TLR4 Signaling SASH1 Is a Scaffold Molecule in Endothelial

SASH1 Is a Scaffold Molecule in Endothelial TLR4 Signaling Shauna M. Dauphinee, Ashley Clayton, Angela Hussainkhel, Cindy Yang, Yoo-Jin Park, Megan E. Fuller, Josip Blonder, This information is current as Timothy D. Veenstra and Aly Karsan of September 27, 2021. J Immunol 2013; 191:892-901; Prepublished online 17 June 2013; doi: 10.4049/jimmunol.1200583

http://www.jimmunol.org/content/191/2/892 Downloaded from

Supplementary http://www.jimmunol.org/content/suppl/2013/06/17/jimmunol.120058 Material 3.DC1 http://www.jimmunol.org/ References This article cites 46 articles, 14 of which you can access for free at: http://www.jimmunol.org/content/191/2/892.full#ref-list-1

Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision

by guest on September 27, 2021 • No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication

*average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology

SASH1 Is a Scaffold Molecule in Endothelial TLR4 Signaling

Shauna M. Dauphinee,*,† Ashley Clayton,*,† Angela Hussainkhel,*,‡ Cindy Yang,x Yoo-Jin Park,x Megan E. Fuller,*,{ Josip Blonder,‖ Timothy D. Veenstra,‖ and Aly Karsan*,†,‡,x,{

Recognition of microbial products by TLRs is critical for mediating innate immune responses to invading pathogens. In this study, we identify a novel scaffold protein in TLR4 signaling called SAM and SH3 domain containing protein 1 (SASH1). Sash1 is expressed across all microvascular beds and functions as a scaffold molecule to independently bind TRAF6, TAK1, IkB kinase a, and IkB kinase b. This interaction fosters ubiquitination of TRAF6 and TAK1 and promotes LPS-induced NF-kB, JNK, and p38 activation, culminating in increased production of proinﬂammatory cytokines and increased LPS-induced endothelial migration. Our ﬁndings suggest that SASH1 acts to assemble a signaling complex downstream of TLR4 to activate early endothelial responses to receptor activation. The Journal of Immunology, 2013, 191: 892–901. Downloaded from

ecognition of bacterial and viral products by the mam- Fas-associated death domain protein (FADD) is a negative reg- malian innate immune system is mediated, in part, by ulator of TLR4 signaling in endothelial cells and FADD-null R a class of receptors called TLRs (1). The intracellular cells show hyperactivation of NF-kB and JNK in response to signaling cascades that are initiated by ligation of TLRs leads to LPS in a TRAF6-dependent manner (6, 7). Because LPS signaling activation of transcription factors such as NF-kB and IFN regu- components have been shown to localize to lipid-rich microdomains http://www.jimmunol.org/ latory factor (IRF), resulting in production of proinflammatory in the plasma membrane (8), we hypothesized that the hyper- cytokines (2, 3). Signaling through TLR4 follows recognition of activation of the LPS signal in FADD-null cells is due, in part, to an LPS and the subsequent recruitment of intracellular adaptor increase in LPS signaling molecules in lipid-rich microdomains. molecules TIRAP, MyD88, and TRIF. Downstream of MyD88, Thus, we used proteomic analysis to identify proteins that are dif- IL-1R–associated kinases (IRAKs) are recruited to activate the ferentially expressed in the lipid-rich microdomains of FADD wild- E3 ubiquitin ligase TRAF6. This results in TRAF6 autoubiquiti- type (WT) versus FADD knockout (KO) cells. The hyperactivation nation of lysine 63 (K63)–linked ubiquitin chains culminating in of the signaling pathway in FADD KO cells would facilitate de- activation of NF-kB and MAPKs (4). Signaling downstream of TRIF tection of proteins present in the cell in limiting amounts. This can also result in recruitment of TRAF6 to the receptor complex and approach resulted in the identification of SAM and SH3 domain by guest on September 27, 2021 subsequent activation of NF-kB and MAPK. Alternatively, recruit- containing protein 1 (SASH1) as a putative candidate for positive ment of TRAF3 leads to induction of IFN-related genes (5). regulation of TLR4 signaling. SASH1 is a large protein with a predicted molecular mass of 137 kDa, and it was originally identified by expression profiling and in silico analysis as a gene that is downregulated in breast and other *Genome Sciences Centre, British Columbia Cancer Agency, Vancouver, British solid cancers, such as lung and thyroid (9). Subsequently, SASH1 Columbia V5Z 1L3, Canada; †Experimental Medicine Program, University of British Columbia, Vancouver, British Columbia V6T 2B5, Canada; ‡Department of Interdis- mRNA has been shown to be reduced in colon cancer and post- ciplinary Oncology, University of British Columbia, Vancouver, British Columbia operative metastases in the liver (10). However, these studies are x V6T 2B5, Canada; Department of Pathology and Laboratory Medicine, British correlative and no direct evidence for SASH1 as a tumor sup- Columbia Cancer Agency, Vancouver, British Columbia V5Z 1L3, Canada; {Depart- ment of Pathology and Laboratory Medicine, University of British Columbia, Van- pressor has been described. SASH1 belongs to a family of SAM couver, British Columbia V6T 2B5, Canada; and ‖Laboratory of Proteomics and and SH3 adaptor proteins, consisting of SH3 domain expressed Analytical Technologies, Advanced Technology Program, Science Applications In- in lymphocytes (SLY1) and hematopoietic adaptor containing ternational Corp.–Frederick Inc., National Cancer Institute–Frederick, Frederick, MD 21702 SH3 and SAM domains 1 (HACS1, also called SLY2) (11, 12). Received for publication February 22, 2012. Accepted for publication May 17, 2013. The SLY family has been implicated in regulation of the adaptive This work was supported by Canadian Institutes for Health Research Grant MOP immune response, suggesting that SASH1 may also function in 97744 (to A.K.). S.M.D. was supported by studentships from the Canadian Institutes the immune system. Indeed, SASH1 was recently identified in for Health Research and the Michael Smith Foundation for Health Research. A.H. a global phosphoproteome analysis as a protein that is phos- was supported by a Canadian Institutes for Health Research studentship and a Uni- versity of British Columbia doctoral fellowship. A.K. is a Senior Scholar of the phorylated at multiple sites in response to LPS (13). However, Michael Smith Foundation for Health Research. a molecular function for SASH1 in the immune system has not Address correspondence and reprint requests to Dr. Aly Karsan, Genome Sciences been reported, and thus we aimed to determine whether SASH1 Centre, British Columbia Cancer Agency, 675 West 10th Avenue, Vancouver, British functions in innate immune signaling. Columbia V5Z 1L3, Canada. E-mail address: [email protected] In this study, we show that Sash1 is preferentially expressed The online version of this article contains supplemental material. in microvascular endothelial cells of various organs, as well as Abbreviations used in this article: FADD, Fas-associated death domain protein; HA, parenchymal cells, but not in lymphocytes. SASH1 positively hemagglutinin; HMEC, human microvascular endothelial cell; IKK, IkB kinase; IP-10, IFN-g–inducible protein 10; IRAK, IL-1R–associated kinase; ISRE, IFN- regulates signaling through TLR4 in human endothelial cells to stimulated responsive element; KO, knockout; MEF, mouse embryonic fibroblast; increase activation of NF-kB and MAPKs, culminating in in- MS, mass spectrometry; SASHI, SAM and SH3 domain containing protein 1; sh, short hairpin; SLY1, SH3 domain expressed in lymphocytes; SLY2, hematopoietic creased production of proinflammatory cytokines. Although SASH1 adaptor containing SH3 and SAM domains 1; WT, wild-type. does not bind to MyD88 or the IRAKs, it interacts with TRAF6 www.jimmunol.org/cgi/doi/10.4049/jimmunol.1200583 The Journal of Immunology 893 throughaconservedTRAF6bindingdomaininSASH1and termates by tail digestion with proteinase K followed by PCR using pri- regulates TRAF6 ubiquitination. SASH1 also binds to TAK1 mers specific to the insertion site of the gene-trap construct to distinguish and the IkB kinase (IKK) complex, independent of TRAF6, to homozygous mice. All animal studies have been reviewed and approved by the University of British Columbia. assemble a signaling hub that permits downstream activation of NF-kB and MAPKs. Collectively, these results demonstrate that b-galactosidase staining SASH1 functions as a novel scaffold protein to regulate innate Adult mouse tissues from Sash1+/2 mice and their WT littermate controls immune signaling downstream of TLR4. were dissected and immediately fixed in 2% paraformaldehyde at 4˚C for 4 h. Tissues were cryopreserved and placed into OCT compound at 280˚C until sectioning. Sections (10 mm) were fixed with 0.2% glutaraldehyde Materials and Methods solution and stained with buffer containing 100 mM sodium phosphate (pH Recombinant plasmids, Abs, and reagents 7.3), 2 mM MgCl2, 0.01% sodium deoxycholate, 0.02% Nonidet P-40, 1 mg/ml 5-bromo-4-chloro-3-indolyl b-D-galactoside, 5 mM ferrocyanide, Hemagglutinin (HA)-SASH1, Flag-SASH1, and Flag-TAK1 constructs and 5 mM ferricyanide. were generated by PCR and cloned into pcDNA3 by restriction digest. Myc-SASH1DT6BD was obtained by inverse PCR to generate a deletion Isolation of mouse endothelial cells of amino acids 852-860. Flag-TRAF6DN, Flag-TRAF6DC, and Flag- TRAF6DCC were cloned from Flag-TRAF6 into pcDNA3 by restriction Adult lung tissue was harvested from C57BL/6 mice, digested with 2 mg/ml digest. Other plasmids were obtained as follows: Flag-TRAF6 (Tularik, collagenase IV, and incubated with 0.2 mg/ml DNase. Tissue homogenate was San Francisco, CA); Flag-IKKb,Flag-IKKa, and Flag-IKKg (T.D. Gilmore, passed through a cell strainer and RBC lysis was carried out. Cells were in- Boston University, Boston, MA); Flag-Ubc13 (Addgene, Cambridge, MA); cubated with rat anti-mouse CD105 hybridoma (gift of E.C. Butcher, Stanford University, Stanford, CA) or rat IgG2a isotype control. Cells were sorted for Myc-Uev1A (W. Xiao, University of Saskatchewan, Saskatoon, SK, + Canada); HA-Ubi-WT, HA-Ubi-K48, and HA-Ubi-K63 (Z. Chen, University aCD105 population (FACS 440; Becton Dickson, Mississauga, ON, Canada) Downloaded from of Texas, Dallas, TX, and M. Servant, McGill University, Montreal, QC, and resuspended in TRIzol to be processed for RNA and RT-PCR. Canada); IFN-stimulated responsive element (ISRE)-Luc (Stratagene, Santa Clara, CA); and NF-kB-Luc (F.R. Jirik, University of Calgary, Calgary, AB, Canada). A rabbit polyclonal Ab to human SASH1 was raised against a synthetic peptide conjugated to keyhole limpet hemocyanin to recognize amino acids 8–20 at the N terminus of the deduced SASH1 protein sequence

(University of British Columbia, Vancouver, BC, Canada). The SASH1 Ab http://www.jimmunol.org/ was purified by protein A-Sepharose chromatography. Human microvascular endothelial cells (HMECs), 293T cells, and FADD-deficient mouse embryonic fibroblasts (MEFs) were obtained and cultured as previously described (7). TRAF6-deficient MEFs were a gift of T. Mak (University of Toronto, Toronto, ON, Canada). HEK293-TLR4-MD2- CD14 cells (InvivoGen, San Diego, CA) were cultured in DMEM sup- plemented with 10% FBS, 2 mM glutamine, plus blasticidin and hygromycin.

Lipid raft isolation

FADD WT or FADD KO MEFs were treated with LPS (100 ng/ml, 5 min), by guest on September 27, 2021 harvested for sucrose density gradient separation, and prepared for mass spectrometry as previously described (14).

Mass spectrometry analysis

Lipid raft protein pellets (∼30 mg each) were solubilized in 0.2 ml CH3OH (60% [v/v]) buffered with NH4HCO3 (pH 7.9). Samples were digested overnight using a 1:20 (w/w) trypsin/protein ratio. Trypsin-catalyzed 16O (FADD WT)/18O (FADD KO) exchange/labeling was carried out as previously described (15). Peptide pools were combined and lyophilized prior to strong cation exchange fractionation. Strong cation exchange fractionation was performed using an HP 1090 LC system (Agilent Technologies, Santa Clara, CA) as previously described (16). Sixteen fractions were collected, lyophilized, and reconstituted in 0.1% trifluoroacetic acid prior to nano- flow reversed-phase liquid chromatography/Fourier transform ion cy- clotron resonance mass spectrometry (MS) (LTQ-FT; Thermo Fisher Scientific, Waltham, MA), as previously described (17). MS/MS spectra were analyzed using the SEQUEST algorithm against the UniProt mouse proteomic database from the European Bioinformatics Institute (http:// www.ebi.ac.uk/). For a peptide to be acceptably identified, it had to achieve charge state and proteolytic cleavage-dependent cross correlation (Xcorr) scores of 2.0 for [M + H]1+, 2.3 for [M + 2H]2+, 3.3 for [M + [3H]3+, and a minimum delta correlation score (DCn)of$0.08. Relative abundances for differentially labeled protein-specific peptides (i.e., peptide matched to only one protein) were calculated using PepQuan (Thermo Fisher Scientific) and in-house developed software (18). Results were reported as 18O/16O (heavy/light) ratios for a particular protein identified by two or more peptides. FIGURE 1. Identification of SASH1 in FADD KO MEFs by mass Mice spectrometry analysis. FADD WT and FADD KO MEFs were stimulated with LPS (100 ng/ml, 5 min), and detergent-resistant microdomains The embryonic stem cell line CC0006 from the Sanger Institute Gene Trap (DRM) were isolated. (A) Protein fractions isolated from sucrose density- Resource was used to generate Sash1 gene-trap mice (C57BL/6 3 129/Ola background). A comparison of the expressed sequence tag from the Sanger gradient separation were immunoblotted with caveolin-1 to validate the B database and Ensembl suggested that the insertion site for the gene-trap separation procedure. ( ) SASH1 peptides identified in FADD KO MEF vector, pGT0LxfT2, is within introns 14–15 of Sash1. PCR of genomic lipid rafts. (C) MS/MS spectrum assigned to one of the SASH1 peptides DNA, followed by DNA sequencing, was used to map the exact location of predicting the amino acid sequence of FIYVDVLNEEEEK. The y and the insertion into the Sash1 gene. Genomic DNA was isolated from lit- b ions are labeled. 894 SASH1 MEDIATES ENDOTHELIAL TLR4 SIGNALING

Immunoblot analysis and immunoprecipitation cells by cotransfection of the shRNA vector, pVSVG, pMDL g/p RRE, and RSV-REV. Viral supernatants were used to transduce target cells, Cells were cotransfected with 5 mg each expression plasmid, and cell and GFP+ cells were selected by ﬂow sorting (FACS 440; Becton lysates were collected using modiﬁed RIPA buffer (50 mM Tris-HCl Dickson). [pH 7.4], 150 mM NaCl, 1 mM EDTA, 1% Nonidet P-40, 0.25% sodium deoxycholate plus protease inhibitors). Subsequently, protein lysate was In silico analysis immunoprecipitated with anti–Flag M2-agarose beads or control IgG- agarose beads (Sigma-Aldrich, St. Louis, MO). Immunoprecipitation was Prediction of TRAF6 as a SASH1 interacting partner was found using the also performed with anti-HA, anti-Myc, or anti-TRAF6 and incubation Eukaryotic Linear Motif resource (http://elm.eu.org/links.html) (20). with protein A or G agarose beads (Cell Signaling Technologies, Danvers, MA). To examine polycovalent ubiquitination, cells were lysed in buffer ELISA containing 50 mM Tris (pH 7.4), 150 mM NaCl, 1 mM EDTA, 1% Triton HMECs were stimulated with LPS (100 ng/ml, 6 h), and cell culture X-100, 0.1% SDS, and 20 mM N-ethylmaleimide plus protease inhibitors, supernatants were assayed for IL-6 (eBioscience) or IFN-g–inducible and endogenous TRAF6 was immunoprecipitated with anti-TRAF6 or protein 10 (IP-10; R&D Systems, Burlington, ON, Canada) by ELISA anti-HA followed by incubation with TrueBlot anti-rabbit Ig immuno- following the manufacturers’ directions. precipitation beads (eBioscience, San Diego, CA). Flag-TAK1 was immunoprecipitated with anti–Flag M2-agarose beads. Transwell migration assay Luciferase reporter assay HMECs were stably transduced with lentivirus, as indicated, and GFP+ cells were used to evaluate the role of SASH1 in endothelial cell migration in HMECs were cotransfected with expression plasmids or stably transduced response to LPS. Cellular migration was measured using an 8-mm-pore with lentivirus, as indicated, plus an NF-kB luciferase reporter or an IFN- polyethylene terephthalate membrane of a transwell migration insert (BD stimulated response element luciferase reporter (pISRE-Luc; Stratagene).

Biosciences, Mississauga, ON, Canada). Briefly, cells were seeded into the Downloaded from The Renilla luciferase plasmid pRL-CMV (Promega, Fitchburg, WI; for upper chamber of the transwell migration system and allowed to adhere pNF-kB-Luc) or pRL-TK (Promega; for pISRE-Luc) was used as a trans- for 1 h with serum-free medium in the lower chamber. Following 1 h, the fection normalization control. Cells were stimulated with ligands, followed media in the lower chamber was replaced with MCDB 131 medium by passive lysis and measurement of luciferase activity by a dual luciferase containing 10% FBS, and cells in the upper chamber were stimulated assay (Promega). with LPS (100 ng/ml, 6 h). Following stimulation, insert membranes RNA interference were washed with PBS and fixed with 4% paraformaldehyde. Cells on the upper side of the membrane were removed using a sterile cotton Small interfering RNAs targeting human SASH1 mRNA (NM_015278), swab, and the membranes were stained with 0.5% crystal violet (in 20% http://www.jimmunol.org/ short hairpin (sh)SASH1 573-GCTAATGATGATGGTCAAAGA-593, and methanol) to visualize cells that had passed through to the lower side shRandom GTTGCTTGCCACGTCCTAGAT were cloned into pLenti- of the membrane. The number of migrated cells was counted using an lox3.7. pLKO.1 (Open Biosystems) and pLKO.1-shTRAF6 were previously inverted microscope. Four randomly selected fields were counted for described (19). Lentiviral particles were produced from HEK293T each sample. by guest on September 27, 2021

FIGURE 2. Generation of gene-targeted Sash1 mice. (A) RT-PCR of tissue RNA isolated from C57BL/6 mice using primers specific to mouse Sash1.(B) Mapping of the genomic insertion of the gene-trap vector to introns 14–15 by PCR. (C–E) Sash1 expression in the endothelium of the spleen (C), thymus (D), and lung (E) as determined by b-galactosidase activity. (F) RT-PCR using RNA of lung endothelial cells purified by flow-sorting using rat anti-mouse CD105 hybridoma. Scale bar, 50 mm; inset image scale bar, 25 mm. The Journal of Immunology 895

Statistical analysis Generation of Sash1 gene-trap mice Results are expressed as means 6 SD. Data were analyzed using a two- Sash1 mRNA is ubiquitously expressed in human tissues, with the tailed Student t test using the GraphPad Prism statistical program. A p highest levels of expression found in the lung, spleen, thymus, and , value 0.05 was considered significant. Error bars depict SD. placenta (9). To investigate the in vivo expression pattern of murine Sash1, tissues were harvested from C57BL/6 mice and Results analyzed for mRNA expression by RT-PCR. Sash1 mRNA was Proteomic analysis identifies SASH1 as a putative player in the found to be expressed in all mouse tissues examined (Fig. 2A). To TLR4 signaling pathway examine the in vivo expression of Sash1 in murine tissues, we To examine the protein content of lipid microdomains from LPS- generated Sash1+/2 mice using a gene-trap that results in a Sash1- stimulated MEFs, caveolin-containing detergent-resistant membrane LacZ fusion protein comprising the first 14 exons of Sash1, fol- fractions were isolated from FADD KO and WT MEFs (Fig. 1A) and lowed by the b-geo construct under control of the endogenous differential proteomic analysis was performed. Two peptides uniquely Sash1 promoter (Fig. 2B). At the cellular level, Sash1 was ex- identified SASH1 in the detergent-resistant membrane fraction of pressed in the parenchyma of various organs that show dysfunc- FADD KO, but not FADD WT, cells (Fig. 1B, 1C), suggesting that tion in sepsis, including the liver, kidney, and brain. Notably, SASH1 may function as a positive regulator of TLR4 signaling. Sash1 was strongly expressed in the microvascular endothelium of Downloaded from http://www.jimmunol.org/ by guest on September 27, 2021

FIGURE 3. SASH1 knockdown decreases endothelial TLR4 signaling. HMECs were transduced with lentiviral vectors encoding shRNA as indicated and (A) SASH1 protein levels were measured by immunoblotting (right panel) and quantified by densitometry relative to tubulin (left panel). (B–H) Luciferase assay to measure NF-kB activity in HMECs following 8 h stimulation with (B) LPS (100 ng/ml), (C) Pam3CSK4 (100 ng/ml), (D) polyinosinic-poly- cytidylic acid (2 mg/ml), (E) flagellin (500 ng/ml), (F) IL-1b (10 ng/ml), (G) IL-17(100 ng/ml), or (H) TGF-b1 (5 ng/ml). (I and J) ELISA to measure (I) IL-6 or (J) IP-10 in the supernatants of LPS-stimulated HMECs (100 ng/ml, 6 h). (K) Luciferase assay to measure IFN activation following 8 h stimulation with LPS in HMECs. Data are presented as fold change relative to normal. *p , 0.0001, **p = 0.0003, ***p = 0.05 as determined by Student t test. Error bars indicate SD; n $ 3 independent experiments. 896 SASH1 MEDIATES ENDOTHELIAL TLR4 SIGNALING all organs examined, explaining the ubiquitous organ expression resulted in an increase in LPS-induced NF-kB activation (Fig. 4A) of Sash1 mRNA (Fig. 2C, 2D, and Supplemental Fig. 1). Of in- and increased production of IL-6 and IP-10 (Fig. 4B, 4C), but it terest, Sash1 was not expressed in lymphoid cells of the spleen had no effect on an ISRE-luciferase reporter (Fig. 4D). Taken and thymus (Fig. 2C–E). To confirm endothelial Sash1 expression together, these data suggest that SASH1 plays a positive role in the in the lung, we examined flow-sorted, CD105+ endothelial cells by activation of NF-kB, but not IRF-regulated, signaling pathways RT-PCR. Sash1 mRNA was found predominantly in the CD105+ downstream of TLR4 activation. fraction of adult lung tissue, along with several endothelial SASH1 interacts with the C-terminal domain of TRAF6 through markers. In contrast, Sly1 and Sly2 were found predominantly in a conserved TRAF6 binding domain the nonendothelial (CD1052) population (Fig. 2F). The presence of Sash1 in the endothelium, but not in lymphoid cells of the TRAF6 binding proteins CD40 and IRAK possess a conserved spleen and thymus, suggests that SASH1 may function in non- TRAF6 interaction motif (24, 25), and in silico analysis revealed immune cells to propagate the TLR4 signal. that SASH1 contains a consensus TRAF6 binding sequence at amino acids 852–860. Interaction of SASH1 and TRAF6 was SASH1 positively regulates LPS signal transduction demonstrated by reciprocal coimmunoprecipitation of Flag-tagged Given the ubiquitous microvascular endothelial expression of TRAF6 and HA-tagged SASH1 in HEK293T cells cotransfected Sash1, we examined SASH1 function in HMECs. Lentiviral- with each of these expression constructs (Fig. 5A). mediated knockdown using shRNA targeting SASH1 in HMEC To determine whether SASH1 binds to TRAF6 through the resulted in ∼70% reduction of SASH1 protein relative to a random putative TRAF6 binding domain identified by in silico analysis, shRNA (Fig. 3A). Knockdown of SASH1 was sufficient to de- a SASH1 mutant lacking this domain was constructed. Deletion Downloaded from crease NF-kB luciferase reporter activity in response to LPS (Fig. of this domain abolished interaction between TRAF6 and SASH1 3B), but not in response to activation of TLR2, TLR3, TLR5, or (Fig. 5B), suggesting that the interaction between these two pro- other receptors that signal through TRAF6, such as IL-1R, IL- teins occurs through the conserved TRAF6 binding motif. Other 17R, and TGF-bR (21, 22) (Fig. 3C–H). In contrast, SASH1 TRAF6 binding partners that possess a conserved TRAF6 inter- knockdown did not affect activation of an ISRE coupled to lu- action motif interact with TRAF6 at the C-terminal TRAF domain

ciferase, suggesting that SASH1 is not required for LPS-induced (26). To investigate which region of TRAF6 binds to SASH1, we http://www.jimmunol.org/ activation of IFN-regulated genes (Fig. 3K). used mutants of the TRAF6 protein. The TRAF6 mutant that lacks We were unable to detect NF-kB activation downstream of the N terminus coimmunoprecipitated with SASH1. However, TLR9 in HMECs using several different CpG oligonucleotides, the mutant lacking the C-terminal region of TRAF6 did not coim- and previous reports have shown that TLR7 and TLR8 are not munoprecipitate with SASH1, suggesting that SASH1 interacts expressedonrestingendothelial cells; thus, NF-kB activation with the C terminus of TRAF6 (Fig. 5C). Additionally, a TRAF6 downstream of these receptors was not assessed (23). deletion construct lacking the coiled-coil domain interacted We next determined whether NF-kB–dependent cytokines are poorly with SASH1, consistent with a role for SASH1 in the oligo- decreased in response to LPS when endogenous SASH1 levels merization and activation of TRAF6. are reduced. Indeed, knockdown of SASH1 resulted in decreased To determine whether the TRAF6–SASH1 interaction was LPS- by guest on September 27, 2021 production of IL-6 and IP-10, in response to LPS, compared with dependent, interaction between endogenous TRAF6 and SASH1 cells transduced with a random control shRNA construct (Fig. 3H, was examined in LPS-stimulated HEK293-TLR4-CD14-MD2 cells. 3I). Conversely, enforced overexpression of SASH1 in HMECs Immunoprecipitation of TRAF6 resulted in coprecipitation of

FIGURE 4. Enforced expression of SASH1 increases TLR4 signaling. (A–D) HMECs were transfected with Flag-SASH1 or vector control and (A) cotransfected with pNF-kB plus pRL-CMV and NF-kB activity was measured by dual luciferase assays following stimulation with LPS (100 ng/ml, 8 h) or (B and C) stimulated with LPS (100 ng/ml, 6 h) and supernatants were assayed by ELISA for (B) IL- 6or(C) IP-10 or (D) cotransfected with pISRE-Luc plus pRL-TK to quantify IFN activity by dual luciferase assays. Data are presented as the fold change relative to normal. *p = 0.0004, **p , 0.0001 as determined by Student t test. Error bars indicate SD; n $ 3 independent experiments. The Journal of Immunology 897

FIGURE 5. SASH1 interacts with the C terminus of TRAF6 through a conserved TRAF6 binding motif. (A) HEK293T cells were cotransfected with HA-SASH1, Flag-TRAF6, or vector control and lysates immunoprecipitated and immunoblotted using anti-SASH1 or anti-TRAF6. (B) Schematic of SASH1 TRAF6 binding domain mutant construct (upper panel). HEK293T cells were cotransfected with Flag-TRAF6 and Myc-SASH1DT6BD, immunoprecipitated, and immunoblotted with anti-TRAF6 or anti-SASH1 (lower panel). (C) Schematic of TRAF6 deletion constructs: TRAF6, amino acids 1–522; Flag-TRAF6DN, amino acids. 289–522; Flag-TRAF6DC, amino Downloaded from acids 1–289; Flag-TRAF6DCC, amino acids 1–292, 351–522 (upper panel). HEK293T cells were cotransfected with HA-SASH1 and either Flag- TRAF6DN, Flag-TRAF6DC, or Flag- TRAF6DCC and lysates were immunoprecipitated and immunoblotted http://www.jimmunol.org/ using Abs to HA, Flag, or TRAF6 (lower panel). (D) Endogenous SASH1 associates with TRAF6 in HEK293- TLR4-MD2-CD14 cells stimulated with LPS (100 ng/ml, times indicated in minutes). (E–G) HEK293T cells were cotransfected with HA-SASH1 and either Flag-IRAK1 (E), Flag-

IRAK4 (F), or Myc-MyD88 (G), and by guest on September 27, 2021 lysates were immunoprecipitated and immunoblotted with Abs to Flag, HA, or Myc. Lysates for isotype control immunoprecipitates are the same as double-transfected immunoprecipitates. CC, Coiled coil; IP, immunoprecipitate.

endogenous SASH1 after 5 min of LPS treatment, and this in- SASH1 regulates TRAF6 ubiquitination teraction was sustained for up to 60 min after stimulation (Fig. K63-linked autoubiquitination of TRAF6 is critical for formation 5D). This finding suggests that the interaction between SASH1 and of the signaling complex comprised of TAK1 and the adaptor TRAF6 is LPS-dependent and physiologically relevant. In contrast, proteins TAB2 and TAB3 (29). To determine whether the inter- SASH1 does not interact with MyD88 or IRAKs (Fig. 5E–G). action between SASH1 and TRAF6 regulates TRAF6 activation, TRAF6 belongs to a family of TRAF molecules that mediate TRAF6 ubiquitination was examined in the presence of SASH1. signaling downstream of TNFR superfamily members (27). In Indeed, transient overexpression of SASH1 in HEK293-TLR4- silico analysis also identified four putative TRAF2 binding sites CD14-MD2 cells was sufficient to induce autoubiquitination of within the human SASH1 protein sequence. TRAF2 is critical for the activation of NF-kB and JNK downstream of numerous TRAF6 in the absence of LPS stimulation (Fig. 6A). Because receptors, including TNFR1 and CD40 (28). The presence of TRAF6 is modified by K48-linked and K63-linked ubiquitin, multiple putative TRAF2 binding sites within SASH1 could be we wanted to determine the precise modification mediated by indicative of a broader role for SASH1 in regulating TRAF family SASH1. We transfected HEK293-TLR4-CD14-MD2 cells with members. However, coimmunoprecipitation analysis did not total ubiquitin, K63-linked ubiquitin, or K48-linked ubiquitin show SASH1–TRAF2 interaction (Supplemental Fig. 2A). TRAF3 and examined TRAF6 ubiquitination by immunoprecipitation. Ex- functions downstream of TLR4 in MyD88-independent pathways, pression of SASH1, independent of LPS stimulation, resulted in primarily contributing to the activation of IFN-dependent genes greater K63-linked ubiquitination, compared with vector control, (5), but again coimmunoprecipitation did not reveal an interaction and no significant difference in K48-linked ubiquitin, suggesting between SASH1 and TRAF3 (Supplemental Fig. 2B). Taken to- that SASH1 is important for activating K63-linked ubiquitination gether, these results suggest that SASH1 may interact specifically but not the degradative K48-linked pathway (Fig. 6B). To deter- with TRAF6 and not with other TRAF molecules. mine whether the interaction between SASH1 and TRAF6 was 898 SASH1 MEDIATES ENDOTHELIAL TLR4 SIGNALING Downloaded from http://www.jimmunol.org/ FIGURE 6. SASH1 regulates TRAF6 ubiquitination. (A) HEK293-TLR4-MD2-CD14 cells were transfected with Flag-SASH1 or Flag-TRAF6, stimulated with LPS (100 ng/ml, 30 min), immunoprecipitated for TRAF6, and immunoblotted with anti-ubiquitin, TRAF6, or SASH1. (B) HEK293-TLR4- MD2-CD14 cells were transduced with Flag-SASH1 or vector control and subsequently transfected with HA-Ubi-WT, HA-Ubi-K48, HA-Ubi-K63, or vector control, stimulated with LPS (100 ng/ml, 30 min), and immunoprecipitated for TRAF6 and immunoblotted with anti-HA, anti-TRAF6, or anti- SASH1. (C) HEK293-TLR4-MD2-CD14 cells were transfected with Flag-SASH1, Myc-SASH1DT6BD, or vector control, stimulated with LPS (100 ng/ml, 30 min), and immunoprecipitated for TRAF6 and immunoblotted with anti-ubiquitin, anti-TRAF6, or anti-SASH1. (D) HMECs were cotransfected with Flag-SASH1, Myc-SASH1DT6BD, or vector control and pNF-kB-Luc and pRL-CMV, and NF-kB activity was measured by dual luciferase assays following stimulation with LPS (100 ng/ml, 8 h). Data are presented as fold change relative to the normal. *p , 0.001 as determined by Student t test. Error bars indicate SD; n = 3 independent experiments. IP, Immunoprecipitate. by guest on September 27, 2021 critical for the increase in TRAF6 ubiquitination, we transiently of TRAF6 (32). Reciprocal coimmunoprecipitation experiments transfected HEK293-TLR4-CD14-MD2 cells with the TRAF6 demonstrated that SASH1 interacts with TAK1 (Fig. 7A). TAK1 binding domain mutant of SASH1 and assessed TRAF6 ubiq- phosphorylates and activates the downstream target IKKb,leading uitination. Expression of this mutant did not induce autoubiqui- to NF-kB activation (33), and reciprocal coimmunoprecipitation tination of TRAF6 in the absence of LPS stimulation (Fig. 6C) or revealed that SASH1 also binds to IKKb (Fig. 7B). IKKb is part of increase the downstream activation of an NF-kB luciferase re- a complex consisting of an additional catalytic subunit, IKKa,and porter (Fig. 6D). These results imply that binding of SASH1 to aregulatorysubunit,IKKg (34). Reciprocal coimmunoprecipitation TRAF6 is important for ubiquitin-mediated activation of TRAF6 revealed that SASH1 also interacted with IKKa, but not the regu- and the subsequent downstream signaling to NF-kB. latory subunit IKKg, although we were able to detect interaction TRAF6 ubiquitination requires interaction with a heterodimeric between IKKg and IKKb as a control (Fig. 7C, 7D). This suggests ubiquitin conjugating enzyme composed of Ubc13 and the Ubc that SASH1 acts as a scaffold to assemble an NF-kB activation variant Uev1A (30). TRAF6 has been shown to bind directly to module through TRAF6, downstream of TLR4 stimulation. Ubc13, but not to Uev1A (31). However, we did not detect an To confirm that the interaction between SASH1 and TAK1 is interaction between SASH1 and either Ubc13 or Uev1A (Sup- independent of the SASH1 interaction with TRAF6, we examined plemental Fig. 3A and 3B, respectively), although we were able to the interaction between SASH1 and TAK1 in MEFs lacking expres- detect interaction between TRAF6 and Ubc13, as well as between sion of TRAF6. Interaction of SASH1 and TAK1 was maintained Ubc13 and Uev1A (Supplemental Fig. 3C and 3D, respectively). in TRAF62/2 MEFs, suggesting that TRAF6 is indispensable for These findings suggest that the E2 ligases do not directly bind the interaction between SASH1 and TAK1 (Fig. 7E). Moreover, SASH1, but become incorporated into a complex by binding when TRAF6 was knocked down in HEK293T cells, interaction of TRAF6 and each other. SASH1 with TAK1 and IKKb was sustained (Fig. 7F, 7G). Simi- larly, interaction of SASH1 with either TAK1 or IKKb was not SASH1 acts as a scaffold molecule by binding TAK1 and the abolished by deletion of the TRAF6 binding domain (Fig. 7H, 7I), IKK complex although the SASH1–TAK1 interaction was significantly reduced, Given that SASH1 is a large protein with multiple protein inter- suggesting that TRAF6–SASH1 interaction may facilitate TAK1 action domains, suggestive of a scaffolding function, coimmuno- binding to SASH1, or that the SASH1 deletion mutant through precipitation was used to determine whether SASH1 provides the conformational or other changes binds TAK1 less efficiently. Col- framework for constructing a molecular signaling complex around lectively, these results suggest that SASH1 acts as a scaffold mol- TRAF6. TAK1 has been reported to bind TRAF6 through the ecule to independently bind TRAF6, TAK1, and IKKb to facilitate adaptor molecules TAB2 and TAB3, thereby facilitating activation signaling to NF-kB. The Journal of Immunology 899

FIGURE 7. SASH1 is a scaffold protein that binds to the TAK1/IKK complex. (A–D) HEK293T cells were cotransfected with HA-SASH1 and either Flag-TAK1 (A), Flag-IKKb (B), Flag-IKKa (C), or Flag- IKKg (D) and lysates were immunoprecipitated and immunoblotted with Abs to HA and Flag. (E) MEFs were transduced with Flag-TAK1 or vector control and lysates were immunoprecipitated with anti-SASH1 and immunoblotted with Abs to SASH1 or Downloaded from Flag. Loss of TRAF6 expression in the TRAF62/2 MEFs was conﬁrmed by immunoblotting with anti-TRAF6. (F and G) HEK293T cells were transduced with lentiviral vectors encoding shRNA, as indicated, and GFP+ cells were cotransfected F with HA-SASH1 and either Flag-TAK1 ( ) http://www.jimmunol.org/ or Flag-IKKb (G) and lysates were immunoprecipitated and immunoblotted with Abs to HA and Flag. Knockdown was conﬁrmed by immunoblotting with anti-TRAF6. (H and I) HEK293T cells were cotransfected with Myc-SASH1DT6BD and either Flag- TAK1 (H)orFlag-IKKb (I) and lysates were immunoprecipitated and immunoblotted with Abs to Myc and Flag. Lysates for isotype control immunoprecipitates are the same as by guest on September 27, 2021 double-transfected immunoprecipitates. IP, Immunoprecipitate.

SASH1 regulates TAK1 ubiquitination and activation of in a decrease in LPS-induced JNK and p38 activation (Supple- downstream MAPK mental Fig. 4B). Taken together, these findings suggest that SASH1 TAK1 polyubiquitination has been shown to be essential for TAK1- is important for regulating multiple signaling cascades activated mediated activation of IKK/NF-kB downstream of receptors for downstream of TRAF6 and TAK1. TNF and IL-1 (35). We have shown that SASH1 interacts with SASH1 regulates LPS-induced endothelial cell migration TAK1, and thus we wanted to determine whether SASH1 could regulate ubiquitination of TAK1. Transient transfection of HEK293T- We have previously shown that LPS stimulates angiogenesis TLR4-MD2-CD14 cells with SASH1 resulted in an increase in through TRAF6-depenent activation of NF-kB and JNK (37). To TAK1 ubiquitination, even in the absence of LPS stimulation (Sup- determine whether SASH1 might affect LPS-induced angiogene- plemental Fig. 4A), similar to what was seen with TRAF6. However, sis, we used a transwell assay to assess endothelial migration. as with TRAF6, the SASH1–TRAF6 binding domain mutant failed Knockdown of SASH1 significantly reduced endothelial migration to result in increased TAK1 ubiquitination in the absence of LPS in response to LPS stimulation (Fig. 8), suggesting that SASH1 is stimulation, suggesting a requirement of SASH1–TRAF6 interaction important for endothelial cell function in innate immunity. for TAK1 activation. TAK1 is essential for activation of NF-kB, JNK, and p38 in response to LPS stimulation (36). Because SASH1 Discussion interacts with TAK1 and regulates its polyubiquitination, we in- The data presented in this study describe the function of a previ- vestigated whether SASH1 is important for activation of JNK and ously uncharacterized protein, SASH1. We show that SASH1, a p38 in endothelial cells. Knockdown of SASH1 in HMECs resulted member of the SLY family of proteins, acts as a novel TLR4 900 SASH1 MEDIATES ENDOTHELIAL TLR4 SIGNALING signaling molecule that is expressed in microvascular endothelial allograft survival, suggesting that SLY1 is critical for mediating cells. Our results support a function for SASH1 as a scaffolding adaptive immune responses in mice (11). SLY2 is expressed in nor- molecule to assemble a molecular complex that includes TRAF6, mal and hematopoietic tissues and is upregulated in B cells stimulated TAK1, IKKa, and IKKb, thereby facilitating activation of NF-kB, with IL-4, IL-13, anti-IgM, and anti-CD40, suggesting a role in B cell JNK, and p38 (Supplemental Fig. 4C). Thus, SASH1 provides the activation and differentiation cascades (12). Moreover, Sly22/2 mice first example of a noncatalytic scaffolding molecule that functions have increased Th1 and Th2 humoral immune responses, suggesting in TLR4 signaling. that Sly2 acts as an immunosuppressor (43). The results presented in Scaffold proteins are defined as molecules that bind to at least this study suggest that SASH1 also functions in immune regulation, two other proteins in a signaling cascade to regulate signaling, but in nonlymphoid cells, and, to our knowledge, describe for the first either by recruiting specific regulators or mediating subcellular time a molecular function for SASH1 in innate immunity. localization of the signaling complex (38). Although scaffold TRAF6 is essential for activation of IKK as well as JNK and molecules have been well defined in adaptive immunity in T cells, p38 MAPKs (44, 45). Our finding that SASH1 interacts with the the description of classical scaffold molecules in innate immune complex of TRAF6/TAK1/IKKa/b and promotes TRAF6 ubiq- signaling pathways has remained elusive. The Pellino proteins are uitination agrees with the finding that SASH1 increases down- a family of E3 ubiquitin ligases characterized by their interaction stream activation of NF-kB and MAPKs. However, because SASH1 with IRAK molecules downstream of TLR and IL-1R complexes regulates TRAF6 ubiquitination, but is insufficient to activate (39). However, in contrast to the catalytic function described for NF-kB or MAPKs in the absence of signal, our findings suggest that Pellino proteins, classical signaling scaffolds typically do not TRAF6 and TAK1 ubiquitination is not sufficient to activate possess enzyme activity and act primarily as specificity elements downstream pathways, and that a second, LPS-dependent event Downloaded from to control signaling between binding partners (40). In addition to is required for full activation of the signaling cascade. binding IRAK, Pellino proteins also complex with TRAF6 and Endothelial cells are among the first cells to come into contact TAK1 (41). However, the interaction between Pellino proteins and with invading pathogens in the bloodstream and play a critical role either TRAF6 or TAK1 has only been demonstrated downstream in the inflammatory response through recruitment and transmi- of IL-1R, and direct interaction between Pellino proteins and gration of leukocytes into infected tissue and the regulation of

TRAF6 or TAK1 has not been shown, as Pellino proteins do not vascular permeability (4). The expression of Sash1 in microvas- http://www.jimmunol.org/ contain a classic TRAF6 binding motif (20, 41). cular endothelial cells, as well as the novel scaffolding function In this study, we show that SASH1 binds to TRAF6 through described in this study, may provide insight into the cell type– a conserved TRAF6 binding domain and that lack of TRAF6, specific responses to LPS and the molecular events that lead to reduced TRAF6 expression, or deletion of the TRAF6 binding endothelial dysfunction and vascular collapse in sepsis. Endo- domain does not abolish binding between SASH1 and TAK1 or thelial cells, through the upregulation of surface adhesion mole- IKKb, suggesting that SASH1 can associate with these molecules cules, such as E-selectin and VCAM-1, serve as important medi- in the absence of a SASH1/TRAF6 complex. The Pellino proteins ators of leukocyte recruitment following LPS challenge (46). are small molecules (∼46 kDa), therefore limiting their ability to However, it remains unclear whether the endothelial events initi- act as assembly scaffolds for multiple signaling partners simul- ated during inflammation are an indirect result of LPS activation by guest on September 27, 2021 taneously. Thus, SASH1 provides the first example of a large of immune cells or a direct effect on the endothelium. In this scaffolding molecule that is capable of binding multiple signaling study, we show that knockdown of SASH1 significantly reduces proteins downstream of TLR4. LPS-induced endothelial migration in vitro, suggesting that The SLY family of SAM and SH3 adaptor molecules has previ- SASH1 may play a role in the angiogenic response during in- ously been implicated in regulation of the immune system. SLY1, fection in vivo. In this study, we were unable to confirm SASH1 named for its predominant expression in lymphoid tissues such as the function in TLR4 signaling in vivo because the homozygous-null spleen and thymus, is serine phosphorylated (Ser27) following B or mice showed perinatal lethality (data not shown). Additional studies TCR stimulation (42). Sly1d/d mice lack Ser27 and a functional nu- using endothelial-specific knockout mice with targeted deletions of clear localization sequence, and as a result show impaired lymphoid genes important in innate immune signaling, such as Sash1,will organ development, defects in Ag receptor–mediated lymphocyte shed light on the importance of the endothelium following LPS activation, attenuated humoral immune responses, and prolonged challenge in vivo.

FIGURE 8. SASH1 regulates LPS-induced endothelial migration. HMECs were transduced with lentiviral vectors encoding shRNA, as indicated, and (A) immunoblotting was used to confirm knockdown. (B and C) HMECs were seeded into the transwell migration system, stimulated with LPS (100 ng/ml, 6 h), and cells that migrated through the membrane were stained (shown in purple) and counted (B). Migrating cells were visualized by microscopy and (C) the number of migrating cells was quantified. Original magnification 3100. *p , 0.001 as determined by Student t test. Error bars indicate SD; n =3 independent experiments. The Journal of Immunology 901

In conclusion, in this study we have shown that SASH1 is a novel ELM server: a new resource for investigating short functional sites in modular regulator of TLR4 signaling through formation of a molecular eukaryotic proteins. Nucleic Acids Res. 31: 3625–3630. 21. Schwandner, R., K. Yamaguchi, and Z. Cao. 2000. Requirement of tumor ne- complex around TRAF6. Indeed, the importance of endothelial crosis factor receptor-associated factor (Traf)6 in interleukin 17 signal trans- NF-kB signaling in the vascular sequelae of sepsis strengthens a duction. J. Exp. Med. 191: 1233–1240. model in which SASH1 functions as an endothelial scaffold 22. Sorrentino, A., N. Thakur, S. Grimsby, A. Marcusson, V. von Bulow, N. Schuster, S. Zhang, C. H. Heldin, and M. Landstro¨m. 2008. The type I TGF-b molecule that is required for the assembly of TRAF6/TAK1/IKK receptor engages TRAF6 to activate TAK1 in a receptor kinase-independent to activate downstream signaling. manner. Nat. Cell Biol. 10: 1199–1207. 23. Fitzner, N., S. Clauberg, F. Essmann, J. Liebmann, and V. Kolb-Bachofen. 2008. Human skin endothelial cells can express all 10 TLR genes and respond to re- Disclosures spective ligands. Clin. Vaccine Immunol. 15: 138–146. The authors have no financial conflicts of interest. 24. Darnay, B. G., J. Ni, P. A. Moore, and B. B. Aggarwal. 1999. Activation of NF- kB by RANK requires tumor necrosis factor receptor-associated factor (TRAF) 6 and NF-kB-inducing kinase. Identification of a novel TRAF6 interaction motif. J. Biol. Chem. 274: 7724–7731. References 25. Ye, H., J. R. Arron, B. Lamothe, M. Cirilli, T. Kobayashi, N. K. Shevde, 1. Kawai, T., and S. Akira. 2009. The roles of TLRs, RLRs and NLRs in pathogen D. Segal, O. K. Dzivenu, M. Vologodskaia, M. Yim, et al. 2002. Distinct mo- recognition. Int. Immunol. 21: 317–337. lecular mechanism for initiating TRAF6 signalling. Nature 418: 443–447. 2. Moynagh, P. N. 2005. TLR signalling and activation of IRFs: revisiting old 26. Kobayashi, T., M. C. Walsh, and Y. Choi. 2004. The role of TRAF6 in signal friends from the NF-kB pathway. Trends Immunol. 26: 469–476. transduction and the immune response. Microbes Infect. 6: 1333–1338. 3. Kawai, T., and S. Akira. 2007. Signaling to NF-kB by Toll-like receptors. Trends 27. Chung, J. Y., Y. C. Park, H. Ye, and H. Wu. 2002. All TRAFs are not created Mol. Med. 13: 460–469. equal: common and distinct molecular mechanisms of TRAF-mediated signal 4. Dauphinee, S. M., and A. Karsan. 2006. Lipopolysaccharide signaling in en- transduction. J. Cell Sci. 115: 679–688.

dothelial cells. Lab. Invest. 86: 9–22. 28. Bradley, J. R., and J. S. Pober. 2001. Tumor necrosis factor receptor-associated Downloaded from 5. Ha¨cker, H., V. Redecke, B. Blagoev, I. Kratchmarova, L. C. Hsu, G. G. Wang, factors (TRAFs). Oncogene 20: 6482–6491. M. P. Kamps, E. Raz, H. Wagner, G. Ha¨cker, et al. 2006. Speciﬁcity in Toll-like 29. Lamothe, B., A. Besse, A. D. Campos, W. K. Webster, H. Wu, and B. G. Darnay. receptor signalling through distinct effector functions of TRAF3 and TRAF6. 2007. Site-speciﬁc Lys-63-linked tumor necrosis factor receptor-associated Nature 439: 204–207. factor 6 auto-ubiquitination is a critical determinant of IkB kinase activation. 6. Bannerman, D. D., J. C. Tupper, J. D. Kelly, R. K. Winn, and J. M. Harlan. 2002. J. Biol. Chem. 282: 4102–4112. The Fas-associated death domain protein suppresses activation of NF-kB by LPS 30. Deng, L., C. Wang, E. Spencer, L. Yang, A. Braun, J. You, C. Slaughter, and IL-1b. J. Clin. Invest. 109: 419–425. C. Pickart, and Z. J. Chen. 2000. Activation of the IkB kinase complex by 7. Zhande, R., S. M. Dauphinee, J. A. Thomas, M. Yamamoto, S. Akira, and

TRAF6 requires a dimeric ubiquitin-conjugating enzyme complex and a unique http://www.jimmunol.org/ A. Karsan. 2007. FADD negatively regulates lipopolysaccharide signaling by polyubiquitin chain. Cell 103: 351–361. impairing interleukin-1 receptor-associated kinase 1-MyD88 interaction. Mol. 31. Wooff, J., L. Pastushok, M. Hanna, Y. Fu, and W. Xiao. 2004. The TRAF6 RING Cell. Biol. 27: 7394–7404. 8. Triantafilou, M., K. Miyake, D. T. Golenbock, and K. Triantafilou. 2002. Medi- finger domain mediates physical interaction with Ubc13. FEBS Lett. 566: 229– ators of innate immune recognition of bacteria concentrate in lipid rafts and fa- 233. cilitate lipopolysaccharide-induced cell activation. J. Cell Sci. 115: 2603–2611. 32. Besse, A., B. Lamothe, A. D. Campos, W. K. Webster, U. Maddineni, S. C. Lin, 9. Zeller, C., B. Hinzmann, S. Seitz, H. Prokoph, E. Burkhard-Goettges, J. Fischer, H. Wu, and B. G. Darnay. 2007. TAK1-dependent signaling requires functional B. Jandrig, L. E. Schwarz, A. Rosenthal, and S. Scherneck. 2003. SASH1: interaction with TAB2/TAB3. J. Biol. Chem. 282: 3918–3928. a candidate tumor suppressor gene on chromosome 6q24.3 is downregulated in 33. Wang, C., L. Deng, M. Hong, G. R. Akkaraju, J. Inoue, and Z. J. Chen. 2001. breast cancer. Oncogene 22: 2972–2983. TAK1 is a ubiquitin-dependent kinase of MKK and IKK. Nature 412: 346–351. 10. Rimkus, C., M. Martini, J. Friederichs, R. Rosenberg, D. Doll, J. R. Siewert, 34. Scheidereit, C. 2006. IkB kinase complexes: gateways to NF-kB activation and B. Holzmann, and K. P. Janssen. 2006. Prognostic significance of downregulated transcription. Oncogene 25: 6685–6705. expression of the candidate tumour suppressor gene SASH1 in colon cancer. Br. 35. Fan, Y., Y. Yu, Y. Shi, W. Sun, M. Xie, N. Ge, R. Mao, A. Chang, G. Xu, by guest on September 27, 2021 J. Cancer 95: 1419–1423. M. D. Schneider, et al. 2010. Lysine 63-linked polyubiquitination of TAK1 at 11. Beer, S., T. Scheikl, B. Reis, N. Hu¨ser, K. Pfeffer, and B. Holzmann. 2005. lysine 158 is required for tumor necrosis factor a- and interleukin-1b-induced Impaired immune responses and prolonged allograft survival in Sly1 mutant IKK/NF-kB and JNK/AP-1 activation. J. Biol. Chem. 285: 5347–5360. mice. Mol. Cell. Biol. 25: 9646–9660. 36. Lee, J., L. Mira-Arbibe, and R. J. Ulevitch. 2000. TAK1 regulates multiple 12. Zhu, Y. X., S. Benn, Z. H. Li, E. Wei, E. Masih-Khan, Y. Trieu, M. Bali, protein kinase cascades activated by bacterial lipopolysaccharide. J. Leukoc. C. J. McGlade, J. O. Claudio, and A. K. Stewart. 2004. The SH3-SAM adaptor Biol. 68: 909–915. HACS1 is up-regulated in B cell activation signaling cascades. J. Exp. Med. 200: 37. Pollet, I., C. J. Opina, C. Zimmerman, K. G. Leong, F. Wong, and A. Karsan. 737–747. 2003. Bacterial lipopolysaccharide directly induces angiogenesis through 13. Weintz, G., J. V. Olsen, K. Fru¨hauf, M. Niedzielska, I. Amit, J. Jantsch, J. Mages, TRAF6-mediated activation of NF-kB and c-Jun N-terminal kinase. Blood 102: C. Frech, L. Do¨lken, M. Mann, and R. Lang. 2010. The phosphoproteome of 1740–1742. Toll-like receptor-activated macrophages. Mol. Syst. Biol. 6: 371. 38. Shaw, A. S., and E. L. Filbert. 2009. Scaffold proteins and immune-cell sig- 14. Karsan, A., J. Blonder, J. Law, E. Yaquian, D. A. Lucas, T. P. Conrads, and nalling. Nat. Rev. Immunol. 9: 47–56. T. Veenstra. 2005. Proteomic analysis of lipid microdomains from lipo- 39. Bacher, S., J. Grosshans, W. Dro¨ge, and M. L. Schmitz. 2001. The Drosophila polysaccharide-activated human endothelial cells. J. Proteome Res. 4: 349–357. proteins Pelle and Tube induce JNK/AP-1 activity in mammalian cells. FEBS 15. Blonder, J., M. L. Hale, K. C. Chan, L. R. Yu, D. A. Lucas, T. P. Conrads, Lett. 497: 153–158. M. Zhou, M. R. Popoff, H. J. Issaq, B. G. Stiles, and T. D. Veenstra. 2005. 40. Zeke, A., M. Lukaćs, W. A. Lim, and A. Remeńyi. 2009. Scaffolds: interaction Quantitative profiling of the detergent-resistant membrane proteome of iota- platforms for cellular signalling circuits. Trends Cell Biol. 19: 364–374. J. Proteome Res. b toxin induced Vero cells. 4: 523–531. 41. Moynagh, P. N. 2009. The Pellino family: IRAK E3 ligases with emerging roles 16. Blonder, J., K. C. Chan, H. J. Issaq, and T. D. Veenstra. 2006. Identification of in innate immune signalling. Trends Immunol. 30: 33–42. membrane proteins from mammalian cell/tissue using methanol-facilitated sol- 42. Astoul, E., A. D. Laurence, N. Totty, S. Beer, D. R. Alexander, and ubilization and tryptic digestion coupled with 2D-LC-MS/MS. Nat. Protoc. 1: D. A. Cantrell. 2003. Approaches to define antigen receptor-induced serine ki- 2784–2790. J. Biol. Chem. 17. Stockwin, L. H., J. Blonder, M. A. Bumke, D. A. Lucas, K. C. Chan, nase signal transduction pathways. 278: 9267–9275. T. P. Conrads, H. J. Issaq, T. D. Veenstra, D. L. Newton, and S. M. Rybak. 2006. 43. Wang, D., A. K. Stewart, L. Zhuang, Y. Zhu, Y. Wang, C. Shi, A. Keating, Proteomic analysis of plasma membrane from hypoxia-adapted malignant mel- A. Slutsky, H. Zhang, and X. Y. Wen. 2010. Enhanced adaptive immunity in anoma. J. Proteome Res. 5: 2996–3007. mice lacking the immunoinhibitory adaptor Hacs1. FASEB J. 24: 947–956. 18. Ye, X., B. T. Luke, D. J. Johann, A. Ono, D. A. Prieto, K. C. Chan, H. J. Issaq, 44. Lomaga, M. A., J. T. Henderson, A. J. Elia, J. Robertson, R. S. Noyce, T. D. Veenstra, and J. Blonder. 2010. An optimized method for computing 18O/16O W. C. Yeh, and T. W. Mak. 2000. Tumor necrosis factor receptor-associated ratios of differentially stable-isotope labeled peptides in the context of post- factor 6 (TRAF6) deficiency results in exencephaly and is required for apopto- digestion 18O exchange/labeling. Anal. Chem. 82: 5878–5886. sis within the developing CNS. J. Neurosci. 20: 7384–7393. 19. Starczynowski, D. T., W. W. Lockwood, S. Dele´houzeé, R. Chari, J. Wegrzyn, 45. Naito, A., S. Azuma, S. Tanaka, T. Miyazaki, S. Takaki, K. Takatsu, K. Nakao, M. Fuller, M. S. Tsao, S. Lam, A. F. Gazdar, W. L. Lam, and A. Karsan. 2011. K. Nakamura, M. Katsuki, T. Yamamoto, and J. Inoue. 1999. Severe osteopet- TRAF6 is an amplified oncogene bridging the RAS and NF-kB pathways in rosis, defective interleukin-1 signalling and lymph node organogenesis in human lung cancer. J. Clin. Invest. 121: 4095–4105. TRAF6-deficient mice. Genes Cells 4: 353–362. 20. Puntervoll, P., R. Linding, C. Gemu¨nd, S. Chabanis-Davidson, M. Mattingsdal, 46. Kelly, M., J. M. Hwang, and P. Kubes. 2007. Modulating leukocyte recruitment S. Cameron, D. M. Martin, G. Ausiello, B. Brannetti, A. Costantini, et al. 2003. in inflammation. J. Allergy Clin. Immunol. 120: 3–10.