orlly6S

NRC

Genetic diversity and population structure of pencil yarlr (Vigna lanceolata) (Phaseoleae, Fabaceae), a wild herbaceous legume endemic to Australia, revealed by microsatellite markers Phakchana Nubank6h, sarocha Pimtong, Prakit somta, Sujinna Dachapak, and Peerasak Srinives

Abstrac! pencil yaDr (yi8no lan(eoldto Benth.) (Phaseoteae, Fabaceae) is a herbaceous legume endemic to Austmlia. A Pr-evious DorpholoSical study sufLested that pencil yam is a complex species of two or more related t:xa with seven distinct nrorPho genetic diversity and deter' logiial typrs lmorphorypes) and, thus, taxonomic levision is nec€ssary. ID this study, we assessed accessions fiom seveD morphotyPes using 18 microsateUite (simple o mined tire geneti. structure ofa pencilyam collection of62 sequence ipeatl markers with the aim to provide information for taxonomic study. In total. 138 alleles were d€tected with a ofo.61, mean of7.6i alleles per locus. polymorphism infornation content per marker vaded betwe€n 0.06 and 0.90 with a mean while the overall gene diversity was 0.62. Bayesian clustering, principal coordilate, and neighborjoining analyses consistently revealed that these accessions are grouped into two subpopulations with differenc€ in number ofllleles, allelic richness, and genc diversity. The population structure was not related to either morphotype or geographical origin. Gene diversity of yi8ro compaEble i. Ianceolata was higherih.r. that ofwild vigaa rodiata (1.)Wilczek and wild utnbell@ta (Thunb.)Ohwi & Ohashi, withthatofwild yiSno nungo (1.)Hepper, yiSna erilis Tateishi & Ma-xted, andvigna gfandifiora lPIain)Tateishi & Maxted and lowe! than that of wild rigra o[Arhrir (Willd.]Ohwi & Ohashi. These results indicated that the taxonomy ofy. lonceolato should be v reyised and that its gene diversitywas moderate compared wirh the other viild Visno sPecies

(d, wordsj yi8no, microsatellite marker, simPle sequence rePeat, SSR.

R6sum6: yiSnd laflceolotd Benth. (Phaseoleae, Fabaceae)est une l€gumineuse fourragCre end6mique de l'Australie. Une 6tude tyPes nrorphologique antErieure a sugg€rd que y, drreoloto est une espace conPlexe comPrcnant au moins deux taxons et sept auteurs ont morphologiques distincts {morphotypes), ce qui rend nEcessaire sa r€vision taxonomique. Dans cette dtude, les y. t5 6val;6 la diversit6 g€n6rique et ddtermin6 la siructure g6n6tique d une collecion de lanceoiaia comPortant 62 accessions de sept morphotypes il'aide de 18 rnarqueurs micrositellites (dp6titionde s€queoce simple), darls Ie but d obtenir de l'information *" du t.frua" t"*onomique. Au total, 13E allales ont 4t6 d6tect6s, avec une moyenne de 7.67 alliles Par locus. Le conteDu informationnel"n du polymorphi5me par marqueur variait de 0,06 i 0.9o, avec une moyenne de 0,61, alorc que la dive$it€ g€n6tique globale 6tait ae o,eZ.I agrigation b;y6sienne,les analrses erl coordonn6es Principales et la m6thode de NJ ont rev6l6 iyrte,notiq-u"-"rrr qr. ces accessions sont groupEes en deux sous-populations qui difftr€nt sur le Plan du nombre d allales d€ I origine ti richesse attetque et de la dive6it6 g6n€iique. La structure de la population n'6tait Pas reli6e au morphotyPe ou i plus grande que celle de yigno rodidto (1.)wilczek et ylSno umbellota E g6ographique. l-adiversit6 gdndtique de v. Ior.eolats Ctait o yigad m!r8o (1. Hepper sauvage, yi8na exilisTateishi & Maxted, et Vigna & irnunu_.1Oirwi a otrastri sauvages, comparable a celle de ) de viSlo an$laris (willd.) ohwi & ohashi sauvage. ces r6sultats 87an.ilrlora lPrain)Tateishi & Maxt€d, et plus faible que celle ! indiqu"i"ni qr" i" t*onomie de y. lanse;lrro devrait €tre rCvis6e et que sa diversitd 86n6tique dtait moddrde comPlrativement o e celle d'autres esptces de viSnd sauvages. lTraduit par la Rddactionl

Moli-clis j yi8xo, marque!r microsatellite, reP6tition de s6quence simPle SSR. o lntroduction (Thunb.) ohwi and Ohashi), and cftole bean (Vi$lo relexo'piloso (Hayata)) (Smartt 1990;Tomooka et al. 2006). Some ofthese crops The genus yi8,m (Phaseoleae, Fabaceae) is a Iarge leguminous o such as cor,pea, mungbeat!, black gram and azuki bean are im_ taxon comprising seven subgenera of1o4 herbaceous sPecies dis' portant fronr an agro-economic ln addition. several ffibuted in topical and subtropical rcgions ofAfrica, Asia' America, Perspective. wild yigno species are cultivated as cover or hawested as and Australia (Lcwis et al. 2oos). Nine yiSra species are domesti- Sxound foods iIr the fol.in ofyoung leaves, flowers young cated as food crops in Asia, Afiica, and America. They include supplementary pods, seeds, and fresh tubers (Lawn and Cottrell 1988; Bambara groundnut (yignd nlbterrdnea (L.) Verdc.)' cowpea (Vigno mature Tomooka et al. 2006). These Iegumes are important sources of unSuiculara (L) Walp.). zombi Pea (vi8no vexillata (L.) A.Rich)' mung- (Ohwi) dietary protein, carbohydmte, vitamins, and minerals for people bean lvigr,a radiatn lL.) wilczek), azuki bean {yi8na an8tllorij and America. Therefore, yiSno is an important Ohwi & Ohashi), black gram {yigno murSo 1L.) Heppe!)' moth bean in Asia, Africa, \Vigno acoflitifolia (Jacq.) Mar6chal), rice bean {Vigno &rnDellota plant taxon that is ofinterest.

Reccived 3 November2014. Accepted E January2015. University, p. Nubankoh and S. pimtong. progam in Agriculrural Biotechnolory, faculty of Agriculture at Xamphaeng Saen, Kasetsart Nakhon Pathom 73140, Thailand. p. Xamphaeng Saen, Kasetsart University, r. io-t , S. n .fr.p"fc anil Srinives. Department ofAgonomy, fac'lrlty ofAgriculture at Nakhon Pathom 731,10, Thailand. corEspondlng author: Prakit Somta {e_mail: [email protected]).

Botany 93: 1E3-191 (201s) dx.doi.orS/10.1139/.jb'201'I{222 .l Prblished it M.nrcrescar.hpress.conlcjb on 31Jrnuary 201s. Botany Vol. 93, 2015

Five yignd species inctuding yryfla radiata lL.l Wilczek var. highly transferable to odrer related species ffangphatsonuuang iublobdrrl (Roxb.) Verdc. (wild mungbean), \4 vcxillou, \\gnd lafteolatLl et al. 2009). SSR markers can be detected by standard polymerase gelus Benrh. (pcncil yam or bush carrot), yiSra hrteola Uacq.) Benth. chain reaction (PCR) analysis and are easy to score. ln the (hairy pod cowpea), and yigra tnarino (Burm.) Merrill (beach cow' yi8!d, SSRS have been develoPed for azuki bean (warg et al. pea) are found in Australia. The first two species belong to the 2004; Chankaew et al. 2014), colvpea (Li et al. 2001; GuPta and subgeneE Cera[orroPis and Plectotropis, respectively, while the lat' GopalakrishrF 2O1O; Xu ct aI.2010; Kongraimun et a1.2012)' and ter thrce species belong to subSenus Vitna. Among these species, mungbean (Somta et al.2008: Seehalak et aI.2009i Somta et al. o]nly V.lanceolaLa is endemic to Australia, while tbe other four 2009i Tangphatsornruang et al. 2009). SSR markers from azuki species are indigeDous (Lawn and Watkinsolr 2002).Vignlan eolata is bean and mungbea[ showed a high rate of amplification in sev_ an important "bush tucker" food for Aborigi[es in Austmlia' eral other Vigra species (Somta et al. 2009; Tangphatsoralruang where the root is commonly eaten in the desert at present, and it et al. 2oo9; Chankaew et al. 2014). was evaluated a set of is a palatable and useful species in Pastures. Vigrra lanceolora is the ln this study, SsR polymorphism io most widely distributed Vlsna species fould throughout the 62 accessions ofV- lan.eolata. The objectives were (i) to assess the y. Australian tropics and subtropics encompassins a divemity of transfembility of SSR markers in I@nceoldta, (ii) to estimate the habitats from the foreshore to the ce[tral desert (Lawn and Ievel of genetic diversity of this species, and (iii) to determine Cottrell 1988; Lawn and Watkioson 2002). An analysis of more population structure within V. lonceolota species comPlex for fur_ thalr 400 accessions of the flve Australian wild vi8n4 species ther taxonomic study. showed that v. lanceolata is the most morphologically and ge" netically diverse species (Lawn and Watkinson 2002). SamPles Materials and methods collected frout fretd/natural habitats showed high variation in Plant materials and DNA extraction morphology and reproductive systems Annual or perennial Sixty-two accessions ofy.lotlceolotd from various Prove[ances in plants showing trailing, twining, and bush-t]?e habits with Australia were used in this study. They represented the seven rhizomes and (or) tuberous roots were found. Although many morphoo'pes of the species suggested by Lawn and Watkinson ) accessions Produced flowers only on the aboveground stems. (2002), including (i) northem pubescent, (ii) geotropic inflores' rnany othcrs are amphicarPic, and some have aerial inflores_ cence, (iii) var.fliJbrmis, (iv)central Austlalia, (v)erectbush' (vi)silver cences on plostrate stems, becominS geottopic with geocarPic leaflet, and (vii) var. lomsolata (SuPPlementaryTable SIi. su(h pods. Vigna laficeolota also Possesses useFul ldaptive traits Seeds ofeach accession were sown in an exPerimental field of IZ as early flowering and frost tolerance (Lawn alrd Holland 2003). Kasetsart University, KamPhaeng Saen Campus, Nakhon Pathom, which may be useful for crop improvement in the future. Thailand. Young leaves from a si gle plant of each accession were Three botanical vaieties have long been desdibed for V lanaedata' method described 66 collected and exEacted for DNA following the viz. vat. fliiorrnis,lanceolatd, and lotlfolia (Bentham 1854 and white by Lodhi et al. (1994)with the exceptionthat absolute ethanolwas a 1918: cited in Lawn and Watkinsolr 2002). However, results frorn used instead of95% ethanol for DNA precipitation. The DNA con- study based on morphological tlaits bv Law[ aDd Watkinson centration was determined by compariso[ with a knowD concen' having 46 (2002) suggested thal V. lanceolatu is a sPecies complex tration of tr DNA and adjusted to 2 n8 L-1 for SSR malker analysis. seven different morphoq?es (var. trtiJonnis northem pubescent ii9 form, geotropic inflorescence, silver leaflet type, centralAustnlia ssR marker analysis 9: type, robust erect type, and var. 14nceoloto). VarietyrliJomlis was Eighty SSR markers in total from azuki bean (Wang et aI 2004; reitricted to wet areas of coastal regions in the far north of Chankaew et al. 2014) and cowPea (l,i et aI 2001) wele used to Australia; var. Ionceolota occufied onty on inland l'rom [orthern anatlze DNA of five V. lonceolata accessions (ACC2O9' ACC 229, ; towestem erect bush form was ACC 248, ACC 261, and P8181) to screen for amplification and a NewsouthWales Quecnsland;the found only in the Kimberly region ofthe Westem Australia; and polymorphism. PCR amplification was performed as described by o geotropic inflorescence forrn was found only in the eastem Sonta et al. (2008) with minor nodiflcations. Briefly, the PCR & the coastal catchments in tropical queensland (Lawn and Holland mixture was prepared in a total volume oflO PL contairing4 ng of 2003). The northern pubescent, silver leaflet, and central Austra_ genomic DNA, 5 pmol each offorward and reverae Primers,lx Tdq DNA o lian forms were widely dist buted, sometimes overlaPping with buffer,2OO mmol.Li dNTPs,2 mmol L-l MgCIr, and 1U Taq each other or with orle or nrore of the other forms (Liwn and polymerase (Fermentas, Vilnius, Lithuania) The PCR cycling pro- Holland 2Oo3). The authors also noted that vegetative character- file was 94 'C for 2 min followed by 35 cycles of94 'C for 30 s. isrics of the B?e specimen ofvar.latlrolid repolted byWhite (1918) 50 or 55 "C for30 s,72'C forl min, ard the 6nalextension at72 "C showed combination attributes of two morPhotypes that they for 10 min. The PCR products were separated on 5% denatured qualitative and quantitative gels marker (Fermentas, Vilnius. o proposed. Cluster analysis based on polyacrylamide dX174 DNA/Hin, traits ofmorphological and agronomic charactels in a collection Lithuania) was used as a size standard. The PCR products were of v. lo]l,ceolato further supported the suggestion of Lawn and visualized by silver staining. In the case that a marker detected a Watkinson (2002) that y. lon.eolora is a species comPlex (Lavrn and o!.lll allele (failed to ampliry in some accessions), the marker was Holland 2003). Hyb dization among different morPhoR?es re' rearullzed to confirm the Presence ofthe null allele vealed differcnt levels ofcross comPatibility Enging liom fertile Fr hybrid plants to sterile Fl hybrid Plants to complete failurc (no Data analysis hybrid seed formed) (Bull 1987; Palmer et al. 2002). Bull (1987) Population stmcturE anal)sis was Pe omled ustuU STRUCTURE 2.3.4 studied chromosomcs offlve diffeleot morPhotJrfes ofy lonceoiota (Pritchard et al. 2007). The software aPplies a Bayesian algorithm number and found thatthey have the same chromosome number{2n = 22) for genetic clustering. The oPtimum ofclusters lsubpoP (Evilnno et al' but differ for overall size, centromere locations. alrd secondlry ulation;K)was detemrioed based on the lK method constfictions. 2005) by mnning 20 independent simulations ofthe STRUCTURE "allele_ftequency inde_ Simple sequence repeat (SSR; also krlolvn as micrcsatellite) is a using Kfrom 1 to 10 with'admixtule" and 000 replicates of DNA marker ofchoice fot molecular genetics study in Plants be- pendent'model, burn'inPeriod of10 ooo, and 50 (MCMC). the software cause of its advantages of being codominant multi'allelic, arld Markov Chain Monte Carlo Subsequently

,supplemenrary daia are available urh the anicle rhrcugh thejournal web site at hrtPr/nrcresearchpress com/doiFtrpPl/10.1139lclEzo-t4'o222

I Published bv NRC Resenrch Pre$ 1i

Nubankoh et al.

Table 1. Characteristics of18 SSR markers used in diversity analysis of 62 Vigno lanceolata accessions. Source Primer Type Sequence (5'-3') SSR repeat motif Reference Azr,rki bean CF]DGOg8 Genomic SSR F:AAAGGAG.IAGAAGGTCCATA (AG)s...(AG)e Wang et al. (2004) R :ACAAAATTGGTTGACTCACC CEDG275 Genomic SSR F: CACACTTCAAGGAACCTCAAG (AG),o Wang et al. (2004) R: GTAGGCAACCTCCATTGAAC CEDG156 Genomic SSR F: CGCGTATTGGTGACTAGGTATG (AG),a Wang et al. (2004) R: CTTAGTGTTGGGTTrcTCGTAAGG CEDG168 Genomic SSR F: CTGCTTGGTGTTGAAGCTTC (AT)r2(AG)r4 Wang et al. (2004) R: CATTCTACATTCCAGACCTCC CEDGZTO Genomic SSR F: GTGCGTCACTAGTCCATTGC (AG), Wang et al. (2004) R: GCAGAAGATTGAATCCTGGACC CEDG165 Genomic SSR F:GGATGGGAGAGTAAGAAG (AG)," Wang et al. (2004) R:GCATGGCATGATGACITG CEDG176 Genomic SSR F: GGTAACACGGGTTCAGATGCC (AG},, wang et al. (2004) R:CAAGGTGGAGGACAAGATCGG CEDG1SO Genomic SSR F:GGTATGGAGCAAAACAATC (AG),, wang et al. (2004)

R : GTG C GTGAAGTTGTCTTATC (2004) CRDG274 Genomic SSR F: CACTCACTGCAAAGAGCAAC (AG)4AA(AC)31 Wang et al. tr o R:CTACCTATCTGAGGGACAC vES00s8 Genic SSR F:TGC1TGCCTTTITCTITICC (AAC)u Chankaew et al. (2014) R: GAGCAGAGGAGATTTMGGG () Chankaew et al. (2014) VESOOTT Genic SSR F : CAAAGGCCATCCTCAACITC (64). R :TCCCGAAAACAGTTCACCTC vEs0081 Genic SSR F:TCAGCGACTCAATCAGGATG (AAC)6...(AGC)e...(AGC)7 Chankaew et al. (2014) ! (! R: GCTGGAGATGGTTCATTG GT Chankaew et al. (2014) o vES0112 Genic SSR F:TGGACAGGATGCAGAGTGAG (AAC)o q R:CCTGAAGGTGCAAAGAGCAG (2014) v VES0287 Genic SSR F:ACCTTCACTCCCTCCATTCC (AG)" Chankaew et al. R: GTGI.CCGTACATTGCTGGTG -o >\ (2014) vES0s03 Genic SSR F: CGCTITIGTAGGATTGGAACA (MG)" Chankaew et al. OO R:TGAAG GATGAGGGGAAGATG 9t> (AGC)s chankaew et al. (2014) aa vES0s46 Genic SSR F:ACCTTCCAAATCCACCATCA R: TGATCTTGAGCGATGAAACG 9= (2014) VES1268 Genic SSR F: CGGTGGCTAAAATTCTGCAT (AAG)u Chankaew et al. R:CTCGGGACTAACCGAGATGA (AAT)5. ..(TC)14(AC)3 I"i et al. (2001) U9 Cowpea vM27 Genomic SSR F : GTCCAAACCAAATGAGTCAA ()9 R: TGAATGACAATGAGGGTGC O,:- Note: F, foruard; R. reversei SSR, simple sequence rePeat.

SSRs further used to analyze the was run with K = 2, burn-in Period of 100 000, and 500 000 repli SSR). These polyrnorphic were cates of MCMC to assign individuals to each subpopulation. Analysis 62 accessions ofV. lanceolota. of molecular variance (AMOVA) was carried out using GenAlEx 6.501 'fhe number of alleles detected by the polymorphic markers dr (Peakall and Snouse 2012) to determine genetic difference be- was 138 in total. The nun'rber of alleles per loctls ranged from two o rween the two subpopulations clustered by STRUCTURI analysis. (VES0038 and VES0546) to 18 (CEDG180) with a mean of 7.67 od Gene diversity (expected heterozygosity; HE), Wright's fixation ('lhble 2). Two markers, CEDD156 and VM27, detected null allele(s) index (F;.) and allelic richness (A*) of each subPopulation as iden- in which they failed to ampliry five and one accessions, resPec- o tifled by STRUCTURE analysis were calculated using FSTAT 2.9'3.2 tively. PIC values varied from 0.06 (VES0038) to 0.90 (VM27) with a L] (Gouclet 2002). !'rs was then en'lployed to calculate outcrossing rate mean of 0.61 (Tablc 2). Eight SSR markers had a PIC value higher (t) using the equation t = (1 - Frr)/(l + I\r) (weir 1996). Polymorphism than 0.70 and two rnarkers (VES0038 and CEDG176) had a PIC d (PIC) each marker was calculated as per o information content of value less than 0.30. Allelic richness values varied from 2.00 ca Anclerson et al. (1993). Hardy-Weinberg equilibrium of each marker (V8S0038) to 77 .72 (CEDG180) with a mean of 7.62 (Table 2). Seven was tested by chisquare analysis using PowerMarker 3.25 (Liu and SSR primers had allelic richness more than 8.0 (Table 2). Gener- Muse 2005) Nei's genetic distance (D") (Nei et al. 1983) among ally, genomic SSRs showed a higher number of alleles, PIC, and individuals was determined using POPUI"\TIONS 1'2.28 (tangella allelic richness than genic SSRs. All the markers excePt VES0112 2002). Dn rnatrix was then subjected to principal coordinate analy- deviated fiom the Hardy-Weinberg equilibrlum ('table 2). The sis (PCoA) to reveal the relationship among different accessiol'ts mean value for fixation index FsT was 0.125 (Table 2), indicating a using PAST 3.0 (l{ammer et al. 2001), and also used for neighbor- mocterate genetic differentiation within the 62 accessions of relation- joining analysis to construct a phylogenic tree depicting V. vexillata. ships among the accessions using MEGA6 (Tamura et al. 2013). Population structure Results Based on the ad hoc AK method of Evanno et aI. (2005) (Supple- lanceolatawere delineated SSR polymorphism mentary Fig. S11), the 62 accessions ofV. (Fig. 1; see also Supplementary Ofthe 80 SSR rnarkers screened in five accessions ofV. lanceolatn, into tlvo subpopulations, I and II 29 (36.25%l were able to ampli$r DNA of the species. Among the Table S11). Subpopulation I comprised 19 accessions, ofwhich nine amplifiable markers, 18 (62.07%l showed polymorphism (Table 1). were northern pubescent, three were silver leaflet, one was cen- Seventeen of them were from azuki bean (nine genomic and tral Australia, one was var. filiformis, one was var. lanceolata, and acces- eight genic SSRs), while one of them was from cowpea (genomic four were unknown type. Subpopulation II consisted of43

I Published by NRC Research Press tsotanY Vol. 93, 2015

Table 2. Numb€r ofalleles (NJ. polymoUrhic informatioo cont€nt (PlC), and allelic richness per locus of18 SSR markers amPlif€d in 62 Vigna lanceolata accessions, and in each subPoPulations (SPl and SPII) ss clustered by STRUCTURE analysis.

NA Allelic Iichness

x'? for H-W Overall Overall SPI equilibrium test (P) Fe

tEs0038 2 1 2 0.06 0.00 0.09 2.00 1.00 r.80 62.00 (P < 0.0001i -0.004 vEs0077 4 3 4 0.58 0.48 0.62 4.00 3.00 3.96 94.06 (P < 0.0001) -0.008 vEs0081 4 3 0.5s 0.51 0.s6 4.00 z-94 3.74 163.23 (P < 0.0001) -0.030 vEs0112 6 4 6 0.33 0.43 0.27 5.91 3.87 3.99 3.83 (P = 0.9982) 0.026 \ES0287 7 4 7 o.76 0.64 0.79 6.99 3.94 6.33 352.0s (P < O.OO01) 0.011 1850503 3 2 3 o.49 0.43 0-s1 3.00 2.00 2.94 101.45 (P< 0.0001) 4.027 vIs0546 2 z 2 0.49 0.50 0-49 2.OO 2.00 z.oo 52.00 (P < 0.0001) -0.033 vEsl268 6 5 o.47 0.46 0.45 5.99 3.92 3.90 29s.72lP

.l Published by NRC R€search Pr€ss a a

Nubukoh et al. 187

Table 3. Number of accessions, number of alleles (No), observed heterozygosity (H.), gene diversity (HL), fixation index (Frs)' and esti- mated outcrossing rate (t) in subpopulations ofV. lanceolata. The sub- populations were ctustered by STRUCTURE analysis. o6 tn No. of 6 Subpopulation accessions N^ Ho HE F,. (P) t (%l oA s8 0.0s0 0.422 O.A83(<0.0001) 6.23 6k I 19 ! il 43 136 0.084 0.625 0.86s (<0.0001) 7.12 &q Overall 62 138 0.074 0.622 0.881 6.32 l F .j 9 o Teble 4. Analysis of molecular variance of the tlvo Yigna lanceolata as clustered by STRUCTURE analysis. ia subpopulations 6 Ilstimated (! df MS variance % Total F statistics nE ,g 6.e Between subpopulations 7 67.049 1.088 17.36 fsr' = 0'174* Irs 0'872"' c.r Among individuals 60 9.700 4.519 72.09 = od = within subpopulations oqtrE Within individuals 62 0.661 0.661 10.ss Fn = 0.895"' Total 123 6.629 100 ^0 au Note: *, statistical significance at P < o oo1. MS, mean square; SOV, source of UEau variation. JU genic (markers with prefix VES-) (PIC 0'a7). InVigna LO SSR markers = species, genic SSR markers, which are developed from sequences ;jd a'aok of genes, are less Polymorphic than genomic SSRs, which are 6- sequences that may not include genes (Solnta *o developed from et al. 2009). -oi\ y .H Genetic structure of V. lanceolata 9vEE Two previous studies using phenoryPic traits showed that aO : b1 seven morphoq?e .i' 6 V. lanceolata is a complex species having distinct Lawn and Holland 2003). Lawn *1 groups (Lrwn tnd Watkinson 2002; tX @ 96 d and Holl.rnd (2003) demonstrated that the germplasm from seven Ur!2 norphotypes was clearly separated into two major clusters; one q-u9 utr geotropic OL \1dl consisted ofaccessions from northern pubescent, inflo- while the other was composed of ac- EEF3,9 V rescence, and var. f liformis, E)A cessions from central Australia, erect bush, silver leaflet, and var. =>r >n l'hl6 lanceolata. In the current study, Bayesian clustering, neighbor- >o vld joining tree, and PCoA plotting based on SSR allelic data consis- Ianceolata comprises two genetic clusters 11.55 tently showed that V. -!olr o contrasting in level ofgenetic diversity; each cluster is a mixture H vbl a of different morphotype groups. In contrast to the results of l,awlr qqv! vd and Holland (2003), our clusters did not confirn a clear and close genetic relationship among northern Pubescent, geotroPic in- florescence, and var. filifurmis, or among central Australia, erect }E In addition, accessions in ns9E bush, silver leaflet, and var.lanceolata. northern pubescent were largely differentiated from those in the :bo other morphotypes (Fig. 2d), and var. Ianceolata is a genetically :>vL homogeneous morphotype showing close genetic relationshiP cQo (Figs. 2n, 2d, and 2e). Moreover, rwo o with several morphotyPes showed high genetic o accessions of var..flifornris used in this srudy associated with the 6 divergence to each other; one was closely a closely related qU northern pubescent form, whereas the other was 6 var. lanceolato (Fig.zel. The contrasting results are possibly N with \D due to the fact that some traits used by lawn and Watkinson I (2002) and Lawu and Holland (2003) to characterize the seven U E morphotypes were morphological and adaPtive traits such as pu- bescence on leafand stem, days to flowering, width and length of 7a and seed yield' qa leafand pod, number ofpods and seeds, seed mass, not suitable oo which were measured as quantitative traits and thus fbr use in classiffing genetic structure of V. lanceolcrta. Nonethe- less, the two genetic clusters detected in the current study suggest thatV.lanceolata is a complex species comprising two closely re- o lated taxa or a single species with two different genePools/ FE.0 o .,U population structures; the two taxa/genepools/populations may b0E be related largely to the northern pubescent and var. lanceolata

{ Published by NRC Research Press Botany Vol. 93. 201s

Fig. 2. Twcdim€nsional plot (PCl vs. PC2) from principal coordinate analysis (PCoA) based on Nei s g€netic distance lD^) amorg 62 accessions of Vigna lonceolata. SPI and SPII in a are accessions ilr subpopulation I and ll clustered by STRUCTURE alalysis, respectively. Accessions ofsi]ver leiflet, var. Ianceolaio, nolthern pub€sc€nt, and unknowD morphotypes are shown in D, c, d, and, respectively, whereas those from the other morphotypes are shown in e. CA, c€ntral Australia: GI, geotropic inflorescence. a) b) I 0.4 0.3 I I 0.3 i of 1l . SPI a 0.2 0.2 t r SPII Silvcr ^^^lll o' s leafler 0.1 a 6 o.r q aa a^ l .t i a 0.0 ^ 0.0 a r.l[ aa ll 'ta a \) -0.10.1 A^A A ., .t' Qn, -0.2 I o -0.2 aaa a -0.3 -0.1

-0.4 -0.4 -0.3 -0.2 -0.1 0.0 0.1 0.2 0.3 O,J -0.1 0.0 0r 0.2 0.3 0.4 ) PCI = 22,02o/o PCI = 22.02"h c) d) 0.4 0.4

0.3 0.1 a Northcm 0.2 0.2 I a pubescent 0.t I 0.1 a , 0.0 0.0 I I I ,0.0.1 tt U -0.t .! o' Yt! -0.2 t -0.2 a ltt I -01 -0.3 a E -0.4 -0.1 -0.2 -0.r 0.0 0.r 0.1 0.1 04 -0 I 0.0 0.r 0.2 0.1 PCI = 22.02oh PCI = 22.02oh e) t) 0.4 0.1 B 0.1 0.3 x A Unknown 0.2 0.2 l CA l o.r a .GI 0.1 q; a x Erecl bush .l : 00 0.0 I x pn' -0.t x

-0.2 -0.2

-0.1 -0.3

-04 -0.4 -0I -0.2 ,0.1 0.0 0. r 0.1 0.:i 0.4 -0 I 0.0 0l 02 0.1 04 PCr = 22.02yo PCI :22.020/.

I Published by NRC Resea'rh Press Fi8. 3. A neighbor-joi[ing tree of 62 accessions of V. ldnreoialo based on Nei's genetic distance (D^) among 62 access ions of Vigna lanceolata. Circles and triangles reprcsent accessions in subpopulatlons I and ll clustered by STRUCTURE analysis, respectively.

""*

I '.$ s V i-s, rs) ? c }'! u\o

vlt4s a vipr a D ! ^\ll '

\0152 a v 'J$r$ ' ..',' // ,l'- . a- a, , -.tt a.)t'

f, % : &u" , t "t* I t $' v B 4< a>> a &- si.. 2a V E ;,;7 ,

'0u5' o

a = Subpopulation I o e : Subpopulation II

Table 5. Comparison ofnumberofalleles (N^), gene diveEity (HL), and estimated outcrossing rate (t) between ViSra lan.eoiatd (subSenus yignaland some wild yiSra species in the subgenus Cer4totToPis. No, ofaccessions No. ofSSR N^ (mean species or sanrples loci analyz€d per locus) H! I l%l Reference V,lonceolaLa 62 10 104 (10.4) 0.7s 4.4 This study Y. dngu,orB var. aipponensir 68 13 245 (18.8s) 0.86 3.2 xu er al. (2008) V. erilit 1O7 22 19319.31 o.7z 1.5 Kaewwongwal et al. (2013) V.grandiflotu 85 22 219 \70.41 0.76 13.3 (aewwongwal et al. (2013) Y. mungo vai. silvestris 14 22 115 \5.2) O.?5 4.4 Kaewwolgwal et al. (2014) V. radioto vat. sublobata 189 19 257 {13.5) 0.63 0.8 Sangiri et al. {2007) v. lmbellarQ (wild) 84 13 12919.9) 0.68 20.6 Tian er rl. (2013) Note: SSR, simple s€queDce r€peat.

a Published hv NRC Reserr.h l.ess 190 Botany Vol. 93, 2015

morphog?es. In Vi8na, two or more diflelent genepools within plasm used in this study. This research was supported by the 2015 thc same species have been reported for wild mungbean {inland Resealch !u[d from the Department of A$onomy, ]'aculty of Asia, eastem Aushonesia, and westem Austronesia; Sangsiri 2oo9), Agriculture at Kamphaeng Sean, Kasetsart University, Thailand. cowpea (West Africa and East Aftica: Huynh et al. 2013), and cul- tlvated zombi pea (Africa and Asia; Danrayanti et al- 2010). The References genetic structures rcported in these yigro species werc associated Anderson,Ja., churchiu, G.,A., Autrique, J.E., Trnkstey, s.D.. and sorr€lls, M.E. with their geogmphical differences. However. in this study, the 1993. Optimizingpa.eDtal selection for genetic ljnkagt maPs. Cenome, 36(1): '181-186. doi:'10. 1139/g93{24. PMID:1a469981- genetic stlucturc of62 accessions ofV, Ianaeolatd showed no asso BuU, .l-K- 1987. Genetic inter-relationships between morphotyPes of viSro ciation with geographical distribution (Supplementary Fi8. s2I). lon.€olato Benth. B-A8r.Sci. th€sis, University of Queensland. Australia. Additional studies, especially field observation ofnatural habitats Chaitieng,8., Kaga, A..Tomooka, N.,ls€mua,T., Kuroda. Y., andVaughan, D.A. in combination with molecular genetics using chloroplast or mi_ 2006. Development ofa black Sran lviana mlnSo (1.) Hepperl linkage maP and comparison an euki bean an8lions (Willd.) Ohwi a.d give its wth lviSra tocluondrial DNA markers or sequences, may additional in_ ohashil linkaSe map. Theor. Appl. Cenet. 113: 1261-1269. doir0.l007/s00122' sight into the genetic structure ofy. Ianceoiata. 006-038G5- PMID:16932883. Chrnkaew, S., lsemura. T., tsobe, S., Xaga, A., Tomooka, N., Somta, P.. Comparison ofgene diversity between y. lonceolota and HiEkawa. H., Shirasaw4 K-, Vaushan, D.4., and Srinives. P.2014. D€te.tion other wild Yigno species of gerome donor species of neglected tenaPloid crop viEna rclexo'frloso (.raol€ bean) and geneti. stru.turc ofdiploid sP{ies based on newly d€v.} gene SSR In this study, diversity ofV. Ianceolok calculated llom oped EST.ssR markers fmm azuki bean (Vlflo an8lrlaris). PLoS ONE doi:10. allelic data was 0.62, indicating a modemte Senetic diveNity of 1371Journnl.pone.0l04990. this wild Vigfl.r species. Comprehensive genetic analyses of wild Damayanti, !., Lawn, RJ.. and Bi€lia, L.M. 2010 Geneti. .omPatibiliry amo^g o genetic resources of Vigxo species using SSR markers wele re_ domesricated and wild accessions of the trcpical tuberous legume vian4 veri[dr4 {t.),4" Rich. crop Pasture sci. 61: 78s-797. doi:10.1071/CP10060. ported in V. onguloris (Xu et al. 2008), V. rodiora (Sangiri ct al. 2007), G-. S., lnd Goudet,J.2oos. Detecting the numD€rofclustert of y. [e.nno. Regmut, umlreliot flian et aI. 2013), V rarngo (Kaewwongwal et al.. in Press), individuals nsing the software STRUCTURE: a simulation study. Mol Ecol. 14: y. exiirJ ((aewwongwal et al. 2013), and v grdfidirora (KaewwoDtwal 26 -2620, doi: 10.1111I.1365-294X.?005.02553 x. PMID:15969739. et al.2ol3).All ofthese speciesbelongto the subgelus Cerdrolropis, C,oudet, J. 2002. lS'I T: a pro$am to estimate alrd test gene diversitics and D from www2 unil..hiPopsen/softwares/fstat.htnr while y. Icnceoloto belongs to the subgenus yigrld of the same fixation indices. Available laccess€d 22 Miy 20141. genus. SSR data ofV. la,lceolata with those We compared dive$ity Gupta, S.X., and Gopalakdshnr, T. 20lo. Development ofunigenMerived SSR ofwild Vignd species, although different SSR markersand Dumber markers in cowpea (Vi8:ri" !ng!,.rldto) and their transferabitiry to other vi8nd wele used (T.1ble 5). Again, as in the case ofnumber ofalleles we sp€.i€s. G€nome, 53(7): s08-523. doi:10.1139/G1G028 PM!D:20616873. statistjcs calculated gene divels ity of y. Idn ceolora using 10 genomic SSRS for Hammer, O., HeA€r, D.A.T., ind Ryan, P.D.2OO1. PAST: Paleontolo8lcal package for €ducatjon and data ana\4is. Palaeontol Electrcn. 4i 1-9. th€ comparison. Gene divcrsity of V. lanceoloto ntas comparable software Huynh, B.-1... Close, TJ., Roberts, P.4.. Ilu, 2., Wenamaker. S, Lucas, M R y. and 55 with that ofwild mlrngo, V. exilis, and V.grafidllor.r, slightly Chiulele. R., Ciss€, N.. David, A., Hearne, S, Fatokun, C., l)ioP, N.N.. and y. y. higher tharl that of wild rodidlo and wild llmbellota, but less Ehlers, J.D. 2013. CeDep and the genetic architectur€ ofdomesticated cow_ than that ofwild V. olrSlldns. These results indicated that level of pea- Plant Cenom€. doil0.383slplanigenome2013 03.0005. P 2013 gene diversity ofy. lonceoloto is sirflar to that ofthe other yigno Kaewvongw.l, A., Jetsadu, A., somta, P., chankaew, s., and srinives. {6 cenetia diverlity and population structuft oivigno orilis andyiFna {andiJlora sPecies. (Phaseol€ae, Iabaceae) from Thaila nd based o,t microsat€llite va.iation Boa A diveNity study based on molphological tmits revealed that y, 91(10): 6s3-661. doil0.1r39/cjb"2013{029. V. Idflaeolato is the most genetically diverse wild yiSxa species irr Kaewongwal. A.. Xongirimun. A., somta, P., Chankaew, S., Yimram, T., .nd 6,? P. press. Cen€tic diversity of tbe black m/"to (1.) Australia {Lawn and watkinson 2002). ln the diversity analysis srinives. ln sram lvEia Hepper! sen€pool as revealed by SSR mukers. Breed. sci. based on SSR markers, Sangid et al. (2007) reported that gene Kongjaimun,,4., xaga. A., Tomooka. N-. somta, P., Shimizu, T, Shu Y. lsemura, T., t is 59. , diversity of wild mungbean in Australia 1126 accessioDs) 0 V;ughan, D.A., and Srinives, P. 2012. An SsR-based linkage map of yardlone ThereFore, level ofgene diversity of y. Idnceoldtd (0-75; Tible 4) is beanlviSra ungli.l]ldtd (L) Walp- subsp. un8lielok Sesquipedrlis Croup) and E hiSher than that ofwild y. radiota ftom Australia, although these qTL rna\^is of pod len8Ih. Genome, ssl2): 8l-92. doit0.11s9/911_078. PMID: two specics commonly co+xist in several habitats in Austlalil 22242703- Xumar, P.S.. tiwn, R..J., and Bielig, L.M. 2012. Comparative studies on reproduc_ (Lnwn ind Watkinson 2002). tive structures in fouramphicarpic troPical lhrteolcae l€8uDes. Crop Pasture 'Ihe estimated outcrossing ftte tn v. lonceolota is compaEble Sci. 63: s70-s81. doi:10.I071lCP122'13. \rith that ofwild y. mungo, but lowerthan that ofwild V. lrnbellol4, Langella, O.2002. Populationsra ftee population genelic software. Version12.31- orsi -trvphon/populations and v. gandiflon, and higher than that of wild v. rodiota. wild Available from httpii&ioinrbrmitics laccessed ; 12 May 20141. and y. erilis (Table 4i. Based on sSR allelic data, sangiri o V. dng!laris, kM, RJ., and Cottrell, A. 1988. Wild mungb€an and its relalives ir Australia. et irl. (2007) reported that the estimated outcrossing rate of wild Biologist, 35: 267-273. v. ra(liota i\ Australia is only 0.4%. The outcrossing rate in t wn, RJ., and Hollrnd, A.E. 2003. V iation in the viSno laa.eohto Benth. coft Au!t.J. Bot. 5r: y. Ionceoldto is expected to be low because y. Ianceolota has cleis' pLex for traits oftaxoDomic adaptive or agronomic interest. ?95-306. doir0.107{810210s. c0 togamous flowers (Kunlxr rt al. 2012), in which Pollen shedding yisno bwn, RJ., and Watkinson. A.R. 2OO2- Habitats, morPhological diversitv, end occurs before flowets open, and is thus self'PollinatinS. distdbution of the genus 14874 Savi in Australia. Aust. J. Ag c. Res. s3l Idllceoldto also shows anphicaryic fruiti[g habit (producing both 13Os-1316. doi:10.107r/AR0206s. aerial and subteranean flowers and seeds) (Lawn and Watl

.l Published by NRc Reseirch Press Nubankoh et al. 191

Peakall, R., and Smouse, P.E. 2012. GenAlEx 6.5: genetic analysis in Excel. Popu- 2009. Characterization of micosatellites and gene contents from genome latioD genetic software for teaching and research-an update. BioiDfomatics, shotgun sequences of mungbean (ViSnaradiato(L.lWilczek). BMC Plant Biol. 2a: 2537 -2539. doi: 10. r093/bioillbnnatics/bts46o. 9: 137. doi:10.1185 17477-2 229-9:137, PMID:19930676. Pdtchard, J.K., Wen, X., and lhlush, D. 2007. Documentation for structure soft- Tian, J., Isemura, T., Kaga, A., Vaughan, D.A., and Tomooka, N. 2013. Genetic ware. Version 2.2. Availabte from http:/ipritchbsduchicagoedu/sofrware/ diveNity ofthe rice bem (Vigrs unDellata) genepool as assessed by SSR mark- structur€22/readrne.pdf [accessed 28 April 2014]. ers. Genome, 56(12],: 777-727. doi:10.1139/g€n-2013{118, PMID:24433207. Sangiri, C., Kaga, A., Tomooka, N., Vaughan, D.A., and Srinives, P. 2007. Genetic Tomooka, N., Kaga, A., and vaughan, D.A. 2006. The Asian Vi8na (yigna subgenus diversityofthe mungbean (yigna rddiota, lf,guminosae) gencpool on the basis Ceratntropk) biodiversity and evolurion. In Plant genome: biodiversity and of microsatellite analysis. Aust. J. Bot. 55: 837-847. doi:10.1071/BT07105. evolution. Vol. 1, part C: Phanercgrams (Angiospems Dicotyledons). Edired by Sangsiri, C. 2009. Genetic diversity of the mungbean {vigna rodiata, Legumino- A.K. Shanna md S. Shanna. Science Publishers, New Jersey. pp. 87-726- sae) genepml based on microsatellite analysis. Ph.D. thesis, Kasetsart Univer- Vanhney, R.K., Graner, A., and Somells, M.E. 2005. Genic microsatellite markers sity, Thailand. in plants: features and applications. Trends Biotechnol. 23: 4E-55. doi:10.1016/ Seehalak, W., Somta, P., Somnranas, w., and Srinivcs, P. 2009. Microsatellite j.tibtech.2oo4.11.oo5. PMID:15629858. markers for mungbean developed from sequence database. Mol. Ecol. Re Wang, X.W., Kaga,4., Tomooka, N., and Vaughan, D.A. 2004. The develoPment sour. 9: 862-864. doi:10.1111ij.17554998.2009.026s5.x. PMID:21564770. ofSSR marker by a trew method in plants and their application to gene flow Smartt, J. 1990. Grain legumes - evolution and genetic resources. Cambridge studies in azuki bean lvigna angtloris WiUd) Ohwi & Ohashil. Theor. APPI. UniveKity Press, Cambridge, U.K. Genet. 109: 352-360. doi:10.1002sO0122-004-1634-8. PMID:15014881. Somta, P., Musch, W., Kongsmrai,8., Chmprure, S., Nakasathien, S., Toojinda, T., Weir, B.S. 1996. Genetic data analysis II: Methods for discrete poPulation genetic Somjjapinun, W., Seehalak, W., Tragoonrung, S., md Srinives, P. 2008. New data. Sinauer Assmiates, Sunderland, Mass. rnicrosatellite markeN isolated fiom mungbean (Vigta radiota (L.) Wilczek). White, C.T. 1918. On a peculiar subtemanean fialiting habit of Vigna latceolqta Mol. Ecol. Resour. 8: 1155-1.157. doi:lo.1l11r.U55{998.2008.02219.x. PMID: Roxb. with a description of a new variety. Qld. Agric. l.10: 47-44. 21586000. Xu, H.X., Jing, T., Tomooka, N., Kaga, A., Is€mura, T., and Vaughan, D.A. 2008. Sonrta, P., Seehalak, W., and Srinives, P. 2009. Development, characterization Genetic diversity of the azuki bean (Vigna angularis (Willd) Ohwi & Ohashi) genic gene SSR 5ll9l: 728-738. doi:10.1139/ o and cross-species amplif,cation of lnungbean lvigru radistol microsat- pool as assessed by markers. Genome, ellite markers. Conseru. Genet. lO:1939-1943. doi:10.10071s10592{09-986Gx. G0E{58. PMID:18772951. Tamura, K., Stecher, G., Peterson, D., Filipski, A., and Kumar, S. 2013. MEGA6: Xu, P., Wu, X., Wang, B., Liu, Y., qin, D., Ehlers, J.D., Close, TJ., Hu, T., Lu, Z.' molecular evolutionary genetics analysis version 6.0. Mol. Biol. Evol. 30: and Li, G. 2010. Development and polymorphism of ViSIu ungulcliata ssp. C) 2725 -2729. doi: lo.l093imolbevtnst 197. PMLD :24132722. unruiillata microsatellite markers used for phylogenetic analysis in aspara- Tangphatsornruang, S., Somta, P., Uthaipaisanwong, P., Chanprasert, J., gus bean (yi8ra un$rifllala ssp. sesguipedalis (L.) Verdc.). Mol. Breed. 25: 675- D Sangsrakm, D., Seehalak, W, Sommanas, W., Tragoonrung, S., and Srinives, P. 684. doi:10.1007/s 11032-009-9364-x. L (6 o v -o i\ oo 9 o.> qa !)- *o U9 o! t B

E ,ir o (!

> A x a

{ Published by NRC Research Press