DOCSLIB.ORG

Non Commercial Use Only

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Non Commercial Use Only Trends in Evolutionary Biology 2017; volume 6:6514 Potential impact tions including insertional mutagenesis, of primate-specific SVA generation of deletions at the insertion site, Correspondence: Olga Vasieva, Institute of 3’ or 5’ transduction events, non-allelic Integrative Biology, Department of retrotransposons during homologous recombination and Comparative Genomics, University of the evolution of human exonisation.1-4 More than 10,000 TE inser- Liverpool, Liverpool, L69 7ZB, UK. cognitive function tions occurred in the human genome since Tel.: +44.151.795.4456 - Fax: +44.151.795.4406. human-chimpanzee divergence which were E-mail: [email protected] suggested to have implications on human 1 1 Key words: SVA, retrotransposons, hominoid, Olga Vasieva, Sultan Cetiner, evolution and especially its reproductive, 2 3 brain, evolution. Abigail Savage, Gerald G. Schumann, cognitive and immune functions that Vivien J. Bubb,2 John P. Quinn2 diverged strongly during a relative short Contributions: OV conceived of the study, 1Institute of Integrative Biology, time period.4,5 The large number of such designed and performed the systems analysis, University of Liverpool, UK; TEs in the genome makes an analysis of and drafted the manuscript, SC performed the 2Department of Molecular and Clinical their specific contribution to evolution very computational analysis and took part in draft- ing of the manuscript, AS has performed the Pharmacology, Institute of Translational difficult, and previous studies highlighted retrieval of SVA-associated gene sets and Medicine, University of Liverpool, UK; the potential role of mainly self-propagating (L1, ERV/ETR) and Alu elements.4 We have helped to draft the manuscript, GGS partici- 3Division of Medical Biotechnology, focused on the functions of genes in proxim- pated in data analysis and helped to draft the Paul-Ehrlich-Institut, Langen, Germany manuscript, VJB participated in retrieval of ity to the integration sites of the less studied associated gene sets and helped to draft the hominoid-specific composite retrotrans- manuscript, JQ conceived of the study, coordi- posons termed SINE-VNTR-Alu (SVA) ele- nated SVA associated gene set retrieval and 6 ments. SVA elements represent the took part in- drafting of the manuscript. Abstract youngest non-LTR retrotransposon family in humans and the human genome harbors Conflict of interest: the authors declare no The SVA family of hominid-specific approximately 2700 SVAs.7-9 We and others potentialonly conflict of interest. non-LTR retrotransposon comprises the have demonstrated that SVA elements have youngest group of transposable elements in properties of transcriptional regulators of Received for publication: 21 March 2016. the human genome. The propagation of the gene expression both in vivo and in Revision received: 24 October 2016. most ancient SVA subfamily took place vitro,8,10,11 and that a significant number of Accepted for publication: 24 October 2016. about 13.5 million years ago, and the SVA elements are located within 10kbuse of the youngest SVA subfamily appeared in the This work is licensed under a Creative major transcriptional start site of many Commons Attribution NonCommercial 4.0 8 human genome after the human/chimpanzee genes. Therefore, SVA insertions estab- License (CC BY-NC 4.0). divergence. Functional analysis of genes lished in the hominoid lineage could be associated with SVA insertions demonstrat- responsible for altering the transcriptome in ©Copyright O. Vasieva et al., 2017 ed their link to multiple ontological cate- a developmental, tissue-specific or stimulus Licensee PAGEPress, Italy gories, with one of the major categories inducible manner, as was already suggested Trends in Evolutionary Biology 2017; 6:6514 being attributed to brain function. Further earlier for Alu elements and demonstrated doi:10.4081/ni.2017.6514 analysis of this subset demonstrated that for LTR sequences of endogenous retro- SVA elements expanded their presence in viruses.4 scriptional regulatory properties both in vivo the human genome at different stages of SVA elements are categorized into sub- and in vitro.7 In this communication, we hominoid evolution and were associated families A to F and F1,11 and their age was wanted to further explore the potential of with progressively evolving behavioral fea- commercialestimated at 13.56 million years (Myrs) for members of the different SVA subfamilies tures that indicate a potential impact of SVA the oldest subfamily (A) and 3.18 Myrs for (A-F1) to modulate specific genes involved propagation on the cognitive ability of a the youngest subfamily (F). Subfamily D is in CNS function. Here, we demonstrate that modern human. Our analysis suggests a by far the largest and encompasses 44% of SVA insertion and subfamily appearance in potential role of SVAs in theNon evolution of all SVAs in the human genome. The subfam- evolution correlate with the acquisition of human central nervous system and especial- ily termed F1 represents the smallest group certain behavioral traits. ly in the emergence of functional trends rel- covering only 3% of all SVA elements. evant to social and parental behavior. Co- Subfamilies E, F and F1 are human-specific evolution of behavioral features and repro- and correspond to the period since the ductive functions are suggested by our human chimpanzee divergence that occurred Materials and Methods analysis and discussed. ~6 million years ago.5 The implications of SVA insertions for the evolution of other Generation of the list of genes associ- hominoid lineages is quite obvious, because, for instance, the family of gibbon-specific ated with SVA insertions Introduction LAVA retrotransposons, derived from an Genomic coordinates of all SVA loci in SVA A element, has been implicated in the the human genome (Hg19 reference genome Genetic studies have been successful at molecular mechanism underpinning genome sequence) were extracted from the UCSC determining the changes that alter pathways plasticity of the gibbon lineage.12 We have genome browser (http://genome. involved in evolution. Transposable ele- previously examined in detail the SVA inser- ucsc.edu/index.html). This included many ments (TEs), despite long being thought of tions found upstream of the genes PARK7 SVA sequences that were fragmented in the as junk DNA, have impacted the human and FUS, which are genes implicated in neu- Repeat Masker track; therefore, this list was genome during its evolution through a vari- rodegeneration, and demonstrated that the manually annotated to generate a list of ety of mechanisms causing structural varia- SVAs associated with these genes have tran- coordinates of complete SVA sequences [Trends in Evolutionary Biology 2017; 6:6514] [page 1] Article resulting in a total of 2676 elements encom- associated with an SVA insertion were shown on Figure 1. passing all seven SVA subfamilies.8 The Cardiovascular disease and Glucose toler- A number of behavioral categories coordinates of all known genes and their ance. However the next highest ranked show an evolutionary corresponding pattern transcripts were extracted from the UCSC were Guidance of axons and Synaptic of connection to SVA insertions. The walk- genome browser, and Galaxy software processes (P=1E-5 and P=6E-5 correspond- ing-category-associated group of genes (http://galaxyproject.org/) was used to gen- ingly). The genes classified to the latter cat- ([AGTPBP1 (ATP/GTP binding protein 1)], erate coordinates of the 10-kb genomic egories were associated with a number of [CACNB4 (Calcium channel, voltage- regions flanking all known transcripts. canonical pathways (such as Synaptic Long dependent, B4 subunit)], [FXN (Frataxin), Finally, the SVA loci were intersected with Term Potentiation or Axonal Guidance SCN8A (Sodium channel, voltage gated, the three lists of genomic coordinates (all Signaling) with no specific enrichment in type VIII alpha subunit)], [ATG7 known genes, 10kb upstream and 10kb any of those top-ranked pathways (Autophagy related 7 homolog)] contain downstream of known genes). Duplicates (Supplementary Material). To better reveal SVA D or F insertions while the functions of were removed from each list individually. functional trends for potential SVA impact climbing activity-associated genes [KCNJ6 For functional enrichment analysis, the on human cognitive function, we focused (Potassium inwardly-rectifying channel, defined SVA coordinates have been used to only on genes relevant to CNS categories J6)] and [HTT (Huntingtin)] are associated produce a shorter list of the Genome (Table 1 and Supplementary Material) and with earlier SVA A and B insertions Reference Consortium Human Build 38 these were re-analyzed by IPA (Supplementary Material). We may specu- (GRCh38) genes directly mapped via (Supplementary Material). The top-ranked late that alteration of the functionality of BIomart Martview service (www. significantly enriched categories (-log(P- these genes overall could have had an biomart.org/biomart/martview/). value)>12) were of morphology and devel- impact on changing from climbing to the opment of forebrain/telencephalon and mul- walking moving mode over the period of Ingenuity pathway analysis tiple categories relevant to axon growth and hominoid evolution. Consistent with that synaptic processes. From the mapped the decline in Nest building activity was Ingenuity Pathway Analysis (IPA) soft- behavioral categories, Learning and Social also speculated to have an enhancing ware (Ingenuity Systems, Inc.) was used
Load more

Recommended publications
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Datasheet Blank Template
    SAN TA C RUZ BI OTEC HNOL OG Y, INC . Fe65L (Y-14): sc-104237 BACKGROUND PRODUCT Fe65L (Fe65-like protein), also known as APBB2 (amyloid β (A4) precursor Each vial contains 200 µg IgG in 1.0 ml of PBS with < 0.1% sodium azide protein-binding, family B, member 2), is a 758 amino acid protein that contains and 0.1% gelatin. one WW domain and 2 PID domains. Binding to the intracellular domain of Blocking peptide available for competition studies, sc-104237 P, (100 µg the -amyloid precursor protein, Fe65L is thought to modulate the internal - β peptide in 0.5 ml PBS containing < 0.1% sodium azide and 0.2% BSA). ization and, therefore, the accessibility and function of β-amyloid. Via its ability to control the intracellular accumulation of -amyloid, Fe65L is thought β APPLICATIONS to play a role in the pathogenesis of Alzheimer’s disease. Multiple isoforms of Fe65L exist due to alternative splicing events. The gene encoding Fe65L Fe65L (Y-14) is recommended for detection of Fe65L of mouse, rat and maps to human chromosome 4, which encodes nearly 6% of the human human origin by Western Blotting (starting dilution 1:200, dilution range genome and has the largest gene deserts (regions of the genome with no 1:100-1:1000), immunoprecipitation [1-2 µg per 100-500 µg of total protein protein encoding genes) of all of the human chromosomes. Defects in some (1 ml of cell lysate)], immunofluorescence (starting dilution 1:50, dilution of the genes located on chromosome 4 are associated with Huntington’s range 1:50-1:500) and solid phase ELISA (starting dilution 1:30, dilution dis ease, Ellis-van Creveld syndrome, methylmalonic acidemia and polycystic range 1:30-1:3000).
    [Show full text]
  • Chemical Modulation of Mitochondria–Endoplasmic Reticulum Contact Sites
    cells Review Chemical Modulation of Mitochondria–Endoplasmic Reticulum Contact Sites 1 1, 1 1 Ana Paula Magalhães Rebelo , Federica Dal Bello y , Tomas Knedlik , Natasha Kaar , Fabio Volpin 1, Sang Hun Shin 1 and Marta Giacomello 1,2,* 1 Department of Biology, University of Padua, Via U. Bassi 58/B, 35121 Padua, Italy; [email protected] (A.P.M.R.); [email protected] (F.D.B.); [email protected] (T.K.); [email protected] (N.K.); [email protected] (F.V.); [email protected] (S.H.S.) 2 Department of Biomedical Sciences, University of Padua, Via U. Bassi 58/B, 35121 Padua, Italy * Correspondence: [email protected]; Tel.: +39-049-827-6300 Current Affiliation: Molecular Angiogenesis Laboratory, GIGA Research, University of Liège, B34, y Avenue de l’Hôpital, 1, 4000 Liège, Belgium. Received: 8 June 2020; Accepted: 2 July 2020; Published: 7 July 2020 Abstract: Contact sites between mitochondria and endoplasmic reticulum (ER) are points in which the two organelles are in close proximity. Due to their structural and functional complexity, their exploitation as pharmacological targets has never been considered so far. Notwithstanding, the number of compounds described to target proteins residing at these interfaces either directly or indirectly is rising. Here we provide original insight into mitochondria–ER contact sites (MERCs), with a comprehensive overview of the current MERCs pharmacology. Importantly, we discuss the considerable potential of MERCs to become a druggable target for the development of novel therapeutic strategies. Keywords: mitochondria–endoplasmic reticulum contact sites; mitochondria-associated membranes; pharmacology; drug targets; synthetic and biological compounds; neurodegeneration; diabetes; cancer 1.
    [Show full text]
  • Identification of the Rs797045105 in the SERAC1 Gene by Whole-Exome Sequencing in a Patient Suspicious of MEGDEL Syndrome
    Basic and Clinical July, August 2020, Volume 11, Number 4 News and Reports: Identification of the rs797045105 in the SERAC1 Gene by Whole-exome Sequencing in a Patient Suspicious of MEGDEL Syndrome Mina Zamani1,2 , Tahereh Seifi1,2, Jawaher Zeighami1, Neda Mazaheri1,2, Emad Jahangirnezhad1, Minoo Gholamzadeh1, Alireza Sed- aghat1,3* , Gholamreza Shariati1,4* , Hamid Galehdari1,2 1. Narges Medical Genetics and Prenatal Diagnosis Laboratory, Ahvaz, Iran. 2. Department of Genetics, Faculty of Science, Shahid Chamran University of Ahvaz, Ahvaz, Iran. 3. Diabetes Research Center, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran. 4. Department of Genetics, School of Medicine, Ahvaz Jundishapur University of medical Sciences, Ahvaz, Iran. Use your device to scan and read the article online Citation: Zamani, M., Seifi, T., Zeighami, J., Mazaheri, J., Mazaheri, N., & Jahangirnezhad, F., et al. (2020). Identification of the rs797045105 in the SERAC1 Gene by Whole-exome Sequencing in a Patient Suspicious of MEGDEL Syndrome. Basic and Clinical Neuroscience, 11(4), 549-556. http://dx.doi.org/10.32598/bcn.9.10.455 : http://dx.doi.org/10.32598/bcn.9.10.455 A B S T R A C T Introduction: Whole Exome Sequencing (WES) has been increasingly utilized in genetic determinants of various inherited diseases. Article info: Received: 13 Oct 2017 Methods: We applied WES for a patient presenting 3-Methylglutaconic Aciduria (MEG), First Revision:10 Nov 2017 Deafness (D), Encephalopathy (E), and Leigh-like (L) syndrome. Then Sanger sequencing was used for the detected variant validation. Accepted: 13 May 2019 Available Online: 01 Jul 2020 Results: We found an insertion, rs797045105 (chr6, 158571484, C>CCATG), in the SERAC1 gene with homozygous genotype in the patient and heterozygous genotype in her unaffected parents.
    [Show full text]
  • Viewed and Published Immediately Upon Acceptance Cited in Pubmed and Archived on Pubmed Central Yours — You Keep the Copyright
    BMC Genomics BioMed Central Research article Open Access Differential gene expression in ADAM10 and mutant ADAM10 transgenic mice Claudia Prinzen1, Dietrich Trümbach2, Wolfgang Wurst2, Kristina Endres1, Rolf Postina1 and Falk Fahrenholz*1 Address: 1Johannes Gutenberg-University, Institute of Biochemistry, Mainz, Johann-Joachim-Becherweg 30, 55128 Mainz, Germany and 2Helmholtz Zentrum München – German Research Center for Environmental Health, Institute for Developmental Genetics, Ingolstädter Landstraße 1, 85764 Neuherberg, Germany Email: Claudia Prinzen - [email protected]; Dietrich Trümbach - [email protected]; Wolfgang Wurst - [email protected]; Kristina Endres - [email protected]; Rolf Postina - [email protected]; Falk Fahrenholz* - [email protected] * Corresponding author Published: 5 February 2009 Received: 19 June 2008 Accepted: 5 February 2009 BMC Genomics 2009, 10:66 doi:10.1186/1471-2164-10-66 This article is available from: http://www.biomedcentral.com/1471-2164/10/66 © 2009 Prinzen et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Abstract Background: In a transgenic mouse model of Alzheimer disease (AD), cleavage of the amyloid precursor protein (APP) by the α-secretase ADAM10 prevented amyloid plaque formation, and alleviated cognitive deficits. Furthermore, ADAM10 overexpression increased the cortical synaptogenesis. These results suggest that upregulation of ADAM10 in the brain has beneficial effects on AD pathology. Results: To assess the influence of ADAM10 on the gene expression profile in the brain, we performed a microarray analysis using RNA isolated from brains of five months old mice overexpressing either the α-secretase ADAM10, or a dominant-negative mutant (dn) of this enzyme.
    [Show full text]
  • Identification of Genetic Modifiers in Hereditary Spastic Paraplegias Due to SPAST/SPG4 Mutations Livia Parodi
    Identification of genetic modifiers in Hereditary Spastic Paraplegias due to SPAST/SPG4 mutations Livia Parodi To cite this version: Livia Parodi. Identification of genetic modifiers in Hereditary Spastic Paraplegias due to SPAST/SPG4 mutations. Human health and pathology. Sorbonne Université, 2019. English. NNT : 2019SORUS317. tel-03141229 HAL Id: tel-03141229 https://tel.archives-ouvertes.fr/tel-03141229 Submitted on 15 Feb 2021 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Sorbonne Université Institut du Cerveau et de la Moelle Épinière École Doctorale Cerveau-Cognition-Comportement Thèse de doctorat en Neurosciences Identification of genetic modifiers in Hereditary Spastic Paraplegias due to SPAST/SPG4 mutations Soutenue le 9 octobre 2019 par Livia Parodi Membres du jury : Pr Bruno Stankoff Président Pr Lesley Jones Rapporteur Dr Susanne de Bot Rapporteur Pr Christel Depienne Examinateur Pr Cyril Goizet Examinateur Pr Alexandra Durr Directeur de thèse Table of contents Abbreviations _________________________________________________________
    [Show full text]
  • Integrated Transcriptomic and Neuroimaging Brain Model Decodes
    RESEARCH ARTICLE Integrated transcriptomic and neuroimaging brain model decodes biological mechanisms in aging and Alzheimer’s disease Quadri Adewale1,2,3, Ahmed F Khan1,2,3, Felix Carbonell4, Yasser Iturria-Medina1,2,3*, Alzheimer’s Disease Neuroimaging Initiative† 1Neurology and Neurosurgery Department, Montreal Neurological Institute, McGill University, Montreal, Canada; 2McConnell Brain Imaging Centre, Montreal Neurological Institute, McGill University, Montreal, Canada; 3Ludmer Centre for Neuroinformatics and Mental Health, McGill University, Montreal, Canada; *For correspondence: 4Biospective Inc, Montreal, Canada [email protected] †Data used in preparation of this article were partly obtained from the Alzheimer’s Disease Abstract Both healthy aging and Alzheimer’s disease (AD) are characterized by concurrent Neuroimaging Initiative (ADNI) alterations in several biological factors. However, generative brain models of aging and AD are database (adni.loni.usc.edu). As limited in incorporating the measures of these biological factors at different spatial resolutions. such, the investigators within the Here, we propose a personalized bottom-up spatiotemporal brain model that accounts for the ADNI contributed to the design direct interplay between hundreds of RNA transcripts and multiple macroscopic neuroimaging and implementation of ADNI modalities (PET, MRI). In normal elderly and AD participants, the model identifies top genes and/or provided data but did not modulating tau and amyloid-b burdens, vascular flow, glucose metabolism, functional activity, and participate in analysis or writing atrophy to drive cognitive decline. The results also revealed that AD and healthy aging share of this report. A complete listing specific biological mechanisms, even though AD is a separate entity with considerably more altered of ADNI investigators can be pathways.
    [Show full text]
  • Downregulation of Carnitine Acyl-Carnitine Translocase by Mirnas
    Page 1 of 288 Diabetes 1 Downregulation of Carnitine acyl-carnitine translocase by miRNAs 132 and 212 amplifies glucose-stimulated insulin secretion Mufaddal S. Soni1, Mary E. Rabaglia1, Sushant Bhatnagar1, Jin Shang2, Olga Ilkayeva3, Randall Mynatt4, Yun-Ping Zhou2, Eric E. Schadt6, Nancy A.Thornberry2, Deborah M. Muoio5, Mark P. Keller1 and Alan D. Attie1 From the 1Department of Biochemistry, University of Wisconsin, Madison, Wisconsin; 2Department of Metabolic Disorders-Diabetes, Merck Research Laboratories, Rahway, New Jersey; 3Sarah W. Stedman Nutrition and Metabolism Center, Duke Institute of Molecular Physiology, 5Departments of Medicine and Pharmacology and Cancer Biology, Durham, North Carolina. 4Pennington Biomedical Research Center, Louisiana State University system, Baton Rouge, Louisiana; 6Institute for Genomics and Multiscale Biology, Mount Sinai School of Medicine, New York, New York. Corresponding author Alan D. Attie, 543A Biochemistry Addition, 433 Babcock Drive, Department of Biochemistry, University of Wisconsin-Madison, Madison, Wisconsin, (608) 262-1372 (Ph), (608) 263-9608 (fax), [email protected]. Running Title: Fatty acyl-carnitines enhance insulin secretion Abstract word count: 163 Main text Word count: 3960 Number of tables: 0 Number of figures: 5 Diabetes Publish Ahead of Print, published online June 26, 2014 Diabetes Page 2 of 288 2 ABSTRACT We previously demonstrated that micro-RNAs 132 and 212 are differentially upregulated in response to obesity in two mouse strains that differ in their susceptibility to obesity-induced diabetes. Here we show the overexpression of micro-RNAs 132 and 212 enhances insulin secretion (IS) in response to glucose and other secretagogues including non-fuel stimuli. We determined that carnitine acyl-carnitine translocase (CACT, Slc25a20) is a direct target of these miRNAs.
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name Protein Apbb2 Gene Symbol Apbb2 Organism Rat Gene Summary Description Not Available Gene Aliases Not Available RefSeq Accession No. Not Available UniGene ID Not Available Ensembl Gene ID ENSRNOG00000025509 Entrez Gene ID 305338 Assay Information Unique Assay ID qRnoCEP0025849 Assay Type Probe - Validation information is for the primer pair using SYBR® Green detection Detected Coding Transcript(s) ENSRNOT00000067979, ENSRNOT00000049214, ENSRNOT00000029018, ENSRNOT00000050664 Amplicon Context Sequence TGCACGGTGTGATCACGTTTGAGCCTTACATGGTAGGAAAGGCACTAAACAAAC TGAAGGAATGAGAACACAGGGCACCAAAAGCTAAAGAAGTGGCTTAGGATGCCA CCGAAGTCCATGAGAGCCGGGATCACGACCC Amplicon Length (bp) 109 Chromosome Location 14:43314646-43314784 Assay Design Exonic Purification Desalted Validation Results Efficiency (%) 94 R2 0.9987 cDNA Cq 21.69 cDNA Tm (Celsius) 82.5 gDNA Cq 25.23 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 1/4 PrimePCR™Assay Validation Report Apbb2, Rat Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 2/4 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online. Detected Coding Transcript(s) This is a list of the Ensembl transcript ID(s) that this assay will detect.
    [Show full text]
  • Mir‑205‑3P Promotes Lung Cancer Progression by Targeting APBB2
    MOLECULAR MEDICINE REPORTS 24: 588, 2021 miR‑205‑3p promotes lung cancer progression by targeting APBB2 LING‑BIN XU1, JIE XIONG1, YA‑HUI ZHANG2, YUN DAI3, XIAO‑PING REN1, YA‑JUAN REN1, DONG HAN1, SHENG‑HONG WEI1 and MIN QI4 1Department of Pulmonary and Critical Care Medicine No. 2, Shaanxi Provincial People's Hospital, Xi'an, Shaanxi 710068; 2Department of Orthopaedics, Xi'an Daxing Hospital, Xi'an, Shaanxi 710016; 3Department of Thoracic Surgery and 4Imaging Center, Shaanxi Provincial People's Hospital, Xi'an, Shaanxi 710068, P.R. China Received August 26, 2020; Accepted March 29, 2021 DOI: 10.3892/mmr.2021.12227 Abstract. Non‑small cell lung cancer (NSCLC), a leading treatments, the 5‑year survival rate has remained as low as cause of cancer‑associated mortality, has resulted in low 15% since the 1970s (5). Therefore, further investigations into survival rates and a high mortality worldwide. Accumulating the mechanisms of NSCLC development and progression are evidence has suggested that microRNAs (miRs) play critical of the utmost importance for the diagnosis, prevention and roles in the regulation of cancer progression and the present treatment of this disease. study aimed to explore the underlying mechanism of miR‑205 MicroRNAs (miRNAs/miRs), a class of endogenous in NSCLC. Reverse transcription‑quantitative PCR was non‑coding RNAs, can mediate various gene expression levels performed, which determined that miR‑205 expression was by suppressing the translation or accelerating the decay of the upregulated in NSCLC, and the present study detected the target mRNA (6,7). Previous data have revealed that miRNAs upregulation of miR‑205‑3p in a number of NSCLC cell lines can regulate 30% of mRNAs (8).
    [Show full text]
  • SERAC1 Gene Serine Active Site Containing 1
    SERAC1 gene serine active site containing 1 Normal Function The SERAC1 gene provides instructions for making a protein whose function is not completely understood. Studies suggest that the SERAC1 protein is involved in altering ( remodeling) certain fats called phospholipids, particularly a phospholipid called phosphatidylglycerol. Another phospholipid called cardiolipin is made from phosphatidylglycerol. Cardiolipin is a component of the membrane that surrounds cellular structures called mitochondria, which convert the energy from food into a form that cells can use, and is important for the proper functioning of these structures. Researchers believe that the SERAC1 protein is also involved in the movement of a waxy, fat-like substance called cholesterol within cells. Cholesterol is a structural component of cell membranes and plays a role in the production of certain hormones and digestive acids. It has important functions both before and after birth. Health Conditions Related to Genetic Changes MEGDEL syndrome At least 16 mutations in the SERAC1 gene have been found to cause MEGDEL syndrome. This condition is characterized by hearing loss, neurological problems, certain changes in the brain described as Leigh-like disease, and abnormally high amounts of an acid called 3-methylglutaconic acid in the urine. The SERAC1 gene mutations that cause this condition reduce the amount of SERAC1 protein that is produced or lead to production of a protein with little or no function. As a result, phosphatidylglycerol remodeling is impaired, which likely alters the composition of cardiolipin. Researchers speculate that the abnormal cardiolipin affects mitochondrial function, reducing cellular energy production and leading to the neurological and hearing problems characteristic of MEGDEL syndrome.
    [Show full text]
  • Mutations and Protein Interaction Landscape Reveal Key Cellular Events Perturbed in Upper Motor Neurons with HSP and PLS
    brain sciences Article Mutations and Protein Interaction Landscape Reveal Key Cellular Events Perturbed in Upper Motor Neurons with HSP and PLS Oge Gozutok 1, Benjamin Ryan Helmold 1 and P. Hande Ozdinler 1,2,3,4,* 1 Department of Neurology, Feinberg School of Medicine, Northwestern University, 303 E. Chicago Ave, Chicago, IL 60611, USA; [email protected] (O.G.); [email protected] (B.R.H.) 2 Center for Molecular Innovation and Drug Discovery, Center for Developmental Therapeutics, Chemistry of Life Processes Institute, Northwestern University, Evanston, IL 60611, USA 3 Mesulam Center for Cognitive Neurology and Alzheimer’s Disease, Feinberg School of Medicine, Northwestern University, Chicago, IL 60611, USA 4 Feinberg School of Medicine, Les Turner ALS Center at Northwestern University, Chicago, IL 60611, USA * Correspondence: [email protected]; Tel.: +1-(312)-503-2774 Abstract: Hereditary spastic paraplegia (HSP) and primary lateral sclerosis (PLS) are rare motor neuron diseases, which affect mostly the upper motor neurons (UMNs) in patients. The UMNs display early vulnerability and progressive degeneration, while other cortical neurons mostly remain functional. Identification of numerous mutations either directly linked or associated with HSP and PLS begins to reveal the genetic component of UMN diseases. Since each of these mutations are identified on genes that code for a protein, and because cellular functions mostly depend on protein- protein interactions, we hypothesized that the mutations detected in patients and the alterations in Citation: Gozutok, O.; Helmold, B.R.; protein interaction domains would hold the key to unravel the underlying causes of their vulnerability. Ozdinler, P.H. Mutations and Protein In an effort to bring a mechanistic insight, we utilized computational analyses to identify interaction Interaction Landscape Reveal Key Cellular Events Perturbed in Upper partners of proteins and developed the protein-protein interaction landscape with respect to HSP Motor Neurons with HSP and PLS.
    [Show full text]