Activity of Antioxidants from Crocus Sativus L. Petals: Potential Preventive Eﬀects Towards Cardiovascular System

Article Activity of Antioxidants from Crocus sativus L. Petals: Potential Preventive Eﬀects towards Cardiovascular System

1, 2, 3, 4 Keti Zeka † , Pasquale Marrazzo † , Matteo Micucci * , Ketan C. Ruparelia , Randolph R. J. Arroo 4 , Guido Macchiarelli 5 , Stefania Annarita Nottola 6, Maria Adelaide Continenza 5, Alberto Chiarini 3, Cristina Angeloni 7 , Silvana Hrelia 2 and Roberta Budriesi 3 1 Department of Haematology, Cambridge Biomedical Campus, University of Cambridge, Long Road, Cambridge CB2 0PT, UK; [email protected] 2 Department for Life Quality Studies, Alma Mater Studiorum-University of Bologna, Corso d’Augusto 237, 47921 Rimini, Italy; [email protected] (P.M.); [email protected] (S.H.) 3 Nutraceutical Lab, Department of Pharmacy and Biotechnology, Alma Mater Studiorum, University of Bologna, Via Belmeloro 6, 40126 Bologna, Italy; [email protected] (A.C.); [email protected] (R.B.) 4 Leicester School of Pharmacy, Faculty of Health and Life Sciences, De Montfort University, The Gateway, Leicester LE1 9BH, UK; [email protected] (K.C.R.); [email protected] (R.R.J.A.) 5 Department of Life, Health and Environmental Sciences, University of L’Aquila, Via Vetoio, Coppito 2, 67100 L’Aquila, Italy; [email protected] (G.M.); [email protected] (M.A.C.) 6 Department of Anatomy, Histology, Forensic Medicine and Orthopaedics, La Sapienza University of Rome, 00161 Rome, Italy; [email protected] 7 School of Pharmacy, University of Camerino, Via Madonna delle Carceri 9, 62032 Camerino (MC), Italy; [email protected] * Correspondence: [email protected] These authors contributed equally to this work. † Received: 3 September 2020; Accepted: 6 November 2020; Published: 9 November 2020

Abstract: The petals of the saffron crocus (Crocus sativus L.) are considered a waste material in saffron production, but may be a sustainable source of natural biologically active substances of nutraceutical interest. The aim of this work was to study the cardiovascular effects of kaempferol and crocin extracted from saffron petals. The antiarrhythmic, inotropic, and chronotropic effects of saffron petal extract (SPE), kaempferol, and crocin were evaluated through in vitro biological assays. The antioxidant activity of kaempferol and crocin was investigated through the 20,70-dichlorodihydrofluorescein diacetate (DCFH-DA) assay using rat cardiomyoblast cell line H9c2. The MTT assay was applied to assess the effects of kaempferol and crocin on cell viability. SPE showed weak negative inotropic and chronotropic intrinsic activities but a significant intrinsic activity on smooth muscle with a potency on the ileum greater than on the aorta: EC50 = 0.66 mg/mL versus EC50 = 1.45 mg/mL. Kaempferol and crocin showed a selective negative inotropic activity. In addition, kaempferol decreased the contraction induced by KCl (80 mM) in guinea pig aortic and ileal strips, while crocin had no effect. Furthermore, following oxidative stress, both crocin and kaempferol decreased intracellular ROS formation and increased cell viability in a concentration-dependent manner. The results indicate that SPE, a by-product of saffron cultivation, may represent a good source of phytochemicals with a potential application in the prevention of cardiovascular diseases.

Keywords: cardiovascular prevention; nutraceuticals; crocin; Crocus sativus L. petals; kaempferol; by-products

Antioxidants 2020, 9, 1102; doi:10.3390/antiox9111102 www.mdpi.com/journal/antioxidants Antioxidants 2020, 9, 1102 2 of 18

Antioxidants 2020, 9, x FOR PEER REVIEW 2 of 19 1. Introduction 1. Introduction For centuries, plants have represented the main tools for the treatment of human diseases. In theFor modern centuries, era, plants phytochemistry have represented and pharmaceutical the main tools for approaches the treatment were of human applied diseases. to investigate In the themodern mechanisms era, phytochemistry of action and and the pharmaceutical chemical composition approaches of plants were usedapplied in folkto investigate medicine the [1,2 ]. mechanisms of action and the chemical composition of plants used in folk medicine [1,2]. The The pharmaceutical value of plant extracts may be due to the synergy of the phytochemicals present pharmaceutical value of plant extracts may be due to the synergy of the phytochemicals present in in them, even if, rarely, the affection of specific functions may be ascribed to isolated molecules. them, even if, rarely, the affection of specific functions may be ascribed to isolated molecules. Phytochemicals are non-nutrients compounds normally found in plants used as food or as components Phytochemicals are non-nutrients compounds normally found in plants used as food or as of food supplements, able to exert several biological effects which potentially result in the modulation components of food supplements, able to exert several biological effects which potentially result in of several parameters related to human health [3]. the modulation of several parameters related to human health [3]. Cardiovascular diseases (CVDs) are considered a major cause of mortality worldwide. According to Cardiovascular diseases (CVDs) are considered a major cause of mortality worldwide. the World Health Organization (WHO), 17.9 million people were estimated to die from CVDs in According to the World Health Organization (WHO), 17.9 million people were estimated to die from 2017,CVDs representing in 2017, representing 31% of all global31% of deathsall global [4]. deaths Of this [4]. mortality, Of this anmortality, estimated an 7.4estimated million 7.4 were million due to coronarywere due heart to coronary disease andheart 6.7 disease million and to stroke.6.7 million In the to age stroke. of genomics, In the age nanotechnology, of genomics, nanotechnology, and proteomics, CVDsand proteomics, continue to CVDs be a majorcontinue challenge to be a major and development challenge and of development a viable evidence-based of a viable evidence-based way to prevent theway onset to prevent of CVDs the continues onset of CVDs to attract continues the attention to attract of the researchers. attention of researchers. SeveralSeveral compounds compounds havehave beenbeen shown to exert biolog biologicalical actions actions that that may may result result in in a adecrease decrease of of cardiovascularcardiovascular diseasesdiseases [[5,6].5,6]. ForFor example, flavonoids flavonoids can can improve improve cardiovascular cardiovascular health health through through severalseveral mechanisms mechanisms including including the the antioxidant antioxidant effect, effect, the hypocholesterolemic the hypocholesterolemic and antidiabetic and antidiabetic activities, theactivities, antiatherosclerotic the antiatherosclerotic and vasorelaxant and vasorelaxant properties [7properties,8]. Similarly, [7,8]. carotenoids Similarly, carotenoids such as crocin, such lutein, as zeaxanthincrocin, lutein, exert zeaxanthin biological exert actions biological that may actions determine that may a plethora determine of cardiovascular a plethora of benefitscardiovascular [9,10]. benefitsSome [9,10]. spices and vegetal extracts exert antioxidant [9] and hypocholesterolemic effects [11,12]. SaffronSome (Crocus spices sativus and vegetalL.) is one extracts of the exert most antioxid popularant spices [9] and [13 ].hypocholesterolemic It is commonly used effects in regions [11,12]. of EuropeSaffron such (Crocus as Italy, sativus Spain, L.) is and one Greece, of the andmost in popular Asian regions spices [13]. of the It world,is commonly such as used Iran in and regions India [of14 ]. Briefly,Europe sa suchffron as is aItaly, spice Spain, derived and from Greece, the flowerand in ofAsianCrocus regions sativus of Lthe (Iridaceae). world, such Each as flowerIran and has India three stigmas,[14]. Briefly, which saffron are dried is a spice and usedderived in cookingfrom the as flower a seasoning of Crocus and sativus as a coloringL (Iridaceae). agent. Each They flower contain has a carotenoidthree stigmas, dye, which crocin, are which dried gives and foodused a in rich cooking golden-yellow as a seasoning hue [7 and,15,16 as]. a Sa coloringffron consumption agent. They is showncontain to a correlate carotenoid with dye, higher crocin, High which Density gives Lipoproteins food a rich (HDL) golden-yellow and lower triglycerideshue [7,15,16]. levels Saffron [17 ]. Moreover,consumption administration is shown ofto 15correlate mg of sa withffron capsuleshigher High to diabetic Density patients Lipoproteins for a 3 month (HDL) period and resultedlower intriglycerides a significant levels decrease [17]. ofMoreover, fasting plasma administration glucose, of cholesterol, 15 mg of saffron Low Density capsules Lipoproteins to diabetic patients (LDL-c), andfor LDLa 3 month/HDL ratioperiod in resulted comparison in a tosignificant the placebo decrease [18]. of fasting plasma glucose, cholesterol, Low DensityTo date, Lipoproteins well over (LDL-c), 6500 and publications LDL/HDL listed ratio in in comparison the PubMed to the Central placebo database [18]. demonstrate the potentialTo date, useswell over of sa 6500ffron publications extracts as listed adjuvant in the in PubMed anti-cancer, Central anti-diabetic, database demonstrate anti-depressant, the andpotential anti-inflammatory uses of saffron treatment. extracts as Ouradjuvant group in hasanti-cancer, shown theanti-diabetic, presence anti-depressant, of substantial amounts and anti- of kaempferolinflammatory and treatment. crocin (Figure Our1 )grou in sapff hasron shown petals [the15,16 presence] which of make substantial up the bulk amounts of the of flowers, kaempferol but are currentlyand crocin considered (Figure 1) ain waste saffron material. petals [15,16] which make up the bulk of the flowers, but are currently considered a waste material.

FigureFigure 1.1. Chemical structures of of kaempferol kaempferol and and crocin. crocin.

KaempferolKaempferol is is one one ofof thethe mainmain flavonolsflavonols of the the sa saffronffron spice spice and and has has protective protective properties properties against against lipidlipid oxidation, oxidation, which which contributescontributes toto the onset and and progression progression of of atheroscle atherosclerosisrosis and and cardiovascular cardiovascular diseasesdiseases [7[7,8].,8]. OriginallyOriginally derived from the carotenoid crocetin, crocetin, crocins crocins have have a acommon common structural structural feature of digentiobiose esters [19]. Crocin contributes to the bitter taste of saffron and to its characteristic yellowish color [20,21]. Antioxidants 2020, 9, 1102 3 of 18 feature of digentiobiose O-glycosyls [19]. Crocin contributes to the bitter taste of saffron and to its characteristic yellowish color [20,21]. In this work, we aim to investigate the cardiovascular effects of saffron petal extract (SPE) and its main components kaempferol, crocin and the effects these compounds have on the oxidative state of rat cardiomyoblast cell line H9C2.

2. Materials and Methods

2.1. Chemistry

20,70-dichlorodihydroﬂuorescein diacetate (DCFH-DA), 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl- tetrazolium bromide (MTT), Dulbecco’s modiﬁed Eagle’s medium (DMEM), fetal bovine serum (FBS), penicillin/streptomycin, l-glutamine (Sigma Aldrich—Merck Darmstadt, Germany).

2.1.1. Plant Material Saffron petals were collected on October 2018 from the plains of Navelli, the center of saffron production in the Abruzzo region, Italy. The plants are a designated DOP (“Protected Designation of Origin”). Petals were obtained after the stigmas had been manually removed from the saffron flowers. Fresh petals were oven dried (o/n at 65 ◦C) and stored in batches of 200 g packed in vacuum sealed plastic bags, in the dark, at room temperature.

2.1.2. Extraction and Purification Oven-dried petals (200 g) were coarsely ground and left to macerate in methanol (4 500 mL) × for 48 h at room temperature until complete discoloration of petals. The methanol was removed by evaporation at 30 ◦C under reduced pressure, and the dry residue stored as total saffron petals extract (SPE), in glass vials at 20 C. Some SPE was used for further purification of kaempferol and crocin as − ◦ described before [15].

2.1.3. Chemical Analyses 1H-NMR and 13C-NMR spectra were recorded on a Bruker 400MHz super-conducting spectrometer 1 at 30 ◦C. Tetramethylsilane was used as an internal standard for H-NMR spectra. Infrared spectra (IR) were recorded on a Perkin-Elmer 298 spectrophotometer. Solid samples were prepared as KBr discs and liquids as thin ﬁlms using NaCl plates. Mass spectra were recorded on a Micromass Quattro II low resolution triple quadruple mass spectrometer by the EPSRC National Mass Spectrometry Service Centre (Swansea, UK). Melting points were determined using a Gallenkamp melting point apparatus and are uncorrected. Thin layer chromatography (TLC) was carried out using Merck aluminum sheet-silica gel 60F254 coated plates which were visualized under UV light and stained with either iodine, 2,4-dinitrophenylhydrazine, or phosphomolybdic acid. Reagents were used as received from Sigma-Aldrich Chemical Company (Dorset, UK).

2.1.4. Quantiﬁcation of Crocin and Kaempferol Extracts of petals were used to quantify crocin and kaempferol by areas comparison under the peak with the authentic reference samples. An Agilent 1100 Series HPLC, equipped with diode array detection was used for the quantiﬁcation of crocin and kaempferol. The column used was Hichrom ACE Ultracore 5 Super C (150 4.6 mm, ID). Flow rate was 1 mL/min, sample size was 5 µL. 18 × Spectra were recorded from 190 to 400 nm as reported previously [15].

2.2. Ex Vivo Guinea Pig Assay Male guinea pig (200–400 g) obtained from Charles River (Calco, Como, Italy) were used. The animals were housed according to the ECC Council Directive regarding the protection of animals Antioxidants 2020, 9, 1102 4 of 18 used for experimental and other scientific purposes. The work was conducted according to the guidelines set forth by EU Directive 2010/63/EU. The protocol was approved by the Institutional Ethics Committee of the University of Bologna (Protocol PR 21.79.14) and transmitted to the Ministry of Health. The animals were sacrificed by cervical dislocation. The used organs were heart, vascular (aorta) and non-vascular (ileum) smooth muscle. Briefly, the organs were set up rapidly under a suitable resting tension in 15 mL organ bath, containing appropriate physiological salt solution (PSS) consistently warmed and buffered to pH 7.4 by saturation with 95% O2–5% CO2 gas and used through specific protocols.

2.2.1. Atria Isolated guinea pig heart preparations were used: spontaneously beating right atria and left atria driven at 1 Hz. The method was previously described [22].

2.2.2. Aortic Strips The thoracic aorta was removed and placed in Tyrode solution as previously reported [22].

2.2.3. Ileum The method was previously described [23]. Brieﬂy, the terminal portion of the ileum (2–3 cm near the ileo-cecal junction) was cleaned, and segments 1 cm long of the ileum were set up under 1 g tension at 37 ◦C in organ baths containing Tyrode solution of the following composition (mM): NaCl 118, KCl 4.75, CaCl 2.54, MgSO 1.20, KH PO 2H O 1.19, NaHCO 25, and 11 glucose equilibrated with 2 4 2 4· 2 3 95% O2–5% CO2 gas at pH 7.4. The intestine was removed above the ileo-cecal junction. Segments of 2 cm length were mounted under a resting tension of 300–400 mg. Strips were secured at one end to a force displacement transducer (FT 0.3, Grass Instruments Corporation) for monitoring changes in isometric contraction.

2.2.4. Statistical Analysis Data from different isolated tissue preparations were analyzed by the Student’s t-test and presented as means S.E.M [24] or by one-way ANOVA followed by Dunnett’s test and p value less than 0.05 ± has been considered significant. The potency of SPE and isolated compounds defined as EC50 and IC50 were calculated from concentration–response curves (Probit analysis using Litchfield and Wilcoxon [24] (Springer, New York, NY, USA) or GraphPad Prism® [25,26] software (GraphPad Prism 5.02 Software, San Diego, CA, USA, www.graphpad.com).

2.3. In Vitro Antioxidant Activity Assay

2.3.1. Cell Culture and Treatments H9c2 rat myoblast cell line was obtained from the European Collection of Cell Cultures (Salisbury, UK). Cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) 10% (v/v) heat-inactivated FBS, penicillin (100 U/mL), streptomycin (100 mg/mL), and l-glutamine (2 mM) and grown at 37 ◦C in an atmosphere of 5% CO2 and 95% air and split 1 to 4 at sub-confluence (80%). Cells were seeded in 96-well cell culture plates at 50,000 cells/mL in 100 µL per well. Crocin and kaempferol were solubilized in DMSO. All treatments were carried out using the same amount of DMSO (0.1%) that does not influence cell viability (data not shown). The same amount of DMSO was added to control cells. The day after seeding, the cells were treated for 1 or 24 h with 0.1–100 µM crocin or kaempferol.

2.3.2. ROS Detection

For intracellular ROS detection, 20,70-dichlorodihydrofluorescein diacetate (DCFH-DA) assay was used, as previously reported [27]. Pre-treated cells were incubated with 10 µM DCFH-DA in DMEM without phenol red for 30 min. After DCFH-DA removal, cells were incubated with 100 µMH2O2 Antioxidants 2020, 9, 1102 5 of 18 in PBS for 15 min. Cells were washed with PBS and the fluorescence was measured using 485 nm excitation and 535 nm emission with a microplate spectrofluorometer (VICTOR3 V Multilabel Counter, PerkinElmer, Wellesley, MA, USA). Intracellular ROS were also evaluated at single cell level by flow cytometry. A number of 2 105 cells was seeded in 12-well tissue culture plates and left in culture × overnight. The cells were treated with crocin or kaempferol (5 µM) for 1 h in DMEM 10% FBS at 37 ◦C 5% CO2, then stained with 10 µM DCFH-DA in DMEM without phenol red and FBS for 30 min, 37 C 5% CO . The cells were detached with trypsin solution and centrifuged at 300 g for 5 min, ◦ 2 × in 1.5 mL tubes. After removing the supernatant, the cell pellet was resuspended and appropriately diluted to 5 10 5 cells/mL in PBS. Guava® easyCyte™ 5 HT instrument was used to collect flow × − cytometry data. FlowJo software was used to analyse the geometric mean fluorescence intensity (MFI). Unstained untreated samples were used as controls.

2.3.3. Cell Viability Assay For cell viability detection, 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyl-tetrazolium bromide (MTT) assay was used, as previously reported [28] pre-treated cells were treated with 100 µMH2O2 in PBS for 45 min, at 37 ◦C 5% CO2. After aspirating the wells, MTT (Sigma Aldrich—Merck Darmstadt, Germany) was incubated in growth medium and MTT solution was added to the cells at 0,5 mg/mL for 1.5 h 37 ◦C 5% CO2. After removing MTT solution, DMSO was added to dissolve formazan in the cells. The absorbance of formazan was measured spectrophotometrically at 595 nm using VICTOR3 V Multilabel plate-reader (PerkinElmer, Wellesley, MA, USA). Untreated cells were considered as viability control in the assay.

2.3.4. Total Antioxidant Activity (TAA) Total antioxidant activity was determined in H9c2 cells using the method of Re et al. [29], based on the ability of the antioxidant molecules in the sample to reduce the radical cation of ABTS, and measured as quenching of the absorbance at 740 nm, as previously reported [30]. Brieﬂy, H9c2 cells were washed 3 times with cold phosphate buﬀer solution (PBS). Cells were subsequently collected in 2 mL of PBS and cells were lysed with two freeze–thaw cycles. H9c2 were centrifuged for 10 min at 5000 g at × 4 ◦C, after which the supernatant was collected. Values obtained for each sample were compared to the concentration–response e curve of a standard Trolox solution, calculated as Trolox equivalent antioxidant activity (TEAA)/mg of protein and express as % of control.

2.3.5. Real-Time Polymerase Chain Reaction (PCR) Assay Total RNA was extracted using RNeasy mini kit (QIAGEN GmbH, Hilden, Germany), following the manufacturer’s protocol. The yield and purity of the RNA were measured using NanoVue spectrophotometer (GE Healthcare, Milano, Italy). One µg of total RNA was reverse-transcribed to cDNA using iScript cDNA synthesis kit (BIO-RAD, Hercules, CA, USA), following the manufacturer’s instructions. The subsequent PCR was performed in a total volume of 10 µL containing 2.5 µL (12.5 ng) of cDNA, 5 µL SsoAdvanced Universal SYBR Green Supermix (BIO-RAD) and 0.5 µL (500 nM) of each primer. The primers used (SIGMA-ALDRICH, Milan, Italy) are reported in Table1; actin was used as reference gene for H9c2 cells.

Table 1. List of primers for real-time PCR in H9c2 cells.

Gene Primer β-actin forward AAGACCTCTATGCCAACAC β-actin reverse TGATCTTCATGGTGCTAGG Nrf2 forward CCATTTGTAGATGACCATGAG Nrf2 reverse GTATTAAGACACTGTAACTCGG CAT forward CAAGTTCCATTACAAGACTGAC CAT reverse TTAAATGGGAAGGTTTCTGC AntioxidantsAntioxidants2020 2020, 9,, 9 1102, x FOR PEER REVIEW 6 of6 of 18 19

3. Results 3. Results 3.1. Chemistry 3.1. Chemistry SPE had been chemically characterized [15]. Alongside fibers, fats, proteins, and minerals, SPE had been chemically characterized [15]. Alongside fibers, fats, proteins, and minerals, Navelli saffron crocus contains significant quantities of secondary metabolites such as kaempferol. Navelli saffron crocus contains significant quantities of secondary metabolites such as kaempferol. In particular, kaempferol glycosides were shown to be abundant in dried petals at 126 mg/g DW, In particular, kaempferol glycosides were shown to be abundant in dried petals at 126 mg/g DW, while crocin concentration was 6.4 mg/g DW [15]. Both kaempferol and crocin were isolated to a level while crocin concentration was 6.4 mg/g DW [15]. Both kaempferol and crocin were isolated to a level exceeding 99% purity, as confirmed by HPLC-DAD and NMR. exceeding 99% purity, as confirmed by HPLC-DAD and NMR. 3.2. Effects of SPE, Crocin and Kaempferol towards Cardiac and Smooth Muscle System 3.2. Effects of SPE, Crocin and Kaempferol towards Cardiac and Smooth Muscle System SPE and the isolated compounds, crocin and kaempferol, were tested for their cardiac profile on SPE and the isolated compounds, crocin and kaempferol, were tested for their cardiac profile on guinea pig left atrium driven at 1 Hz and on spontaneously beating right atrium to evaluate their guinea pig left atrium driven at 1 Hz and on spontaneously beating right atrium to evaluate their inotropic and chronotropic effects, respectively. Data of cardiac activity for extract and compounds inotropic and chronotropic effects, respectively. Data of cardiac activity for extract and compounds are are collected in Table 2. collected in Table2. As shown in Table 2 and Figure 2A, SPE exerted weak negative inotropic and chronotropic As shown in Table2 and Figure2A, SPE exerted weak negative inotropic and chronotropic e ffects. effects. The maximum negative inotropic (36 ± 0.9%) and negative chronotropic (40 ± 1.4%) effects The maximum negative inotropic (36 0.9%) and negative chronotropic (40 1.4%) effects were were reached at 1 and 10 mg/mL, respectively.± ± reached at 1 and 10 mg/mL, respectively. SPE, crocin, and kaempferol were tested on K+-depolarized (40 or 80 mM) guinea pig smooth SPE, crocin, and kaempferol were tested on K+-depolarized (40 or 80 mM) guinea pig smooth muscles: aortic strips and ileum longitudinal smooth muscle to assess their vascular- or not vascular- muscles: aortic strips and ileum longitudinal smooth muscle to assess their vascular- or not relaxant activity, respectively. Data are included in Table 2. vascular-relaxant activity, respectively. Data are included in Table2. On vascular smooth muscle, SPE had intrinsic effect less than 50% (48 ± 1.3%) at 10 mg/mL On vascular smooth muscle, SPE had intrinsic effect less than 50% (48 1.3%) at 10 mg/mL against against KCl-induced contraction (Figure 2B). On the contrary, SPE inhibited± K+ 80 mM-induced KCl-induced contraction (Figure2B). On the contrary, SPE inhibited K + 80 mM-induced contraction on contraction on guinea pig non-vascular smooth muscle. The maximum effect (89 ± 1.9%) was reached guinea pig non-vascular smooth muscle. The maximum effect (89 1.9%) was reached at 10 mg/mL at 10 mg/mL with a potency of 2.05 mg/mL (c.l. 1.36–3.10). ± with a potency of 2.05 mg/mL (c.l. 1.36–3.10).

A B heart smooth muscle 100 100 aorta - chrono (DX) 75 75 - ino (SN) ileum

50 50

% of response of % 25 25 % of relaxant effect 0 0

0.0 0.3 0.6 0.9 1 4 7 10 0.0 0.3 0.6 0.9 1 4 7 10 SPE (mg/mL) SPE (mg/mL)

FigureFigure 2. 2.(A )(A Negative) Negative inotropic inotropic and chronotropic and chronotropic effects oneffe guineacts on pig guinea left and pig right left atrium and respectively.right atrium Cumulativerespectively. concentration–response Cumulative concentration–response curves for Saffron curv Petales for Extract Saffron (SPE) Petal were Extract obtained (SPE) using were negative obtained effects as percentage of the initial tension (left atria) and initial rate (right atria). (B) Spasmolytic effect using negative effects as percentage of the initial tension (left atria) and initial rate (right atria). (B) of SPE on 80 mM K+-induced contraction on guinea pig vascular (aorta) and non-vascular (ileum) Spasmolytic effect of SPE on 80 mM K+-induced contraction on guinea pig vascular (aorta) and non- smooth muscle. Cumulative concentration–response curves for SPE were obtained using relaxant vascular (ileum) smooth muscle. Cumulative concentration–response curves for SPE were obtained effects as percentage of the initial tension induced by 80 mM K+, taken as 100%. Each point is the mean using relaxant effects as percentage of the initial tension induced by 80 mM K+, taken as 100%. Each SEM (n = 5–6). Where error bars are not shown these are covered by the point itself. ±point is the mean ± SEM (n = 5–6). Where error bars are not shown these are covered by the point itself.

Antioxidants 2020, 9, 1102 7 of 18

Table 2. Cardiac activity of SPE, crocin, and kaempferol.

Left Atrium Right Atrium Negative Inotropy Negative Inotropy Negative Chronotropy a b c d Samples Unit Activity M S.E.M. EC50 95% conf int Activity M S.E.M. Activity M S.E.M. ± ± ± 36 0.9 40 1.4 ± ± SPE [µM] [–] [–] (mg/mL)(1) (10) 73 1.9 25 1.2 20 1.3 ± ± ± Crocin [µM] [5] 0.17 0.12–0.23 [100] [100] (mg/mL)(0.0048)(0.00017)(0.00012–0.00022)(0.097)(0.097) 87 2.1 29 1.1 30 0.9 ± ± ± Kaempferol [µM] [5] 0.15 0.083–0.63 [5] [50] (mg/mL)(0.0014)(0.000043)(0.000024–0.00018)(0.0014)(0.0014) a,c Decrease in developed tension on isolated guinea pig left atrium (a) and on guinea-pig spontaneously beating isolated right atrium (c), expressed as percent changes from the control (n = 5–6). The left atria were driven at 1 Hz. b Calculated from log concentration–response curves (Probit analysis by Litchfield and Wilcoxon [24] with n = 6–7). When the maximum effect d was <50%, the EC50 ino. values were not calculated. Decrease in atrial rate on guinea pig spontaneously beating isolated right atrium at the concentration that produces the maximum intrinsic effect in parenthesis, expressed as percent changes from the control (n = 7–8). Pre-treatment heart rate ranged from 165 to 190 beats/min. Please note: the concentration that produces the maximum intrinsic effect (a, c, and d) and the potency (b) are expressed as µM for crocin and kaempferol and as mg/mL for all samples. Antioxidants 2020, 9, x FOR PEER REVIEW 8 of 19 Antioxidants 2020, 9, 1102 8 of 18 Crocin and kaempferol showed an interesting cardiac profile: a selective negative inotropic Antioxidants 2020, 9, x FOR PEER REVIEW 8 of 19 activity (Figure 3). CrocinCrocin and and kaempferol kaempferol showed showed an an interesting interesting cardiac cardiac profile: profile: a a selective selective negative negative inotropic inotropic activityactivityA (Figure (Figure3). 3). heart heart B 100 100 A chrono DX heart heart B chrono DX 75 ino SN 75 100 100 ino SN chrono DX chrono DX 50 50 75 ino SN 75 ino SN %response of 25 % of response 25 50 50

0 0 %response of 25 % of response 25

-8 -7 -6 -5 -4 -8 -7 -6 -5 -4 0 log [kaempferol] (M) 0 log [crocin] (M)

-8 -7 -6 -5 -4 -8 -7 -6 -5 -4 Figure 3. Negativelog [kaempferol]inotropic and (M) chronotropic effects on guinea pig leftlog (ino [crocin] SN) and (M) right atrium (chrono DX) respectively. Cumulative concentration–response curves for kaempferol (A) and crocin FigureFigure(B) were 3. 3. Negativeobtained Negative using inotropic inotropic negative and and chronotropic effectschronotropic as percentage e ffeffectsects on ofon guineathe guinea initial pig pig tension left left (ino (ino (left SN) SN) atria) and and and right right initial atrium atrium rate (chrono(right(chrono atria). DX) DX) respectively. Eachrespectively. point is Cumulative theCumulative mean ± concentration–responseSEM concentration–response of four–six experiments curves curves (n for= for4–6). kaempferol kaempferol Where error (A (A) and)bars andcrocin are crocin not (Bshown()B were) were these obtained obtained are covered using using negative negative by the point e ffeffectsects itself. as as percentage percentage of of the the initial initial tension tension (left (left atria) atria) and and initial initial rate rate (right atria). Each point is the mean SEM of four–six experiments (n = 4–6). Where error bars are not (right atria). Each point is the mean± ± SEM of four–six experiments (n = 4–6). Where error bars are not shown these are covered by the point itself. shownThe maximum these are coveredintrinsic by effect the point is achieved itself. at 5 μM for both compounds (Table 2). They have negative inotropic potency in the 0.1 μM range [EC50 = 0.17 μM (c.l. 0.12–0.23); EC50 = 0.15 μM (c.l. The maximum intrinsic effect is achieved at 5 µM for both compounds (Table2). They have 0.083–0.28)The maximum respectively]. intrinsic This effect negative is achieved inotropic at effe 5 μctM is forselective both compounds of the left atrium (Table driven 2). They at 1have Hz; negative inotropic potency in the 0.1 µM range [EC50 = 0.17 µM (c.l. 0.12–0.23); EC50 = 0.15 µM innegative fact, it inotropicdoes not potencyoccur in in the the spontaneously 0.1 μM range be[ECating50 = 0.17right μ atriumM (c.l. 0.12–0.23);where the ECintrinsic50 = 0.15 activity μM (c.l. is (c.l. 0.083–0.28) respectively]. This negative inotropic effect is selective of the left atrium driven at 1 Hz; 0.083–0.28)around 30% respectively]. for both compound This negative (Table inotropic2). The same effe ctcan is beselective said of of the the negative left atrium chronotropic driven at effect1 Hz; in fact, it does not occur in the spontaneously beating right atrium where the intrinsic activity is around (Tablein fact, 2). it does not occur in the spontaneously beating right atrium where the intrinsic activity is 30% for both compound (Table2). The same can be said of the negative chronotropic e ffect (Table2). aroundCrocin 30% and for bothkaempferol compound were (Table tested 2).on TheK+-depolarized same can be (80 said mM) of theguinea negative pig smooth chronotropic muscles: effect i.e., Crocin and kaempferol were tested on K+-depolarized (80 mM) guinea pig smooth muscles: (Tableaortic strips2). and ileum longitudinal smooth muscle, in an attempt to assess their vascular- or non- i.e., aortic strips and ileum longitudinal smooth muscle, in an attempt to assess their vascular- or vascular-relaxantCrocin and kaempferol activity respectively. were tested The on dataK+-depolarized are presented (80 inmM) Table guinea 3 together pig smooth with thosemuscles: of SPE. i.e., non-vascular-relaxant activity respectively. The data are presented in Table3 together with those of aorticCrocin strips had no and effect ileum on longitudinalvascular or non-vascular smooth muscle, smooth in an muscle attempt (Figure to assess 4). their vascular- or non- SPE. Crocin had no effect on vascular or non-vascular smooth muscle (Figure4). vascular-relaxant activity respectively. The data are presented in Table 3 together with those of SPE. Crocin had no effect onaorta vascular or non-vascular smooth muscle (Figure 4).ileum

+ Kaempferol K+40 mM Kaempferol K 80 mM 100 100 aorta+ ileum Kaempferol K 80 mM crocin K+ 80 mM + + 75 Kaempferolcrocin K 80 K mM+40 mM 75 Kaempferol K 80 mM 100 100 + Kaempferol K 80 mM crocin K+ 80 mM 50 + 50 75 crocin K 80 mM 75

25 25 50 50 % of relaxant effect % of relaxant effect 0 0 25 25 % of relaxant effect % of relaxant effect -6 -5 -4 -3 -7 -6 -5 -4 0 log [Compound] (M) 0 log [Compound] (M)

-6 -5 -4 -3 -7+ -6 -5 -4 Figure 4. Spasmolytic eﬀect of crocin and kaempferol on high K -induced+ contraction on guinea pig Figure 4. Spasmolyticlog [Compound] effect of crocin (M) and kaempferol on high K -inducedlog [Compound] contraction (M)on guinea pig vascularvascular (aorta) (aorta) and and non-vascular non-vascular (ileum) (ileum) smooth smooth muscle. muscle. Cumulative Cumulative concentration–response concentration–response curves curves for crocin and kaempferol were obtained using relaxant eﬀects as percentage of the initial tension Figurefor crocin 4. Spasmolytic and kaempferol effect were of crocin obtained and kaempferolusing relaxant on higheffects K+ -inducedas percentage contraction of the initialon guinea tension pig + induced by 40- or 80-mM K ,+ taken as 100%. Each point is the mean SEM (n = 5–6). Where error bars vascularinduced by(aorta) 40- or and 80-mM non-vascular K , taken (ileum) as 100%. smooth Each muscle.point is Cumulativethe mean± ± SEM concentration–response (n = 5–6). Where error curves bars are not shown these are covered by the point itself. arefor crocinnot shown and thesekaempferol are covered were byobtained the point using itself. rela xant effects as percentage of the initial tension induced by 40- or 80-mM K+, taken as 100%. Each point is the mean ± SEM (n = 5–6). Where error bars areIn contrast,not shown kaempferolthese are covered inhibited by the Kpoint+-induced itself. contraction on guinea pig vascular and non- vascular smooth muscle (Figure 4). In particular, kaempferol showed a similar intrinsic activity, but In contrast, kaempferol inhibited K+-induced contraction on guinea pig vascular and non- vascular smooth muscle (Figure 4). In particular, kaempferol showed a similar intrinsic activity, but Antioxidants 2020, 9, 1102 9 of 18

Table 3. Relaxant activity of tested samples on K+-depolarized guinea pig vascular (aortic strips) and non-vascular (ileum) smooth muscle.

Vascular Non-Vascular Aorta Ileum K+ 40 mM K+ 80 mM K+ 80 mM Samples Unit Activity a M S.E.M. Activity a M S.E.M. EC b 95% conf int Activity a M S.E.M. EC b 95% conf lim ± ± 50 ± 50 48 1.3 89 2.4 2.05 1.36–3.10 ± ± SPE [µM] [–][–] (mg/mL)(10)(10) 3 0.1 15 0.3 ± ± Crocin [µM] [50] [100] (mg/mL)(0.0049)(0.098) 42 1.6 69 1.9 79 2.4 ± ± ± Kaempferol [µM] [50] [50] 20.76 12.58–29.37 [5] 1.16 0.77–2.36 (mg/mL)(0.014)(0.014)(0.0059) (0.0036–0.0084) (0.014)(0.00033) (0.00022–0.00068) a Percent inhibition of calcium-induced contraction on K+-depolarized (40 and 80 mM, respectively) guinea pig aortic strips and longitudinal smooth muscle at indicated concentration. The indicated concentration gave the maximum effect for the samples. b Calculated from concentration–response curves (Probit analysis by Litchfield and Wilcoxon [24] with n = 6–7). When the maximum effect was <50%, the IC50 values were not calculated. Please note: the concentration that produces the maximum intrinsic effect (a) and the potency (b) are expressed as µM for crocin and kaempferol and as mg/mL for all samples. Antioxidants 2020, 9, 1102 10 of 18

In contrast, kaempferol inhibited K+-induced contraction on guinea pig vascular and non-vascular smooth muscle (Figure4). In particular, kaempferol showed a similar intrinsic activity, but the maximum effect is reached at concentrations 10 times lower than for the non-vascular smooth muscle [(69 1.9%) ± at 50 µM, (79 2.4%) at 5 µM, respectively]. Kaempferol has non-vascular relaxant potency seventeen ± times greater than on vascular smooth muscle [EC50 = 20.76 µM (c.l. 12.58–29.37); EC50 = 1.16 µM (c.l. 7.74–2.36); respectively]. On aorta K+ 40 mM depolarized, kaempferol show an intrinsic activity of less than 50% (42 1.6%) at 50 µM (Figure4). ± The intrinsic activity decreases when the K+ concentration is reduced to 40 mM. This finding is in agreement with the assumption that the calcium channels blocking by specific drugs is linked to membrane depolarization [31,32]. It is well-known that classic Ca2+ channel blockers such as nifedipine, Antioxidantsverapamil, 2020 and, 9, diltiazemx FOR PEER actREVIEW in this way, though some natural extracts and derivative compounds 11 of 19 seem to act in the same way [31,32].

3.3.3.3. Effects Effects of of Crocin Crocin and and Kaem Kaempferolpferol on on H9c2 H9c2 Cellular Viability H9c2H9c2 cells cells were were treated treated with with different different concentrations concentrations (1–100 (1–100 μM)µM) of crocin of crocin and and kaempferol kaempferol for 24for h. 24 Data h. Data reported reported in Figure in Figure 5 5show show that that crocin crocin is is cytotoxic cytotoxic only only at at the the highest concentration.concentration. KaempferolKaempferol showed showed a a higher higher cytotoxicity, cytotoxicity, in in fact, cell viability was was significantly significantly lower lower in in respect respect to to controlcontrol cells cells at at concentrations concentrations equal equal or or greater greater than than 25 25 μµM.M. For For this this reason, reason, the the next next experiments experiments were were carriedcarried out out using using concentrations concentrations lower than 25 μµM.

Figure 5. Viability of H9c2 cells treated with crocin and kaempferol. Cells were treated for 24 h with Figureincreasing 5. Viability concentrations of H9c2 (1–100cells treatedµM) of with crocin crocin or kaempferol. and kaempferol. Viability Cells was were measured treated byfor MTT 24 h assay,with as reported in Materials and Methods. Each bar represents means S.E.M. of at least 4 independent increasing concentrations (1–100 μM) of crocin or kaempferol. Viability± was measured by MTT assay, asexperiments. reported in (Materialsn = 4) Data and were Methods. analyzed Each by bar one-way represents ANOVA means followed ± S.E.M. by of Dunnett’s at least 4 test. independent * p < 0.05 experiments.with respect to(n CTRL.= 4) Data were analyzed by one-way ANOVA followed by Dunnett’s test. * p < 0.05 with respect to CTRL. To investigate the potential protective effect of the two compounds against oxidative stress, cellsTo were investigate treated with the potential increasing protective concentrations effect of (0.1–10 the twoµ M)compounds of crocin against or kaempferol oxidative for stress, 1 h or cells 24 h werebefore treated the induction with increasing of oxidative concentrations stress (100 (0.1–10µMH 2μOM)2) of (Figure crocin6 ).or Thiskaempferol peroxide for concentration 1 h or 24 h before has been chosen as it reduces cell viability by 50% with respect to control cells. Moreover, similar H O the induction of oxidative stress (100 μM H2O2) (Figure 6). This peroxide concentration has been2 2 concentrations had been used by other authors [33] in H9c2 cells. Treatment with 1–10 µM crocin for chosen as it reduces cell viability by 50% with respect to control cells. Moreover, similar H2O2 concentrations1 h was able to had counteract been used peroxide-induced by other authors damage, [33] in H9c2 significantly cells. Treatment increasing with cell 1–10 viability μM crocin in respect for 1to h Hwas2O 2abletreated to counteract cells. Kaempferol peroxide-induced treatment damage, for 1 h was significantly less effective increasing than crocin cell viability and increased in respect cell viability after peroxide-induction only at concentrations of 2.5 µM and higher, moreover the highest % to H2O2 treated cells. Kaempferol treatment for 1 h was less effective than crocin and increased cell viabilityincrease after triggered peroxide-induction by kaempferol only was onlyat concentrations 9% at 5 µM, whereasof 2.5 μM 10 andµM higher, crocin moreover led to a 16% the increasehighest %in increase respect totriggered H2O2. Interestingly,by kaempferol the was long-term only 9% treatmentsat 5 μM, whereas (24 h) did10 μ notM crocin show led any to protective a 16% increase effect, suggesting that these compounds may act with a direct antioxidant mechanism. in respect to H2O2. Interestingly, the long-term treatments (24 h) did not show any protective effect, suggesting that these compounds may act with a direct antioxidant mechanism. To better investigate this aspect, H9c2 cells were treated with 0.1–10 μM crocin and kaempferol for either 1 or 24 h prior to the addition of H2O2 and the level of intracellular ROS was determined using the peroxide-sensitive fluorescent probe DCFH-DA (Figure 7). Regarding the short-term treatments (1 h), unlike the data on the protection against H2O2, all tested crocin and kaempferol concentrations led to a significant reduction of endogenous ROS levels in H2O2 treated cells. This discrepancy may be due to the different sensitivity of the two assays. In agreement with the MTT data, the long-term treatments (24 h) were less effective in reducing ROS levels in respect to 1 h treatments. In particular, all the tested concentrations of kaempferol were not able to reduce ROS levels in respect to peroxide. On the other hand, crocin at 0.1–5 μM significantly reduced ROS levels in respect to H2O2. Antioxidants 2020, 9, 1102 11 of 18 Antioxidants 2020, 9, x FOR PEER REVIEW 12 of 19

Figure 6. Effect of crocin and kaempferol against H O -induced injury in H9c2 cells. Cells were Figure 6. Effect of crocin and kaempferol against H2O22-induced2 injury in H9c2 cells. Cells were pre- pre-treated with crocin or kaempferol (0.1–10 µM) for 1 or 24 h and then exposed to 100 µMH O . treated with crocin or kaempferol (0.1–10 μM) for 1 or 24 h and then exposed to 100 μM H2O2. Cell2 2 viabilityCell viability was measured was measured by MTT by MTTassay assay as reported as reported in Materials in Materials and Methods. and Methods. Data Dataare reported are reported as % as % increase in respect to H O treated cells. Each bar represents means SE of at least four increase in respect to H2O2 treated2 2 cells. Each bar represents means ± SE of at least± four independent experimentsindependent ( experimentsn = 4). Data (weren = 4). analyzed Data were by analyzedone-way byANOVA one-way followed ANOVA by followed Dunnett’s by test. Dunnett’s * p < 0.05 test. * p < 0.05 H O . H2O2. 2 2 To better investigate this aspect, H9c2 cells were treated with 0.1–10 µM crocin and kaempferol for Intracellular ROS were also evaluated at the single cell level in basal condition, i.e., without either 1 or 24 h prior to the addition of H2O2 and the level of intracellular ROS was determined using exposing cells to H2O2, by flow cytometry (Figure 8A). H9c2 cells were treated with 5 μM crocin and the peroxide-sensitive fluorescent probe DCFH-DA (Figure7). Regarding the short-term treatments kaempferol for 1 h and stained with DCFH-DA before flow cytometry analysis. In agreement with (1 h), unlike the data on the protection against H O , all tested crocin and kaempferol concentrations the previous data, the peaks relating to the cells tr2 eated2 with either crocin or kaempferol had shifted led to a significant reduction of endogenous ROS levels in H O treated cells. This discrepancy may to the left away from the positive control, towards that of the2 negative2 control (blak). This is due to be due to the different sensitivity of the two assays. In agreement with the MTT data, the long-term the lower intracellular fluorescence of the DCFH-DA dye compared to positive control cells, treatments (24 h) were less effective in reducing ROS levels in respect to 1 h treatments. In particular, indicating a lower level of ROS. all the tested concentrations of kaempferol were not able to reduce ROS levels in respect to peroxide. To confirm the ability of the two compounds to scavenge ROS, H9c2 cells were treated with 5 On the other hand, crocin at 0.1–5 µM significantly reduced ROS levels in respect to H O . μM crocin and kaempferol for 1 h and total antioxidant activity (TAA) was evaluated (Figure2 2 8B). As Intracellular ROS were also evaluated at the single cell level in basal condition, i.e., without exposing expected, both crocin and kaempferol were able to significantly increase TAA, in agreement with the cells to H O , by flow cytometry (Figure8A). H9c2 cells were treated with 5 µM crocin and kaempferol data on the2 ROS2 production. for 1 h and stained with DCFH-DA before flow cytometry analysis. In agreement with the previous In order to better clarify the mechanisms behind crocin and kaempferol protection, expression data, the peaks relating to the cells treated with either crocin or kaempferol had shifted to the left of the Nrf2/ARE signaling pathway was investigated. In particular, RT-PCR analysis was carried out away from the positive control, towards that of the negative control (blak). This is due to the lower to determine if the compounds modulate the expression of Nrf2 and the antioxidant enzyme catalase intracellular fluorescence of the DCFH-DA dye compared to positive control cells, indicating a lower (CAT). Cells were treated with kaempferol and crocin 5 μM for 1 h before RT-PCR analysis (Figure level of ROS. 9). Of note, both crocin and kaempferol were able to significantly up-regulate both Nrf2 and catalase, To confirm the ability of the two compounds to scavenge ROS, H9c2 cells were treated with suggesting their involvement in the Nrf2/ARE pathway. 5 µM crocin and kaempferol for 1 h and total antioxidant activity (TAA) was evaluated (Figure8B). As expected, both crocin and kaempferol were able to significantly increase TAA, in agreement with the data on the ROS production. Antioxidants 2020, 9, 1102 12 of 18 Antioxidants 2020, 9, x FOR PEER REVIEW 13 of 19 Antioxidants 2020, 9, x FOR PEER REVIEW 13 of 19

Figure 7.FigureEﬀect 7. Effect of crocin of crocin and and kaempferol kaempferol on on ReactiveReactive Oxygen Oxygen Species Species (ROS) (ROS) production production in H9c2 in cells. H9c2 cells. Cells wereFigureCells pre-treated 7.were Effect pre-treated of crocin with with crocinand crocinkaempferol or kaempferolor kaempferol on Reactive (0.1–10 (0.1–10 Oxygenµ μM)M) forforSpecies 1 or 24(ROS) 24 h h and and production then then exposed exposed in H9c2 to 100 to cells. 100 µM CellsμM wereH2O2 . pre-treatedIntracellular with ROS crocinproduction or kaempferol was measured (0.1–10 with μ theM) peroxide-sensitivefor 1 or 24 h and thenprobe exposed DCFH-DA to 100 H2O2. Intracellular ROS production was measured with the peroxide-sensitive probe DCFH-DA as μMas Hreported2O2. Intracellular in Materials ROS and production Methods. wasData measured were expressed with the as peroxide-sensitivepercentage with respect probe to DCFH-DA H2O2- reported in Materials and Methods. Data were expressed as percentage with respect to H2O2-treated astreated reported cells. in Each Materials bar represents and Me meansthods. ±Data SE. ofwere at least expressed four independent as percentage experiments with respect (n = 4). toData H2 O2- cells. Each bar represents means SE. of at least four independent experiments (n = 4). Data were treatedwere analyzedcells. Each by barone-way represents ANOVA± means followed ± SE .by of Dunnett’sat least four test. independent * p < 0.05 with experiments respect to H 2(On 2=. 4). Data p analyzedwere by analyzed one-way by ANOVAone-way ANOVA followed followed by Dunnett’s by Dunnett’s test. *test.< *0.05 p < 0.05 with with respect respect to to H 2HO2O2.2.

Figure 8. Effect of crocin and kaempferol on ROS production at single cell level and total antioxidant activity of H9c2 cells. H9c2 cells were treated with 5 μM of the crocin or kaempferol for 1 h. (A) FigureFigure 8.IntracellularEﬀ 8.ect Effect of ROS crocin of crocin were and evaluated and kaempferol kaempferol at single on on cell ROS ROS level productionproducti using DCFH-DAon at at single single by cell flow cell level cytometry level and and total as total reportedantioxidant antioxidant in Materials and Methods. (B) Total antioxidant activity was measured as reported in the Materials activityactivity of H9c2 of H9c2 cells. cells. H9c2 H9c2 cells cells werewere treated treated with with 5 μ 5Mµ Mof the of crocin the crocin or kaempferol or kaempferol for 1 h. for(A) 1 h. (A) IntracellularIntracellular ROS ROS were were evaluated evaluated at single at single cell level cell using level DCFH-DA using DCFH-DA by flow cytometry by ﬂow as cytometry reported as in Materials and Methods. (B) Total antioxidant activity was measured as reported in the Materials reported in Materials and Methods. (B) Total antioxidant activity was measured as reported in the Materials and Methods and expressed as percent of control cells. Each bar represents means SE of ± three independent experiments (n = 3). Data were analyzed with one-way ANOVA followed by the Bonferroni’s test. * p < 0.05 vs. CTRL. Antioxidants 2020, 9, 1102 13 of 18

In order to better clarify the mechanisms behind crocin and kaempferol protection, expression of the Nrf2/ARE signaling pathway was investigated. In particular, RT-PCR analysis was carried out to 14 of 19 determineAntioxidants if 2020 the, 9 compounds, x FOR PEER REVIEW modulate the expression of Nrf2 and the antioxidant enzyme catalase (CAT).and Cells Methods were treated and expressed with kaempferol as percent and of control crocin 5ceµlls.M Each for 1 bar h before represents RT-PCR means analysis ± SE of (Figure three 9). Of note,independent both crocin experiments and kaempferol (n = 3). were Data ablewere to analyzed signiﬁcantly with up-regulateone-way ANOVA both followed Nrf2 and by catalase, the suggestingBonferroni’s their involvement test. * p < 0.05 in vs. the CTRL. Nrf2 /ARE pathway.

Figure 9. Effect of kaempferol and crocin on Nrf2 and antioxidant enzyme catalase (CAT) expression. RealFigure time-PCR 9. Effect was of performedkaempferol toand detect crocin Nrf2 on andNrf2 CAT and mRNAantioxidant levels. enzyme Data arecatalase expressed (CAT) as expression. relative abundanceReal time-PCR compared was performed to untreated to detect cells. Nrf2 Each and bar CAT represents mRNA mean levels. DataSEM are of expressed three independent as relative ± experiments.abundance Datacompared were analyzedto untreated with cells. one-way Each ANOVA bar represents followed mean by the ± Bonferroni’sSEM of three test. independent * p < 0.05 vs.experiments. CTRL. Data were analyzed with one-way ANOVA followed by the Bonferroni’s test. * p < 0.05 vs. CTRL. 4. Discussion 4. DiscussionNowadays, the relationship between cardiac dysfunction and initiating factors such as smoking, excessive alcohol consumption, diet, obesity, and stress is well known. In several cases, the effect of one Nowadays, the relationship between cardiac dysfunction and initiating factors such as smoking, of these factors alone or in combination with others, as atherosclerosis and hypertension, represents a excessive alcohol consumption, diet, obesity, and stress is well known. In several cases, the effect of first step in the development of different cardiac dysfunctions such as angina, infarction, arrhythmias, one of these factors alone or in combination with others, as atherosclerosis and hypertension, or heart failure [34]. represents a first step in the development of different cardiac dysfunctions such as angina, infarction, Dietary factors play a key role in the development as well as prevention of certain human arrhythmias, or heart failure [34]. diseases, including cardiovascular diseases. Currently, there has been increased global interest in Dietary factors play a key role in the development as well as prevention of certain human identification of medicinal plants that are pharmacologically effective and have little or no side effects diseases, including cardiovascular diseases. Currently, there has been increased global interest in for use in preventive medicine. There is a growing amount of literature concerning the potential identification of medicinal plants that are pharmacologically effective and have little or no side effects benefits of these herbs and spices from a health perspective especially in conferring protection against for use in preventive medicine. There is a growing amount of literature concerning the potential cardiovascular diseases. benefits of these herbs and spices from a health perspective especially in conferring protection against Many phytochemicals have been shown to exert antioxidant effect and to counteract many cardiovascular diseases. oxidative-stress-related diseases, like cardiovascular diseases [35,36]. Many phytochemicals have been shown to exert antioxidant effect and to counteract many In accordance with principles of circular economy, we focused on agricultural waste oxidative-stress-related diseases, like cardiovascular diseases [35,36]. products of a crop cultivated in Italy, with the aim to provide a health promoting substance for In accordance with principles of circular economy, we focused on agricultural waste products nutraceutical application. of a crop cultivated in Italy, with the aim to provide a health promoting substance for nutraceutical Crocus sativus L. has been used for centuries in folk medicine, for the treatment of several disorders, application. including those concerning cardiovascular system [13]. Our group has demonstrated lately the high Crocus sativus L. has been used for centuries in folk medicine, for the treatment of several antioxidant potential of kaempferol and crocin [15]. disorders, including those concerning cardiovascular system [13]. Our group has demonstrated lately In the current work, we report its ability to affect cardiovascular parameters by influencing the high antioxidant potential of kaempferol and crocin [15]. inotropy, chronotropy and to reduce KCl induced contraction in vascular and non-vascular smooth In the current work, we report its ability to affect cardiovascular parameters by influencing muscle and its antioxidant activity in cardiac cells. inotropy, chronotropy and to reduce KCl induced contraction in vascular and non-vascular smooth An aqueous extract of Crocus sativus L. petals reduced blood pressure in normotensive and muscle and its antioxidant activity in cardiac cells. hypertensive anesthetized rats, though no active pharmaceutical ingredient was identified [37] as An acqueous extract of Crocus sativus L. petals reduced blood pressure in normotensive and this compound was shown to prevent angiotensin II-induced hypertension in anesthetized rats [38]. hypertensive anesthetized rats, though no active pharmaceutical ingredient was identified [37] as this compound was shown to prevent angiotensin II-induced hypertension in anesthetized rats [38]. Our data suggest that crocin does not directly affect smooth muscle contractility, as it has not reduced the contractions induced by KCl in guinea pig vascular (aorta) and non-vascular (ileum) smooth muscle. The hypotensive activity was also observed with a Crocus sativus L. hydroalcoholic extract in angiotensin II hypertensive rats, likely due to the inhibition of renin-angiotensin system [39]. The Antioxidants 2020, 9, 1102 14 of 18

Our data suggest that crocin does not directly affect smooth muscle contractility, as it has not reduced the contractions induced by KCl in guinea pig vascular (aorta) and non-vascular (ileum) smooth muscle. The hypotensive activity was also observed with a Crocus sativus L. hydroalcoholic extract in angiotensin II hypertensive rats, likely due to the inhibition of renin-angiotensin system [39]. The hypotensive activity of saffron extract may also occur through the inhibition of calcium channels, the reduction of calcium release into sarcoplasmic reticulum [40], and through the antagonism towards adrenergic receptors [41]. Although previous reports demonstrated that some saffron extracts and related compounds act on vascular smooth muscle, no data on extracts from saffron petals from Navelli, L’Aquila (Italy) are available. In our work, SPE exerted a selective spasmolytic effect towards 80 mM K+-induced contraction in guinea pig non-vascular (ileum) smooth muscle, suggesting the involvement of calcium channels. This is in agreement with the observation that saffron extract has the ability to reduce calcium influx inhibiting receptor operated Ca2+ channels [37]. A similar effect was observed with crocin, while kaempferol had a relaxant effect both on guinea pig vascular (aorta) and non-vascular (ileum) smooth muscle, showing a higher potency towards the latter tissue. The maintenance of cardiovascular health is the result of multiple molecular events that concern, among others, the state of inflammation and oxidative stress. Therefore, in addition to the study of the parameters described above, we measured the antioxidant effect of the products derived from Crocus on the oxidative state of H9c2 cells. Our data show that crocin and, to a lesser extent, kaempferol protect H9c2 cells against H2O2-induced damage by reducing intracellular ROS levels and thus counteracting oxidative stress. The antioxidant activity of crocin and kaempferol purified from petals of Crocus sativus L. has already been demonstrated in vitro [15]. There, the authors used two different antioxidant tests: DPPH and ABTS assays. Both showed that the compounds have antioxidant activity, kaempferol being more effective than crocin. In contrast, our current data on the in vitro cell-based assay show a higher effect of crocin compared to kaempferol in reducing ROS levels and our hypothesis is that this could be due to a different cellular uptake of the two compounds. Crocin has been demonstrated to penetrate the blood brain barrier and localize inside the brain after i.p. administration in mice [42], suggesting its bioavailability in vivo. On the other hand, kaempferol is poorly absorbed due to its low water solubility [43]. Our data on the antioxidant activity of crocin are in agreement with those of previous experiments [44] where crocin attenuated the effects of LPS-induced expression of inflammatory factors and oxidative stress. In a cell model of ischemia/reperfusion, 10 µM crocin for 24 h increased Nrf2 and HO-1 levels in rat cardiomyocytes [45], suggesting that crocin not only acts with a direct antioxidant mechanism but also with an indirect one through the upregulation of endogenous antioxidant enzymes. The antioxidant activity of kaempferol has also been investigated against antimycin A-induced oxidative stress in osteoblast-like MC3T3-E1 cells [46]. The authors demonstrated the reduction of ROS level using both DCFH-DA and MitoSOX, a live-cell-permeable and mitochondrial localizing superoxide indicator. In H9c2 cells, 2.5 µM kaempferol for 1 h reduced oxygen-glucose deprivation (OGD)-triggered cell damage through down-regulating miR15b expression via activating PI3K/AKT and Wnt3a/β-catenin pathways [47]. Of note, OGD triggers oxidative stress, so the protection evoked by kaempferol could also be related to its antioxidant activity [48]. Interestingly, our data show that crocin and kaempferol short-term treatments (1h) are more effective than long-term treatments (24 h). In particular, a long-term treatment with kaempferol did not show any protective effect, meanwhile, a long-term treatment with crocin did not show any protective effect in terms of cell viability but was able to slightly reduce intracellular ROS level. This could be due to the molecular mechanisms by which the compounds counteract oxidative stress. In particular, the fact that only the short-term treatment counteracts oxidative stress let us speculate a Antioxidants 2020, 9, 1102 15 of 18 direct antioxidant mechanism, that could not be present anymore after a long term-treatment. In fact, after 24 h, the compounds might be extensively metabolized. To clarify this point and understand if the compounds act through a direct scavenging activity of ROS or by enhancing the endogenous antioxidant system, we investigated the level of the transcription factor Nrf2 and the antioxidant enzyme catalase after 1 h treatment. Both the compounds were able to up-regulate Nrf2 and catalase, suggesting that they also act with an indirect mechanism, enhancing the antioxidant defense system. Further studies will be necessary to understand the potential additive or synergic effect of the compounds used in combination. Kaempferol and crocin exerted significant antioxidant activity in cardiac cells. In agreement, the antioxidant activity of those compounds was previously observed by the ABTS and DPPH tests [15,36].

5. Conclusions Crocus sativus L. petals are a source of bioactive compounds such as kaempferol and crocin. Both SPE and isolated compounds may find use as nutraceuticals to prevent or reduce the effects of non-communicable diseases, if applied in a clinical space “beyond diet, before drug”. In fact, the observed effects may delay the onset or the progression of chronic diseases involving the cardiovascular system. SPE, kaempferol, crocin from petals of Crocus sativus L., were shown to affect several targets, thus they may provide benefits in the early stages of chronic diseases such as atherosclerosis or hypertension. In order to achieve the potential beneficial effects, the studied nutraceuticals need to be administered in the most appropriate way. For this purpose, SPE, crocin, and kaempferol may be provided, in future in vivo studies, through a proper pharmaceutical formulation. In conclusion, we suggest that more investigation should be done to completely explore the potential cardiovascular protective activity of what until recently was considered waste material in the production of the “golden spice”.

Author Contributions: Conceptualization, R.B., M.M. and S.H.; methodology, M.M., C.A. and K.Z.; validation, formal analysis and investigation, M.M., P.M., K.Z., S.A.N. and M.A.C.; resources, R.B.; data curation, M.M., K.Z., P.M. and K.C.R.; writing—original draft preparation, M.M., C.A. and K.Z.; writing—review and editing, R.B., S.H. and G.M.; visualization, A.C.; supervision, R.R.J.A.; project administration, R.B. and H.S.; funding acquisition, R.B. and S.H. All authors have read and agreed to the published version of the manuscript. Funding: This research was funded by University of Bologna, “Ricerca Fondamentale Oritentata” (RFO), 2019. Acknowledgments: The authors thank the EPSRC (National Mass Spectrometry Service Centre) (Swancea, UK). The authors would like to thank people from Navelli village which provided saffron petals. Conflicts of Interest: The authors declare no conflict of interest.

References

1. Micucci, M.; Bolchi, C.; Budriesi, R.; Cevenini, M.; Maroni, L.; Capozza, S.; Chiarini, A.; Pallavicini, M.; Angeletti, A. Antihypertensive phytocomplexes of proven efficacy and well-established use: Mode of action and individual characterization of the active constituents. Phytochemistry 2020, 170, 112222. [CrossRef] [PubMed] 2. Fallah Huseini, H.; Fakhrzadeh, H.; Larijani, B.; Shikh Samani, A.H. Review of anti-diabetic medicinal plant used in traditional medicine. J. Med. Plants 2006, 1, 1–8. 3. Ciudad-Mulero, M.; Matallana-González, M.C.; Hurtado, M.C.; Fernández-Ruiz, V.; Morales, P. Antioxidant Phytochemicals in Pulses and their Relation to Human Health: A Review. Curr. Pharm. Des. 2020, 26, 1880–1897. [CrossRef][PubMed] 4. WHO Guidelines; WHO: Geneva, Switzerland, 2019. 5. Micucci, M.; Malaguti, M.; Gallina Toschi, T.; Di Lecce, G.; Aldini, R.; Angeletti, A.; Chiarini, A.; Budriesi, R.; Hrelia, S. Cardiac and Vascular Synergic Protective Eﬀect of Olea europea L. Leaves and Hibiscus sabdariﬀa L. Flower Extracts. Oxidative Med. Cell. Longev. 2015, 2015, 318125. [CrossRef] Antioxidants 2020, 9, 1102 16 of 18

6. Chiarini, A.; Micucci, M.; Malaguti, M.; Budriesi, R.; Ioan, P.; Lenzi, M.; Fimognari, C.; Toschi, T.G.; Comandini, P.; Hrelia, S. Sweet Chestnut (Castanea sativa Mill.) Bark Extract: Cardiovascular Activity and Myocyte Protection against Oxidative Damage. Oxidative Med. Cell. Longev. 2013, 2013, 1–10. [CrossRef] 7. Zeka, K.; Ruparelia, K.; Arroo, R.R.J.; Budriesi, R.; Micucci, M. Flavonoids and Their Metabolites: Prevention in Cardiovascular Diseases and Diabetes. Diseases 2017, 5, 19. [CrossRef] 8. Farzaei, M.; Singh, A.K.; Kumar, R.; Croley, C.R.; Pandey, A.K.; Coy-Barrera, E.; Patra, J.K.; Das, G.; Kerry, R.G.; Annunziata, G.; et al. Targeting Inflammation by Flavonoids: Novel Therapeutic Strategy for Metabolic Disorders. Int. J. Mol. Sci. 2019, 20, 4957. [CrossRef][PubMed] 9. Eggersdorfer, M.; Wyss, A. Carotenoids in human nutrition and health. Arch. Biochem. Biophys. 2018, 652, 18–26. [CrossRef] 10. Ghaffari, S.; Roshanravan, N. Saffron; An updated review on biological properties with special focus on cardiovascular effects. Biomed. Pharmacother. 2019, 109, 21–27. [CrossRef] 11. Budriesi, R.; Vivarelli, F.; Canistro, D.; Aldini, R.; Babot, C.; Corazza, I.; Fato, R.; Cirillo, S.; Bergamini, C.; D’Errico, A.; et al. Liver and intestinal protective effects of Castanea sativa Mill. bark extract in high-fat diet rats. PLoS ONE 2018, 13, e0201540. [CrossRef] 12. Jiang, T.A. Health Benefits of Culinary Herbs and Spices. J. AOAC Int. 2019, 102, 395–411. [CrossRef] [PubMed] 13. Hosseinzadeh, H.; Nassiri-Asl, M. Avicenna’s (Ibn Sina) the canon of medicine and saffron (Crocus sativus): A review. Phytother Res. 2013, 27, 475–483. [CrossRef][PubMed] 14. Christodoulou, E.; Kadoglou, N.P.; Kostomitsopoulos, N.; Valsami, G. Saffron: A natural product with potential pharmaceutical applications. J. Pharm. Pharmacol. 2015, 67, 1634–1649. [CrossRef][PubMed] 15. Zeka, K.; Ruparelia, K.C.; Continenza, M.A.; Stagos, D.; Vegliò, F.; Arroo, R.R. Petals of Crocus sativus L. as a potential source of the antioxidants crocin and kaempferol. Fitoterapia 2015, 107, 128–134. [CrossRef] 16. Zeka, K.; Ruparelia, K.C.; Sansone, C.; Macchiarelli, G.; Continenza, M.A.; Arroo, R.R. New Hydrogels Enriched with Antioxidants from Saffron Crocus Can Find Applications in Wound Treatment and/or Beautification. Skin Pharmacol. Physiol. 2018, 31, 95–98. [CrossRef] 17. Rahmani, J.; Manzari, N.; Thompson, J.; Clark, C.C.T.; Villanueva, G.; Kord-Varkaneh, H.; Mirmiran, P. The effect of saffron on weight and lipid profile: A systematic review, meta-analysis, and dose-response of randomized clinical trials. Phytother. Res. 2019, 33, 2244–2255. [CrossRef][PubMed] 18. Aleali, A.M.; Amani, R.; Shahbazian, H.; Namjooyan, F.; Latifi, S.M.; Cheraghian, B. The effect of hydroalcoholic Saffron (Crocus sativus L.) extract on fasting plasma glucose, HbA1c, lipid profile, liver, and renal function tests in patients with type 2 diabetes mellitus: A randomized double-blind clinical trial. Phytother. Res. 2019, 33, 1648–1657. [CrossRef] 19. Khoddami, A.; Wilkes, M.A.; Roberts, T.H. Techniques for Analysis of Plant Phenolic Compounds. Molecules 2013, 18, 2328–2375. [CrossRef] 20. Hassani, F.V.; Naseri, V.; Razavi, B.M.; Mehri, S.; Abnous, K.; Hosseinzadeh, H. Antidepressant effects of crocin and its effects on transcript and protein levels of CREB, BDNF, and VGF in rat hippocampus. DARU J. Pharm. Sci. 2014, 22, 16. [CrossRef][PubMed] 21. Carmona, M.; Sanchez, A.M.; Ferreres, F.; Zalacain, A.; Tomás-Barberán, F.; Alonso, G.L. Identification of the flavonoid fraction in saffron spice by LC/DAD/MS/MS: Comparative study of samples from different geographical origins. Food Chem. 2007, 100, 445–450. [CrossRef] 22. Carosati, E.; Budriesi, R.; Ioan, P.; Cruciani, G.; Fusi, F.; Frosini, M.; Saponara, S.; Gasparrini, F.; Ciogli, A.; Villani, C.; et al. Stereoselective behavior of the functional diltiazem analogue 1-[(4-chlorophenyl)sulfonyl]- 2-(2-thienyl)pyrrolidine, a new L-type calcium channel blocker. J. Med. Chem. 2009, 52, 6637–6648. [CrossRef] 23. Micucci, M.; Protti, M.; Aldini, R.; Frosini, M.; Corazza, I.; Marzetti, C.; Mattioli, L.B.; Tocci, G.; Chiarini, A.; Mercolini, L.; et al. Thymus vulgaris L. Essential Oil Solid Formulation: Chemical Profile and Spasmolytic and Antimicrobial Effects. Biomolecules 2020, 10, 860. [CrossRef] 24. Hill, I.D.; Tallarida, R.J.; Murray, R.B. Manual of Pharmacologic Calculations with Computer Programs. J. R. Stat. Soc. Ser. C Appl. Stat. 1982, 31, 307. [CrossRef] 25. Motulsky, H.; Christopoulos, A. Fitting Models to Biological Data Using Linear and Non Linear Regression. 2003. Available online: https://www.facm.ucl.ac.be/cooperation/Vietnam/WBI-Vietnam-October- 2011/Modelling/RegressionBook.pdf (accessed on 17 June 2020). 26. Motulsky, H.J. Prism 5 Statistics Guide; GraphPad Software Inc.: San Diego, CA, USA, 2007; Available online: https://cdn.graphpad.com/faq/2/file/Prism_v5_Statistics_Guide.pdf (accessed on 17 June 2020). Antioxidants 2020, 9, 1102 17 of 18

27. Angeloni, C.; Hrelia, S. Quercetin Reduces Inflammatory Responses in LPS-Stimulated Cardiomyoblasts. Oxidative Med. Cell. Longev. 2012, 2012, 1–8. [CrossRef] 28. Giusti, L.; Angeloni, C.; Barbalace, M.C.; Lacerenza, S.; Ciregia, F.; Ronci, M.; Urbani, A.; Manera, C.; Digiacomo, M.; Macchia, M.; et al. A Proteomic Approach to Uncover Neuroprotective Mechanisms of Oleocanthal against Oxidative Stress. Int. J. Mol. Sci. 2018, 19, 2329. [CrossRef] 29. Re, R.; Pellegrini, N.; Proteggente, A.; Pannala, A.; Yang, M.; Rice-Evans, C. Antioxidant activity applying an improved ABTS radical cation decolorization assay. Free. Radic. Biol. Med. 1999, 26, 1231–1237. [CrossRef] 30. Hrelia, S.; Fiorentini, D.; Maraldi, T.; Angeloni, C.; Bordoni, A.; Biagi, P.L.;Hakim, G. Doxorubicin induces early lipid peroxidation associated with changes in glucose transport in cultured cardiomyocytes. Biochim. Biophys. Acta (BBA) Biomembr. 2002, 1567, 150–156. [CrossRef] 31. Ioan, P.; Carosati, E.; Micucci, M.; Cruciani, G.; Broccatelli, F.; Zhorov, B.S.; Chiarini, A.; Budriesi, R. 1,4-Dihydropyridine scaffold in medicinal chemistry, the story so far and perspectives (part 1): Action in ion channels and GPCRs. Curr. Med. Chem. 2011, 18, 4901–4922. [CrossRef] 32. Carosati, E.; Ioan, P.; Micucci, M.; Broccatelli, F.; Cruciani, G.; Zhorov, B.; Chiarini, A.; Budriesi, R. 1,4-Dihydropyridine Scaffold in Medicinal Chemistry, The Story So Far And Perspectives (Part 2): Action in Other Targets and Antitargets. Curr. Med. Chem. 2012, 19, 4306–4323. [CrossRef] 33. Nudelman, V.; Zahalka, M.A.; Nudelman, A.; Rephaeli, A.; Kessler-Icekson, G. Cardioprotection by AN-7, a prodrug of the histone deacetylase inhibitor butyric acid: Selective activity in hypoxic cardiomyocytes and cardiofibroblasts. Eur. J. Pharmacol. 2020, 882, 173255. [CrossRef] 34. Talukder, M.A.H.; Johnson, W.M.; Varadharaj, S.; Lian, J.; Kearns, P.N.; El-Mahdy, M.A.; Liu, X.; Zweier, J.L. Chronic cigarette smoking causes hypertension, increased oxidative stress, impaired NO bioavailability, endothelial dysfunction, and cardiac remodeling in mice. Am. J. Physiol. Circ. Physiol. 2011, 300, H388–H396. [CrossRef] 35. Malaguti, M.; Angeloni, C.; Hrelia, S. Nutraceutical Bioactive Compounds Promote Healthspan Counteracting Cardiovascular Diseases. J. Am. Coll. Nutr. 2015, 34, 22–27. [CrossRef][PubMed] 36. Alfa, H.H.; Arroo, R.R.J. Over 3 decades of research on dietary flavonoid antioxidants and cancer prevention: What have we achieved? Phytochem. Rev. 2019, 18, 989–1004. [CrossRef] 37. Imenshahidi, M.; Hosseinzadeh, H.; Javadpour, Y. Hypotensive effect of aqueous saffron extract (Crocus sativus L.) and its constituents, safranal and crocin, in normotensive and hypertensive rats. Phytother. Res. 2010, 24, 990–994. [CrossRef] 38. Shafei, M.N.; Faramarzi, A.; Rad, A.K.; Anaeigoudari, A. Crocin prevents acute angiotensin II-induced hypertension in anesthetized rats. Avicenna J. Phytomed. 2017, 7, 345–352. [CrossRef] 39. Plangar, A.F.; Anaeigoudari, A.; Khajavirad, A.; Shafei, M.N. Beneficial Cardiovascular Effects of Hydroalcoholic Extract from Crocus Sativus in Hypertension Induced by Angiotensin II. J. Pharmacopunct. 2019, 22, 95–101. [CrossRef] 40. Liu, T.; Chu, X.; Wang, H.; Zhang, X.; Zhang, Y.; Guo, H.; Liu, Z.; Dong, Y.; Liu, H.; Liu, Y.; et al. Crocin, a carotenoid component of Crocus cativus, exerts inhibitory effects on L-type Ca2+ current, Ca2+ transient, and contractility in rat ventricular myocytes. Can. J. Physiol. Pharmacol. 2016, 94, 302–308. [CrossRef] 41. Fatehi-Hassanabad, Z.; Rashidabady, T.; Fatehi-Hassanabad, Z. Effects of Crocus sativus petals’ extract on rat blood pressure and on responses induced by electrical field stimulation in the rat isolated vas deferens and guinea-pig ileum. J. Ethnopharmacol. 2003, 84, 199–203. [CrossRef] 42. Karkoula, E.; Lemonakis, N.; Kokras, N.; Dalla, C.; Gikas, E.; Skaltsounis, A.-L.; Tsarbopoulos, A. Trans-crocin 4 is not hydrolyzed to crocetin following i.p. administration in mice, while it shows penetration through the blood brain barrier. Fitoterapia 2018, 129, 62–72. [CrossRef] 43. Colombo, M.; Melchiades, G.D.L.; Michels, L.R.; Figueiró, F.; Bassani, V.L.; Teixeira, H.F.; Koester, L.S. Solid Dispersion of Kaempferol: Formulation Development, Characterization, and Oral Bioavailability Assessment. AAPS PharmSciTech 2019, 20, 106. [CrossRef] 44. Rahim, V.B.; Khammar, M.T.; Rakhshandeh, H.; Samzadeh-Kermani, A.; Hosseini, A.; Askari, V.R.; Rahimi, V.B. Crocin protects cardiomyocytes against LPS-Induced inflammation. Pharmacol. Rep. 2019, 71, 1228–1234. [CrossRef] 45. Wang, X.; Yuan, B.; Cheng, B.; Liu, Y.; Zhang, B.; Wang, X.; Lin, X.; Yang, B.; Gong, G. Crocin Alleviates Myocardial Ischemia/Reperfusion-Induced Endoplasmic Reticulum Stress via Regulation of miR-34a/Sirt1/Nrf2 Pathway. Shock 2019, 51, 123–130. [CrossRef] Antioxidants 2020, 9, 1102 18 of 18

46. Choi, E.M. Kaempferol protects MC3T3-E1 cells through antioxidant eﬀect and regulation of mitochondrial function. Food Chem. Toxicol. 2011, 49, 1800–1805. [CrossRef][PubMed] 47. Li, L.; Shao, Y.; Zheng, H.; Niu, H. Kaempferol regulates mir-15b/bcl-2/tlr4 to alleviate ogd-induced injury in h9c2 cells. Int. Heart J. 2020, 61, 585–594. [CrossRef] 48. Santos, C.X.; Anilkumar, N.; Zhang, M.; Brewer, A.C.; Shah, A.M. Redox signaling in cardiac myocytes. Free Radic. Biol. Med. 2011, 50, 777–793. [CrossRef]

Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional aﬃliations.

© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).