DOCSLIB.ORG

Impact of Macrophage Zinc Metabolism on Host Defense Against Mycobacterium Tuberculosis

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Impact of Macrophage Zinc Metabolism on Host Defense Against Mycobacterium Tuberculosis IMPACT OF MACROPHAGE ZINC METABOLISM ON HOST DEFENSE AGAINST MYCOBACTERIUM TUBERCULOSIS DISSERTATION Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University By Charlie Jacob Pyle, PharmD. Graduate Program in Pharmaceutical Sciences The Ohio State University 2016 Dissertation committee: Daren L. Knoell, PharmD., Advisor Larry S. Schlesinger MD. Karl Werbovetz, PhD. Amal Amer, MD, PhD. Copyright by Charlie Jacob Pyle 2016 ABSTRACT Tuberculosis (TB) is a global epidemic caused by infection of human macrophages with the world’s most deadly single bacterial pathogen Mycobacterium tuberculosis (M.tb). Manipulation of dietary micronutrients is a critical mechanism of host defense against infection and is referred to as nutritional immunity. In particular the essential trace element zinc functions as a critical modulator in inflammation through the human zinc transporter ZIP8. We hypothesize that zinc metabolism modulates macrophage host defense through ZIP8 during infection with Mycobacterium tuberculosis which is critical to the host response to TB. We began our investigation by establishing a physiologically relevant, in vitro model for the evaluation of zinc metabolism in human macrophage host defense. We then used the model to investigate the relationship between zinc, ZIP8 and NF-κB. ZIP8 is constitutively present in human macrophages, and induced through NF-κB as well as in response to LPS. Cellular zinc deprivation of macrophages increases LPS-induced macrophage zinc uptake, however ZIP8 knockdown in macrophages does not impact zinc accumulation prior to the arrival of the induced protein. Zinc supplementation increases NF-κB activity, ii independently of ZIP8. However, in response to LPS, ZIP8 inhibits NF-κB in the absence of zinc supplementation. Based upon these observations, we next identified the impact of ZIP8- dependent zinc on the balance of macrophage pro- and anti-inflammatory cytokine production. Zinc uptake within hours of LPS stimulation results in reduced IL-10 production and an increase in pro-inflammatory cytokine production in macrophages. ZIP8 knockdown partially reverses zinc-dependent reduction of IL-10 release but does not impact pro-inflammatory cytokine production. Localization of NF-κB subunits to binding sites on the IL-10 promoter is independent of zinc and ZIP8. However zinc supplementation of LPS-exposed macrophages reduces activity of the IL-10 inducing transcription factor C/EBPβ revealing a potential mechanism for the IL-10 effect. Finally we identified the impact of zinc and ZIP8 on macrophage inflammation and host defense during M.tb infection. We began by critically evaluating published epidemiologic studies and discovered that TB disease correlates with inadequate nutritional zinc intake and reduced circulating zinc levels. We also determined in vitro that M.tb infection uniquely induces ZIP8 expression in comparison to the other 23 known zinc transporters. M.tb infection during zinc supplementation results in redistribution and increase of cytosolic zinc. Importantly, supplementation of zinc during macrophage infection reduces both IL-10 production and M.tb growth, which is independent of ZIP8. Using a novel, in vivo myeloid specific ZIP8 knockout mouse we determined that during iii M.tb infection, ZIP8 induces expression of pro-inflammatory cytokines and immune modulators in alveolar macrophages. Finally we revealed that the absence of ZIP8 is associated with decreased M.tb growth in the lung in vivo. This work establishes a framework demonstrating that macrophage zinc metabolism modulates the antimicrobial response to M.tb through alterations in zinc metabolism. The impact of zinc metabolism on M.tb infection is both ZIP8- dependent- and –independent, further revealing that the impact of zinc is complex, involving multiple factors. These critical observations will facilitate investigation of the impact of macrophage zinc metabolism on the intracellular lifestyle of M.tb. Future studies determining the relative cellular distributions of ZIP8 and zinc throughout infection and the mechanisms underlying their impact on critical host defense functions have the potential to improve our understanding of TB pathogenesis. iv DEDICATION This document is dedicated to my daughters Scarlet and Alannah. v ACKNOWLEDGMENTS I would first like to thank my advisors, Drs. Daren L. Knoell and Larry S. Schlesinger for their benefaction, extraordinary mentorship and tireless support. I would also like to thank all of the past and current members of the Knoell and Schlesinger labs for their invaluable assistance. In particular Mingjie Liu thank you for your intellectual faculty, guidance and good cheer while unraveling the finer aspects of bench science. Shengying Bao, thank you for your affability and unrivaled technical instruction. Jessica Napolitano, thank you for your encouragement and sensible advice. Claire Dodd, thank you for your loyal friendship, gusto and revelatory scientific insights. Most importantly I would like to thank the members of my family Sarah, Scarlet and Alannah Pyle for their love, patience, understanding and companionship during my studies. vi VITA August 24, 1979 .................................... Born – Akron, Ohio June 1998 ............................................... Northwest Local High School December 2003 ...................................... B.S. Biology, The University of Akron June 2010 ............................................... PharmD, The Ohio State University September 2010 to present ................... Graduate Research Associate, The Ohio State University College of Pharmacy PUBLICATIONS 1. Liu MJ, Bao S, Galvez-Peralta M, Pyle CJ, Rudawsky AC, Pavlovicz RE, et al. ZIP8 regulates host defense through zinc-mediated inhibition of NF- kappaB. Cell Rep. 2013;3(2):386-400. 2. Pyle CJ, Akhter S, Dodd CE, Bao SY, Schlesinger LS, Knoell DL. Zinc modulates endotoxin-induced human macrophage inflammation through ZIP8 induction and C/EBPβ inhibition. [Manuscript in revision] FIELDS OF STUDY Major Field: Pharmaceutical Sciences vii TABLE OF CONTENTS Abstract………………………………………………………………………………..….ii Dedication………………………………………………………………………………..v Acknowledgements……………………………………………………………………..vi Vita……………………………………………………………………………………....vii List of Tables…………………………………………………………………………….x List of Figures…………………………………………………………………………...xi List of Abbreviations..…………………………………………………………………xiii Chapter 1: Introduction………………………………………………………………....1 1.2. Nutrients in Health………………………………………………………....2 1.3 Zinc………………………………………………………………………….11 1.4. Nutrient Dependent Host Defense……………………………………...29 1.5. Tuberculosis………………………………………………………………50 1.5. Goals for the dissertation………………………………………………..59 Chapter 2: The relationship between ZIP8, macrophage zinc status and NF-κB signaling………………………………………………………………………………...62 2.2 Results……………………………………………………………………...65 viii 2.3 Discussion………………………………………………………………….71 2.4 Materials and methods…………………………………………………...78 Chapter 3: Zinc modulates endotoxin-induced human macrophage inflammation through ZIP8 induction and C/EBPβ inhibition……………………………..……..102 3.2 Results…………………………………………………………………….103 3.3 Discussion………………………………………………………………..108 3.4 Materials and methods………………………………………………….114 Chapter 4: Macrophage zinc metabolism modulates host defense against Mycobacterium tuberculosis………………………………………………………...135 4.2 Results…………………………………………………………………….139 4.3 Discussion………………………………………………………………..145 4.4 Materials and methods………………………………………………….152 Chapter 5: Synthesis…………………………………………………………..…….172 Bibliography…………………………………………………………………………..183 ix LIST OF TABLES Table 1. The impact of ZIP8 knockdown on macrophage zinc transporter expression……………………………………………………………………………...96 Table 2. Select NF-κB binding sites of IL-10………………………………………134 Table 3. Serum zinc concentrations in TB…………………………………………171 x LIST OF FIGURES Figure 1. Human zinc transporters………………………………………………......61 Figure 2. ZIP8 is induced by NF-κB and inhibits its function in cell lines………..86 Figure 3. ZIP8 is constitutively present and highly inducible by LPS in human macrophages…………………………………………………………………………..88 Figure 4. Prolonged culture in zinc deficient media results in macrophage zinc deficiency……………………………………………………………………………….90 Figure 5. Constitutively expressed macrophage ZIP8 does not have a prolonged influence on intracellular zinc content……………………………………………….92 Figure 6. Zinc and ZIP8 alter p50 and p65 activity…………………………………94 Figure 7. Serum buffers zinc inhibition of macrophage cytokine responses…..120 Figure 8. Zinc supplementation reduces macrophage IL-10 expression in response to LPS………………………………………...……………………………122 Figure 9. Zinc supplementation reduces LPS-induced macrophage IL-10 release…………………………………………………………………………………124 Figure 10. Reduction in macrophage IL-10 production by zinc is ZIP8- dependent……………………………………………………………………………..126 xi Figure 11. Zinc-dependent IL-10 inhibition is independent of NF-κB…………..128 Figure 12. Zinc inhibits LPS-induced C/EBPβ…………………………………….130 Figure 13. Graphical abstract of macrophage zinc-dependent inhibition of LPS- induced C/EBPβ-driven IL-10 production………………………………………….132 Figure 14. TB incidence is correlated with risk for zinc deficiency……………...157 Figure 15. ZIP8 is induced by macrophage M.tb infection………………………159 Figure 16. BCG and M.tb infection alters macrophage zinc distribution……….161 Figure 17. Zinc supplementation reduces macrophage IL-10 expression and bacterial growth during
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Iron Transport Proteins: Gateways of Cellular and Systemic Iron Homeostasis
    Iron transport proteins: Gateways of cellular and systemic iron homeostasis Mitchell D. Knutson, PhD University of Florida Essential Vocabulary Fe Heme Membrane Transport DMT1 FLVCR Ferroportin HRG1 Mitoferrin Nramp1 ZIP14 Serum Transport Transferrin Transferrin receptor 1 Cytosolic Transport PCBP1, PCBP2 Timeline of identification in mammalian iron transport Year Protein Original Publications 1947 Transferrin Laurell and Ingelman, Acta Chem Scand 1959 Transferrin receptor 1 Jandl et al., J Clin Invest 1997 DMT1 Gunshin et al., Nature; Fleming et al. Nature Genet. 1999 Nramp1 Barton et al., J Leukocyt Biol 2000 Ferroportin Donovan et al., Nature; McKie et al., Cell; Abboud et al. J. Biol Chem 2004 FLVCR Quigley et al., Cell 2006 Mitoferrin Shaw et al., Nature 2006 ZIP14 Liuzzi et al., Proc Natl Acad Sci USA 2008 PCBP1, PCBP2 Shi et al., Science 2013 HRG1 White et al., Cell Metab DMT1 (SLC11A2) • Divalent metal-ion transporter-1 • Former names: Nramp2, DCT1 Fleming et al. Nat Genet, 1997; Gunshin et al., Nature 1997 • Mediates uptake of Fe2+, Mn2+, Cd2+ • H+ coupled transporter (cotransporter, symporter) • Main roles: • intestinal iron absorption Illing et al. JBC, 2012 • iron assimilation by erythroid cells DMT1 (SLC11A2) Yanatori et al. BMC Cell Biology 2010 • 4 different isoforms: 557 – 590 a.a. (hDMT1) Hubert & Hentze, PNAS, 2002 • Function similarly in iron transport • Differ in tissue/subcellular distribution and regulation • Regulated by iron: transcriptionally (via HIF2α) post-transcriptionally (via IRE) IRE = Iron-Responsive Element Enterocyte Lumen DMT1 Fe2+ Fe2+ Portal blood Enterocyte Lumen DMT1 Fe2+ Fe2+ Fe2+ Fe2+ Ferroportin Portal blood Ferroportin (SLC40A1) • Only known mammalian iron exporter Donovan et al., Nature 2000; McKie et al., Cell 2000; Abboud et al.
    [Show full text]
  • Aberrant Expression of ZIP and Znt Zinc Transporters in Urotsa Cells Transformed to Malignant Cells by Cadmium
    Article Aberrant Expression of ZIP and ZnT Zinc Transporters in UROtsa Cells Transformed to Malignant Cells by Cadmium Soisungwan Satarug 1,2,*, Scott H. Garrett 2, Seema Somji 2, Mary Ann Sens 2 and Donald A. Sens 2 1 Kidney Disease Research Collaborative, Centre for Health Service Research, The University of Queensland Translational Research Institute, Woolloongabba, Brisbane 4102, Australia 2 Department of Pathology, University of North Dakota School of Medicine and Health Sciences, Grand Forks, ND 58202, USA; [email protected] (S.H.G.); [email protected] (S.S.); [email protected] (M.A.S.); [email protected] (D.A.S.) * Correspondence: [email protected] Abstract: Maintenance of zinc homeostasis is pivotal to the regulation of cell growth, differentiation, apoptosis, and defense mechanisms. In mammalian cells, control of cellular zinc homeostasis is through zinc uptake, zinc secretion, and zinc compartmentalization, mediated by metal transporters of the Zrt-/Irt-like protein (ZIP) family and the Cation Diffusion Facilitators (CDF) or ZnT family. We quantified transcript levels of ZIP and ZnT zinc transporters expressed by non-tumorigenic UROtsa cells and compared with those expressed by UROtsa clones that were experimentally transformed to cancer cells by prolonged exposure to cadmium (Cd). Although expression of the ZIP8 gene in parent UROtsa cells was lower than ZIP14 (0.1 vs. 83 transcripts per 1000 β-actin transcripts), an increased expression of ZIP8 concurrent with a reduction in expression of one or two zinc influx transporters, namely ZIP1, ZIP2, and ZIP3, were seen in six out of seven transformed UROtsa clones.
    [Show full text]
  • Loss of the Dermis Zinc Transporter ZIP13 Promotes the Mildness Of
    www.nature.com/scientificreports OPEN Loss of the dermis zinc transporter ZIP13 promotes the mildness of fbrosarcoma by inhibiting autophagy Mi-Gi Lee1,8, Min-Ah Choi2,8, Sehyun Chae3,8, Mi-Ae Kang4, Hantae Jo4, Jin-myoung Baek4, Kyu-Ree In4, Hyein Park4, Hyojin Heo4, Dongmin Jang5, Sofa Brito4, Sung Tae Kim6, Dae-Ok Kim 1,7, Jong-Soo Lee4, Jae-Ryong Kim2* & Bum-Ho Bin 4* Fibrosarcoma is a skin tumor that is frequently observed in humans, dogs, and cats. Despite unsightly appearance, studies on fbrosarcoma have not signifcantly progressed, due to a relatively mild tumor severity and a lower incidence than that of other epithelial tumors. Here, we focused on the role of a recently-found dermis zinc transporter, ZIP13, in fbrosarcoma progression. We generated two transformed cell lines from wild-type and ZIP13-KO mice-derived dermal fbroblasts by stably expressing the Simian Virus (SV) 40-T antigen. The ZIP13−/− cell line exhibited an impairment in autophagy, followed by hypersensitivity to nutrient defciency. The autophagy impairment in the ZIP13−/− cell line was due to the low expression of LC3 gene and protein, and was restored by the DNA demethylating agent, 5-aza-2’-deoxycytidine (5-aza) treatment. Moreover, the DNA methyltransferase activity was signifcantly increased in the ZIP13−/− cell line, indicating the disturbance of epigenetic regulations. Autophagy inhibitors efectively inhibited the growth of fbrosarcoma with relatively minor damages to normal cells in xenograft assay. Our data show that proper control over autophagy and zinc homeostasis could allow for the development of a new therapeutic strategy to treat fbrosarcoma.
    [Show full text]
  • Role of ZIP8 in Host Response to Mycobacterium Tuberculosis
    International Journal of Molecular Sciences Review Elemental Ingredients in the Macrophage Cocktail: Role of ZIP8 in Host Response to Mycobacterium tuberculosis Charlie J. Pyle 1, Abul K. Azad 2, Audrey C. Papp 3, Wolfgang Sadee 3, Daren L. Knoell 4,* and Larry S. Schlesinger 2,* 1 Department of Molecular Genetics and Microbiology, Duke University, Durham, NC 27710, USA; [email protected] 2 Texas Biomedical Research Institute, San Antonio, TX 78227, USA; [email protected] 3 Center for Pharmacogenomics, Department of Cancer Biology and Genetics, College of Medicine, The Ohio State University Wexner Medical Center, Columbus, OH 43085, USA; [email protected] (A.C.P.); [email protected] (W.S.) 4 College of Pharmacy, The University of Nebraska Medical Center, Omaha, NE 68198-6120, USA * Correspondence: [email protected] (D.L.K.); [email protected] (L.S.S.); Tel.: +1-402-559-9016 (D.L.K.); +1-210-258-9419 (L.S.S.) Received: 6 October 2017; Accepted: 6 November 2017; Published: 9 November 2017 Abstract: Tuberculosis (TB) is a global epidemic caused by the infection of human macrophages with the world’s most deadly single bacterial pathogen, Mycobacterium tuberculosis (M.tb). M.tb resides in a phagosomal niche within macrophages, where trace element concentrations impact the immune response, bacterial metal metabolism, and bacterial survival. The manipulation of micronutrients is a critical mechanism of host defense against infection. In particular, the human zinc transporter Zrt-/Irt-like protein 8 (ZIP8), one of 14 ZIP family members, is important in the flux of divalent cations, including zinc, into the cytoplasm of macrophages.
    [Show full text]
  • Ferredoxin Reductase Is Critical for P53-Dependent Tumor Suppression Via Iron Regulatory Protein 2
    Downloaded from genesdev.cshlp.org on October 11, 2021 - Published by Cold Spring Harbor Laboratory Press Ferredoxin reductase is critical for p53- dependent tumor suppression via iron regulatory protein 2 Yanhong Zhang,1,9 Yingjuan Qian,1,2,9 Jin Zhang,1 Wensheng Yan,1 Yong-Sam Jung,1,2 Mingyi Chen,3 Eric Huang,4 Kent Lloyd,5 Yuyou Duan,6 Jian Wang,7 Gang Liu,8 and Xinbin Chen1 1Comparative Oncology Laboratory, Schools of Veterinary Medicine and Medicine, University of California at Davis, Davis, California 95616, USA; 2College of Veterinary Medicine, Nanjing Agricultural University, Nanjing 210014, China; 3Department of Pathology, University of Texas Southwestern Medical Center, Dallas, Texas 75390, USA; 4Department of Pathology, School of Medicine, University of California at Davis Health, Sacramento, California 95817, USA; 5Department of Surgery, School of Medicine, University of California at Davis Health, Sacramento, California 95817, USA; 6Department of Dermatology and Internal Medicine, University of California at Davis Health, Sacramento, California 95616, USA; 7Department of Pathology, School of Medicine, Wayne State University, Detroit, Michigan 48201 USA; 8Department of Medicine, School of Medicine, University of Alabama at Birmingham, Birmingham, Alabama 35294, USA Ferredoxin reductase (FDXR), a target of p53, modulates p53-dependent apoptosis and is necessary for steroido- genesis and biogenesis of iron–sulfur clusters. To determine the biological function of FDXR, we generated a Fdxr- deficient mouse model and found that loss of Fdxr led to embryonic lethality potentially due to iron overload in developing embryos. Interestingly, mice heterozygous in Fdxr had a short life span and were prone to spontaneous tumors and liver abnormalities, including steatosis, hepatitis, and hepatocellular carcinoma.
    [Show full text]
  • The Role of Zip Superfamily of Metal Transporters in Chronic Diseases, Purification & Characterization of a Bacterial Zip Tr
    Wayne State University Wayne State University Theses 1-1-2011 The Role Of Zip Superfamily Of Metal Transporters In Chronic Diseases, Purification & Characterization Of A Bacterial Zip Transporter: Zupt. Iryna King Wayne State University Follow this and additional works at: http://digitalcommons.wayne.edu/oa_theses Part of the Biochemistry Commons, and the Molecular Biology Commons Recommended Citation King, Iryna, "The Role Of Zip Superfamily Of Metal Transporters In Chronic Diseases, Purification & Characterization Of A Bacterial Zip Transporter: Zupt." (2011). Wayne State University Theses. Paper 63. This Open Access Thesis is brought to you for free and open access by DigitalCommons@WayneState. It has been accepted for inclusion in Wayne State University Theses by an authorized administrator of DigitalCommons@WayneState. THE ROLE OF ZIP SUPERFAMILY OF METAL TRANSPORTERS IN CHRONIC DISEASES, PURIFICATION & CHARACTERIZATION OF A BACTERIAL ZIP TRANSPORTER: ZUPT by IRYNA KING THESIS Submitted to the Graduate School of Wayne State University, Detroit, Michigan in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE 2011 MAJOR: BIOCHEMISTRY & MOLECULAR BIOLOGY Approved by: ___________________________________ Advisor Date © COPYRIGHT BY IRYNA KING 2011 All Rights Reserved DEDICATION I dedicate this work to my father, Julian Banas, whose footsteps I indisputably followed into science & my every day inspiration, my son, William Peter King ii ACKNOWLEDGMENTS First and foremost I would like to thank the department of Biochemistry & Molecular Biology at Wayne State University School of Medicine for giving me an opportunity to conduct my research and be a part of their family. I would like to thank my advisor Dr. Bharati Mitra for taking me into the program and nurturing a biochemist in me.
    [Show full text]
  • Essential Trace Elements in Human Health: a Physician's View
    Margarita G. Skalnaya, Anatoly V. Skalny ESSENTIAL TRACE ELEMENTS IN HUMAN HEALTH: A PHYSICIAN'S VIEW Reviewers: Philippe Collery, M.D., Ph.D. Ivan V. Radysh, M.D., Ph.D., D.Sc. Tomsk Publishing House of Tomsk State University 2018 2 Essential trace elements in human health UDK 612:577.1 LBC 52.57 S66 Skalnaya Margarita G., Skalny Anatoly V. S66 Essential trace elements in human health: a physician's view. – Tomsk : Publishing House of Tomsk State University, 2018. – 224 p. ISBN 978-5-94621-683-8 Disturbances in trace element homeostasis may result in the development of pathologic states and diseases. The most characteristic patterns of a modern human being are deficiency of essential and excess of toxic trace elements. Such a deficiency frequently occurs due to insufficient trace element content in diets or increased requirements of an organism. All these changes of trace element homeostasis form an individual trace element portrait of a person. Consequently, impaired balance of every trace element should be analyzed in the view of other patterns of trace element portrait. Only personalized approach to diagnosis can meet these requirements and result in successful treatment. Effective management and timely diagnosis of trace element deficiency and toxicity may occur only in the case of adequate assessment of trace element status of every individual based on recent data on trace element metabolism. Therefore, the most recent basic data on participation of essential trace elements in physiological processes, metabolism, routes and volumes of entering to the body, relation to various diseases, medical applications with a special focus on iron (Fe), copper (Cu), manganese (Mn), zinc (Zn), selenium (Se), iodine (I), cobalt (Co), chromium, and molybdenum (Mo) are reviewed.
    [Show full text]
  • The Influence of Dietary Zinc Concentration During Periods Of
    Iowa State University Capstones, Theses and Graduate Theses and Dissertations Dissertations 2019 The influence of dietary zinc concentration during periods of rapid growth induced by ractopamine hydrochloride or dietary energy and dietary fiber content on trace mineral metabolism and performance of beef steers Remy Nicole Carmichael Iowa State University Follow this and additional works at: https://lib.dr.iastate.edu/etd Part of the Agriculture Commons, and the Animal Sciences Commons Recommended Citation Carmichael, Remy Nicole, "The influence of dietary zinc concentration during periods of rapid growth induced by ractopamine hydrochloride or dietary energy and dietary fiber content on trace mineral metabolism and performance of beef steers" (2019). Graduate Theses and Dissertations. 17416. https://lib.dr.iastate.edu/etd/17416 This Dissertation is brought to you for free and open access by the Iowa State University Capstones, Theses and Dissertations at Iowa State University Digital Repository. It has been accepted for inclusion in Graduate Theses and Dissertations by an authorized administrator of Iowa State University Digital Repository. For more information, please contact [email protected]. The influence of dietary zinc concentration during periods of rapid growth induced by ractopamine hydrochloride or dietary energy and dietary fiber content on trace mineral metabolism and performance of beef steers by Remy Nicole Carmichael A dissertation submitted to the graduate faculty in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY Major: Animal Science Program of Study Committee: Stephanie Hansen, Major Professor Nicholas Gabler Olivia Genther-Schroeder Elisabeth Huff-Lonergan Daniel Loy The student author, whose presentation of the scholarship herein was approved by the program of study committee, is solely responsible for the content of this dissertation.
    [Show full text]
  • Sudden Sensorineural Hearing Loss and Polymorphisms in Iron Homeostasis Genes: New Insights from a Case-Control Study
    Hindawi Publishing Corporation BioMed Research International Volume 2015, Article ID 834736, 10 pages http://dx.doi.org/10.1155/2015/834736 Research Article Sudden Sensorineural Hearing Loss and Polymorphisms in Iron Homeostasis Genes: New Insights from a Case-Control Study Alessandro Castiglione,1 Andrea Ciorba,2 Claudia Aimoni,2 Elisa Orioli,3 Giulia Zeri,3 Marco Vigliano,3 and Donato Gemmati3 1 Department of Neurosciences-Complex Operative Unit of Otorhinolaryngology and Otosurgery, University Hospital of Padua, Via Giustiniani 2, 35128 Padua, Italy 2ENT & Audiology Department, University Hospital of Ferrara, Via Aldo Moro 8, 44124 Cona, Ferrara, Italy 3Centre for Haemostasis & Thrombosis, Haematology Section, Department of Medical Sciences, University of Ferrara, 44100 Ferrara, Italy Correspondence should be addressed to Alessandro Castiglione; [email protected] Received 15 September 2014; Revised 15 December 2014; Accepted 6 January 2015 Academic Editor: Song Liu Copyright © 2015 Alessandro Castiglione et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Background. Even if various pathophysiological events have been proposed as explanations, the putative cause of sudden hearing loss remains unclear. Objectives. To investigate and to reveal associations (if any) between the main iron-related gene variants and idiopathic sudden sensorineural hearing loss.
    [Show full text]
  • A Short Review of Iron Metabolism and Pathophysiology of Iron Disorders
    medicines Review A Short Review of Iron Metabolism and Pathophysiology of Iron Disorders Andronicos Yiannikourides 1 and Gladys O. Latunde-Dada 2,* 1 Faculty of Life Sciences and Medicine, Henriette Raphael House Guy’s Campus King’s College London, London SE1 1UL, UK 2 Department of Nutritional Sciences, School of Life Course Sciences, King’s College London, Franklin-Wilkins-Building, 150 Stamford Street, London SE1 9NH, UK * Correspondence: [email protected] Received: 30 June 2019; Accepted: 2 August 2019; Published: 5 August 2019 Abstract: Iron is a vital trace element for humans, as it plays a crucial role in oxygen transport, oxidative metabolism, cellular proliferation, and many catalytic reactions. To be beneficial, the amount of iron in the human body needs to be maintained within the ideal range. Iron metabolism is one of the most complex processes involving many organs and tissues, the interaction of which is critical for iron homeostasis. No active mechanism for iron excretion exists. Therefore, the amount of iron absorbed by the intestine is tightly controlled to balance the daily losses. The bone marrow is the prime iron consumer in the body, being the site for erythropoiesis, while the reticuloendothelial system is responsible for iron recycling through erythrocyte phagocytosis. The liver has important synthetic, storing, and regulatory functions in iron homeostasis. Among the numerous proteins involved in iron metabolism, hepcidin is a liver-derived peptide hormone, which is the master regulator of iron metabolism. This hormone acts in many target tissues and regulates systemic iron levels through a negative feedback mechanism. Hepcidin synthesis is controlled by several factors such as iron levels, anaemia, infection, inflammation, and erythropoietic activity.
    [Show full text]
  • Dysregulation of Zinc and Iron Balance in Adipose Tissue From
    abetes & Di M f e o t a l b a o Maxel et al., J Diabetes Metab 2015, 6:2 n l r i s u m o DOI: 10.4172/2155-6156.1000497 J Journal of Diabetes and Metabolism ISSN: 2155-6156 Research Article Open Access Dysregulation of Zinc and Iron Balance in Adipose Tissue from Diabetic Sand Rats (Psammomys obesus) Trine Maxel1, Rasmus Pold2, Agnete Larsen1*, Steen Bønløkke Pedersen3, Dorthe Carlson4, Bidda Rolin5, Thóra Brynja Bödvarsdóttir5, Sten Lund2, Jørgen Rungby1,6 and Kamille Smidt1 1Department of Biomedicine, Aarhus University, Wilhelm Meyers Allé 4, 8000 Aarhus, Denmark 2Department of Clinical Medicine - The Department of Endocrinology and Diabetes, Aarhus University Hospital, Nørrebrogade 44, 8000 Aarhus, Denmark 3Department of Endocrinology (MEA), Aarhus University Hospital, Tage Hansens Gade 2, 8000 Aarhus, Denmark 4Department of Animal Science, Aarhus University, Blichers Allé 20, 8830 Tjele, Denmark 5Diabetes and Obesity Pharmacology Novo Nordisk A/S, Maaloev Byvej 200, 2760 Maaloev, Denmark 6Center for Diabetes Research, Department of Med F, Gentofte University Hospital, N. Andersens Vej 65, 2900 Hellerup, Denmark Abstract Background: In obesity, the distribution and metabolic function of adipose tissue are of vast importance for the risk of type 2 diabetes development. The homeostasis of zinc and iron is believed to be disturbed in diabetic patients. Zinc dyshomeostasis could affect the metabolic function of adipose tissue as zinc is known to facilitate the functions of insulin within adipose tissue as well as take part in cell proliferation and apoptosis. Further, altered iron levels have been shown to affect insulin sensitivity. This study investigates the intracellular zinc regulation and total zinc and iron status in adipose tissues in obesity-linked, type 2 diabetes in the Psammomys obesus model.
    [Show full text]