DOCSLIB.ORG

Examination of the Role of Zip8 and Cadmium in the Development of Chronic Obstructive Pulmonary Disease

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Examination of the Role of Zip8 and Cadmium in the Development of Chronic Obstructive Pulmonary Disease EXAMINATION OF THE ROLE OF ZIP8 AND CADMIUM IN THE DEVELOPMENT OF CHRONIC OBSTRUCTIVE PULMONARY DISEASE DISSERTATION Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University By Jessica Rose Napolitano, B.A. Biomedical Sciences Graduate Program The Ohio State University 2014 Dissertation Committee: Daren L. Knoell, PharmD., Advisor Estelle Cormet- Boyaka, PhD. Mark Failla, PhD. Joanne Turner, PhD. Copyright by Jessica Rose Napolitano 2014 ABSTRACT Chronic obstructive pulmonary disease (COPD) is a complex respiratory disease primarily caused by cigarette smoking. Cadmium (Cd), a toxic metal abundantly present in cigarette smoke, has been implicated in the development of disease, and accumulates in the bodies of smokers. It was recently discovered that a zinc (Zn) transporter, SLC39A8 (ZIP8), is responsible for the primary import of Cd into cells. Our lab discovered ZIP8 is under the transcriptional regulation of the central inflammatory NF-κB pathway. We hypothesize that inflammation in the lung created by smoke exposure increases the expression of ZIP8 thereby facilitating Cd uptake and pathology associated with COPD. The first aim of our work addressed the role of ZIP8 in Cd-mediated epithelial cell toxicity using the adenocarcinomic alveolar epithelial A549 cell line. Cd-induced toxicity was enhanced by TNFα in an NF-κB-dependent manner, which stimulated expression of ZIP8. Use of an NF-κB (p65) inhibitor (Bay11- 7082) or ZIP8 siRNA resulted in a significant decrease in cell toxicity. Cell death was also reversible with increasing concentrations of the micronutrient Zn. Immunohistochemical analysis of primary human upper airway epithelial cells revealed preferential ZIP8 expression on the environmentally-facing apical ii membrane. Analysis of lung tissue from GOLD stage 0 cigarette smokers and non-smoking controls revealed ZIP8 mRNA and protein to be significantly increased in the lungs of smokers. We translated these findings into a mouse model of chronic cigarette smoke exposure using a transgenic ZIP8 overexpressing mouse line. ZIP8 overexpression dramatically increased emphysematic pathology, compared to smoke exposed C57/Bl6 control mice. In line with previous studies, our epidemiologic analysis of the 2011-2012 National Health and Nutrition Examination Survey revealed blood Cd levels of smokers correlated with lower Zn serum levels. Based on our findings, we contend ZIP8 is a potential mediator of COPD pathogenesis by creating an imbalance of the toxicant Cd and micronutrient Zn. Lastly, we investigated the contribution of Cd to macrophage dysfunction in COPD. We found Cd to significantly reduce a macrophages ability to respond to an endotoxin challenge, specifically by inhibiting NF-κB activity, an effect not observed in monocytes, a closely related cell type. Atomic absorption spectroscopy revealed a greater accumulation of Cd within macrophages than monocytes, suggesting fundamental differences in Cd metabolism. We postulate this may be an important mechanism by which Cd contributes to impaired immune responses observed in COPD patients. Taken together, this novel body of work suggests Zn metabolism may inadvertently contribute to COPD pathogenesis by facilitating cadmium import and thereby lung pathology. iii DEDICATION This document is dedicated to my future husband and best friend, Andrew. iv ACKNOWLEDGMENTS First, I would like to thank my advisor, Dr. Daren Knoell. You constantly challenged and encouraged me to become a better scientist, and I am deeply appreciative of your mentorship. I am grateful for your unwavering support in my pursuit of opportunities to diversify my training, as this has made all the difference as I begin to establish my career. You are an outstanding teacher and I am proud to have completed my training under your tutelage. Thank you. The members of my lab, past and current, have all played a significant role in my training. Ying Bao, thanks for always being so patient and taking the time to teach me nearly every bench technique I have learned. Mingjie Liu, I feel fortunate to have worked with a scientist as talented and meticulous as you, as you’ve set an outstanding example for me to follow. Charlie Pyle, thank you for all of your scientific discussion in lab meetings and over cups of Brennen’s coffee, they undoubtedly improved my work. Many thanks to my collaborators on the 4th floor of the DHLRI and beyond for your invaluable assistance and expertise. I would like to thank Drs. Amy Ferketich and Susan Olivo-Marston for their collaboration and encouragement to discover and pursue the science I love. I would also like to thank my committee members Dr. Estelle Cormet-Boyaka, Dr. Mark Failla and Dr. Joanne Turner whom have been incredibly generous with v their time, support and guidance. Your input has greatly improved this body of work and I sincerely appreciate your assistance. I would also like to thank my friends and family for their constant encouragement through graduate school. Ashley Bowers, I am so grateful for your friendship and all of our time spent together outside of the lab, you helped keep me balanced. To my sisters, Alyssa and Kelsey, you’ve been my biggest cheerleaders and I’m so appreciative of your friendship. To my parents, Thomas and Christine, thank you for recognizing my love of learning early, and nurturing my passion for science. You gave me the courage to pursue my Ph.D. and I cannot thank you enough for always believing in me, no matter the circumstances. And last but not least, thanks to my favorite classmate and husband-to-be, Andrew. Thank you for all of your love, patience and encouragement on this journey. I am so grateful to have found such a wonderful teammate in you, and I am so excited to see what life has in store for us. vi VITA March 13, 1987 ...................................... Born – New York, New York June 2005 ............................................... Mineola High School May 2009 ................................................ B.A. Biology, College of the Holy Cross July 2009 to present .............................. Graduate Research Associate, Department of Pulmonary, Critical Care, Allergy and Sleep Medicine, The Ohio State University PUBLICATIONS 1. Jessica R. Napolitano, Mingjie Liu, Shengying Bao, Estelle Cormet-Boyaka, Patrick Nana-Sinkam, Melissa Crawford, Daren L. Knoell. Cadmium toxicity requires NF-kB-mediated transcriptional activation of the human zinc transporter ZIP8 in lung epithelia. Am J Physiol Lung Cell Mol Physiol. 2012 May;302(9):L909-18 2. Liu M-J, Bao S, Napolitano JR, Burris DL, Yu L, et al. (2014) Zinc Regulates the Acute Phase Response and Serum Amyloid A Production in Response to Sepsis through JAK-STAT3 Signaling. PLoS ONE 9(4): e94934. doi:10.1371/journal.pone.0094934 FIELDS OF STUDY Major Field: Biomedical Sciences Graduate Program vii TABLE OF CONTENTS Abstract .................................................................................................................ii Dedication ............................................................................................................iv Acknowledgments ................................................................................................ v Vita ...................................................................................................................... vii List of Tables ....................................................................................................... xii List of Figures ..................................................................................................... xiii List of Abbreviations……………………………………………………………………….......xv Chapter 1: Introduction ........................................................................................ 1 1.1 General Introduction………………………………………………………..1 1.2 COPD……..………………………………………………………………….1 1.2.1 Clinical Pathology ………………………………………………..1 1.2.2 Cellular responses to tobacco smoke………………………….4 1.2.3 Tobacco constituents, cadmium and immune activation……..6 1.2.4 Inflammatory signaling…………………………………………...8 1.2.5 Hypothesized disease mechanisms………………………......12 1.3 Tobacco smoking………………………………………………………….14 viii 1.3.1 Epidemiology…………………………………………………….15 1.3.2 Cadmium toxicity………………………………………………..17 1.4 Zinc nutrition and metabolism……………………………………………19 1.4.1 Zinc biochemistry………………………………………………..19 1.4.2 Dietary zinc………………………………………………………20 1.4.3 Zinc metabolism………………………………………………...22 1.4.4 ZIP8 and inflammation…………………………………………23 1.4.5 ZIP8 and cadmium…………………………………………......25 1.5 Specific aims……………………………………………………………….26 1.6 Tables………………………………………………………………………29 1.7 Figures……………………………………………………………………...30 Chapter 2: Cd-mediated toxicity of lung epithelia is mediated through ZIP8 expression in vitro………………………………..……………………………30 2.1 Summary…………………………………………………………………...30 2.2 Results……………………………………………………………………...32 2.3 Discussion………………………………………………………………….37 2.4 Materials and methods……………………………………………………43 2.5 Figures……………………………………………………………………...50 Chapter 3: The contribution of Cd and ZIP8 to COPD pathogenesis in vivo……54 3.1 Summary…………………………………………………………………...54 3.2 Results……………………………………………………………………...56 3.3 Discussion………………………………………………………………....64 ix 3.4 Materials and methods……………………………………………………72 3.5 Figures……………………………………………………………………...80 Chapter 4: Determining the influence of Cd upon monocytes and macrophage immune function……………………………………………………………….86 4.1 Summary…………………………………………………………………...86 4.2
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Aberrant Expression of ZIP and Znt Zinc Transporters in Urotsa Cells Transformed to Malignant Cells by Cadmium
    Article Aberrant Expression of ZIP and ZnT Zinc Transporters in UROtsa Cells Transformed to Malignant Cells by Cadmium Soisungwan Satarug 1,2,*, Scott H. Garrett 2, Seema Somji 2, Mary Ann Sens 2 and Donald A. Sens 2 1 Kidney Disease Research Collaborative, Centre for Health Service Research, The University of Queensland Translational Research Institute, Woolloongabba, Brisbane 4102, Australia 2 Department of Pathology, University of North Dakota School of Medicine and Health Sciences, Grand Forks, ND 58202, USA; [email protected] (S.H.G.); [email protected] (S.S.); [email protected] (M.A.S.); [email protected] (D.A.S.) * Correspondence: [email protected] Abstract: Maintenance of zinc homeostasis is pivotal to the regulation of cell growth, differentiation, apoptosis, and defense mechanisms. In mammalian cells, control of cellular zinc homeostasis is through zinc uptake, zinc secretion, and zinc compartmentalization, mediated by metal transporters of the Zrt-/Irt-like protein (ZIP) family and the Cation Diffusion Facilitators (CDF) or ZnT family. We quantified transcript levels of ZIP and ZnT zinc transporters expressed by non-tumorigenic UROtsa cells and compared with those expressed by UROtsa clones that were experimentally transformed to cancer cells by prolonged exposure to cadmium (Cd). Although expression of the ZIP8 gene in parent UROtsa cells was lower than ZIP14 (0.1 vs. 83 transcripts per 1000 β-actin transcripts), an increased expression of ZIP8 concurrent with a reduction in expression of one or two zinc influx transporters, namely ZIP1, ZIP2, and ZIP3, were seen in six out of seven transformed UROtsa clones.
    [Show full text]
  • Loss of the Dermis Zinc Transporter ZIP13 Promotes the Mildness Of
    www.nature.com/scientificreports OPEN Loss of the dermis zinc transporter ZIP13 promotes the mildness of fbrosarcoma by inhibiting autophagy Mi-Gi Lee1,8, Min-Ah Choi2,8, Sehyun Chae3,8, Mi-Ae Kang4, Hantae Jo4, Jin-myoung Baek4, Kyu-Ree In4, Hyein Park4, Hyojin Heo4, Dongmin Jang5, Sofa Brito4, Sung Tae Kim6, Dae-Ok Kim 1,7, Jong-Soo Lee4, Jae-Ryong Kim2* & Bum-Ho Bin 4* Fibrosarcoma is a skin tumor that is frequently observed in humans, dogs, and cats. Despite unsightly appearance, studies on fbrosarcoma have not signifcantly progressed, due to a relatively mild tumor severity and a lower incidence than that of other epithelial tumors. Here, we focused on the role of a recently-found dermis zinc transporter, ZIP13, in fbrosarcoma progression. We generated two transformed cell lines from wild-type and ZIP13-KO mice-derived dermal fbroblasts by stably expressing the Simian Virus (SV) 40-T antigen. The ZIP13−/− cell line exhibited an impairment in autophagy, followed by hypersensitivity to nutrient defciency. The autophagy impairment in the ZIP13−/− cell line was due to the low expression of LC3 gene and protein, and was restored by the DNA demethylating agent, 5-aza-2’-deoxycytidine (5-aza) treatment. Moreover, the DNA methyltransferase activity was signifcantly increased in the ZIP13−/− cell line, indicating the disturbance of epigenetic regulations. Autophagy inhibitors efectively inhibited the growth of fbrosarcoma with relatively minor damages to normal cells in xenograft assay. Our data show that proper control over autophagy and zinc homeostasis could allow for the development of a new therapeutic strategy to treat fbrosarcoma.
    [Show full text]
  • Role of ZIP8 in Host Response to Mycobacterium Tuberculosis
    International Journal of Molecular Sciences Review Elemental Ingredients in the Macrophage Cocktail: Role of ZIP8 in Host Response to Mycobacterium tuberculosis Charlie J. Pyle 1, Abul K. Azad 2, Audrey C. Papp 3, Wolfgang Sadee 3, Daren L. Knoell 4,* and Larry S. Schlesinger 2,* 1 Department of Molecular Genetics and Microbiology, Duke University, Durham, NC 27710, USA; [email protected] 2 Texas Biomedical Research Institute, San Antonio, TX 78227, USA; [email protected] 3 Center for Pharmacogenomics, Department of Cancer Biology and Genetics, College of Medicine, The Ohio State University Wexner Medical Center, Columbus, OH 43085, USA; [email protected] (A.C.P.); [email protected] (W.S.) 4 College of Pharmacy, The University of Nebraska Medical Center, Omaha, NE 68198-6120, USA * Correspondence: [email protected] (D.L.K.); [email protected] (L.S.S.); Tel.: +1-402-559-9016 (D.L.K.); +1-210-258-9419 (L.S.S.) Received: 6 October 2017; Accepted: 6 November 2017; Published: 9 November 2017 Abstract: Tuberculosis (TB) is a global epidemic caused by the infection of human macrophages with the world’s most deadly single bacterial pathogen, Mycobacterium tuberculosis (M.tb). M.tb resides in a phagosomal niche within macrophages, where trace element concentrations impact the immune response, bacterial metal metabolism, and bacterial survival. The manipulation of micronutrients is a critical mechanism of host defense against infection. In particular, the human zinc transporter Zrt-/Irt-like protein 8 (ZIP8), one of 14 ZIP family members, is important in the flux of divalent cations, including zinc, into the cytoplasm of macrophages.
    [Show full text]
  • The Role of Zip Superfamily of Metal Transporters in Chronic Diseases, Purification & Characterization of a Bacterial Zip Tr
    Wayne State University Wayne State University Theses 1-1-2011 The Role Of Zip Superfamily Of Metal Transporters In Chronic Diseases, Purification & Characterization Of A Bacterial Zip Transporter: Zupt. Iryna King Wayne State University Follow this and additional works at: http://digitalcommons.wayne.edu/oa_theses Part of the Biochemistry Commons, and the Molecular Biology Commons Recommended Citation King, Iryna, "The Role Of Zip Superfamily Of Metal Transporters In Chronic Diseases, Purification & Characterization Of A Bacterial Zip Transporter: Zupt." (2011). Wayne State University Theses. Paper 63. This Open Access Thesis is brought to you for free and open access by DigitalCommons@WayneState. It has been accepted for inclusion in Wayne State University Theses by an authorized administrator of DigitalCommons@WayneState. THE ROLE OF ZIP SUPERFAMILY OF METAL TRANSPORTERS IN CHRONIC DISEASES, PURIFICATION & CHARACTERIZATION OF A BACTERIAL ZIP TRANSPORTER: ZUPT by IRYNA KING THESIS Submitted to the Graduate School of Wayne State University, Detroit, Michigan in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE 2011 MAJOR: BIOCHEMISTRY & MOLECULAR BIOLOGY Approved by: ___________________________________ Advisor Date © COPYRIGHT BY IRYNA KING 2011 All Rights Reserved DEDICATION I dedicate this work to my father, Julian Banas, whose footsteps I indisputably followed into science & my every day inspiration, my son, William Peter King ii ACKNOWLEDGMENTS First and foremost I would like to thank the department of Biochemistry & Molecular Biology at Wayne State University School of Medicine for giving me an opportunity to conduct my research and be a part of their family. I would like to thank my advisor Dr. Bharati Mitra for taking me into the program and nurturing a biochemist in me.
    [Show full text]
  • The Influence of Dietary Zinc Concentration During Periods Of
    Iowa State University Capstones, Theses and Graduate Theses and Dissertations Dissertations 2019 The influence of dietary zinc concentration during periods of rapid growth induced by ractopamine hydrochloride or dietary energy and dietary fiber content on trace mineral metabolism and performance of beef steers Remy Nicole Carmichael Iowa State University Follow this and additional works at: https://lib.dr.iastate.edu/etd Part of the Agriculture Commons, and the Animal Sciences Commons Recommended Citation Carmichael, Remy Nicole, "The influence of dietary zinc concentration during periods of rapid growth induced by ractopamine hydrochloride or dietary energy and dietary fiber content on trace mineral metabolism and performance of beef steers" (2019). Graduate Theses and Dissertations. 17416. https://lib.dr.iastate.edu/etd/17416 This Dissertation is brought to you for free and open access by the Iowa State University Capstones, Theses and Dissertations at Iowa State University Digital Repository. It has been accepted for inclusion in Graduate Theses and Dissertations by an authorized administrator of Iowa State University Digital Repository. For more information, please contact [email protected]. The influence of dietary zinc concentration during periods of rapid growth induced by ractopamine hydrochloride or dietary energy and dietary fiber content on trace mineral metabolism and performance of beef steers by Remy Nicole Carmichael A dissertation submitted to the graduate faculty in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY Major: Animal Science Program of Study Committee: Stephanie Hansen, Major Professor Nicholas Gabler Olivia Genther-Schroeder Elisabeth Huff-Lonergan Daniel Loy The student author, whose presentation of the scholarship herein was approved by the program of study committee, is solely responsible for the content of this dissertation.
    [Show full text]
  • Frontiersin.Org 1 April 2015 | Volume 9 | Article 123 Saunders Et Al
    ORIGINAL RESEARCH published: 28 April 2015 doi: 10.3389/fnins.2015.00123 Influx mechanisms in the embryonic and adult rat choroid plexus: a transcriptome study Norman R. Saunders 1*, Katarzyna M. Dziegielewska 1, Kjeld Møllgård 2, Mark D. Habgood 1, Matthew J. Wakefield 3, Helen Lindsay 4, Nathalie Stratzielle 5, Jean-Francois Ghersi-Egea 5 and Shane A. Liddelow 1, 6 1 Department of Pharmacology and Therapeutics, University of Melbourne, Parkville, VIC, Australia, 2 Department of Cellular and Molecular Medicine, University of Copenhagen, Copenhagen, Denmark, 3 Walter and Eliza Hall Institute of Medical Research, Parkville, VIC, Australia, 4 Institute of Molecular Life Sciences, University of Zurich, Zurich, Switzerland, 5 Lyon Neuroscience Research Center, INSERM U1028, Centre National de la Recherche Scientifique UMR5292, Université Lyon 1, Lyon, France, 6 Department of Neurobiology, Stanford University, Stanford, CA, USA The transcriptome of embryonic and adult rat lateral ventricular choroid plexus, using a combination of RNA-Sequencing and microarray data, was analyzed by functional groups of influx transporters, particularly solute carrier (SLC) transporters. RNA-Seq Edited by: Joana A. Palha, was performed at embryonic day (E) 15 and adult with additional data obtained at University of Minho, Portugal intermediate ages from microarray analysis. The largest represented functional group Reviewed by: in the embryo was amino acid transporters (twelve) with expression levels 2–98 times Fernanda Marques, University of Minho, Portugal greater than in the adult. In contrast, in the adult only six amino acid transporters Hanspeter Herzel, were up-regulated compared to the embryo and at more modest enrichment levels Humboldt University, Germany (<5-fold enrichment above E15).
    [Show full text]
  • Role of Zinc in Immune System and Anti-Cancer Defense Mechanisms
    nutrients Review Role of Zinc in Immune System and Anti-Cancer Defense Mechanisms Dorota Skrajnowska and Barbara Bobrowska-Korczak * Department of Bromatology, Medical University of Warsaw, Banacha 1, 02-097 Warsaw, Poland; [email protected] * Correspondence: [email protected]; Tel./Fax: +48-225720785 Received: 1 September 2019; Accepted: 18 September 2019; Published: 22 September 2019 Abstract: The human body cannot store zinc reserves, so a deficiency can arise relatively quickly, e.g., through an improper diet. Severe zinc deficiency is rare, but mild deficiencies are common around the world. Many epidemiological studies have shown a relationship between the zinc content in the diet and the risk of cancer. The anti-cancer effect of zinc is most often associated with its antioxidant properties. However, this is just one of many possibilities, including the influence of zinc on the immune system, transcription factors, cell differentiation and proliferation, DNA and RNA synthesis and repair, enzyme activation or inhibition, the regulation of cellular signaling, and the stabilization of the cell structure and membranes. This study presents selected issues regarding the current knowledge of anti-cancer mechanisms involving this element. Keywords: zinc; immune system; cancer; defense mechanisms 1. Introduction Cancer cells are characterized by uncontrolled division. Thus paradoxically, by striving for immortality, they end the life of a human being much faster than the passage of time. The search for new natural or synthetic compounds with anti-cancer activity is ongoing [1–4]. It is particularly important that their effect should be based on the selective pathophysiological mechanisms that have been observed in tumorigenic cells, and should not disrupt the biological balance of the patient.
    [Show full text]
  • Manganese Influx and Expression of ZIP8 Is Essential in Primary Myoblasts and Contributes to Activation of SOD2
    bioRxiv preprint doi: https://doi.org/10.1101/494542; this version posted December 12, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Manganese influx and expression of ZIP8 is essential in primary myoblasts and contributes to activation of SOD2 Shellaina J. V. Gordon1, Daniel E. Fenker2, Katherine E. Vest2*, and Teresita Padilla-Benavides1* 1 Department of Biochemistry and Molecular Pharmacology, University of Massachusetts Medical School, 394 Plantation St., Worcester, MA, 01605, USA; S.J.V.G.: [email protected] 2 Department of Molecular Genetics, Biochemistry & Microbiology, University of Cincinnati School of Medicine, 231 Albert Sabin Way, Cincinnati, OH, 45267, USA, [email protected] * Co-Corresponding authors: [email protected]; [email protected]‎; Tel.: T.P.-B.: +1-508-856-5204; K.E.V.: +1-513-558-0023 ABSTRACT: Trace elements such as copper (Cu), zinc (Zn), iron (Fe), and manganese (Mn) are enzyme cofactors and second messengers in cell signaling. Trace elements are emerging as key regulators of differentiation and development of mammalian tissues including blood, brain, and skeletal muscle. We previously reported an influx of Cu and dynamic expression of various metal transporters during differentiation of skeletal muscle cells. Here, we demonstrate that during differentiation of skeletal myoblasts an increase of additional trace elements such as Mn, Fe and Zn occurs. Interestingly the Mn increase is concomitant with increased Mn-dependent SOD2 levels.
    [Show full text]
  • Impact of Macrophage Zinc Metabolism on Host Defense Against Mycobacterium Tuberculosis
    IMPACT OF MACROPHAGE ZINC METABOLISM ON HOST DEFENSE AGAINST MYCOBACTERIUM TUBERCULOSIS DISSERTATION Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University By Charlie Jacob Pyle, PharmD. Graduate Program in Pharmaceutical Sciences The Ohio State University 2016 Dissertation committee: Daren L. Knoell, PharmD., Advisor Larry S. Schlesinger MD. Karl Werbovetz, PhD. Amal Amer, MD, PhD. Copyright by Charlie Jacob Pyle 2016 ABSTRACT Tuberculosis (TB) is a global epidemic caused by infection of human macrophages with the world’s most deadly single bacterial pathogen Mycobacterium tuberculosis (M.tb). Manipulation of dietary micronutrients is a critical mechanism of host defense against infection and is referred to as nutritional immunity. In particular the essential trace element zinc functions as a critical modulator in inflammation through the human zinc transporter ZIP8. We hypothesize that zinc metabolism modulates macrophage host defense through ZIP8 during infection with Mycobacterium tuberculosis which is critical to the host response to TB. We began our investigation by establishing a physiologically relevant, in vitro model for the evaluation of zinc metabolism in human macrophage host defense. We then used the model to investigate the relationship between zinc, ZIP8 and NF-κB. ZIP8 is constitutively present in human macrophages, and induced through NF-κB as well as in response to LPS. Cellular zinc deprivation of macrophages increases LPS-induced macrophage zinc uptake, however ZIP8 knockdown in macrophages does not impact zinc accumulation prior to the arrival of the induced protein. Zinc supplementation increases NF-κB activity, ii independently of ZIP8.
    [Show full text]
  • SLC39A8 Gene Encoding a Metal Ion Transporter: Discovery and Bench to Bedside Daniel W
    Nebert and Liu Human Genomics (2019) 13:51 https://doi.org/10.1186/s40246-019-0233-3 REVIEW Open Access SLC39A8 gene encoding a metal ion transporter: discovery and bench to bedside Daniel W. Nebert1,2* and Zijuan Liu3 Abstract SLC39A8 is an evolutionarily highly conserved gene that encodes the ZIP8 metal cation transporter in all vertebrates. SLC39A8 is ubiquitously expressed, including pluripotent embryonic stem cells; SLC39A8 expression occurs in every cell type examined. Uptake of ZIP8-mediated Mn2+,Zn2+,Fe2+,Se4+, and Co2+ represents endogenous functions— moving these cations into the cell. By way of mouse genetic differences, the phenotype of “subcutaneous cadmium-induced testicular necrosis” was assigned to the Cdm locus in the 1970s. This led to identification of the mouse Slc39a8 gene, its most closely related Slc39a14 gene, and creation of Slc39a8-overexpressing, Slc39a8(neo/ neo) knockdown, and cell type-specific conditional knockout mouse lines; the Slc39a8(−/−) global knockout mouse is early-embryolethal. Slc39a8(neo/neo) hypomorphs die between gestational day 16.5 and postnatal day 1— exhibiting severe anemia, dysregulated hematopoiesis, hypoplastic spleen, dysorganogenesis, stunted growth, and hypomorphic limbs. Not surprisingly, genome-wide association studies subsequently revealed human SLC39A8- deficiency variants exhibiting striking pleiotropy—defects correlated with clinical disorders in virtually every organ, tissue, and cell-type: numerous developmental and congenital disorders, the immune system, cardiovascular system,
    [Show full text]
  • “Vesículas Extracelulares De Origen Cerebral Aisladas Desde Suero Presentan Perfil Proteico Diferencial En Dos Modelos De Estrés En Ratas.”
    “Vesículas extracelulares de origen cerebral aisladas desde suero presentan perfil proteico diferencial en dos modelos de estrés en ratas.” Tesis entregada a la Universidad de Chile en cumplimiento de los requisitos para optar al grado de Doctor en Farmacología Facultad de Ciencias Químicas y Farmaceuticas por CRISTÓBAL RAUL GÓMEZ MOLINA Octubre, 2020 DIRECTOR DE TESIS: DRA. ÚRSULA WYNEKEN H. 1 Agradecimientos Quisiera agradecer en primer lugar a mí familia, por el apoyo constante y sostenido en todas las instancias profesionales de mi vida. A mis padres por darme los valores y principios que rigen mi vida. A mi madre, por su fuerza, apoyo incondicional, y amor infinito, que fue capaz de criar a dos hijos cumpliendo el rol de padre y madre a la vez. A mi padre, que, si bien nos acompañó por poco tiempo, logro inculcar en mí el amor por la ciencia y el conocimiento. Y a mi hermana Camila por su alegría y apoyo incondicional. A la Dra. Wyneken, por ser mí guía y tutora, y por la paciencia que tuvo durante este largo proceso. A mis compañeros y amigos del laboratorio de Neurociencias: Soledad, Bárbara, Verónica, Catalina, Ariel, Alejandro, Roberto, Juan Pablo, Carlos, etc., por su apoyo en todo lo que necesité durante este proceso. Agradezco de manera especial a Mauricio, ya que sin su motivación esta tesis no habría llegado a término. A las instituciones que han apoyado la realización de este postgrado, a CONICYT con su beca para estudios de Doctorado en Chile y su beca de apoyo a la realización de la Tesis doctoral.
    [Show full text]