Loss of the Dermis Zinc Transporter ZIP13 Promotes the Mildness Of
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P. -
Chuannaky2016phd.Pdf (13.10Mb)
! " " ZINC%HOMEOSTASIS!IN#HEALTH,!EXERCISE!AND$ CHRONIC'DISEASES! " " " " " " Anna Kit Yung Chu BAppSc (Ex&SpSc) / BSc (Nutr) (Hons I) The University of Sydney, 2012 A thesis submitted in fulfilment of the requirements for the degree of Doctor of Philosophy (PhD) Department of Human Nutrition Division of Sciences University of Otago 2016 i" " """""" """""! " Table&of&Contents& & Abstract&...................................................................................................................................&iv" Acknowledgments&...............................................................................................................&vi" List&of&abbreviations&........................................................................................................&viii" List&of&tables&............................................................................................................................&x" List&of&figures&.......................................................................................................................&xii" Publications&arising&from&this&thesis&............................................................................&xv" List&of&other&publications&arising&from&this&thesis&.................................................&xvi" Chapter&1&&&Introduction&and&Literature&Review&.............................................................&1" Introduction&............................................................................................................................&2" Whole&body&zinc&homeostasis&...........................................................................................&5" -
The Significance of the Evolutionary Relationship of Prion Proteins and ZIP Transporters in Health and Disease
The Significance of the Evolutionary Relationship of Prion Proteins and ZIP Transporters in Health and Disease by Sepehr Ehsani A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy Department of Laboratory Medicine and Pathobiology University of Toronto © Copyright by Sepehr Ehsani 2012 The Significance of the Evolutionary Relationship of Prion Proteins and ZIP Transporters in Health and Disease Sepehr Ehsani Doctor of Philosophy Department of Laboratory Medicine and Pathobiology University of Toronto 2012 Abstract The cellular prion protein (PrPC) is unique amongst mammalian proteins in that it not only has the capacity to aggregate (in the form of scrapie PrP; PrPSc) and cause neuronal degeneration, but can also act as an independent vector for the transmission of disease from one individual to another of the same or, in some instances, other species. Since the discovery of PrPC nearly thirty years ago, two salient questions have remained largely unanswered, namely, (i) what is the normal function of the cellular protein in the central nervous system, and (ii) what is/are the factor(s) involved in the misfolding of PrPC into PrPSc? To shed light on aspects of these questions, we undertook a discovery-based interactome investigation of PrPC in mouse neuroblastoma cells (Chapter 2), and among the candidate interactors, identified two members of the ZIP family of zinc transporters (ZIP6 and ZIP10) as possessing a PrP-like domain. Detailed analyses revealed that the LIV-1 subfamily of ZIP transporters (to which ZIPs 6 and 10 belong) are in fact the evolutionary ancestors of prions (Chapter 3). -
Aberrant Expression of ZIP and Znt Zinc Transporters in Urotsa Cells Transformed to Malignant Cells by Cadmium
Article Aberrant Expression of ZIP and ZnT Zinc Transporters in UROtsa Cells Transformed to Malignant Cells by Cadmium Soisungwan Satarug 1,2,*, Scott H. Garrett 2, Seema Somji 2, Mary Ann Sens 2 and Donald A. Sens 2 1 Kidney Disease Research Collaborative, Centre for Health Service Research, The University of Queensland Translational Research Institute, Woolloongabba, Brisbane 4102, Australia 2 Department of Pathology, University of North Dakota School of Medicine and Health Sciences, Grand Forks, ND 58202, USA; [email protected] (S.H.G.); [email protected] (S.S.); [email protected] (M.A.S.); [email protected] (D.A.S.) * Correspondence: [email protected] Abstract: Maintenance of zinc homeostasis is pivotal to the regulation of cell growth, differentiation, apoptosis, and defense mechanisms. In mammalian cells, control of cellular zinc homeostasis is through zinc uptake, zinc secretion, and zinc compartmentalization, mediated by metal transporters of the Zrt-/Irt-like protein (ZIP) family and the Cation Diffusion Facilitators (CDF) or ZnT family. We quantified transcript levels of ZIP and ZnT zinc transporters expressed by non-tumorigenic UROtsa cells and compared with those expressed by UROtsa clones that were experimentally transformed to cancer cells by prolonged exposure to cadmium (Cd). Although expression of the ZIP8 gene in parent UROtsa cells was lower than ZIP14 (0.1 vs. 83 transcripts per 1000 β-actin transcripts), an increased expression of ZIP8 concurrent with a reduction in expression of one or two zinc influx transporters, namely ZIP1, ZIP2, and ZIP3, were seen in six out of seven transformed UROtsa clones. -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
Protein Identities in Evs Isolated from U87-MG GBM Cells As Determined by NG LC-MS/MS
Protein identities in EVs isolated from U87-MG GBM cells as determined by NG LC-MS/MS. No. Accession Description Σ Coverage Σ# Proteins Σ# Unique Peptides Σ# Peptides Σ# PSMs # AAs MW [kDa] calc. pI 1 A8MS94 Putative golgin subfamily A member 2-like protein 5 OS=Homo sapiens PE=5 SV=2 - [GG2L5_HUMAN] 100 1 1 7 88 110 12,03704523 5,681152344 2 P60660 Myosin light polypeptide 6 OS=Homo sapiens GN=MYL6 PE=1 SV=2 - [MYL6_HUMAN] 100 3 5 17 173 151 16,91913397 4,652832031 3 Q6ZYL4 General transcription factor IIH subunit 5 OS=Homo sapiens GN=GTF2H5 PE=1 SV=1 - [TF2H5_HUMAN] 98,59 1 1 4 13 71 8,048185945 4,652832031 4 P60709 Actin, cytoplasmic 1 OS=Homo sapiens GN=ACTB PE=1 SV=1 - [ACTB_HUMAN] 97,6 5 5 35 917 375 41,70973209 5,478027344 5 P13489 Ribonuclease inhibitor OS=Homo sapiens GN=RNH1 PE=1 SV=2 - [RINI_HUMAN] 96,75 1 12 37 173 461 49,94108966 4,817871094 6 P09382 Galectin-1 OS=Homo sapiens GN=LGALS1 PE=1 SV=2 - [LEG1_HUMAN] 96,3 1 7 14 283 135 14,70620005 5,503417969 7 P60174 Triosephosphate isomerase OS=Homo sapiens GN=TPI1 PE=1 SV=3 - [TPIS_HUMAN] 95,1 3 16 25 375 286 30,77169764 5,922363281 8 P04406 Glyceraldehyde-3-phosphate dehydrogenase OS=Homo sapiens GN=GAPDH PE=1 SV=3 - [G3P_HUMAN] 94,63 2 13 31 509 335 36,03039959 8,455566406 9 Q15185 Prostaglandin E synthase 3 OS=Homo sapiens GN=PTGES3 PE=1 SV=1 - [TEBP_HUMAN] 93,13 1 5 12 74 160 18,68541938 4,538574219 10 P09417 Dihydropteridine reductase OS=Homo sapiens GN=QDPR PE=1 SV=2 - [DHPR_HUMAN] 93,03 1 1 17 69 244 25,77302971 7,371582031 11 P01911 HLA class II histocompatibility antigen, -
Role of ZIP8 in Host Response to Mycobacterium Tuberculosis
International Journal of Molecular Sciences Review Elemental Ingredients in the Macrophage Cocktail: Role of ZIP8 in Host Response to Mycobacterium tuberculosis Charlie J. Pyle 1, Abul K. Azad 2, Audrey C. Papp 3, Wolfgang Sadee 3, Daren L. Knoell 4,* and Larry S. Schlesinger 2,* 1 Department of Molecular Genetics and Microbiology, Duke University, Durham, NC 27710, USA; [email protected] 2 Texas Biomedical Research Institute, San Antonio, TX 78227, USA; [email protected] 3 Center for Pharmacogenomics, Department of Cancer Biology and Genetics, College of Medicine, The Ohio State University Wexner Medical Center, Columbus, OH 43085, USA; [email protected] (A.C.P.); [email protected] (W.S.) 4 College of Pharmacy, The University of Nebraska Medical Center, Omaha, NE 68198-6120, USA * Correspondence: [email protected] (D.L.K.); [email protected] (L.S.S.); Tel.: +1-402-559-9016 (D.L.K.); +1-210-258-9419 (L.S.S.) Received: 6 October 2017; Accepted: 6 November 2017; Published: 9 November 2017 Abstract: Tuberculosis (TB) is a global epidemic caused by the infection of human macrophages with the world’s most deadly single bacterial pathogen, Mycobacterium tuberculosis (M.tb). M.tb resides in a phagosomal niche within macrophages, where trace element concentrations impact the immune response, bacterial metal metabolism, and bacterial survival. The manipulation of micronutrients is a critical mechanism of host defense against infection. In particular, the human zinc transporter Zrt-/Irt-like protein 8 (ZIP8), one of 14 ZIP family members, is important in the flux of divalent cations, including zinc, into the cytoplasm of macrophages. -
MA Identifier Upordown LFC Avgexpr T P Value P Corrected
MA_Identifier UpOrDown LFC AvgExpr t p_value p_corrected mRNA_Accession mRNA_Name AGT_Accession GD214292.1 Up 2.09674838 10.60378749 30.17940104 1.3532E-12 4.15339E-08 No Good Match No Good Match TR73477|c2_g4_i1 EB253690.1 Up 1.42056324 8.629454582 16.9400776 8.61647E-10 4.15339E-08 No Good Match No Good Match TR114624|c0_g1_i1 EB324506.1 Up 1.714877372 11.7626061 29.56600148 1.62329E-12 4.15339E-08 XM_013079935 uncharacterized LOC101862711, transcript variant X2 TR105757|c1_g1_i3 EB244298.1 Up 1.504941765 13.13555745 25.49705172 8.54949E-12 6.17912E-08 XM_005093725 uncharacterized LOC101862711, transcript variant X3 TR105757|c1_g1_i1 EB350631.1 Up 1.951725495 13.11211692 23.57801356 2.22739E-11 1.45399E-07 No Good Match No Good Match TR674|c0_g1_i1 EB250403.1 Up 2.236254197 12.79847784 21.59049993 6.28948E-11 3.48034E-07 No Good Match No Good Match TR107643|c0_g1_i1 EB229658.1 Up 1.196239323 12.26876042 18.23277846 3.64746E-10 5.66891E-07 No Good Match No Good Match CL455Contig2 EB349970.1 Up 0.915715907 13.66977042 17.25614464 6.50486E-10 8.43055E-07 No Good Match No Good Match TR112158|c9_g9_i1 EB215450.1 Down -0.779710678 9.573335222 -15.07554052 2.88601E-09 1.03781E-06 No Good Match No Good Match TR81289|c1_g1_i5 EB256532.1 Up 0.957584438 12.63905003 15.56227553 2.07024E-09 1.19669E-06 No Good Match No Good Match TR64854|c4_g1_i2 EB261386.1 Up 0.771865585 7.532393475 13.39242509 1.06221E-08 1.19669E-06 No Good Match No Good Match TR87266|c0_g1_i1 EB323709.1 Up 0.993428329 8.843840926 14.33197647 5.17673E-09 1.19669E-06 XM_013085446 -
9-Azido Analogs of Three Sialic Acid Forms for Metabolic Remodeling Of
Supporting Information 9-Azido Analogs of Three Sialic Acid Forms for Metabolic Remodeling of Cell-Surface Sialoglycans Bo Cheng,†,‡ Lu Dong,†,§ Yuntao Zhu,†,‡ Rongbing Huang,†,‡ Yuting Sun,†,‖ Qiancheng You,†,‡ Qitao Song,†,§ James C. Paton, ∇ Adrienne W. Paton,∇ and Xing Chen*,†,‡,§,⊥,# †College of Chemistry and Molecular Engineering, ‡Beijing National Laboratory for Molecular Sciences, §Peking−Tsinghua Center for Life Sciences,‖Academy for Advanced Interdisciplinary Studies, ⊥Synthetic and Functional Biomolecules Center, and #Key Laboratory of Bioorganic Chemistry and Molecular Engineering of Ministry of Education, Peking University, Beijing 100871, China ∇Research Centre for Infectious Diseases, Department of Molecular and Biomedical Science, University of Adelaide, Adelaide SA 5005, Australia Page S1 Table of Contents: Scheme S1.……………………………………………………….........……………. S3 Figure S1……………………………………………………..………..……………. S3 Figure S2……………………………………………………..………..…………… S4 Figure S3……………………………………………………..………..…………… S4 Figure S4……………………………………………………..………..…………… S5 Figure S5……………………………………………………..………..…………… S6 Figure S6……………………………………………………..………..…………….S7 Figure S7……………………………………………………..………..…………….S8 Figure S8……………………………………………………..………..…………….S9 Experimental Procedures……………………………….…........…………....S10-S27 Table S1………………………………………………..………..…………….S28-S48 Supporting Reference……………………………………………….......………...S49 Page S2 Scheme S1. Synthesis of 9AzNeu5Gc Figure S1: a, b, c, d) Representative scatter plots (FSC vs. SSC) and histograms of flow cytometry analysis -
The Crossroads Between Zinc and Steroidal Implant-Induced Growth of Beef Cattle
animals Review The Crossroads between Zinc and Steroidal Implant-Induced Growth of Beef Cattle Elizabeth M. Messersmith † , Dathan T. Smerchek † and Stephanie L. Hansen * Department of Animal Science, Iowa State University, Ames, IA 50011, USA; [email protected] (E.M.M.); [email protected] (D.T.S.) * Correspondence: [email protected] † These authors contributed equally to this work. Simple Summary: This review addresses the physiological and biochemical connections between steroidal implants and Zn and their interaction to influence growth in beef cattle. Steroidal implants have been widely accepted as a growth-promoting technology that provides an unmatched economic return to the producer and improves beef production’s environmental sustainability. Likewise, decades of research have indicated Zn is vital for skeletal muscle growth. Considering Zn is an essen- tial trace mineral, strategic Zn supplementation to implanted cattle may optimize beef production. Although many interrelationships between steroidal implants and Zn are new and forthcoming, the literature reviewed hereafter indicates roles for Zn in a multitude of growth processes perti- nent to steroidal implant-induced growth and uncover changes in Zn metabolism due to steroidal implant use. Abstract: Growth-promoting technologies such as steroidal implants have been utilized in the beef industry for over 60 years and remain an indispensable tool for improving economic returns through consistently improved average daily gain via increased skeletal muscle hypertrophy. Zinc has been Citation: Messersmith, E.M.; implicated in skeletal muscle growth through protein synthesis, satellite cell function, and many Smerchek, D.T.; Hansen, S.L. The other growth processes. Therefore, the objective of this review was to present the available literature Crossroads between Zinc and linking Zn to steroidal implant-induced protein synthesis and other metabolic processes. -
The Role of Zip Superfamily of Metal Transporters in Chronic Diseases, Purification & Characterization of a Bacterial Zip Tr
Wayne State University Wayne State University Theses 1-1-2011 The Role Of Zip Superfamily Of Metal Transporters In Chronic Diseases, Purification & Characterization Of A Bacterial Zip Transporter: Zupt. Iryna King Wayne State University Follow this and additional works at: http://digitalcommons.wayne.edu/oa_theses Part of the Biochemistry Commons, and the Molecular Biology Commons Recommended Citation King, Iryna, "The Role Of Zip Superfamily Of Metal Transporters In Chronic Diseases, Purification & Characterization Of A Bacterial Zip Transporter: Zupt." (2011). Wayne State University Theses. Paper 63. This Open Access Thesis is brought to you for free and open access by DigitalCommons@WayneState. It has been accepted for inclusion in Wayne State University Theses by an authorized administrator of DigitalCommons@WayneState. THE ROLE OF ZIP SUPERFAMILY OF METAL TRANSPORTERS IN CHRONIC DISEASES, PURIFICATION & CHARACTERIZATION OF A BACTERIAL ZIP TRANSPORTER: ZUPT by IRYNA KING THESIS Submitted to the Graduate School of Wayne State University, Detroit, Michigan in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE 2011 MAJOR: BIOCHEMISTRY & MOLECULAR BIOLOGY Approved by: ___________________________________ Advisor Date © COPYRIGHT BY IRYNA KING 2011 All Rights Reserved DEDICATION I dedicate this work to my father, Julian Banas, whose footsteps I indisputably followed into science & my every day inspiration, my son, William Peter King ii ACKNOWLEDGMENTS First and foremost I would like to thank the department of Biochemistry & Molecular Biology at Wayne State University School of Medicine for giving me an opportunity to conduct my research and be a part of their family. I would like to thank my advisor Dr. Bharati Mitra for taking me into the program and nurturing a biochemist in me. -
Transcriptomic and Proteomic Profiling Provides Insight Into
BASIC RESEARCH www.jasn.org Transcriptomic and Proteomic Profiling Provides Insight into Mesangial Cell Function in IgA Nephropathy † † ‡ Peidi Liu,* Emelie Lassén,* Viji Nair, Celine C. Berthier, Miyuki Suguro, Carina Sihlbom,§ † | † Matthias Kretzler, Christer Betsholtz, ¶ Börje Haraldsson,* Wenjun Ju, Kerstin Ebefors,* and Jenny Nyström* *Department of Physiology, Institute of Neuroscience and Physiology, §Proteomics Core Facility at University of Gothenburg, University of Gothenburg, Gothenburg, Sweden; †Division of Nephrology, Department of Internal Medicine and Department of Computational Medicine and Bioinformatics, University of Michigan, Ann Arbor, Michigan; ‡Division of Molecular Medicine, Aichi Cancer Center Research Institute, Nagoya, Japan; |Department of Immunology, Genetics and Pathology, Uppsala University, Uppsala, Sweden; and ¶Integrated Cardio Metabolic Centre, Karolinska Institutet Novum, Huddinge, Sweden ABSTRACT IgA nephropathy (IgAN), the most common GN worldwide, is characterized by circulating galactose-deficient IgA (gd-IgA) that forms immune complexes. The immune complexes are deposited in the glomerular mesangium, leading to inflammation and loss of renal function, but the complete pathophysiology of the disease is not understood. Using an integrated global transcriptomic and proteomic profiling approach, we investigated the role of the mesangium in the onset and progression of IgAN. Global gene expression was investigated by microarray analysis of the glomerular compartment of renal biopsy specimens from patients with IgAN (n=19) and controls (n=22). Using curated glomerular cell type–specific genes from the published literature, we found differential expression of a much higher percentage of mesangial cell–positive standard genes than podocyte-positive standard genes in IgAN. Principal coordinate analysis of expression data revealed clear separation of patient and control samples on the basis of mesangial but not podocyte cell–positive standard genes.