DOCSLIB.ORG

SASH1, a New Potential Link Between Smoking and Atherosclerosis Henri Weidmann

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
SASH1, a New Potential Link Between Smoking and Atherosclerosis Henri Weidmann SASH1, a new potential link between smoking and atherosclerosis Henri Weidmann To cite this version: Henri Weidmann. SASH1, a new potential link between smoking and atherosclerosis. Cardiology and cardiovascular system. Université Pierre et Marie Curie - Paris VI; Universität Hamburg, 2015. English. NNT : 2015PA066267. tel-01242976 HAL Id: tel-01242976 https://tel.archives-ouvertes.fr/tel-01242976 Submitted on 14 Dec 2015 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Université Pierre et Marie Curie Ecole Doctorale 394: Physiology and physiopathology UMRS 1166 ICAN Institute, Insitute of Cardiometabolism And Nutrition Equipe 1: Genomics and physiopathology of cardiovascular diseases SASH1, a new potential link between smoking and atherosclerosis By Henri Weidmann To obtain the Degree of Doctor of physiology and physiopathology of the University Pierre et Marie Curie Directed by Dr Ewa Ninio Co-directed by Pr Tanja Zeller Publicly presented on the 23th of September 2015 Jury: Dr Mustapha Rouis, President of the Jury Dr Marie-Paul Jacob-Lenet, Reporter Dr Alain-Pierre Gadeau, Reporter Dr Klaus-Peter Janssen, Examiner Dr Fabienne Foufelle, Examiner 1 To my family To my friends 2 “Science is a way of thinking, much more than it is a body of knowledge” Carl Sagan 3 Acknowledgment Having reached the end of my thesis, I would like to thanks all the people that made this work possible and thus allowed me to attain my fondest dream, working in biological research. First of all I would like to thank Dr Ewa Ninio who supervised all my work on this project, whose determination and tenacity allowed us to overcome many difficulties, both scientific and administrative that paved the way along my thesis project. I also thank Pr Blankenberg and Pr Tanja Zeller, who gave me the opportunity to do half of my thesis in her team at the Universitätsklinikum Eppendorf and without whom this project wouldn’t have been possible. Furthermore, I would like to also give a special thanks to Laurence Tiret who made this collaboration possible in addition to contributing to the microarrays analyses and François Cambien who participated in the initiation of the project and microarrays analyses. I would also like to thank the members of my jury Dr Mustapha Rouis, Dr Marie-Paul Jacob-Lenet, Dr Alain-Pierre Gadeau, Dr Klaus-Peter Janssen and Dr Fabienne Foufelle, for giving me the honor of evaluating my scientific work. My thanks also goes to all the people from the core facilities who contributed to the experiments during my thesis: Solenne Chardonnet Cedric Pionneau who were extremely helpful for the protein part of this project, Dr Frederic Charlotte and Annette Lesot who performed and contributed to the analysis of the histological staining, Dominique Langui, Aurélien Dauphin and Perrine Frère who taught me how to use confocal microscopy. Nathalie Abiola also has all my thanks for helping to overcome all the administrative paperwork that goes along the thesis and international collaboration. Of course I would like to thank my lab mates from Paris, Hervé Durand, Carole Proust, Claire Perret, Dominique Stengel and Zahia Touat to whom the hour 11h30 should ring a pavlovian bell. And the bioinformaticians from our team, Nicolas who worked with me in the late hours be it on GHS database analyses or plane engineering, Dylan who helped with the methylation data and who’s fascination for Spanish salami sometimes go over the edge, Guillaume who invented the double deck human blood shaker, Vinh with whom I had a lot of interesting talk regarding mRNA sequencing and who initiated me to rock climbing deep in the scary woods of Fontainebleau, Ares who is now working on the hypothesis that catalan and spanish could be two different languages, Ulli who supervised part of my intense training before leaving for Germany, Bathilde who is probably drinking beer at the time I write these lines, Jessica who scientifically demonstrated that there is no need for us to put on a helmet while riding a bike, Lyamine who gave me the trick to always get nice food for lunch, Nadjim who’s dedication to washing its Tupperware is now legendary, Romain who definitely “knows about this theory”, Alexandre who picked up most of our bad habits, Maguelonne who managed my communication with the team brilliantly, Veronica who always had a nice vaff’ for me, Yasmine “ptb”, François who’s hears leave no one indifferent, 4 Bastien who will always be forever unemployed in my heart. I also thank Rajai my predecessor for his introduction to the lab, Badreddine who’s calm and patience are to be commanded, and finally all the interns that came along the way and gave me the occasion to learn how to supervise students in the lab, Hélène “un, deux, trois, j’ai gagné” who tricked Nicolas into getting croissant for everyone, Chloé who I guess is the only person now working in pedagogy being able to perform quantitative PCR, Saakib who learned that experiments in the wet lab have their part of mystery, Auxanne who fought for the right of the interns to have their own personalized thanks in this part and Rima who charitably always smile at my jokes, even when they miss the spot. My German lab mates are not to be forgotten as well, as they gave me a warm welcome in Hamburg and tried to kidnap me away from the lab from time to time! So thank you, Tina who took care of me when I first arrive in Hamburg, Diana who took time to give me good advice for the redaction of my manuscript, especially for the figures, Simon “mister Z” my personal body coach and ping pong partner with whom I wrote a song after extracting RNA at 1am, Christian “herr Mueller” who must now fear the sound of my steps moving toward his office, Mereile “mip mip” who always brought a lot of fun in the lab, Tim who’s gattung ist zu selten and loves water-soluble bear, Caro who thinks french are so much into bread that they call wand “baguette magique”, Svenja who holds a picture of me proving my med’ cred’, fossil Svenja who now have a -152 million dead fish at home because of me, Vivian who I only met briefly but who’s good mood is contagious, taller Vivian who always took time to practice English with me, Jule who is also an honorary member of the “spreading the good mood team”, Frauke who is into boxing so I shall not make any further comments here, Maerit who still owes me a severe correction at tennis, Sebastian with whom I had very interesting discussions, Hartwig who helped me a lot with the logistic, Denise who would make a fortune if she had a penny every time someone came to her for a technical advice, Rose who everyone think is german and a special thought for Arius “herr jami” with whom I spent long nights/week-ends working in the lab and who learned the most important French sentence to be used in a lab “je n’ai pas de resultats”. I also thank the german interns I supervised: Tobias who discovered the syndrome of the ghost drop and Sabrina whose performances were very impressive. Finally I would like to thank my friends and family who were by my side all the way. 5 Table of content I Introduction/Scientific background ............................................................................................ 10 I.1. Atherosclerosis ........................................................................................................................................ 10 I.1.a Physiopathology of atherosclerosis ................................................................................................... 10 I.1.b cell types involved in the plaque progression ................................................................................... 14 I.2 High-Throughput technologies and atherosclerosis ................................................................................ 16 I.3 Smoking and atherosclerosis .................................................................................................................... 17 I.3.a The pathophysiology linking smoking and atherosclerosis ............................................................... 17 I.3.b Molecular pathways linking smoking to atherosclerosis .................................................................. 18 I.3.c Modeling cigarette smoke exposure in vitro ..................................................................................... 22 I.4 SASH1 ........................................................................................................................................................ 25 I.4.a SASH1 gene ........................................................................................................................................ 25 I.4.b SASH1 protein .................................................................................................................................... 25 I.4.c SASH1 in the literature, the quest for SASH1 function ...................................................................... 26 I.5 Thesis project: from Genome Wide Analysis in the Gutenberg Health Study to in vitro experiments .... 30 I.6 Aim of the
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • A Genome-Wide Association Study of a Coronary Artery Disease Risk Variant
    Journal of Human Genetics (2013) 58, 120–126 & 2013 The Japan Society of Human Genetics All rights reserved 1434-5161/13 www.nature.com/jhg ORIGINAL ARTICLE A genome-wide association study of a coronary artery diseaseriskvariant Ji-Young Lee1,16, Bok-Soo Lee2,16, Dong-Jik Shin3,16, Kyung Woo Park4,16, Young-Ah Shin1, Kwang Joong Kim1, Lyong Heo1, Ji Young Lee1, Yun Kyoung Kim1, Young Jin Kim1, Chang Bum Hong1, Sang-Hak Lee3, Dankyu Yoon5, Hyo Jung Ku2, Il-Young Oh4, Bong-Jo Kim1, Juyoung Lee1, Seon-Joo Park1, Jimin Kim1, Hye-kyung Kawk1, Jong-Eun Lee6, Hye-kyung Park1, Jae-Eun Lee1, Hye-young Nam1, Hyun-young Park7, Chol Shin8, Mitsuhiro Yokota9, Hiroyuki Asano10, Masahiro Nakatochi11, Tatsuaki Matsubara12, Hidetoshi Kitajima13, Ken Yamamoto13, Hyung-Lae Kim14, Bok-Ghee Han1, Myeong-Chan Cho15, Yangsoo Jang3,17, Hyo-Soo Kim4,17, Jeong Euy Park2,17 and Jong-Young Lee1,17 Although over 30 common genetic susceptibility loci have been identified to be independently associated with coronary artery disease (CAD) risk through genome-wide association studies (GWAS), genetic risk variants reported to date explain only a small fraction of heritability. To identify novel susceptibility variants for CAD and confirm those previously identified in European population, GWAS and a replication study were performed in the Koreans and Japanese. In the discovery stage, we genotyped 2123 cases and 3591 controls with 521 786 SNPs using the Affymetrix SNP Array 6.0 chips in Korean. In the replication, direct genotyping was performed using 3052 cases and 4976 controls from the KItaNagoya Genome study of Japan with 14 selected SNPs.
    [Show full text]
  • KLF2 Induced
    UvA-DARE (Digital Academic Repository) The transcription factor KLF2 in vascular biology Boon, R.A. Publication date 2008 Link to publication Citation for published version (APA): Boon, R. A. (2008). The transcription factor KLF2 in vascular biology. General rights It is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s), other than for strictly personal, individual use, unless the work is under an open content license (like Creative Commons). Disclaimer/Complaints regulations If you believe that digital publication of certain material infringes any of your rights or (privacy) interests, please let the Library know, stating your reasons. In case of a legitimate complaint, the Library will make the material inaccessible and/or remove it from the website. Please Ask the Library: https://uba.uva.nl/en/contact, or a letter to: Library of the University of Amsterdam, Secretariat, Singel 425, 1012 WP Amsterdam, The Netherlands. You will be contacted as soon as possible. UvA-DARE is a service provided by the library of the University of Amsterdam (https://dare.uva.nl) Download date:23 Sep 2021 Supplementary data: Genes induced by KLF2 Dekker et al. LocusLink Accession Gene Sequence Description Fold p-value ID number symbol change (FDR) 6654 AK022099 SOS1 cDNA FLJ12037 fis, clone HEMBB1001921. 100.00 5.9E-09 56999 AF086069 ADAMTS9 full length insert cDNA clone YZ35C05. 100.00 1.2E-09 6672 AF085934 SP100 full length insert cDNA clone YR57D07. 100.00 6.7E-13 9031 AF132602 BAZ1B Williams Syndrome critical region WS25 mRNA, partial sequence.
    [Show full text]
  • Aberrant Expression of ZIP and Znt Zinc Transporters in Urotsa Cells Transformed to Malignant Cells by Cadmium
    Article Aberrant Expression of ZIP and ZnT Zinc Transporters in UROtsa Cells Transformed to Malignant Cells by Cadmium Soisungwan Satarug 1,2,*, Scott H. Garrett 2, Seema Somji 2, Mary Ann Sens 2 and Donald A. Sens 2 1 Kidney Disease Research Collaborative, Centre for Health Service Research, The University of Queensland Translational Research Institute, Woolloongabba, Brisbane 4102, Australia 2 Department of Pathology, University of North Dakota School of Medicine and Health Sciences, Grand Forks, ND 58202, USA; [email protected] (S.H.G.); [email protected] (S.S.); [email protected] (M.A.S.); [email protected] (D.A.S.) * Correspondence: [email protected] Abstract: Maintenance of zinc homeostasis is pivotal to the regulation of cell growth, differentiation, apoptosis, and defense mechanisms. In mammalian cells, control of cellular zinc homeostasis is through zinc uptake, zinc secretion, and zinc compartmentalization, mediated by metal transporters of the Zrt-/Irt-like protein (ZIP) family and the Cation Diffusion Facilitators (CDF) or ZnT family. We quantified transcript levels of ZIP and ZnT zinc transporters expressed by non-tumorigenic UROtsa cells and compared with those expressed by UROtsa clones that were experimentally transformed to cancer cells by prolonged exposure to cadmium (Cd). Although expression of the ZIP8 gene in parent UROtsa cells was lower than ZIP14 (0.1 vs. 83 transcripts per 1000 β-actin transcripts), an increased expression of ZIP8 concurrent with a reduction in expression of one or two zinc influx transporters, namely ZIP1, ZIP2, and ZIP3, were seen in six out of seven transformed UROtsa clones.
    [Show full text]
  • Loss of the Dermis Zinc Transporter ZIP13 Promotes the Mildness Of
    www.nature.com/scientificreports OPEN Loss of the dermis zinc transporter ZIP13 promotes the mildness of fbrosarcoma by inhibiting autophagy Mi-Gi Lee1,8, Min-Ah Choi2,8, Sehyun Chae3,8, Mi-Ae Kang4, Hantae Jo4, Jin-myoung Baek4, Kyu-Ree In4, Hyein Park4, Hyojin Heo4, Dongmin Jang5, Sofa Brito4, Sung Tae Kim6, Dae-Ok Kim 1,7, Jong-Soo Lee4, Jae-Ryong Kim2* & Bum-Ho Bin 4* Fibrosarcoma is a skin tumor that is frequently observed in humans, dogs, and cats. Despite unsightly appearance, studies on fbrosarcoma have not signifcantly progressed, due to a relatively mild tumor severity and a lower incidence than that of other epithelial tumors. Here, we focused on the role of a recently-found dermis zinc transporter, ZIP13, in fbrosarcoma progression. We generated two transformed cell lines from wild-type and ZIP13-KO mice-derived dermal fbroblasts by stably expressing the Simian Virus (SV) 40-T antigen. The ZIP13−/− cell line exhibited an impairment in autophagy, followed by hypersensitivity to nutrient defciency. The autophagy impairment in the ZIP13−/− cell line was due to the low expression of LC3 gene and protein, and was restored by the DNA demethylating agent, 5-aza-2’-deoxycytidine (5-aza) treatment. Moreover, the DNA methyltransferase activity was signifcantly increased in the ZIP13−/− cell line, indicating the disturbance of epigenetic regulations. Autophagy inhibitors efectively inhibited the growth of fbrosarcoma with relatively minor damages to normal cells in xenograft assay. Our data show that proper control over autophagy and zinc homeostasis could allow for the development of a new therapeutic strategy to treat fbrosarcoma.
    [Show full text]
  • Role of ZIP8 in Host Response to Mycobacterium Tuberculosis
    International Journal of Molecular Sciences Review Elemental Ingredients in the Macrophage Cocktail: Role of ZIP8 in Host Response to Mycobacterium tuberculosis Charlie J. Pyle 1, Abul K. Azad 2, Audrey C. Papp 3, Wolfgang Sadee 3, Daren L. Knoell 4,* and Larry S. Schlesinger 2,* 1 Department of Molecular Genetics and Microbiology, Duke University, Durham, NC 27710, USA; [email protected] 2 Texas Biomedical Research Institute, San Antonio, TX 78227, USA; [email protected] 3 Center for Pharmacogenomics, Department of Cancer Biology and Genetics, College of Medicine, The Ohio State University Wexner Medical Center, Columbus, OH 43085, USA; [email protected] (A.C.P.); [email protected] (W.S.) 4 College of Pharmacy, The University of Nebraska Medical Center, Omaha, NE 68198-6120, USA * Correspondence: [email protected] (D.L.K.); [email protected] (L.S.S.); Tel.: +1-402-559-9016 (D.L.K.); +1-210-258-9419 (L.S.S.) Received: 6 October 2017; Accepted: 6 November 2017; Published: 9 November 2017 Abstract: Tuberculosis (TB) is a global epidemic caused by the infection of human macrophages with the world’s most deadly single bacterial pathogen, Mycobacterium tuberculosis (M.tb). M.tb resides in a phagosomal niche within macrophages, where trace element concentrations impact the immune response, bacterial metal metabolism, and bacterial survival. The manipulation of micronutrients is a critical mechanism of host defense against infection. In particular, the human zinc transporter Zrt-/Irt-like protein 8 (ZIP8), one of 14 ZIP family members, is important in the flux of divalent cations, including zinc, into the cytoplasm of macrophages.
    [Show full text]
  • Noelia Díaz Blanco
    Effects of environmental factors on the gonadal transcriptome of European sea bass (Dicentrarchus labrax), juvenile growth and sex ratios Noelia Díaz Blanco Ph.D. thesis 2014 Submitted in partial fulfillment of the requirements for the Ph.D. degree from the Universitat Pompeu Fabra (UPF). This work has been carried out at the Group of Biology of Reproduction (GBR), at the Department of Renewable Marine Resources of the Institute of Marine Sciences (ICM-CSIC). Thesis supervisor: Dr. Francesc Piferrer Professor d’Investigació Institut de Ciències del Mar (ICM-CSIC) i ii A mis padres A Xavi iii iv Acknowledgements This thesis has been made possible by the support of many people who in one way or another, many times unknowingly, gave me the strength to overcome this "long and winding road". First of all, I would like to thank my supervisor, Dr. Francesc Piferrer, for his patience, guidance and wise advice throughout all this Ph.D. experience. But above all, for the trust he placed on me almost seven years ago when he offered me the opportunity to be part of his team. Thanks also for teaching me how to question always everything, for sharing with me your enthusiasm for science and for giving me the opportunity of learning from you by participating in many projects, collaborations and scientific meetings. I am also thankful to my colleagues (former and present Group of Biology of Reproduction members) for your support and encouragement throughout this journey. To the “exGBRs”, thanks for helping me with my first steps into this world. Working as an undergrad with you Dr.
    [Show full text]
  • The Role of Zip Superfamily of Metal Transporters in Chronic Diseases, Purification & Characterization of a Bacterial Zip Tr
    Wayne State University Wayne State University Theses 1-1-2011 The Role Of Zip Superfamily Of Metal Transporters In Chronic Diseases, Purification & Characterization Of A Bacterial Zip Transporter: Zupt. Iryna King Wayne State University Follow this and additional works at: http://digitalcommons.wayne.edu/oa_theses Part of the Biochemistry Commons, and the Molecular Biology Commons Recommended Citation King, Iryna, "The Role Of Zip Superfamily Of Metal Transporters In Chronic Diseases, Purification & Characterization Of A Bacterial Zip Transporter: Zupt." (2011). Wayne State University Theses. Paper 63. This Open Access Thesis is brought to you for free and open access by DigitalCommons@WayneState. It has been accepted for inclusion in Wayne State University Theses by an authorized administrator of DigitalCommons@WayneState. THE ROLE OF ZIP SUPERFAMILY OF METAL TRANSPORTERS IN CHRONIC DISEASES, PURIFICATION & CHARACTERIZATION OF A BACTERIAL ZIP TRANSPORTER: ZUPT by IRYNA KING THESIS Submitted to the Graduate School of Wayne State University, Detroit, Michigan in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE 2011 MAJOR: BIOCHEMISTRY & MOLECULAR BIOLOGY Approved by: ___________________________________ Advisor Date © COPYRIGHT BY IRYNA KING 2011 All Rights Reserved DEDICATION I dedicate this work to my father, Julian Banas, whose footsteps I indisputably followed into science & my every day inspiration, my son, William Peter King ii ACKNOWLEDGMENTS First and foremost I would like to thank the department of Biochemistry & Molecular Biology at Wayne State University School of Medicine for giving me an opportunity to conduct my research and be a part of their family. I would like to thank my advisor Dr. Bharati Mitra for taking me into the program and nurturing a biochemist in me.
    [Show full text]
  • Association Weight Matrix for the Genetic Dissection of Puberty in Beef Cattle
    Association weight matrix for the genetic dissection of puberty in beef cattle Marina R. S. Fortesa,b,c, Antonio Revertera,b, Yuandan Zhanga,d, Eliza Collisa,b, Shivashankar H. Nagarajb,NickN.Jonssona,c,e, Kishore C. Prayagaa,b,1, Wes Barrisa,b, and Rachel J. Hawkena,b,2 aCooperative Research Centre for Beef Genetic Technologies; bCommonwealth Scientific and Industrial Research Organization, division of Livestock Industries, Queensland Bioscience Precinct, Brisbane QLD 4067, Australia; cThe University of Queensland, School of Veterinary Science, Gatton QLD 4343, Australia; dAnimal Genetics and Breeding Unit, University of New England, Armidale NSW 2351, Australia; and eFaculty of Veterinary Medicine, University of Glasgow, Glasgow G61 1QH, United Kingdom Edited by George Seidel, Colorado State University, Fort Collins, CO, and approved June 21, 2010 (received for review February 23, 2010) We describe a systems biology approach for the genetic dissection tional data on traits related to puberty are available. For example, of complex traits based on applying gene network theory to the re- weight and condition score are often measured on occasions sults from genome-wide associations. The associations of single- throughout an animal’s development. Hence, understanding ge- nucleotide polymorphisms (SNP) that were individually associated netics of cattle puberty and its biology serves two purposes: as with a primary phenotype of interest, age at puberty in our study, a strategy to develop efficient livestock resources and as a model were explored across 22 related traits. Genomic regions were sur- for human biology. veyed for genes harboring the selected SNP. As a result, an asso- The focus of this work is to demonstrate a unique systems ap- ciation weight matrix (AWM) was constructed with as many rows proach, which we call an association weight matrix (AWM), ap- as genes and as many columns as traits.
    [Show full text]
  • Discovery of Candidate DNA Methylation Cancer Driver Genes
    Published OnlineFirst May 10, 2021; DOI: 10.1158/2159-8290.CD-20-1334 RESEARCH ARTICLE Discovery of Candidate DNA Methylation Cancer Driver Genes Heng Pan1,2,3, Loïc Renaud4,5,6,7, Ronan Chaligne4,5,6, Johannes Bloehdorn8, Eugen Tausch8, Daniel Mertens9, Anna Maria Fink10, Kirsten Fischer10, Chao Zhang3,6, Doron Betel3,6, Andreas Gnirke11, Marcin Imielinski1,3,4,5,12, Jérôme Moreaux13,14,15,16, Michael Hallek10, Alexander Meissner11,17, Stephan Stilgenbauer8, Catherine J. Wu11,18, Olivier Elemento1,2,3,5, and Dan A. Landau3,4,5,6 Downloaded from cancerdiscovery.aacrjournals.org on September 28, 2021. © 2021 American Association for Cancer Research. Published OnlineFirst May 10, 2021; DOI: 10.1158/2159-8290.CD-20-1334 ABSTRACT Epigenetic alterations, such as promoter hypermethylation, may drive cancer through tumor suppressor gene inactivation. However, we have limited ability to differentiate driver DNA methylation (DNAme) changes from passenger events. We developed DNAme driver inference–MethSig–accounting for the varying stochastic hypermethylation rate across the genome and between samples. We applied MethSig to bisulfite sequencing data of chronic lymphocytic leukemia (CLL), multiple myeloma, ductal carcinoma in situ, glioblastoma, and to methylation array data across 18 tumor types in TCGA. MethSig resulted in well-calibrated quantile–quantile plots and reproducible inference of likely DNAme drivers with increased sensitivity/specificity compared with benchmarked methods. CRISPR/Cas9 knockout of selected candidate CLL DNAme drivers provided a fitness advantage with and without therapeutic intervention. Notably, DNAme driver risk score was closely associated with adverse outcome in independent CLL cohorts. Collectively, MethSig represents a novel inference framework for DNAme driver discovery to chart the role of aberrant DNAme in cancer.
    [Show full text]
  • The Landscape of Human Mutually Exclusive Splicing
    bioRxiv preprint doi: https://doi.org/10.1101/133215; this version posted May 2, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. The landscape of human mutually exclusive splicing Klas Hatje1,2,#,*, Ramon O. Vidal2,*, Raza-Ur Rahman2, Dominic Simm1,3, Björn Hammesfahr1,$, Orr Shomroni2, Stefan Bonn2§ & Martin Kollmar1§ 1 Group of Systems Biology of Motor Proteins, Department of NMR-based Structural Biology, Max-Planck-Institute for Biophysical Chemistry, Göttingen, Germany 2 Group of Computational Systems Biology, German Center for Neurodegenerative Diseases, Göttingen, Germany 3 Theoretical Computer Science and Algorithmic Methods, Institute of Computer Science, Georg-August-University Göttingen, Germany § Corresponding authors # Current address: Roche Pharmaceutical Research and Early Development, Pharmaceutical Sciences, Roche Innovation Center Basel, F. Hoffmann-La Roche Ltd., Basel, Switzerland $ Current address: Research and Development - Data Management (RD-DM), KWS SAAT SE, Einbeck, Germany * These authors contributed equally E-mail addresses: KH: [email protected], RV: [email protected], RR: [email protected], DS: [email protected], BH: [email protected], OS: [email protected], SB: [email protected], MK: [email protected] - 1 - bioRxiv preprint doi: https://doi.org/10.1101/133215; this version posted May 2, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity.
    [Show full text]
  • Variability in the Degree of Expression of Phosphorylated I B in Chronic
    6796 Vol. 10, 6796–6806, October 15, 2004 Clinical Cancer Research Featured Article Variability in the Degree of Expression of Phosphorylated I␬B␣ in Chronic Lymphocytic Leukemia Cases With Nodal Involvement Antonia Rodrı´guez,1 Nerea Martı´nez,1 changes in the expression profile (mRNA and protein ex- Francisca I. Camacho,1 Elena Ruı´z-Ballesteros,2 pression) and clinical outcome in a series of CLL cases with 2 1 lymph node involvement. Activation of NF-␬B, as deter- Patrocinio Algara, Juan-Fernando Garcı´a, ␬ ␣ 3 5 mined by the expression of p-I B , was associated with the Javier Mena´rguez, Toma´s Alvaro, expression of a set of genes comprising key genes involved in 6 4 Manuel F. Fresno, Fernando Solano, the control of B-cell receptor signaling, signal transduction, Manuela Mollejo,2 Carmen Martin,1 and and apoptosis, including SYK, LYN, BCL2, CCR7, BTK, Miguel A. Piris1 PIK3CD, and others. Cases with increased expression of ␬ ␣ 1Molecular Pathology Program, Centro Nacional de Investigaciones p-I B showed longer overall survival than cases with lower Oncolo´gicas, Madrid, Spain; 2Department of Genetics and Pathology, expression. A Cox regression model was derived to estimate 3 Hospital Virgen de la Salud, Toledo, Spain; Department of some parameters of prognostic interest: IgVH mutational Pathology, Hospital General Universitario Gregorio Maran˜o´n, ␬ ␣ 4 status, ZAP-70, and p-I B expression. The multivariate Madrid, Spain; Department of Hematology, Hospital Nuestra Sen˜ora analysis disclosed p-I␬B␣ and ZAP-70 expression as inde- del Prado, Talavera de la Reina, Toledo, Spain; 5Department of Pathology, Hospital Verge de la Cinta, Tortosa, Spain; pendent prognostic factors of survival.
    [Show full text]