA (2011) Neonatal exposure of rats to antidepressants affects behavioral reactions to novelty and social interactions in a manner analogous to autistic spectrum disorders. Anatomical Record 294: 1726-35 Romijn HJ, Hofman MA, Gramsbergen A (1991) At What Age Is the Developing Cerebral-Cortex of the Rat Comparable to That of the Full-Term Newborn Human Baby. Early Hum Dev 26: 61-67 Ronald A, Pennell CE, Whitehouse AJ (2010) Prenatal Maternal Stress Associated with ADHD and Autistic Traits in early Childhood. Front Psychol 1: 223 Roozendaal B, McEwen BS, Chattarji S (2009) Stress, memory and the amygdala. Nat Rev Neurosci 10: 423-33 Ross LE, McLean LM (2006) Anxiety disorders during pregnancy and the postpartum period: A systematic review. J Clin Psychiatry 67: 1285-98 Sadler TR, Nguyen PT, Yang J, Givrad TK, Mayer EA, Maarek JM, Hinton DR, Holschneider DP (2011) Antenatal maternal stress alters functional brain responses in adult offspring during conditioned fear. Brain Res 1385: 163-74 Salari AA, Fatehi-Gharehlar L, Motayagheni N, Homberg JR (2016) Fluoxetine normalizes the effects of prenatal maternal stress on depression- and anxiety-like behaviors in mouse dams and male offspring. Behav Brain Res 311: 354-67 Salgado-Delgado R, Tapia Osorio A, Saderi N, Escobar C (2011) Disruption of circadian rhythms: a crucial factor in the etiology of depression. Depress Res Treat 2011: 839743 Samarasinghe RA, Di Maio R, Volonte D, Galbiati F, Lewis M, Romero G, DeFranco DB (2011) Nongenomic glucocorticoid receptor action regulates gap junction intercellular communication and neural progenitor cell proliferation. Proceedings of the National Academy of Sciences of the United States of America 108: 16657- 62 Samuels BA, Hen R (2011) Novelty-Suppressed Feeding in the Mouse # T Mood and Anxiety Related Phenotypes in Mice (Neuromethods), pp 107-121 Saper CB, Scammell TE, Lu J (2005) Hypothalamic regulation of sleep and circadian rhythms. Nature 437: 1257-1263

252

Sapolsky RM, Romero LM, Munck AU (2000) How do glucocorticoids influence stress responses? Integrating permissive, suppressive, stimulatory, and preparative actions. Endocrine Reviews 21: 55-89 Saxe MD, Battaglia F, Wang JW, Malleret G, David DJ, Monckton JE, Garcia AD, Sofroniew MV, Kandel ER, Santarelli L, Hen R, Drew MR (2006) Ablation of hippocampal neurogenesis impairs contextual fear conditioning and synaptic plasticity in the dentate gyrus. Proceedings of the National Academy of Sciences of the United States of America 103: 17501-6 Schmidt MV (2011) Animal models for depression and the mismatch hypothesis of disease. Psychoneuroendocrinology 36: 330-8 Schmitt U, Hiemke C (1998) Strain differences in open-field and elevated plus-maze behavior of rats without and with pretest handling. Pharmacology, Biochemistry and Behavior 59: 807-11 Schraut KG, Jakob SB, Weidner MT, Schmitt AG, Scholz CJ, Strekalova T, El Hajj N, Eijssen LM, Domschke K, Reif A, Haaf T, Ortega G, Steinbusch HW, Lesch KP, Van den Hove DL (2014) Prenatal stress-induced programming of genome-wide promoter DNA methylation in 5-HTT-deficient mice. Transl Psychiatry 4: e473 Schwarting RK, Thiel CM, Muller CP, Huston JP (1998) Relationship between anxiety and serotonin in the ventral striatum. Neuroreport 9: 1025-9 Seckl JR (2008) Glucocorticoids, developmental 'programming' and the risk of affective dysfunction. Progress in Brain Research 167: 17-34 Secoli SR, Teixeira NA (1998) Chronic prenatal stress affects development and behavioral depression in rats. Stress 2: 273-80 Selten JP, van der Graaf Y, van Duursen R, Gispen-de Wied CC, Kahn RS (1999) Psychotic illness after prenatal exposure to the 1953 Dutch Flood Disaster. Schizophrenia Research 35: 243-5 Shelton J, Yun SJ, Olson SL, Turek F, Bonaventure P, Dvorak C, Lovenberg T, Dugovic C (2015) Selective pharmacological blockade of the 5-HT7 receptor attenuates light and 8-OH-DPAT induced phase shifts of mouse circadian wheel running activity. Front Behav Neurosci 8 Shonkoff JP (2010) Building a new biodevelopmental framework to guide the future of early childhood policy. Child Development 81: 357-67 Siegel A, Roeling TA, Gregg TR, Kruk MR (1999) Neuropharmacology of brain- stimulation-evoked aggression. Neurosci Biobehav Rev 23: 359-89 Silva CMd, Gonçalves L, Manhaes-de-Castro R, Nogueira MI (2010) Postnatal fluoxetine treatment affects the development of serotonergic neurons in rats. Neuroscience Letters 483: 179-183 Singh Y, Jaiswal AK, Singh M, Bhattacharya SK (1998) Effect of prenatal diazepam, phenobarbital, haloperidol and fluoxetine exposure on foot shock induced aggression in rats. Indian J Exp Biol 36: 1023-4 Sipes TA, Geyer MA (1995) 8-OH-DPAT disruption of prepulse inhibition in rats: reversal with (+)WAY 100,135 and localization of site of action. Psychopharmacology (Berl) 117: 41-8 Smit-Rigter LA, Noorlander CW, von Oerthel L, Chameau P, Smidt MP, van Hooft JA (2012) Prenatal fluoxetine exposure induces life-long serotonin 5-HT₃ receptor-

253

dependent cortical abnormalities and anxiety-like behaviour. Neuropharmacology 62: 865-70 Smith JW, Seckl JR, Evans AT, Costall B, Smythe JW (2004) Gestational stress induces post-partum depression-like behaviour and alters maternal care in rats. Psychoneuroendocrinology 29: 227-44 Smith MA, Makino S, Kvetnansky R, Post RM (1995) Stress and glucocorticoids affect the expression of brain-derived neurotrophic factor and neurotrophin-3 mRNAs in the hippocampus. J Neurosci 15: 1768-77 Smith VM, Iannatonne S, Achal S, Jeffers RT, Antle MC (2014) The serotonergic anxiolytic buspirone attenuates circadian responses to light. Eur J Neurosci 40: 3512-25 Smith VM, Jeffers RT, McAllister BB, Basu P, Dyck RH, Antle MC (2015) Effects of lighting condition on circadian behavior in 5-HT1A receptor knockout mice. Physiol Behav 139: 136-44 Smith VM, Sterniczuk R, Phillips CI, Antle MC (2008) Altered photic and non-photic phase shifts in 5-HT(1A) receptor knockout mice. Neuroscience 157: 513-523 Smolensky MH, Hermida RC, Reinberg A, Sackett-Lundeen L, Portaluppi F (2016) Circadian disruption: New clinical perspective of disease pathology and basis for chronotherapeutic intervention. Chronobiol Int 33: 1101-19 Speirs HJ, Seckl JR, Brown RW (2004) Ontogeny of glucocorticoid receptor and 11beta- hydroxysteroid dehydrogenase type-1 gene expression identifies potential critical periods of glucocorticoid susceptibility during development. The Journal of endocrinology 181: 105-16 Stamatakis A, Mantelas A, Papaioannou A, Pondiki S, Fameli M, Stylianopoulou F (2006) Effect of neonatal handling on serotonin 1A sub-type receptors in the rat hippocampus. Neuroscience 140: 1-11 Steinman MQ, Laredo SA, Lopez EM, Manning CE, Hao RC, Doig IE, Campi KL, Flowers AE, Knight JK, Trainor BC (2015) Hypothalamic vasopressin systems are more sensitive to the long term effects of social defeat in males versus females. Psychoneuroendocrinology 51: 122-34 Stella N, Schweitzer P, Piomelli D (1997) A second endogenous cannabinoid that modulates long-term potentiation. Nature 388: 773-8 Stohr T, Schulte Wermeling D, Szuran T, Pliska V, Domeney A, Welzl H, Weiner I, Feldon J (1998) Differential effects of prenatal stress in two inbred strains of rats. Pharmacol Biochem Behav 59: 799-805 Strekalova T, Spanagel R, Dolgov O, Bartsch D (2005) Stress-induced hyperlocomotion as a confounding factor in anxiety and depression models in mice. Behav Pharmacol 16: 171-180 Suarez J, Llorente R, Romero-Zerbo SY, Mateos B, Bermudez-Silva FJ, de Fonseca FR, Viveros MP (2009) Early maternal deprivation induces gender-dependent changes on the expression of hippocampal CB(1) and CB(2) cannabinoid receptors of neonatal rats. Hippocampus 19: 623-32 Svirsky N, Levy S, Avitsur R (2016) Prenatal exposure to selective serotonin reuptake inhibitors (SSRI) increases aggression and modulates maternal behavior in offspring mice. Dev Psychobiol 58: 71-82

254

Swerdlow NR, Geyer MA, Braff DL (2001) Neural circuit regulation of prepulse inhibition of startle in the rat: current knowledge and future challenges. Psychopharmacology (Berl) 156: 194-215 Szewczyk B, Kotarska K, Daigle M, Misztak P, Sowa-Kucma M, Rafalo A, Curzytek K, Kubera M, Basta-Kaim A, Nowak G, Albert PR (2014) Stress-induced alterations in 5-HT1A receptor transcriptional modulators NUDR and Freud-1. Int J Neuropsychopharmacol 17: 1763-75 Takahashi JS, Hong H-K, Ko CH, McDearmon EL (2008) The genetics of mammalian circadian order and disorder: implications for physiology and disease. Nature Reviews Genetics 9: 764-775 Takahashi LK, Turner JG, Kalin NH (1992) Prenatal stress alters brain catecholaminergic activity and potentiates stress-induced behavior in adult rats. Brain Research 574: 131-7 Takahashi LK, Turner JG, Kalin NH (1998) Prolonged stress-induced elevation in plasma corticosterone during pregnancy in the rat: implications for prenatal stress studies. Psychoneuroendocrinology 23: 571-81 Talge NM, Neal C, Glover V, Early Stress TR, Prevention Science Network F, Neonatal Experience on C, Adolescent Mental H (2007) Antenatal maternal stress and long-term effects on child neurodevelopment: how and why? J Child Psychol Psychiatry 48: 245-61 Tarullo AR, Gunnar MR (2006) Child maltreatment and the developing HPA axis. Hormones and Behavior 50: 632-9 Tasker JG, Herman JP (2011) Mechanisms of rapid glucocorticoid feedback inhibition of the hypothalamic-pituitary-adrenal axis. Stress 14: 398-406 Tennant C (2002) Life events, stress and depression: a review of recent findings. Aust Nz J Psychiat 36: 173-182 Terranova JP, Michaud JC, Le Fur G, Soubrie P (1995) Inhibition of long-term potentiation in rat hippocampal slices by anandamide and WIN55212-2: reversal by SR141716 A, a selective antagonist of CB1 cannabinoid receptors. Naunyn Schmiedebergs Arch Pharmacol 352: 576-9 Tian Q, Stepaniants SB, Mao M, Weng L, Feetham MC, Doyle MJ, Yi EC, Dai H, Thorsson V, Eng J, Goodlett D, Berger JP, Gunter B, Linseley PS, Stoughton RB, Aebersold R, Collins SJ, Hanlon WA, Hood LE (2004) Integrated genomic and proteomic analyses of gene expression in Mammalian cells. Mol Cell Proteomics 3: 960-9 Tiba PA, Palma BD, Tufik S, Suchecki D (2003) Effects of early handling on basal and stress-induced sleep parameters in rats. Brain Research 975: 158-166 Trainor BC, Pride MC, Villalon Landeros R, Knoblauch NW, Takahashi EY, Silva AL, Crean KK (2011) Sex differences in social interaction behavior following social defeat stress in the monogamous California mouse (Peromyscus californicus). PLoS One 6: e17405 Tsuda MC, Yamaguchi N, Ogawa S (2011) Early life stress disrupts peripubertal development of aggression in male mice. Neuroreport 22: 259-63

255

Umathe SN, Manna SS, Jain NS (2011) Involvement of endocannabinoids in antidepressant and anti-compulsive effect of fluoxetine in mice. Behav Brain Res 223: 125-34 Vallee M, Maccari S, Dellu F, Simon H, Le Moal M, Mayo W (1999) Long-term effects of prenatal stress and postnatal handling on age-related glucocorticoid secretion and cognitive performance: a longitudinal study in the rat. European Journal of Neuroscience 11: 2906-2916 Vallee M, Mayo W, Dellu F, Le Moal M, Simon H, Maccari S (1997a) Prenatal stress induces high anxiety and postnatal handling induces low anxiety in adult offspring: correlation with stress-induced corticosterone secretion. Journal of Neuroscience 17: 2626-36 Vallee M, Mayo W, Dellu F, LeMoal M, Simon H, Maccari S (1997b) Prenatal stress induces high anxiety and postnatal handling induces low anxiety in adult offspring: Correlation with stress-induced corticosterone secretion. J Neurosci 17: 2626-2636 Van den Bergh BR, Marcoen A (2004) High antenatal maternal anxiety is related to ADHD symptoms, externalizing problems, and anxiety in 8- and 9-year-olds. Child Dev 75: 1085-97 Van den Bergh BRH, Mulder EJH, Mennes M, Glover V (2005) Antenatal maternal anxiety and stress and the neurobehavioural development of the fetus and child: links and possible mechanisms. A review. Neuroscience and Biobehavioral Reviews 29: 237-58 Van den Hove D, Jakob SB, Schraut KG, Kenis G, Schmitt AG, Kneitz S, Scholz CJ, Wiescholleck V, Ortega G, Prickaerts J, Steinbusch H, Lesch KP (2011) Differential Effects of Prenatal Stress in 5-Htt Deficient Mice: Towards Molecular Mechanisms of Gene x Environment Interactions. Plos One 6 Van den Hove DL, Lauder JM, Scheepens A, Prickaerts J, Blanco CE, Steinbusch HW (2006) Prenatal stress in the rat alters 5-HT1A receptor binding in the ventral hippocampus. Brain Res 1090: 29-34 van Os J, Selten JP (1998) Prenatal exposure to maternal stress and subsequent schizophrenia. The May 1940 invasion of The Netherlands. The British journal of psychiatry : the journal of mental science 172: 324-6 Vartazarmian R, Malik S, Baker GB, Boksa P (2005) Long-term effects of fluoxetine or vehicle administration during pregnancy on behavioral outcomes in guinea pig offspring. Psychopharmacology 178: 328-338 Vazquez DM, Eskandari R, Zimmer CA, Levine S, Lopez JF (2002) Brain 5-HT receptor system in the stressed infant rat: implications for vulnerability to substance abuse. Psychoneuroendocrinology 27: 245-72 Vazquez DM, Lopez JF, Van Hoers H, Watson SJ, Levine S (2000) Maternal deprivation regulates serotonin 1A and 2A receptors in the infant rat. Brain Res 855: 76-82 Velazquez-Moctezuma J, Dominguez Salazar E, Cruz Rueda ML (1993) The effect of prenatal stress on adult sexual behavior in rats depends on the nature of the stressor. Physiology and Behavior 53: 443-8 Venihaki M, Carrigan A, Dikkes P, Majzoub JA (2000) Circadian rise in maternal glucocorticoid prevents pulmonary dysplasia in fetal mice with adrenal

256

insufficiency. Proceedings of the National Academy of Sciences of the United States of America 97: 7336-41 Vicentic A, Francis D, Moffett M, Lakatos A, Rogge G, Hubert GW, Harley J, Kuhar MJ (2006) Maternal separation alters serotonergic transporter densities and serotonergic 1A receptors in rat brain. Neuroscience 140: 355-65 Vieira M, Hamada R, Gonzaga N, Bacchi A, Barbieri M, Moreira E, Mesquita S, Gerardin D (2013) Could maternal exposure to the antidepressants fluoxetine and St. John's Wort induce long-term reproductive effects on male rats? Reproductive Toxicology 35: 102-7 Vinkers CH, Oosting RS, van Bogaert MJV, Olivier B, Groenink L (2010) Early-life blockade of 5-HT(1A) receptors alters adult anxiety behavior and benzodiazepine sensitivity. Biological Psychiatry 67: 309-16 Vitalis T, Parnavelas JG (2003) The role of serotonin in early cortical development. Dev Neurosci 25: 245-56 Vorhees CV, Acuff-Smith KD, Schilling MA, Fisher JE, Moran MS, Buelke-Sam J (1994) A developmental neurotoxicity evaluation of the effects of prenatal exposure to fluoxetine in rats. Fundamental And Applied Toxicology: Official Journal Of The Society Of Toxicology 23: 194-205 Vorhees CV, Williams MT (2006) Morris water maze: procedures for assessing spatial and related forms of learning and memory. Nature Protocols 1: 848-858 Wamsteeker JI, Kuzmiski JB, Bains JS (2010) Repeated stress impairs endocannabinoid signaling in the paraventricular nucleus of the hypothalamus. J Neurosci 30: 11188-96 Ward AJ (1991) Prenatal stress and childhood psychopathology. Child Psychiatry and Human Development 22: 97-110 Ward IL (1972) Prenatal stress feminizes and demasculinizes the behavior of males. Science (New York, N Y ) 175: 82-4 Ward IL, Weisz J (1984) Differential effects of maternal stress on circulating levels of corticosterone, progesterone, and testosterone in male and female rat fetuses and their mothers. Endocrinology 114: 1635-44 Watanabe Y, Sakai RR, McEwen BS, Mendelson S (1993) Stress and antidepressant effects on hippocampal and cortical 5-HT1A and 5-HT2 receptors and transport sites for serotonin. Brain Res 615: 87-94 Watson JB, Mednick SA, Huttunen M, Wang X (1999) Prenatal teratogens and the development of adult mental illness. Development and Psychopathology 11: 457- 66 Webb IC, Antle MC, Mistlberger RE (2014) Regulation of circadian rhythms in mammals by behavioral arousal. Behav Neurosci 128: 304-25 Weinstock M (2007) Gender differences in the effects of prenatal stress on brain development and behaviour. Neurochem Res 32: 1730-40 Welberg LA, Seckl JR, Holmes MC (2001) Prenatal glucocorticoid programming of brain corticosteroid receptors and corticotrophin-releasing hormone: possible implications for behaviour. Neuroscience 104: 71-9 Wenzel A, Haugen EN, Jackson LC, Brendle JR (2005) Anxiety symptoms and disorders at eight weeks postpartum. J Anxiety Disord 19: 295-311

257

Wisner KL, Sit DKY, Hanusa BH, Moses-Kolko EL, Bogen DL, Hunker DF, Perel JM, Jones-Ivy S, Bodnar LM, Singer LT (2009) Major depression and antidepressant treatment: impact on pregnancy and neonatal outcomes. The American journal of psychiatry 166: 557-66 Witt WP, Cheng ER, Wisk LE, Litzelman K, Chatterjee D, Mandell K, Wakeel F (2014) Maternal stressful life events prior to conception and the impact on infant birth weight in the United States. American Journal of Public Health 104 Suppl 1: S81- 9 Wollnik F (1992) Effects of chronic administration and withdrawal of antidepressant agents on circadian activity rhythms in rats. Pharmacology, Biochemistry, And Behavior 43: 549-561 Wood GE, Young LT, Reagan LP, McEwen BS (2003) Acute and chronic restraint stress alter the incidence of social conflict in male rats. Hormones and Behavior 43: 205-13 Wynne-Edwards KE, Edwards HE, Hancock TM (2013) The human fetus preferentially secretes corticosterone, rather than cortisol, in response to intra-partum stressors. PLoS ONE 8: e63684 Yamakawa GR, Antle MC (2010) Phenotype and function of raphe projections to the suprachiasmatic nucleus. European Journal of Neuroscience 31: 1974-1983 Yamakawa GR, Basu P, Cortese F, MacDonnell J, Whalley D, Smith VM, Antle MC (2016) The cholinergic forebrain arousal system acts directly on the circadian pacemaker. Proc Natl Acad Sci U S A 113: 13498-13503 Yan W, Wilson CC, Haring JH (1997) 5-HT1a receptors mediate the neurotrophic effect of serotonin on developing dentate granule cells. Brain Res Dev Brain Res 98: 185-90 Yang M, Silverman JL, Crawley JN (2011) Automated three-chambered social approach task for mice. Curr Protoc Neurosci Chapter 8: Unit 8 26 Yavarone MS, Shuey DL, Sadler TW, Lauder JM (1993) Serotonin uptake in the ectoplacental cone and placenta of the mouse. Placenta 14: 149-161 Yehuda R, Engel SM, Brand SR, Seckl J, Marcus SM, Berkowitz GS (2005) Transgenerational effects of posttraumatic stress disorder in babies of mothers exposed to the World Trade Center attacks during pregnancy. The Journal of clinical endocrinology and metabolism 90: 4115-8 Yohe LR, Suzuki H, Lucas LR (2012) Aggression is suppressed by acute stress but induced by chronic stress: immobilization effects on aggression, hormones, and cortical 5-HT(1B)/ striatal dopamine D(2) receptor density. Cognitive, Affective and Behavioral Neuroscience 12: 446-59 Zhao C, Deng W, Gage FH (2008) Mechanisms and functional implications of adult neurogenesis. Cell 132: 645-60 Zheng J, Xu D-F, Li K, Wang H-T, Shen P-C, Lin M, Cao X-H, Wang R (2011) Neonatal exposure to fluoxetine and fluvoxamine alteres spine density in mouse hippocampal CA1 pyramidal neurons. International Journal Of Clinical And Experimental Pathology 4: 162-168

258

Ziabreva I, Schnabel R, Poeggel G, Braun K (2003) Mother's voice "buffers" separation- induced receptor changes in the prefrontal cortex of octodon degus. Neuroscience 119: 433-41 Zimmerberg B, Blaskey LG (1998) Prenatal stress effects are partially ameliorated by prenatal administration of the neurosteroid allopregnanolone. Pharmacol Biochem Be 59: 819-827