DOCSLIB.ORG

The Influence of Dietary Zinc Concentration During Periods Of

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The Influence of Dietary Zinc Concentration During Periods Of Iowa State University Capstones, Theses and Graduate Theses and Dissertations Dissertations 2019 The influence of dietary zinc concentration during periods of rapid growth induced by ractopamine hydrochloride or dietary energy and dietary fiber content on trace mineral metabolism and performance of beef steers Remy Nicole Carmichael Iowa State University Follow this and additional works at: https://lib.dr.iastate.edu/etd Part of the Agriculture Commons, and the Animal Sciences Commons Recommended Citation Carmichael, Remy Nicole, "The influence of dietary zinc concentration during periods of rapid growth induced by ractopamine hydrochloride or dietary energy and dietary fiber content on trace mineral metabolism and performance of beef steers" (2019). Graduate Theses and Dissertations. 17416. https://lib.dr.iastate.edu/etd/17416 This Dissertation is brought to you for free and open access by the Iowa State University Capstones, Theses and Dissertations at Iowa State University Digital Repository. It has been accepted for inclusion in Graduate Theses and Dissertations by an authorized administrator of Iowa State University Digital Repository. For more information, please contact [email protected]. The influence of dietary zinc concentration during periods of rapid growth induced by ractopamine hydrochloride or dietary energy and dietary fiber content on trace mineral metabolism and performance of beef steers by Remy Nicole Carmichael A dissertation submitted to the graduate faculty in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY Major: Animal Science Program of Study Committee: Stephanie Hansen, Major Professor Nicholas Gabler Olivia Genther-Schroeder Elisabeth Huff-Lonergan Daniel Loy The student author, whose presentation of the scholarship herein was approved by the program of study committee, is solely responsible for the content of this dissertation. The Graduate College will ensure this dissertation is globally accessible and will not permit alterations after a degree is conferred. Iowa State University Ames, Iowa 2019 Copyright © Remy Nicole Carmichael, 2019. All rights reserved. ii TABLE OF CONTENTS Page NOMENCLATURE ........................................................................................................... v ACKNOWLEDGMENTS ............................................................................................... viii ABSTRACT ........................................................................................................................ x CHAPTER 1. GENERAL INTRODUCTION ................................................................... 1 Dissertation Organization .............................................................................................. 2 CHAPTER 2. LITERATURE REVIEW ............................................................................ 4 Zinc in Ruminant Diets .................................................................................................. 4 Importance of Zn in the Body .................................................................................. 4 Establishing Zn as a Requirement for Cattle ............................................................ 6 Zn Trafficking .......................................................................................................... 7 Metallothionein: Zn Sequestering Protein ................................................................ 9 Zinc Influx and Homeostasis .................................................................................. 11 Zinc Exporters ........................................................................................................ 12 Zinc and Diet Digestibility ..................................................................................... 12 Dietary Energy ............................................................................................................. 14 Dietary Energy History .......................................................................................... 14 Dietary Energy Systems in Cattle .......................................................................... 15 Net Energy and Gain .............................................................................................. 17 Growth Technology Impacts on Net Energy Requirements .................................. 18 Beta-Adrenergic Agonists ........................................................................................... 20 Beta-Adrenergic Agonist use in Cattle ................................................................... 20 Mode of Action ...................................................................................................... 22 Zinc and Growth Pathways .......................................................................................... 26 Interactions between Zn and the b-Adrenergic Agonist Cascade .......................... 26 Zinc and Anabolic Implants ................................................................................... 29 Literature Cited ............................................................................................................ 33 CHAPTER 3. THE INFLUENCE OF SUPPLEMENTAL ZINC AND RACTOPAMINE HYDROCHLORIDE ON TRACE MINERAL AND NITROGEN RETENTION OF BEEF STEERS .................................................................................... 51 Abstract: ....................................................................................................................... 51 Introduction ................................................................................................................. 52 Materials and Methods ................................................................................................ 53 Experimental Design .............................................................................................. 53 Metabolism Period ................................................................................................. 55 Analytical Procedures ............................................................................................. 56 Statistical Analysis ................................................................................................. 58 iii Results ......................................................................................................................... 58 Pre-BA Growth Period. .......................................................................................... 58 Collection Period. ................................................................................................... 58 Overall performance and liver mineral concentrations. ......................................... 59 Discussion .................................................................................................................... 60 Literature Cited ............................................................................................................ 65 CHAPTER 4. THE INFLUENCE OF RACTOPAMINE HYDROCHLORIDE SUPPLEMENTATION AND SUPPLEMENTAL ZINC CONCENTRATION AND SOURCE ON PERFORMANCE, TRACE MINERAL STATUS, AND GENE EXPRESSION IN BEEF STEERS ................................................................................... 76 Abstract: ....................................................................................................................... 76 Introduction ................................................................................................................. 78 Materials and Methods ................................................................................................ 79 Experimental Design .............................................................................................. 79 Feed and Tissue Analysis ....................................................................................... 81 Statistical Analysis ................................................................................................. 83 Results ......................................................................................................................... 84 Pre-Ractopamine Period ......................................................................................... 84 Ractopamine HCl Supplementation Period ............................................................ 84 Discussion .................................................................................................................... 87 Literature Cited ............................................................................................................ 93 CHAPTER 5. THE INFLUENCE OF SUPPLEMENTAL ZINC AND DIETARY FIBER CONCENTRATION ON MINERAL RETENTION OF BEEF STEERS ........ 109 Abstract: ..................................................................................................................... 109 Introduction ............................................................................................................... 110 Materials and Methods .............................................................................................. 111 Experimental Design ............................................................................................ 112 Metabolism Period ............................................................................................... 113 Analytical Procedures ........................................................................................... 115 Statistical Analysis ..............................................................................................
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Chuannaky2016phd.Pdf (13.10Mb)
    ! " " ZINC%HOMEOSTASIS!IN#HEALTH,!EXERCISE!AND$ CHRONIC'DISEASES! " " " " " " Anna Kit Yung Chu BAppSc (Ex&SpSc) / BSc (Nutr) (Hons I) The University of Sydney, 2012 A thesis submitted in fulfilment of the requirements for the degree of Doctor of Philosophy (PhD) Department of Human Nutrition Division of Sciences University of Otago 2016 i" " """""" """""! " Table&of&Contents& & Abstract&...................................................................................................................................&iv" Acknowledgments&...............................................................................................................&vi" List&of&abbreviations&........................................................................................................&viii" List&of&tables&............................................................................................................................&x" List&of&figures&.......................................................................................................................&xii" Publications&arising&from&this&thesis&............................................................................&xv" List&of&other&publications&arising&from&this&thesis&.................................................&xvi" Chapter&1&&&Introduction&and&Literature&Review&.............................................................&1" Introduction&............................................................................................................................&2" Whole&body&zinc&homeostasis&...........................................................................................&5"
    [Show full text]
  • Aberrant Expression of ZIP and Znt Zinc Transporters in Urotsa Cells Transformed to Malignant Cells by Cadmium
    Article Aberrant Expression of ZIP and ZnT Zinc Transporters in UROtsa Cells Transformed to Malignant Cells by Cadmium Soisungwan Satarug 1,2,*, Scott H. Garrett 2, Seema Somji 2, Mary Ann Sens 2 and Donald A. Sens 2 1 Kidney Disease Research Collaborative, Centre for Health Service Research, The University of Queensland Translational Research Institute, Woolloongabba, Brisbane 4102, Australia 2 Department of Pathology, University of North Dakota School of Medicine and Health Sciences, Grand Forks, ND 58202, USA; [email protected] (S.H.G.); [email protected] (S.S.); [email protected] (M.A.S.); [email protected] (D.A.S.) * Correspondence: [email protected] Abstract: Maintenance of zinc homeostasis is pivotal to the regulation of cell growth, differentiation, apoptosis, and defense mechanisms. In mammalian cells, control of cellular zinc homeostasis is through zinc uptake, zinc secretion, and zinc compartmentalization, mediated by metal transporters of the Zrt-/Irt-like protein (ZIP) family and the Cation Diffusion Facilitators (CDF) or ZnT family. We quantified transcript levels of ZIP and ZnT zinc transporters expressed by non-tumorigenic UROtsa cells and compared with those expressed by UROtsa clones that were experimentally transformed to cancer cells by prolonged exposure to cadmium (Cd). Although expression of the ZIP8 gene in parent UROtsa cells was lower than ZIP14 (0.1 vs. 83 transcripts per 1000 β-actin transcripts), an increased expression of ZIP8 concurrent with a reduction in expression of one or two zinc influx transporters, namely ZIP1, ZIP2, and ZIP3, were seen in six out of seven transformed UROtsa clones.
    [Show full text]
  • Interactions of Zinc with the Intestinal Epithelium - Effects On
    Aus dem Institut für Veterinär-Physiologie des Fachbereichs Veterinärmedizin der Freien Universität Berlin Interactions of zinc with the intestinal epithelium - effects on transport properties and zinc homeostasis Inaugural-Dissertation zur Erlangung des Grades eines Doktors der Veterinärmedizin an der Freien U niversität Berlin vorgelegt von Eva-Maria Näser, geb. Gefeller Tierärztin aus Kassel Berlin 2015 Journal-Nr.: 3813 Gefördert durch die Deutsche Forschungsgemeinschaft und die H.W. Schaumann Stiftung Gedruckt mit Genehmigung des Fachbereichs Veterinärmedizin der Freien Universität Berlin Dekan: Univ.-Prof. Dr. Jürgen Zentek Erster Gutachter: Univ.-Prof. Dr. Jörg Rudolf Aschenbach Zweiter Gutachter: Prof. Dr. Holger Martens Dritter Gutachter: Prof. Dr. Robert Klopfleisch Deskriptoren (nach CAB-Thesaurus): pigs, weaning, zinc, intestines, epithelium, jejunum, ion transport Tag der Promotion: 15.09.2015 Bibliografische Information der Deutschen Nationalbibliothek Die Deutsche Nationalbibliothek verzeichnet diese Publikation in der Deutschen Nationalbibliografie; detaillierte bibliografische Daten sind im Internet über <http://dnb.ddb.de> abrufbar. ISBN: 978-3-86387-656-2 Zugl.: Berlin, Freie Univ., Diss., 2015 Dissertation, Freie Universität Berlin D 188 Dieses Werk ist urheberrechtlich geschützt. Alle Rechte, auch die der Übersetzung, des Nachdruckes und der Vervielfältigung des Buches, oder Teilen daraus, vorbehalten. Kein Teil des Werkes darf ohne schriftliche Genehmigung des Verlages in irgendeiner Form reproduziert oder unter Verwendung elektronischer Systeme verarbeitet, vervielfältigt oder verbreitet werden. Die Wiedergabe von Gebrauchsnamen, Warenbezeichnungen, usw. in diesem Werk berechtigt auch ohne besondere Kennzeichnung nicht zu der Annahme, dass solche Namen im Sinne der Warenzeichen- und Markenschutz-Gesetzgebung als frei zu betrachten wären und daher von jedermann benutzt werden dürfen. This document is protected by copyright law.
    [Show full text]
  • Targeting an Nrf2/G6pdh Pathway to Reverse Multi-Drug
    TARGETING AN NRF2/G6PDH PATHWAY TO REVERSE MULTI-DRUG RESISTANCE IN DIFFUSE LARGE B-CELL LYMPHOMA A Dissertation by SEYEDHOSSEIN MOUSAVIFARD Submitted to the Office of Graduate and Professional Studies of Texas A&M University in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY Chair of Committee, Steve Maxwell Committee Members, James C. Sacchettini Raquel Sitcheran David W. Threadgill Warren Zimmer Head of Program, Warren Zimmer May 2017 Major Subject: Medical Sciences Copyright 2017 Seyed Hossein Mousavi-Fard ABSTRACT A leading cause of mortality in diffuse large B-cell lymphoma (DLBCL) patients is the development of resistance to the CHOP regimen, the anthracycline-based chemotherapy consisting of cyclophosphamide, doxorubicin, vincristine, and prednisone. Our first objective of this work was to investigate the impact of Nuclear factor erythroid–related factor 2 (Nrf2)/ glucose-6-phosphate dehydrogenase (G6PDH) pathway on CHOP-resistance in DLBCL cell lines. We provide evidence here that a Nrf2/G6PDH pathway plays a role in mediating CHOP resistance in DLBCL. We found that CHOP-resistant DLBCL cells expressed both higher Nrf2 and G6PDH activities and lower reactive oxygen (predominantly superoxide) levels than CHOP- sensitive cells. We hypothesized that increased activity of the Nrf2/G6PDH pathway leads to higher GSH production, a more reduced state (lower ROS), and CHOP-resistance. In support of our hypothesis, direct inhibition of G6PDH or knockdown of Nrf2/G6PDH lowered both NADPH and GSH levels, increased ROS, and reduced tolerance or CHOP-resistant cells to CHOP. We also present evidence that repeated cycles of CHOP treatment select for a small population of Nrf2High/G6PDHHigh/ROSLow cells that are more tolerant of CHOP and might be responsible for the emergence of chemoresistant tumors.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Loss of the Dermis Zinc Transporter ZIP13 Promotes the Mildness Of
    www.nature.com/scientificreports OPEN Loss of the dermis zinc transporter ZIP13 promotes the mildness of fbrosarcoma by inhibiting autophagy Mi-Gi Lee1,8, Min-Ah Choi2,8, Sehyun Chae3,8, Mi-Ae Kang4, Hantae Jo4, Jin-myoung Baek4, Kyu-Ree In4, Hyein Park4, Hyojin Heo4, Dongmin Jang5, Sofa Brito4, Sung Tae Kim6, Dae-Ok Kim 1,7, Jong-Soo Lee4, Jae-Ryong Kim2* & Bum-Ho Bin 4* Fibrosarcoma is a skin tumor that is frequently observed in humans, dogs, and cats. Despite unsightly appearance, studies on fbrosarcoma have not signifcantly progressed, due to a relatively mild tumor severity and a lower incidence than that of other epithelial tumors. Here, we focused on the role of a recently-found dermis zinc transporter, ZIP13, in fbrosarcoma progression. We generated two transformed cell lines from wild-type and ZIP13-KO mice-derived dermal fbroblasts by stably expressing the Simian Virus (SV) 40-T antigen. The ZIP13−/− cell line exhibited an impairment in autophagy, followed by hypersensitivity to nutrient defciency. The autophagy impairment in the ZIP13−/− cell line was due to the low expression of LC3 gene and protein, and was restored by the DNA demethylating agent, 5-aza-2’-deoxycytidine (5-aza) treatment. Moreover, the DNA methyltransferase activity was signifcantly increased in the ZIP13−/− cell line, indicating the disturbance of epigenetic regulations. Autophagy inhibitors efectively inhibited the growth of fbrosarcoma with relatively minor damages to normal cells in xenograft assay. Our data show that proper control over autophagy and zinc homeostasis could allow for the development of a new therapeutic strategy to treat fbrosarcoma.
    [Show full text]
  • Role of ZIP8 in Host Response to Mycobacterium Tuberculosis
    International Journal of Molecular Sciences Review Elemental Ingredients in the Macrophage Cocktail: Role of ZIP8 in Host Response to Mycobacterium tuberculosis Charlie J. Pyle 1, Abul K. Azad 2, Audrey C. Papp 3, Wolfgang Sadee 3, Daren L. Knoell 4,* and Larry S. Schlesinger 2,* 1 Department of Molecular Genetics and Microbiology, Duke University, Durham, NC 27710, USA; [email protected] 2 Texas Biomedical Research Institute, San Antonio, TX 78227, USA; [email protected] 3 Center for Pharmacogenomics, Department of Cancer Biology and Genetics, College of Medicine, The Ohio State University Wexner Medical Center, Columbus, OH 43085, USA; [email protected] (A.C.P.); [email protected] (W.S.) 4 College of Pharmacy, The University of Nebraska Medical Center, Omaha, NE 68198-6120, USA * Correspondence: [email protected] (D.L.K.); [email protected] (L.S.S.); Tel.: +1-402-559-9016 (D.L.K.); +1-210-258-9419 (L.S.S.) Received: 6 October 2017; Accepted: 6 November 2017; Published: 9 November 2017 Abstract: Tuberculosis (TB) is a global epidemic caused by the infection of human macrophages with the world’s most deadly single bacterial pathogen, Mycobacterium tuberculosis (M.tb). M.tb resides in a phagosomal niche within macrophages, where trace element concentrations impact the immune response, bacterial metal metabolism, and bacterial survival. The manipulation of micronutrients is a critical mechanism of host defense against infection. In particular, the human zinc transporter Zrt-/Irt-like protein 8 (ZIP8), one of 14 ZIP family members, is important in the flux of divalent cations, including zinc, into the cytoplasm of macrophages.
    [Show full text]
  • The Crossroads Between Zinc and Steroidal Implant-Induced Growth of Beef Cattle
    animals Review The Crossroads between Zinc and Steroidal Implant-Induced Growth of Beef Cattle Elizabeth M. Messersmith † , Dathan T. Smerchek † and Stephanie L. Hansen * Department of Animal Science, Iowa State University, Ames, IA 50011, USA; [email protected] (E.M.M.); [email protected] (D.T.S.) * Correspondence: [email protected] † These authors contributed equally to this work. Simple Summary: This review addresses the physiological and biochemical connections between steroidal implants and Zn and their interaction to influence growth in beef cattle. Steroidal implants have been widely accepted as a growth-promoting technology that provides an unmatched economic return to the producer and improves beef production’s environmental sustainability. Likewise, decades of research have indicated Zn is vital for skeletal muscle growth. Considering Zn is an essen- tial trace mineral, strategic Zn supplementation to implanted cattle may optimize beef production. Although many interrelationships between steroidal implants and Zn are new and forthcoming, the literature reviewed hereafter indicates roles for Zn in a multitude of growth processes perti- nent to steroidal implant-induced growth and uncover changes in Zn metabolism due to steroidal implant use. Abstract: Growth-promoting technologies such as steroidal implants have been utilized in the beef industry for over 60 years and remain an indispensable tool for improving economic returns through consistently improved average daily gain via increased skeletal muscle hypertrophy. Zinc has been Citation: Messersmith, E.M.; implicated in skeletal muscle growth through protein synthesis, satellite cell function, and many Smerchek, D.T.; Hansen, S.L. The other growth processes. Therefore, the objective of this review was to present the available literature Crossroads between Zinc and linking Zn to steroidal implant-induced protein synthesis and other metabolic processes.
    [Show full text]
  • The Role of Zip Superfamily of Metal Transporters in Chronic Diseases, Purification & Characterization of a Bacterial Zip Tr
    Wayne State University Wayne State University Theses 1-1-2011 The Role Of Zip Superfamily Of Metal Transporters In Chronic Diseases, Purification & Characterization Of A Bacterial Zip Transporter: Zupt. Iryna King Wayne State University Follow this and additional works at: http://digitalcommons.wayne.edu/oa_theses Part of the Biochemistry Commons, and the Molecular Biology Commons Recommended Citation King, Iryna, "The Role Of Zip Superfamily Of Metal Transporters In Chronic Diseases, Purification & Characterization Of A Bacterial Zip Transporter: Zupt." (2011). Wayne State University Theses. Paper 63. This Open Access Thesis is brought to you for free and open access by DigitalCommons@WayneState. It has been accepted for inclusion in Wayne State University Theses by an authorized administrator of DigitalCommons@WayneState. THE ROLE OF ZIP SUPERFAMILY OF METAL TRANSPORTERS IN CHRONIC DISEASES, PURIFICATION & CHARACTERIZATION OF A BACTERIAL ZIP TRANSPORTER: ZUPT by IRYNA KING THESIS Submitted to the Graduate School of Wayne State University, Detroit, Michigan in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE 2011 MAJOR: BIOCHEMISTRY & MOLECULAR BIOLOGY Approved by: ___________________________________ Advisor Date © COPYRIGHT BY IRYNA KING 2011 All Rights Reserved DEDICATION I dedicate this work to my father, Julian Banas, whose footsteps I indisputably followed into science & my every day inspiration, my son, William Peter King ii ACKNOWLEDGMENTS First and foremost I would like to thank the department of Biochemistry & Molecular Biology at Wayne State University School of Medicine for giving me an opportunity to conduct my research and be a part of their family. I would like to thank my advisor Dr. Bharati Mitra for taking me into the program and nurturing a biochemist in me.
    [Show full text]
  • Dataset for the Quantitative Proteomics Analysis of the Primary Hepatocellular Carcinoma with Single and Multiple Lesions
    Data in Brief 5 (2015) 226–240 Contents lists available at ScienceDirect Data in Brief journal homepage: www.elsevier.com/locate/dib Data Article Dataset for the quantitative proteomics analysis of the primary hepatocellular carcinoma with single and multiple lesions Xiaohua Xing a,b, Yao Huang c, Sen Wang a,b, Minhui Chi a,b,c, Yongyi Zeng a,b,c, Lihong Chen a,b,c, Ling Li a,b,c, Jinhua Zeng a,b,c, Minjie Lin a,b, Xiao Han d, Jingfeng Liu a,b,c, Xiaolong Liu a,b,n a The Liver Center of Fujian Province, Fujian Medical University, Fuzhou 350025, People’s Republic of China b The United Innovation of Mengchao Hepatobiliary Technology Key Laboratory of Fujian Province, Mengchao Hepatobiliary Hospital of Fujian Medical University, Fuzhou 350025, People’s Republic of China c Liver Disease Center, The First Affiliated Hospital of Fujian Medical University, Fuzhou 350007, People’s Republic of China d Biotechnology Research Institute, Chinese Academy of Agricultural Sciences, Beijing 100081, People’s Republic of China article info abstract Article history: Hepatocellular Carcinoma (HCC) is one of the most common malig- Received 18 August 2015 nant tumor, which is causing the second leading cancer-related death Received in revised form worldwide. The tumor tissues and the adjacent noncancerous tissues 27 August 2015 obtained from HCC patients with single and multiple lesions were Accepted 28 August 2015 quantified using iTRAQ. A total of 5513 proteins (FDR of 1%) were Available online 8 September 2015 identified which correspond to roughly 27% of the total liver proteome.
    [Show full text]
  • Relationship Between Neuropathic Pain and Zinc
    Global Drugs and Therapeutics Mini Review ISSN: 2398-970X Relationship between neuropathic pain and zinc ion Tomoya Kitayama* Department of Pharmacy, School of Pharmacy and Pharmaceutical Science, Mukogawa Women’s University, Japan Neuropathic pain characterized by spontaneous pain, pain zinc ion activates matrix metalloproteinases that convert pro-BDNF sensation and tactile allodynia. The disease arising from peripheral or to mature-BDNF [7]. Zinc ion ionophore pyrithione inhibits KCC2 spinal nerve injury, diabetes, or infection with herpes virus is a result activity in vitro [8]. In other word, increase of zinc ion induces of the final product of an altered peripheral, spinal, and supraspinal decrease KCC2 function. On the other hand, high synaptic zinc ion process for which the usual analgesics are not effective and novel regulated by zinc transporter-3 elevates KCC2 activity via activation analgesics are desired. of metabotropic zinc ion sensing receptor [9]. These reports suggest The past study indicated that reduction of chloride gradient that zinc ion concentration have an important relationship with across the neuronal membrane, which in turn leads to reduction of KCC2 function. Moreover, it is considered that the alteration of zinc anion reversal potential, occurred in neurons of the superficial dorsal concentration modulates pain signaling. horn following a peripheral nerve injury [1]. The mechanism of the + - We previously detected by microarray method that partial sciatic change is down-regulation of K -Cl -cotransporter-2 (KCC2), which is nerve ligation surgery induces the decreased expression of slc30a1 (zinc potassium-chloride exporter, in spinal lamina I [1]. Similarly, the anion transporter 1, ZnT1) mRNA. The down regulation of ZnT1 gene was gradient is induced by brain-derived neurotrophic factor (BDNF) in relationship with BDNF-TrkB-KCC2 cascade reaction in astrocyte neuropathic pain model animals [2].
    [Show full text]