K.R.Padma et al. / Journal of Pharmacy Research 2017,11(3),196-200 Research Article Available online through ISSN: 0974-6943 http://jprsolutions.info Coexpression of Adrenomedullin and Its receptors in Uteroimplantation regions of wistar rats in early gestation period

K.R.Padma1 and Dr.P.Josthna* Department of Biotechnology ,Sri Padmavati Mahila Visvavidyalayam (Women’s University), Tirupati, 517 502 Andhra Pradesh, India.

Received on:12-01-2017; Revised on: 14-02-2017; Accepted on: 17-03-2017

ABSTRACT Concentrations of adrenomedullin (ADM) in circulation increases during pregnancy. The pattern of ADM level and gene expression of ADM, its receptor components from early pregnancy has been studied in our present work. Calcitonin gene-related peptide (CGRP) and its related peptide, adrenomedullin (ADM), have vasorelaxant activity in a variety of tissues. The CGRP plays an important role in maintaining uterine relaxation during pregnancy. Calcitonin receptor-like receptor (CRLR), a seven-domain transmembrane protein functions as CGRP- á & â receptor in association with receptor activity modifying protein (RAMP1), whereas CRLR and RAMP2 or RAMP3 constitute a receptor for ADM. In our present study we examined the mRNA expression of ADM, CRLR, RAMP1, RAMP2 & RAMP3 by real-time PCR. The changes in mRNA are relative to the GAPDH marker. Administration of peptide receptor antagonist s.c on day 2 of gestation with the help of osmotic mini pump results in decrease in mRNA expression levels mainly in ADM & RAMP2 rather than CRLR and RAMP1&3.The dose response effect of ADM evinced well marked decrease in uterus and implantation weights when administered with 250µg/rat/day rather than control and low doses. Our results demonstrated that both CGRP and ADM along with receptor activity modifying protein (RAMP1) are essential to maintain implantation to full term baby.

KEY WORDS: Adrenomedullin, RAMP, pregnancy, osmotic mini pumps CGRP. 1. INTRODUCTION: Previous studies revealed [1] that ADM (adrenomedullin) content of the calcitonin gene related peptide (CALCA) family and can bind to fetal membranes is augmented in both term and pre-term labour. We the CALCA receptor along with receptor activity modifying protein therefore inclined to determine whether ADM mRNA expression is (RAMP) complexes results in expression of specific receptors. altered in Uteroimplantation sites during early gestation. ADM mRNA According to previous reports [14,15], CGRP appeared to mediate its is strongly expressed in the reproductive system of rats and humans effects by two receptors, CGRP- and CGRP-. and its concentrations are altered in normal pregnancy[2]. The abundance of mRNA in pregnant rat uterus is double that in the non- It is well pioneered that the calcitonin receptor-like receptor (CALCRL) pregnant animal. Several reports have exposed that the plasma levels assets for the majority of ADM and CALCA binding, and whether it of ADM increase in normal human pregnancy at as early as 8 weeks binds to ADM or to CALCA depends on the type of receptor activity of gestation and are elevated as pregnancy progresses[3-5]. In addition, modifying protein [RAMP] that is expressed[16] notedly RAMP1, a previous study[6] has demonstrated that in maternal plasma, total RAMP2 and RAMP3.However, the expression of ADM was not ADM concentration increased progressively throughout pregnancy demonstrated in the uteroimplantation sites and there are no reports and decreased after delivery. of CALCRL or RAMP in the uteroimplantation regions, to our knowledge. Therefore, we studied the ADM level and the gene Adrenomedullin (ADM) is ubiquitous multiregulatory peptide expression of ADM, CALCRL, and RAMP and characterized the expressed and secreted by various organs and tissues, including the specific binding of ADM to RAMPs. We also studied the dose heart, kidney, lung, adrenal gland [7-8] and reproductive organs, such response effect of ADM in uterus and implantation weights. Our as the ovary[9-11], uterus, oviduct, testis, prostate and the epididymis. data suggested that RAMPs are necessary and sufficient to determine ADM shares structural homology with rat as it consists of 52 amino ligand specificity of CRLR. Thus ADM plays a crucial role in acids in the human and 50 amino acids in the rat[12,13]. As a member of maintaining healthy pregnancy.

*Corresponding author. 2. MATERIALS AND METHODS: Dr. P. Josthna Assistant Professor 2.1. Animal maintenance: Department of Biotechnology Animal studies were performed as per institute animal ethics Sri Padmavati Mahila Visvavidyalayam (Women’s University) committee regulations and approved by the committee (Reg. No. Tirupati, 517 502 Andhra Pradesh, India. 1677/PO/a/12/CPCSEA/SPMVV-IEC/2014/01). Female Wistar rats with Journal of Pharmacy Research Vol.11 Issue 3 March 2017 196-200 K.R.Padma et al. / Journal of Pharmacy Research 2017,11(3),196-200 220-250 g weights were used for this study. Rats were placed in essential for all intracellular RNA isolation procedures. Complete plastic cages covered with wire mesh. Temperature was maintained disruption of cells walls and plasma membranes of cells and organelles at 37oC and a humidity of 55±5 % under a 12h light-dark cycle. is absolutely required to release all the RNA contained in the sample. Healthy female rats of Wistar strain were purchased from authorized vendor (M/S Raghavendra Enterprises, Bangalore, India). Incomplete disruption results in significantly reduced yields and after disruption homogenization is necessary to reduce the viscosity 2.2. Experimental Design: of the cell lysates produced by disruption. Homogenization shears Three to four pregnant rats were used for each of the experimental the high-molecular weight genomic DNA and other high-molecular- study. Female rats were mated with male proven breeders. The next weight cellular components to create a homogeneous lysate. day morning, collecting of vaginal secretion with a plastic pipette Incomplete homogenization results in significantly reduced yields. filled with 10 ìL of normal saline (NaCl 0.9%) by inserting the tip into Immediately place the weighed, fresh tissue in liquid nitrogen and the rat vagina. One drop of vaginal fluid was placed on glass slides then grind to a fine powder with mortar and pestle under liquid the unstained material was observed under a light microscope[17,18]. Two females of pro-estrous stage were paired with a male overnight nitrogen. Transfer tissue powder and liquid nitrogen into a liquid- and the next morning, males were removed and females were assessed nitrogen-cooled, 2-ml microfuge tube and allow the liquid nitrogen for the presence of sperms in the vaginal flush. Animals with positive to evaporate. Add the appropriate amount of Buffer RLT and sperm in the flushes are designated as day 1 of gestation. homogenize by passing the lysate at least 5 times. Alternatively, pipet lysate onto a QIAshredder column in a 2-ml collection tube 2.3. Treatments: and centrifuge for 2 min at maximum speed to homogenize. Centrifuge The mean ± SEM body weight was 224 ± 250 g in the rats on day 2 of lysate for 3 min at maximum speed in a microcentrifuge and use only gestation were taken. On day 2 of gestation, (model 2001) Alzet pump; 1.0 µl/h were inserted subcutaneously into the dorsum of pregnant the supernatant in subsequent steps. Add 1 volume (usually 350µl rats while the animals were under anaesthesia (anaesthesia consisted or 600 µl) of 70% ethanol to the cleared lysate, and mix well by of a combination of ketamine (45 mg/kg) and xylazine (5 mg/kg). The pipetting. Do not centrifuge. Apply 700 µl of the sample, including minipumps were filled with saline alone or with saline containing any precipitate which may have formed, to an RNeasy mini spin different concentrations of AM22–52. These concentrations were column in a 2-ml collection tube. Centrifuge for 15 sec at >10,000 [19] chosen based on the earlier findings of Witlin, et al. and rpm. Pipet 700 µl Buffer RW1 onto the RNeasy column, and centrifuge Penchalaneni, et al.[20] to deliver AM at 125 and 250µg/rat/day. 22–52 for 15 sec at >10,000 rpm to wash. Discard flow-through and collection tube. Pipet 500 µl Buffer RPE onto RNeasy column, and centrifuge 2.4. Dose response effect of Uteroimplantation region: An initial time course study was performed. Pumps were inserted on for 2 min at maximum speed to dry the RNeasy membrane. Place the Day 2 of gestation to continuously deliver ADM antagonist (100, RNeasy spin column in a new 2-ml collection tube and discard the 125 & 250 mg/rat/day) or vehicle control. The dose of ADM was old collection tube with the filtrate. Centrifuge at full speed for 1 min. chosen based on preliminary work with ADM, published experience Transfer RNeasy column into a new 1.5-ml collection tube and pipet with CGRP[14]. Following the time-course study, we modified the doses 30–50 µl of RNase-free water directly onto the RNeasy membrane. of ADM antagonist. The osmotic minipumps were inserted on Day 2 Centrifuge for 1 min at 10000 x g to elute. Repeat if the expected RNA of gestation; the rats were killed on gestational day5, 6, 7& 8. Based yield is >30 µg. on our initial time-course studies, we adjusted the dose of ADM antagonist to 100, 125 µg/rat/day, 250 µg/rat/day or vehicle control. 2.5.1.2. Reverse Transcription & Polymerase Chain Reaction (RT-PCR): In all cases, the drugs were placed in the mini pumps and the osmotic The first-strand cDNA was synthesized by reverse transcription (RT) mini pumps were inserted s.c. into the dorsum of the pregnant rats while animals were under anesthesia. We sacrificed the rats with for that in a 25-µl reaction volume containing, PCR buffer, 2µg of total RNA were mixed with 10 nmol of random primer, 1mM dNTP solution CO2. Each uterus and implanted regions was dissected intact and recorded the gestational day 5, 6, 7& 8 uterus and implantation weights and 5 U of RNase inhibitor and place it in a thermal cycler for 35 cycle at for each group. 94ºC for 30sec, 52ºC for 30 sec, 72ºC for 3 min. The polymerase chain reactions was initiated for ADM, CRLR, RAMP1, RAMP2 and 2.5. Quantitative analyses of Real time-PCR: RAMP3 by the specific primer set designed based on the published 2.5.1. RNA Extraction: DNA sequence[21]. Briefly, 2 µl of cDNA will be mixed with a PCR 2.5.1.1. Disruption and homogenization of Animal Tissue: mixture containing 2.5 mM MgCl2, 1x of 10x PCR buffer, 5 U/100 µl of 1 Efficient disruption and homogenization of the animal tissue is mM dNTP mixture, and 0.2 µM of the following gene-specific primers: Journal of Pharmacy Research Vol.11 Issue 3 March 2017 196-200 K.R.Padma et al. / Journal of Pharmacy Research 2017,11(3),196-200 Table1. Sequences of primer pairs used for Semi- quantitative PCR 3.2. Changes of expression on CRLR, RAMP1, RAMP2 and analysis. RAMP3 mRNA transcripts after ADM22-52 antagonist treatment on Gene Forward primer Reverse primer Uteroimplantation tissue: Expression of CRLR, RAMP1, RAMP2, and RAMP3 mRNA in the rat CRLR TGCTCTGTGAAGGCATTTAC CAGAATTGCTTGAACCTCTC RAMP1 GAGACGCTGTGGGTGACTG TCGGCTACTCTGGACTCCTG uteroimplantation tissue was determined by RT-PCR analysis, and RAMP2 GCTGTTACTGCTGCTGTTGC GTCTGCCTCGTACTCCAAGC the level of mRNA for these component proteins was determined RAMP3 CTTCTCCCTCTGTTGCTGCT GTCCTGTCCACAGTGCAGTT ADM TTCAGCAGGGTATCGGAGC CCGACTGTTCAATGCTGCC relative to GAPDH and β-actin mRNA from each animal. Comparisons GAPDH ACCCAGAAGACTGTGGATGG CAACAGACACGTTGGGAGTG were made in the mRNA expression among groups of rats on Day 9 2.6. Statistics: of gestation. The levels of mRNA observed in CRLR, RAMP1, RAMP2 The given data were expressed as mean ± SD. The results obtained and RAMP3. The RAMP1 and RAMP3 is expressed significantly were analyzed and compared by two analysis of variance (ANOVA) but modest expression in CRLR and RAMP2 showed significant without replication for comparing various doses of ADM antagonist. decrease in expression (as shown in figure-2A&B) when compared Student t-test was performed for statistical comparison between with vehicle control and CRLR, RAMP1 and RAMP2. treated and controls. P values less than 0.05 were considered statistically significant.

3. RESULTS: 3.1. Dose dependent effects of Adrenomedullin antagonist on uteroimplantation growth weights: This portion of the study evaluated the uteroimplantation growth effects of AM antagonist infusion initiated on gestational day 5 and continued through gestational day 8 as compared with vehicle control. The detrimental effects of AM antagonist infusion appeared to manifest in both the uterus and implantation which is determined by significantly decreased uterus and implantation growth during the dose response effect experiment (Fig. 1A&B).

Dose response effect from Gestation day 5th -8th

Figure:2A:PCR product detection in real time. The standard deviation is determined from the data points collected from the base line of the amplification plot. Ct values are calculated by determining A the point at which the fluorescence exceeds a threshold limit (usually Dose response effect from Gestation day 5th-8th 10 times the standard deviation of the base line). The RAMP1 and RAMP3 are expressed significantly but modest expression in CRLR and RAMP2 showed significant decrease in expression.

B

Figure:1(A&B) - Effect of the dose and time of infusion ADM22-52 antagonist (100 µg/rat/day, 125, 250 µg/rat/day and control groups. FIG 2B: Changes of expression on CRLR, RAMP1, RAMP2 and RAMP3 Osmotic minipumps were inserted on Day 2; the mother rats were mRNA transcripts after ADM22-52 antagonist treatment on Uteroimplantation killed from on Gestational Days 5, 6,7and 8. tissue. Journal of Pharmacy Research Vol.11 Issue 3 March 2017 196-200 K.R.Padma et al. / Journal of Pharmacy Research 2017,11(3),196-200 mRNA expression of ADM, CRLR, RAMP1, RAMP2 & RAMP3 were ACKNOWLEDGEMENTS analyzed by RT-PCR technique using appropriate primers. Whereas The authors express their appreciation to Sri Padmavathi Mahila LD is Low dose and HD is High dose of ADM22-52. The densitometry Visvavidyalayam (Women’s) University for providing access to the analysis of respective PCR products for CRLR and RAMP1, 2, 3& research facilities and for actively participating in the study and also ADM are represented as a ratio relative to that of GAPDH. Bars thanks to the faculty, staff, and students from the Mahila University represent the mean ± SEM from four replicates in each group. for their assistance in the research studies. The authors are also highly thankful to Dr.Syed Rahamathulla, Path Gene Health care *P < 0.05, ** P< 0.001indicates significantly different compared with private limited, Tirupati, A.P. for assisting and guiding in Real Time - the control. PCR and Dr.Penchalaneni Josthna acknowledges the DST-SERB, New Delhi for providing financial assistance. 4. DISCUSSION: In the present study, the ADM systems in the rat uteroimplantation Funding regions were thoroughly examined. The peptide levels and the mRNA These studies were supported by DST-SERB, New Delhi for providing levels of ADM, CRLR, and RAMP were measured by Real time-PCR financial support in project by releasing funds timely Project .The mRNA expression levels of ADM receptors (CRLR, RAMP1, ref. no.: SB/SO/AS-080 /2013. RAMP2 and RAMP3) in the uteroimplantation tissues of pregnant Competing interests rats which are treated with ADM22-52 antagonist at early gestation even showed marked decrease in expression in RAMP2& ADM The authors declare that they have no competing interests. compared to other receptors. The level of mRNA for these component proteins was determined relative to GAPDH in uteroimplantation Consent for publication Not applicable. tissues from each animal. We proposed that in addition to CGRP, ADM mainly regulate uterine relaxation during pregnancy. This Ethics approval and consent to participate information, together with the earlier studies[22-26], suggests that both Animal studies were performed as per institute animal ethics CGRP and ADM may play a role in the maintenance of uterine serenity committee regulations and approved by the committee (Reg. No. during pregnancy. We have used the time-course and dose-response 1677/PO/a/12/CPCSEA/SPMVV-IEC/2014) studies to evaluate the complete spectrum of ADM antagonist effects. In every variation of ADM antagonist exposure, deleterious effects REFERENCES: to the uterioimplantation regions were observed. The uterus and 1. Al-Ghafra, A., Gude, N. M., Brennecke, S. P. and King, R. G. implantation weights showed apparent decrease in 250 µg/rat/day (2003) Labour-associated changes in adrenomedullin than in control and low doses. Adrenomedullin is a multiregulator content in human placenta and fetal membranes. Clin. Sci. that put forth its effects through dual pathways in each of two 105, 419–423 vascular cell types. In endothelial cells, the accomplishment of ADM 2. Beltowski, J. and Jamroz, A. (2004) Adrenomedullin: what appears to involve the generation of NO and its diffusion to the do we know 10 years since its discovery? Pol. J. Pharmacol. adjacent smooth muscle cells[27]. In the vascular smooth muscle cells, 56, 5–27 3. Di Iorio, R., Marinoni, E., Letizia, C., Villaccio, B., Alberini, ADM stimulates cAMP[28-30]. A. and Cosmi, E. V. (1999) Adrenomedullin production is increased in normal human pregnancy. Eur. J. Endocrinol. 5. CONCLUSION: 140, 201–206 In summary, our present findings provide fact that in 4. Di Iorio, R. D., Marinoni, E., Scavo, D., Letizia, C. and Cosmi, uteroimplantation sites ADM mRNA expression significantly E. V. (1997) Adrenomedullin in pregnancy. Lancet 349, 328 increases at early gestation when compared with control and RAMPs 5. Nagata, N., Kato, J. and Kitamura, K. et al (1998) Dissociation but when ADM antagonist is infused in rats it leads to decrease in of adrenomedullin concentrations in plasma and ADM expression. In addition, the present study has identified that cerebrospinal fluid in pregnant and non-pregnant women. ADM binds to RAMP2 and when antagonist is infused it Eur. J. Endocrinol. 139, 611–614 significantly resulted in decreased expression of RAMP2 and ADM 6. Kanenishi, K., Kuwabara, H., Ueno, M., Sato, C., Sakamoto, mRNA. Thus both CRLR and ADM are elevated not only during late H. and Hata, T. (2001) Change of adrenomedullin gestation but also in early gestation period. Therefore the present concentrations in plasma and amniotic fluid, and human data suggests that ADM is important hormone in maintaining the placental adrenomedullin expression with advancing gestation. Placenta 22, 244–250 trophoblast and helps in differentiation and sustaining foetus without resorption. Journal of Pharmacy Research Vol.11 Issue 3 March 2017 196-200 K.R.Padma et al. / Journal of Pharmacy Research 2017,11(3),196-200 7. Kitamura K, Kangawa K, Kawamoto M, Ichiki Y, Nakamura 20. Yallampalli C, Dong Y, Wimalawansa SJ. Calcitonin gene- S, Matsuo H, et al. Adrenomedullin: a novel hypotensive related peptide reverses the hypertension and significantly peptide isolated from human pheochromocytoma. Biochem decreases the fetal mortality in pre-eclampsia rats induced Biophys Res Commun 1993; 192:553– 60. by Ng-nitro-L-arginine methyl ester. Hum Reprod 1996; 8. Hwang IS, Tang F. Peripheral distribution and gene 11:895–899. expression of adrenomedullin in the rat: possible source of 21. Stevenson JC, MacDonald DWR, Warren RC, Booker MW, blood adrenomedullin. Neuropeptides 2000; 34:32–7. Whitehead MI. Increased concentration of circulating 9. Moriyama T, Otani T, Maruo T. Expression of calcitonin gene-related peptide during normal human adrenomedullin by human granulosa lutein cells and its pregnancy. BMJ 1986; 293:1329–1330. effect on progesterone production. Eur J Endocrinol 22. Dong YL, Gangula PRR, Fang L, Wimalawansa SJ, Yallampalli 2000;142:671– 6. C.Uterine relaxation responses to calcitonin gene-related 10. Abe K, Minegishi T, Ibuki Y, Kojima M, Kangawa K. peptide and calcitonin gene-related peptide receptors Expression of adrenomedullin in the human corpus luteum. decreased during labor in rats. Am J Obstet Gynecol 1998; Fertil Steril 2000;74:141–5. 179:497–506. 11. Abe K, Minegishi T, Tano M, Hirakawa T, Tsuchiya M, 23. Dong YL, Fang L, Kondapaka S, Gangula PR, Wimalawansa Kangawa K, et al. Expression and effect of adrenomedullin SJ, Yallampalli C. Involvement of calcitonin gene-related on rat granulosa cell. Endocrinology 1998; 139:5263– 6. peptide in the modulation of human myometrial contractility 12. Cameron VA, Fleming AM. Novel sites of adrenomedullin during pregnancy. J Clin Invest 1999; 104:559–565. gene expression in mouse and rat tissues. Endocrinology 24. Naghashpour M, Dahl G. Relaxation of myometrium by 1998; 139: 2253–64. calcitonin gene-related peptide is independent of nitric oxide 13. Kitamura K, Sakata J, Kangawa K, Kojima M, Matsuo H, synthase activity in mouse uterus. Biol Reprod 2000; Eto T. Cloning and characterization of cDNA encoding a 63:1421–1427. precursor for human adrenomedullin. Biochem Biophys Res 25. Gangula PR, Wimalawansa SJ, Yallampalli C. Pregnancy and Commun 1993; 194:720 –5. sex steroid hormones enhance circulating calcitonin gene- 14. Sakata J, Shimokubo T, Kitamura K, Nakamura S, Kangawa related peptide concentrations in rats. Hum Reprod 2000; K, Matsuo H, et al. Molecular cloning and biological 15:949–953. activities of rat adrenomedullin, a hypotensive peptide. 26. Yallampalli C, Gangula PRR, Kondapaka S, Fang L, Biochem Biophys Res Commun 1993; 195:921–7. Wimalawansa SJ. Regulation of calcitonin gene-related 15. Yallampalli C, Chauhan M, Thota CS, Kondapaka SB, peptide receptors in the rat uterus during pregnancy, labor Wimalawansa SJ. Calcitonin gene-related peptide in and by progesterone. Biol Reprod 1999; 61:1023–1030. pregnancy and its emerging receptor heterogeneity. Trends 27. Hayakawa H, Hirata Y, Kakoki M, Suzuki Y, Nishimatsu H, Endocrinol Metab 2002; 13:263–269. Nagata D, Suzuki E, Kikuchi K, Nagano T, Kangawa K, 16. Chauhan M, Thota CS, Kondapaka S, Wimalawansa SJ, Matsuo H, Sugimoto T, Omata M. Role of nitric oxide-cGMP Yallampalli C. Evidence for the existence of a new receptor pathway in adrenomedullin induced vasodilation in the rat. for CGRP, which is not CRLR. Peptides 2003; 24:65–71. Hypertension 1999; 33:689–693. 17. McLatchie LM, Fraser NJ, Main MJ, Wise A, Brown J, 28. Isumi Y, Minamino N, Katafuchi T, Yoshioka M, Tsuji T, Thompson N, Solari R, Lee MG, Foord SM. RAMPs regulate Kangawa K, Matsuo H. Adrenomedullin production in the transport and ligand specificity of the calcitonin- fibroblasts: its possible function as a growth regulator of receptor-like receptor. Nature 1998; 393:333–339. Swiss 3T3 cells. Endocrinology 1998; 139:2552–2563. 18. Witlin AG, Li ZY, Wimalawansa SJ, Grady JJ, Grafe 29. Barker S, Kapas S, Corder R, Clark AJ. Adrenomedullin acts MR,Yallampalli C. Placental and fetal growth and via stimulation of cyclic AMP and not via calcium signaling development in late rat gestation is dependent on in vascular cells in culture. J Hum Hypertens 1996; 10:421– adrenomedullin.Biol Reprod2002, 67:1025–31. 423. 19. Penchalaneni J, Wimalawansa SJ, Yallampalli C: 30. Ishizaka Y, Ishizaka Y, Tanaka M, Kitamura K, Kangawa K, Adrenomedullin antagonist treatment during early gestation Minamino N, Matsuo H, Eto T. Adrenomedullin stimulates in rats causes fetoplacental growth restriction through cyclic AMP formation in rat vascular smooth muscle cells. apoptosis. Biol Reprod 2004, 71:1475-1483. Biochem Biophys Res Commun 1994; 200:642–646.

Source of support: DST-SERB, New Delhi ; Conflict of interest: None Declared

Journal of Pharmacy Research Vol.11 Issue 3 March 2017 196-200