Candidate Enzymes for Saffron Crocin Biosynthesis Are Localized in Multiple Cellular Compartments

Candidate enzymes for saffron crocin biosynthesis are localized in multiple cellular compartments

Item Type Article

Authors Demurtas, Olivia Costantina; Frusciante, Sarah; Ferrante, Paola; Diretto, Gianfranco; Azad, Noraddin Hosseinpour; Pietrella, Marco; Aprea, Giuseppe; Taddei, Anna Rita; Romano, Elena; Mi, Jianing; Al-Babili, Salim; Frigerio, Lorenzo; Giuliano, Giovanni

Citation Demurtas OC, Frusciante S, Ferrante P, Diretto G, Azad NH, et al. (2018) Candidate enzymes for saffron crocin biosynthesis are localized in multiple cellular compartments. Plant Physiology: pp.01815.2017. Available: http://dx.doi.org/10.1104/pp.17.01815.

Eprint version Post-print

DOI 10.1104/pp.17.01815

Publisher American Society of Plant Biologists (ASPB)

Journal Plant Physiology

Rights Archived with thanks to Plant Physiology

Download date 28/09/2021 10:07:42

Link to Item http://hdl.handle.net/10754/628006 Plant Physiology Preview. Published on May 29, 2018, as DOI:10.1104/pp.17.01815

1 Short title: Compartmentation of saffron crocin biosynthesis 2 3 Corresponding author: Giovanni Giuliano, ENEA, Italian National Agency for New 4 Technologies, Energy and Sustainable Economic Development, Casaccia Research Centre, Via 5 Anguillarese n° 301, 00123 Rome, Italy; Phone: +390630483192, E-mail: 6 [email protected] 7 8 Candidate enzymes for saffron crocin biosynthesis are localized in multiple cellular 9 compartments 10 11 Olivia Costantina Demurtas1, Sarah Frusciante1, Paola Ferrante1, Gianfranco Diretto1, Noraddin 12 Hosseinpour Azad2, Marco Pietrella1,3, Giuseppe Aprea1, Anna Rita Taddei4, Elena Romano5, 13 Jianing Mi6, Salim Al-Babili6, Lorenzo Frigerio7, Giovanni Giuliano1* 14 15 1Italian National Agency for New Technologies, Energy and Sustainable Economic 16 Development (ENEA), Casaccia Res. Ctr., 00123, Rome, Italy 17 2Department of Medicinal plant and plant production, University of Mohaghegh Ardabili, 18 Ardabil, Iran 19 3Council for Agricultural Research and Economics (CREA), Research Center for Olive, Citrus 20 and Tree Fruit, 47121 Forlì, Italy 21 4Center of Large Equipment-section of Electron Microscopy, University of Tuscia, Largo 22 dell’Università, snc, Viterbo, Italy 23 5Department of Biology, University of Rome "Tor Vergata", Via della Ricerca Scientifica Snc, 24 00133 Rome, Italy. 25 6King Abdullah University of Science and Technology (KAUST), Biological and 26 Environmental Sciences and Engineering Division, The Bioactives Lab, Thuwal 23955-6900, 27 Kingdom of Saudi Arabia 28 7School of Life Sciences, University of Warwick, Coventry CV4 7AL, United Kingdom 29 30 One-sentence summary: Carotenoid cleavage dioxygenase 2 and candidate aldehyde 31 dehydrogenase and UDP-glycosyltransferase enzymes involved in saffron crocin biosynthesis 32 are localized in the chromoplast, the endoplasmic reticulum, and the cytoplasm. 33 34 Footnotes:

Downloaded from on June 3, 2018 - Published by www.plantphysiol.org Copyright © 2018 American Society of Plant Biologists. All rights reserved. Copyright 2018 by the American Society of Plant Biologists

35 Author contributions: O.C.D., S.F., P.F., G.D., N.H.A., A.R.T., E.R., J.M., S.A-B., and L.F. 36 produced data. O.C.D., M.P., G.A., S.A-B., L.F., and G.G. analyzed data. G.G. coordinated the 37 study. O.C.D. and G.G. wrote the manuscript. All authors reviewed the results and approved the 38 final version of the manuscript.

39 40 Funding: This work was supported by the European Union [From discovery to products: A 41 next generation pipeline for the sustainable generation of high-value plant products, FP7 42 Contract 613153], by baseline funding given to S. A-B. from King Abdullah University of 43 Science and Technology (KAUST) and benefited from the networking activities within the 44 European Cooperation in Science and Technology Action CA15136 (EUROCAROTEN). 45 46 *Corresponding author email: [email protected] 47 48

49 Abstract 50 51 Saffron is the dried stigmas of Crocus sativus and is the most expensive spice in the world. Its 52 red color is due to crocins, which are apocarotenoid glycosides that accumulate in the vacuole to 53 a level up to 10% of the stigma dry weight. Previously, we characterized the first dedicated 54 enzyme in the crocin biosynthetic pathway, carotenoid cleavage dioxygenase 2 (CsCCD2), 55 which cleaves zeaxanthin to yield crocetin dialdehyde. In this work, we identified six putative 56 aldehyde dehydrogenase (ALDH) genes expressed in C. sativus stigmas. Heterologous 57 expression in E. coli showed that only one of corresponding proteins (CsALDH3I1) was able to 58 convert crocetin dialdehyde into the crocin precursor crocetin. CsALDH3I1 carries a C-terminal 59 hydrophobic domain, similar to that of the Neurospora membrane-associated apocarotenoid 60 dehydrogenase YLO-1. We also characterized the UDP-glycosyltransferase CsUGT74AD1, 61 which converts crocetin to crocins 1 and 2’. In vitro assays revealed high specificity of 62 CsALDH3I1 for crocetin dialdehyde and long-chain apocarotenals, and of CsUGT74AD1 for 63 crocetin. Following extract fractionation, CsCCD2, CsALDH3I1, and CsUGT74AD1 were 64 found in the insoluble fraction, suggesting their association with membranes or large insoluble 65 complexes. Analysis of protein localization in both C. sativus stigmas and following transgene 66 expression in Nicotiana benthamiana leaves revealed that CsCCD2, CsALDH3I, and 67 CsUGT74AD1 were respectively localized to the plastids, the endoplasmic reticulum (ER), and 68 the cytoplasm in association with cytoskeletal-like structures. Based on these findings and 69 current literature, we propose that the ER and cytoplasm function as “transit centers” for 70 metabolites whose biosynthesis starts in the plastid and are accumulated in the vacuole. 71

73 Introduction

74 One gram of dried saffron is composed of the stigmas of approximately 150 Crocus sativus 75 flowers, picked by hand. This makes saffron the most expensive spice in the world, with prices 76 ranging from 2 to 10 EUR/gram. The main organoleptic properties of the stigmas are due to the 77 accumulation of three apocarotenoid classes: crocins (composed of different glucosyl- and 78 gentiobiosyl-esters of crocetin), picrocrocin, and safranal (Tarantilis et al., 1995), conferring to 79 saffron, respectively, its red color, bitter taste, and pungent aroma. Crocins make up to 10% of 80 stigma dry weight and, by virtue of their glycosylation, are water-soluble. They have 81 applications as textile colorants and histochemical stains (Bathaie et al., 2014), antioxidants 82 (Alavizadeh and Hosseinzadeh, 2014), and in the prevention of age-related macular 83 degeneration (Bisti et al., 2014). Due to their complex structure and abundance of chiral centers, 84 crocins cannot be synthesized chemically, and there is a strong industrial interest in their 85 biotechnological production. 86 87 In C. sativus stigmas, crocin biosynthesis starts with symmetric oxidative cleavage of the C7,C8 88 and C7’,C8’ double bonds in zeaxanthin, which is catalyzed by the enzyme carotenoid cleavage 89 dioxygenase 2 (CsCCD2) producing crocetin dialdehyde (Fig. 1; Frusciante et al., 2014). Like 90 many aldehydes, crocetin dialdehyde is highly reactive and is converted into the diacid crocetin 91 by yet unidentified aldehyde dehydrogenase (ALDH) enzymes. ALDHs are NAD(P)+- 92 dependent oxidoreductases that generally contribute to different processes, such as cytoplasmic 93 male sterility, plant defense, and abiotic stress response (Kirch et al., 2004). The final step of 94 crocin biosynthesis involves glycosylation of crocetin. This reaction is usually catalyzed by 95 uridine diphosphate glycosyl transferase (UGTs) that mediate the glycosylation of secondary 96 metabolites, xenobiotics, and hormones (Wang, 2009). In Gardenia jasminoides, two crocetin 97 UGTs have been characterized (Nagatoshi et al., 2012): UGT75L6 is responsible for the 98 primary glycosylation of crocetin, producing crocetin monoglucosyl and diglucosyl esters, 99 whereas UGT94E5 is responsible for the secondary glycosylation of the glucose groups, leading 100 to the formation of one or two gentiobiose groups (Fig. 1). Contrasting data have been reported 101 on crocin formation in saffron: a crocetin UGT purified from C. sativus stigmas has been shown 102 to catalyze only primary glycosylation (Cote et al., 2001) whereas a cloned UGT (UGTCs2) has 103 been reported to mediate both types of glycosylation (Moraga et al., 2004). 104 105 The crocin biosynthetic pathway encompasses multiple subcellular compartments: the initial 106 precursor, zeaxanthin, is localized in plastids whereas the final products, crocins, accumulate in 107 vacuoles (Bouvier et al., 2003; Gomez-Gomez et al., 2017), like many other plant glycosylated

108 metabolites (Martinoia et al., 2007). We have identified the carotenoid cleavage dioxygenase 109 responsible for the first dedicated step in C. sativus carotenoid biosynthesis, CsCCD2. It has 110 been shown that CsCCD2, the enzyme that catalyzes the cleavage of zeaxanthin in crocin 111 biosynthesis (Frusciante et al., 2014), is localized to the plastid (Ahrazem et al., 2016). In 112 contrast, the subcellular localization of the further intermediates in crocin biosynthesis and the 113 corresponding enzymes remains elusive. There are other examples of glycosylated metabolites, 114 such as steviol (Brandle and Telmer, 2007) and ABA-GE (Nambara and Marion-Poll, 2005), 115 which originate from plastid-localized precursors and accumulate in the vacuole. For these, 116 plastid-derived metabolites are modified and glycosylated in the cytoplasm, forming final 117 glycosylated products that are transported into vacuoles via tonoplast transporters (Martinoia et 118 al., 2007). This compartmentation is consistent with the assumed cytoplasmic localization of the 119 majority of plant UGTs (Ross et al., 2001). A different model for crocin biosynthesis and 120 sequestration was proposed based only on proteomic data and microscopic observation (Gomez- 121 Gomez et al., 2017). This model proposed that crocins are biosynthesized entirely in the plastid, 122 prior to accumulation in plastid-localized vesicles and final transport to the vacuole where 123 crocins are delivered and stored. A crocetin UGT (UGTCs2) has been identified in C. sativus 124 stigmas (Moraga et al., 2004) and, on the basis of proteomic data, has been proposed to reside in 125 C. sativus stigma chromoplasts (Gomez-Gomez et al., 2017). The ALDH responsible for the 126 second step in crocin biosynthesis has not been identified so far. 127 128 To further elucidate the crocin biosynthetic pathway and to determine its compartmentation, we 129 searched a C. sativus stigma transcriptome for putative ALDHs and UGTs and characterized 130 their activity using E. coli as expression system. We identified an ALDH and an UGT, which 131 together convert crocetin dialdehyde to crocins. In addition, we determined the localization of 132 these two enzymes by immunogold electron microscopy and by analyzing the distribution of 133 Green Fluorescent Protein (GFP) fusions in Nicotiana benthamiana cells using confocal 134 microscopy. Based on the data obtained, we propose a model for crocin 135 biosynthesis/compartmentation in C. sativus stigmas. 136 137 Results

138 Identification and characterization of ALDH candidate transcripts in C. sativus stigmas

139 To identify the enzyme(s) involved in the conversion of crocetin dialdehyde into crocetin, an in- 140 house transcriptome assembly obtained from RNA-Seq data from developing C. sativus stigmas 141 (Frusciante et al., 2014) was searched for homologs of transcripts encoding apocarotenoid

142 ALDH enzymes from different organisms: i) Neurospora crassa YLO-1, a member of family 3 143 ALDH (EC 1.2.1.5) responsible for the dehydrogenation of β-apo-4-carotenal into 144 neurosporaxanthin (Estrada et al., 2008) and, together with its Arabidopsis thaliana homologs 145 ALDH3I1 and ALDH3H1 (Stiti et al., 2011a; Stiti et al., 2011b), responsible for the oxidation 146 of medium-chain fatty aldehydes; ii) Bixa orellana ALDH (BoALDH), a family 2 ALDH 147 member (EC 1.2.1.3), which has been claimed to convert the apocarotenoid bixin dialdehyde 148 into norbixin (Bouvier et al., 2003); iii) Synechocystis sp. PCC6803 ALDH (SynALDH) that 149 converts a wide range of apocarotenals and alkanals into the corresponding carboxylic acids 150 (Trautmann et al., 2013), and five ALDHs claimed, based on proteomic data, to reside within 151 stigma chromoplasts (CsADHComp; Gomez-Gomez et al., 2017). Using this approach, we 152 identified six candidate genes expressed in C. sativus stigmas and encoding putative ALDH 153 enzymes (Fig. 2A). CsALDH2C4, a member of family 2, is the closest homolog of BoALDH 154 and AtALDH2C4; a second family 2 member, CsALDH2B4, corresponds to 155 CsADHComp11367 and shows identity of 97.2% and 85.2% to CsADHComp2946 and 156 CsADHComp20158, respectively; CsALDH3I1 (family 3) is a close homolog of AtALDH3I1, 157 AtALDH3H1, YLO-1, SynALDH, and CsADHComp54788; CsALDH5F1, which belongs to 158 family 5 comprising succinic semialdehyde dehydrogenases (EC 1.2.1.24; Brocker et al., 2013), 159 is a close homolog of AtALDH5F1, involved in plant defense against reactive oxygen species 160 (Stiti et al., 2011b); CsALDH6B2 is a family 6 member and a homolog of AtALDH6B2 and 161 CsADHComp3893; CsALDH7B4 (family 7, EC 1.2.1.31, comprising Δ1-piperideine-6- 162 carboxylate dehydrogenases and α-aminoadipic semialdehyde dehydrogenases (Brocker et al., 163 2013)) is a close homolog of AtALDH7B4, encoded by an osmotic-stress-inducible ALDH gene 164 (Kotchoni et al., 2006). 165 166 The CsALDH5F1 and CsALDH7B4 amino acid sequences indicate the presence of 167 tetramerization interfaces (Supplemental Fig. S1), whereas CsALDH3I1 and YLO-1 are 168 equipped with a C-terminal hydrophobic domain (Supplemental Fig. S2) flanked by short 169 regions of positively charged amino acids and preceded by an unstructured domain 170 (Supplemental Fig. S1). A similar structure has been found in a rat microsome-localized ALDH 171 and has been shown to mediate its localization to the endoplasmic reticulum (ER; Masaki et al., 172 1994). Indeed, YLO-1 is a cytosolic, membrane-localized enzyme, although its exact 173 localization is unknown (Estrada et al., 2008). This C-terminal domain has been lost in 174 CsADHComp54788 that represents a truncated form of CsALDH3I1, due to an early stop 175 codon. The subcellular localization of the identified CsALDHs was predicted using TargetP 176 (Supplemental Table S1; Emanuelsson et al., 2000). None of the enzymes contained a plastid

177 transit peptide, excluding localization within this organelle, whereas CsALDH2B4, 6B2, and 178 5F1 are predicted to be mitochondrial. All CsALDH genes were expressed throughout stigma 179 development (Fig. 2B). 180 181 CsALDH3I1 catalyzes the dehydrogenation of crocetin dialdehyde into crocetin

182 To check the ability of the different CsALDH enzymes to convert crocetin dialdehyde to 183 crocetin, we expressed them as thioredoxin fusion proteins in Escherichia coli accumulating 184 crocetin dialdehyde (see Materials and Methods). Briefly, a strain of E. coli carrying a plasmid 185 for zeaxanthin biosynthesis (Kanr) was co-transformed with the pTHIO-CsCCD2 (Cmr) vector 186 harboring the CsCCD2 enzyme that converts zeaxanthin to crocetin dialdehyde (Frusciante et 187 al., 2014) and a third pTHIO-ALDH vector (Ampr) containing one of the six CsALDHs cDNAs 188 or the SynALDH gene (Supplemental Fig. S3A; Trautmann et al., 2013). Immunoblot analysis 189 using an anti-6xHis antibody confirmed the expression of CsCCD2:thioredoxin and 190 ALDH:thioredoxin fusion proteins at the expected molecular mass of (81.9 kDa) and (69.8–76.9 191 kDa), respectively. The intensities of the bands corresponding to ALDH:thioredoxin fusion 192 proteins were similar, indicating that all ALDH proteins were expressed at comparable levels 193 upon induction (Supplemental Fig. S3B). 194 195 We quantified zeaxanthin, crocetin dialdehyde, and crocetin levels in induced bacterial cells 196 harboring the various constructs. Non-polar and polar metabolites were analyzed by high 197 performance liquid chromatography-photodiode array detection-high resolution mass 198 spectrometry (HPLC-PDA-HRMS) using a Q-Exactive mass spectrometer. The analysis 199 revealed a decrease of zeaxanthin in all clones expressing CsCCD2 due to the activity of the 200 CsCCD2 enzyme (Fig. 3, A and D). An ion with the mass of crocetin dialdehyde and co- 201 migrating with a crocetin dialdehyde authentic standard was detected in all clones expressing 202 CsCCD2, with the exception of the CsCCD2/ALDH3I1 clone, where this metabolite was almost 203 absent (Fig. 3, B and E). Trace levels of an ion with the accurate mass of the ALDH product, 204 crocetin, were observed in all clones expressing CsCCD2, possibly due to the action of an 205 endogenous E. coli ALDH or to non-enzymatic dehydrogenation of crocetin dialdehyde (Fig. 3, 206 C and F). We observed a different pattern in cells co-expressing CsCCD2 and CsALDH3I1. 207 Compared to all other cells, we detected a much higher reduction in crocetin dialdehyde and an 208 according higher increase in crocetin content (Fig. 3, E and F). Thus, since all ALDHs were 209 expressed at similar levels (Supplemental Fig. S3B), we assumed that CsALDH3I1 is the 210 enzyme that converts crocetin dialdehyde into crocetin with high efficiency. The C. sativus

211 ortholog of BoALDH, CsALDH2C4, as well as SynALDH, did not show any activity above the 212 E. coli background. 213 214 Crocetin was resolved by our chromatographic system into two different peaks with identical 215 mass but different chromatographic mobility (peaks 1 and 2 in Fig. 3C). The commercial 216 standard of crocetin is composed mostly of all-trans-isomer, that corresponds to the fastest- 217 migrating peak (peak 1, Fig. 3C). Hence, we assume that the two peaks correspond to all-trans- 218 and cis-crocetin with an absorption maximum at 426 nm and 420 nm with an additional 219 absorption peak (“cis-peak”) at 318 nm, respectively (Supplemental Fig. S4; Chryssanthi et al., 220 2011; Rubio-Moraga et al., 2010). Interestingly, the all-trans- and cis-isomer produced in E. coli 221 were present in approximately equimolar amounts. Because our chromatographic system does 222 not separate the trans- and cis-isomer of crocetin dialdehyde, we are not able to assess whether 223 the cis configuration is already present in crocetin dialdehyde or is generated during the 224 dehydrogenation reaction. 225 226 To further characterize the substrate specificity of CsALDH3I1, we introduced the pTHIO- 227 ALDH vector in an E. coli strain harboring the groES-groEL-chaperones system to maximize 228 the amount of correctly folded protein (Nishihara et al., 1998). Proteins were solubilized using 229 Triton X-100 (Supplemental Fig. S5) and utilized in an in vitro assay with different aldehydes 230 according to Trautmann et al. (2013). The control extract from E. coli cell transformed with the 231 void plasmid showed negligible (1.3%) oxidation of crocetin dialdehyde into crocetin 232 (Supplemental Fig. S6), whereas the extract containing CsALDH3I1 converted crocetin 233 dialdehyde into crocetin in a time-dependent manner, with an almost complete conversion after 234 120 min incubation (Fig. 4). We also assayed the CsALDH3I1 activity on different 235 apocarotenals and non-apocarotenoid aldehydes. As shown in Supplemental Table S2, 236 CsALDH3I1 displayed a strong preference for long-chain apocarotenals, and for 237 diapocarotenoids, showing after 60 min a conversion rate of 93.3%, 76.4%, and 3.6% for -apo-

238 8’-carotenal (C30), crocetin dialdehyde (C20) and retinal (C20), respectively. In contrast, the 239 activity of the enzyme was very low or even not detectable, upon incubation with non- 240 apocarotenoid (fatty) aldehydes, such as dodecanal, hexanal or 4-OH-benzaldehyde. 241 242 CsUGT74AD1 catalyzes the glycosylation of crocetin into crocins 1 and 2’

243 To check whether the previously identified UGT enzyme (UGTCs2; GenBank: AY262037.1; 244 Moraga et al., 2004) is involved in crocin biosynthesis and how many sugars it adds we 245 searched our transcriptome, as well as that of Jain et al. (2016), for the presence of the

246 corresponding transcript. However, we could not find an identical sequence. The most similar 247 UGT transcript present in these transcriptomes was that of CsUGT74AD1, which encodes a 248 version of UGTCs2 (Moraga et al., 2004) showing a 4 amino-acid extension at the N-terminus, 249 lacking 7 amino acids at the C-terminus and differing in 44 amino acids (Supplemental Fig. S7). 250 The plant secondary product glycosyltransferase (PSPG) motif, which is responsible for binding 251 the sugar donor UDP-glucose (Gachon et al., 2005), is conserved in CsUGT74AD1, UGTCs2, 252 and Gardenia jasminoides UGTs involved in crocin formation (Nagatoshi et al., 2012), whereas 253 some differences were observed in other catalytic residues. Specifically, both UGTCs2 and 254 GjUGT75L6 lack the Asp121 residue (Supplemental Fig. S7), which has been shown to be 255 necessary, together with His22, for the catalytic activity of Medicago truncatula UGT71G1 256 (Shao et al., 2005). Similar to CsCCD2, CsUGT74AD1 is highly expressed in early stigma 257 development, with transcript levels reaching a maximum at the red stage and declining 258 thereafter (Fig. 2B). A dendrogram that includes CsUGT74AD1, other described C. sativus 259 UGTs (Moraga et al., 2009; Trapero et al., 2012; Ahrazem et al., 2015; Gomez-Gomez et al., 260 2017), G. jasminoides UGTs involved in crocin biosynthesis (Nagatoshi et al., 2012), and 261 Arabidopsis thaliana and Medicago truncatula UGTs (Dong and Hwang, 2014; Shao et al., 262 2005) is shown in Figure 2C. Three clusters are observed: one comprising the three C. sativus 263 genes putatively involved in auxin-GE biosynthesis (Ahrazem et al., 2015); a second one 264 comprising CsUGT74AD1, GjUGT75L6, involved in crocetin primary glycosylation 265 (Nagatoshi et al., 2012) and CsGT45, involved in flavonoid glycosylation (Moraga et al., 2009); 266 and a third one, comprising Arabidopsis ABA UGTs. GjUGT94E5, involved in crocetin 267 secondary glycosylation (Nagatoshi et al., 2012) and CsUGT707B1, putatively involved in 268 flavonoid glycosylation (Trapero et al., 2012) did not cluster with any other sequence. None of 269 the described CsUGTs contains transmembrane domains (Supplemental Fig. S2) or chloroplast 270 transit peptides (Supplemental Table S1). 271 272 To verify the function of CsUGT74AD1, we cloned the corresponding cDNA in the bacterial 273 expression vector pTHIO (Spectr). As expected, co-expression of pTHIO-CsCCD2, pTHIO- 274 CsALDH3I1, and pTHIO-CsUGT74AD1 in an zeaxanthin-accumulating E. coli strain did not 275 result in accumulation of crocin, probably due to insufficient levels of UDP-glucose (UDP-glc) 276 in E. coli, which is required for UGT activity (Ross et al., 2001). We thus performed an in vitro 277 assay using CsUGT74AD1 produced in the E. coli strain harboring the groES-groEL- 278 chaperones system (Nishihara et al., 1998). Immunoblotting with the anti-His6 antibody 279 revealed a band corresponding to the CsUGT74AD1:thioredoxin fusion protein (69.7 kDa) in 280 soluble extracts of arabinose-induced cells (Supplemental Fig. S8). We performed an in vitro

281 assay using 40 µg of soluble E. coli extract, encapsulated crocetin, and UDP-glc as substrates 282 (Moraga et al., 2004). The reaction was incubated at 30°C for increasing periods of time, 283 followed by analysis of semi-polar and polar metabolites by HPLC-PDA-HRMS. In the assay 284 performed with extract of cells transformed with the empty pTHIO vector, we only detected two 285 peaks with a maximum absorbance at 440 nm, corresponding to trans- and cis-crocetin. On the 286 contrary, in the presence of CsUGT74AD1, we detected 2 additional peaks (Fig. 5A) 287 corresponding to the monoglucosyl and diglucosyl esters of crocetin (crocin 1 and 2’, 288 respectively; Fig. 5B). A time course of the reaction is shown in Figure 5C: the monoglucosyl 289 ester is a reaction intermediate reaching a maximum between 10 and 20 min, whereas an almost 290 complete conversion of crocetin into the diglucosyl ester, crocin 2’, was detected in 60 min. 291 Although we incubated the reaction for up to 120 min and repeated the assay several times, we 292 could not detect the formation of gentiobiosyl esters of crocetin, which are the most abundant 293 forms of crocins in mature stigmas (Fig. 5A). Thus, in our hands, the CsUGT74AD1 enzyme 294 performed only the first step of crocetin glycosylation (addition of glucose moieties to crocetin), 295 in agreement with previous data obtained in G. jasminoides (Nagatoshi et al., 2012) and C. 296 sativus (Cote et al., 2001). 297 298 The activity of CsUGT74AD1 was also tested on a broad range of different substrates known to 299 undergo glycosylation in planta, using UDP-glc or UDP-galactose (UDP-gal) as sugar donors. 300 We observed that the enzyme is highly specific, showing a high activity with crocetin and UDP- 301 glc (81.3% conversion in 30 min, Supplemental Table S3), although we detected a lower 302 activity with UDP-gal as a sugar donor (35.5% conversion in 30 min). The enzyme also 303 displayed low levels of activity, with UDP-glc as sugar donor, on flavonoids, i.e. quercetin and 304 naringenin, and on the phenolic acid cinnamic acid, whereas it did not show any activity with 305 ABA or indole 3-acetic acid (IAA; Supplemental Table S3). These results suggest that 306 CsUGT74AD1 is the enzyme responsible for the primary glycosylation of crocetin. 307 308 CsCCD2, CsALDH3I1, and CsUGT74AD1 tissue specificity, solubility, and subcellular 309 localization

310 To analyze the tissue-specific expression pattern of the CsCCD2, CsALDH3I1, and 311 CsUGT74AD1 enzymes in flowers of C. sativus, we raised polyclonal antibodies against 312 immunogenic peptides from the three proteins (see Materials and Methods) and used them in 313 immunoblot analysis on protein extracts from C. sativus stigmas, stamens, and tepals at anthesis 314 (Fig. 6A). The antibodies raised against CsCCD2 recognized a single band corresponding to the 315 molecular mass of the enzyme (63 kDa after the removal of the transit peptide), which was only

316 present in the stigma fraction. The anti-CsALDH3I1 antibodies recognized a major band of 53 317 kDa, corresponding to the molecular mass of the protein, which was highly expressed in 318 stigmas, but also present at much lower levels in stamens and tepals. Anti-CsALDH3I1 319 antibodies also recognized several fainter bands, likely due to cross-reactivity with other ALDH 320 enzymes. The antibodies raised against CsUGT74AD1 recognized a band of 51 kDa, which 321 corresponds to the molecular mass of CsUGT74AD1, and two additional bands with molecular 322 masses of 69 and 29 kDa. The 29 kDa band is too small to represent a functional UGT (Gachon 323 et al., 2005) and corresponds probably to a proteolytic product of CsUGT74AD1. In agreement 324 with this hypothesis, the 51 and 29 kDa bands are present together in the stigma fraction and are 325 absent in other tissues. In contrast, we detected the 69 kDa band in all three tissues, indicating 326 that it represents an unrelated UGT or a different protein.

327 The substrates of CsCCD2 and CsALDH3I1 (zeaxanthin and crocetin dialdehyde, respectively) 328 are hydrophobic molecules that are presumably membrane-associated in vivo. Accordingly, both 329 CsCCD2 and CsALDH3I1 contain a transmembrane domain (Supplemental Fig. S2), which is 330 in CsALDH3I1 reminiscent of an ER localization sequence (Masaki et al., 1994). To determine 331 the solubility of the three enzymes involved in crocin biosynthesis, we homogenized C. sativus 332 stigmas in PBS buffer to lyse plastids, and then sequentially fractionated the extracts into 333 soluble proteins, extrinsic membrane proteins, and insoluble proteins (respectively, lanes 1, 2, 334 and 3 of each panel in Fig. 6B). Interestingly, all three enzymes were found in the insoluble 335 fraction (lane 3 in Fig. 6B). This result was expected for CsCCD2 and CsALDH3I1 that contain 336 a transmembrane domain, but not for CsUGT74AD1 that, like other CsUGTs, does not have any 337 hydrophobic domain (Supplemental Fig. S2). 338 339 To determine the localization of the three enzymes within stigma cells, we performed 340 immunogold electron microscopy on mature stigmas. Figure 7, A and B, each show a Scanning 341 Electron Micrograph (SEM) of a C. sativus stigma. Figure 7C shows an Immuno Electron 342 Micrograph (IEM) of a crocin-accumulating cell, decorated with a secondary antibody coupled 343 to colloidal gold. The various organelles, i.e. nucleus, chromoplast, cell wall, and vacuole, are 344 clearly visible without any gold particles. Figure 7, D and E, show respectively low and high 345 magnification IEM of cells immunodecorated using the primary anti-CsCCD2 antibodies 346 followed by the secondary antibody coupled to colloidal gold. The gold particles are localized to 347 the chromoplasts, in agreement with the reported plastid localization of a CCD2 from C. 348 ancyrensis (Ahrazem et al., 2016) and the predicted presence of plastid transit peptide for this 349 enzyme (Supplemental Table S1). The CsCCD2 signal was homogeneously distributed in the 350 organelles. IEM with anti-CsUGT74AD1 antibodies gave a clear signal in the cytoplasm (Fig. 7,

351 F and G). In the higher magnification, the gold particles showed an association with electron- 352 dense filamentous structures reminiscent of membranes or cytoskeletal elements (Fig. 7G). A 353 cytoskeletal association of UGTs was previously reported for the maize UDP-glucose starch 354 glycosyltransferase (Azama et al., 2003). The membrane or cytoskeletal association of 355 CsUGT74AD1 could explain its insolubility. Unfortunately, IEM performed using two different 356 anti-CsALDH3I1 antibodies gave no signal, probably due to the fact that the epitopes 357 recognized by these antibodies are not accessible in the folded protein. 358 359 To confirm the data obtained by IEM on CsCCD2 and CsUGT74AD1 and to determine the 360 subcellular localization of CsALDH3I1, we fused the three proteins to enhanced Green 361 Fluorescent Protein (eGFP; Cinelli et al., 2000) and expressed them in N. benthamiana leaves 362 through infiltration with Agrobacterium tumefaciens (strain C58C1). The confocal microscopy 363 results indicate that CsCCD2:eGFP is localized on chloroplast-associated speckles (Fig. 8A), 364 further confirming the plastid localization demonstrated by IEM. In contrast, CsUGT74AD1 365 showed a cytosolic localization (Fig. 8A), which was further confirmed by coexpression with 366 cytosolic mCherry (Fig. 8C). Finally, CsALDH3I1 labeled a reticulate membrane network that 367 is likely identical with the ER (Fig. 8A). Indeed, CsALDH3I1 contains a canonical C-terminal 368 retention signal (KKRK, Supplemental Fig. S1; Benghezal et al., 2000). Coexpression of 369 CsALDH3I1 with the ER marker RFP-HDEL showed the colocalization of both proteins, thus 370 confirming that CsALDH3I1 is an ER-associated enzyme (Fig. 8B). 371 All other CsALDH proteins investigated in this study showed a cytosolic localization, as judged 372 by confocal fluorescence microscopy, with the exception of CsALDH5F1 that may be a 373 mitochondrial enzyme (Supplemental Fig. S9, Supplemental Table S1). 374 375 Discussion 376 In this and in a previous work (Frusciante et al., 2014), we have isolated and characterized 377 transcripts expressed in C. sativus stigmas, encoding CCD, ALDH, and UGT enzymes that 378 respectively catalyze the first, second, and third step in C. sativus crocin biosynthesis in E. coli 379 and/or in vitro.

380 The first step: cleavage of zeaxanthin 381 382 The C. sativus enzyme CsCCD2 has been previously shown to catalyze the first dedicated step 383 in crocin biosynthesis, i.e. the cleavage of zeaxanthin to crocetin dialdehyde (Frusciante et al., 384 2014). A CCD2 from the spring crocus C. ancyrensis, which synthesizes crocins in tepals, is 385 localized to plastids when overexpressed in tobacco leaves (Ahrazem et al., 2016). In this work,

386 both immunoelectron microscopy on C. sativus stigmas and confocal fluorescence microscopy 387 in N. benthamiana leaves confirmed the plastidial localization of CsCCD2, indicating that this 388 localization probably extends to the whole Crocus genus, irrespective of the organ where 389 crocins are synthesized. CsCCD2 is homogeneously distributed in C. sativus stigma 390 chromoplasts and, upon extract fractionation, behaves as an insoluble enzyme, consistent with 391 the presence of a large internal transmembrane domain. 392 393 The second step: dehydrogenation of crocetin dialdehyde 394 395 We used an approach similar to that of Frusciante et al. (2014) to identify the ALDH 396 responsible for the second step in crocin biosynthesis. Plant ALDH enzymes have been 397 classified in 13 distinct families (Brocker et al., 2013). In our stigma transcriptome, we 398 identified six expressed ALDHs. In particular, CsALDH3H1 encodes a family 3 member closely 399 related to YLO-1, a N. crassa ALDH which is responsible for the conversion of β-apo-4- 400 carotenal to neurosporaxanthin (Estrada et al., 2008) and to Synechocystis sp. and Fusarium 401 fujikuroi ALDHs able to convert apocarotenals into the corresponding carboxylic acids 402 (Trautmann et al., 2013; Diaz-Sanchez et al., 2011), whereas CsALDH2C4 is closely related to 403 BoALDH, a Bixa orellana family 2 ALDH claimed to convert bixin dialdehyde into norbixin 404 (Bouvier et al., 2003); CsALDH2B4 and CsALDH6B2 are identical with or highly similar to 405 CsADH enzymes (Comp11367, Comp2946, Comp20158, and Comp3893) claimed to reside in 406 stigma chromoplasts (Gomez-Gomez et al., 2017); CsALDH5F1 and CsALDH7B4 encode 407 family 5 and 7 enzymes, respectively, reported to oxidize succinic semialdehydes and Δ1- 408 piperideine-6-carboxylate, α-aminoadipic semialdehydes, respectively (Brocker et al., 2013). 409 410 By expression in E. coli, we demonstrated that, of the six tested ALDH enzymes whose 411 transcripts are highly expressed in C. sativus stigmas, only CsALDH3I1 is able to catalyze the 412 conversion of crocetin dialdehyde into a mixture of trans- and cis-crocetin, whereas all other 413 ALDHs, including SynALDH, did not show any appreciable activity above the endogenous E. 414 coli background. In vitro assays confirmed the high activity of CsALDH3I1 in converting 415 crocetin dialdehyde into crocetin (Fig. 4) and indicated a strong preference for carotenoid- 416 derived substrates, particularly crocetin aldehyde and long-chain apocarotenals (Supplemental 417 Table S2). The CsALDH3I1 protein is expressed much more in stigmas, the tissue of crocin 418 biosynthesis, than in anthers and tepals. Taken together, these data strongly suggest that 419 CsALDH3I1 is the enzyme catalyzing the dehydrogenation of crocetin dialdehyde in C. sativus 420 stigmas. Interestingly, both CsALDH3I1 and the fungal apocarotenal dehydrogenase YLO-1

421 contain a C-terminal transmembrane domain, which is flanked by sequences rich in basic amino 422 acids and linked to the ALDH core through an unstructured domain (Supplemental Fig. S1; 423 Estrada et al., 2008). It has been suggested that this domain mediates YLO-1 association with 424 intracellular membranes (Estrada et al., 2008). Indeed, a rat microsomal ALDH contains very 425 similar C-terminal domain that is responsible for posttranslational targeting to the endoplasmic 426 reticulum (ER; Masaki et al., 1994). 427 428 We were unable to obtain a specific IEM reaction using two distinct anti-CsALDH3I1 429 antibodies. However, confocal fluorescence in N. benthamiana leaves showed a clear 430 localization in a cytoplasmic reticular structure, similar to that observed for ER-localized 431 proteins harboring a C-terminal KKXX signal (Benghezal et al., 2000), also found in 432 CsALDH3I1. CsALDH3I1 clearly co-localized with an ER marker in N. benthamiana leaves 433 and, upon fractionation of C. sativus stigma extracts, it behaved as an insoluble protein, in 434 keeping with its ER localization. 435 436 Based on proteomic data, several C. sativus stigma ALDHs have been claimed to reside in the 437 plastid (Gomez-Gomez et al., 2017), including CsADHComp54788, a truncated CsALDH3I1 438 form that lacks the C-terminal hydrophobic tail likely mediating ER localization. However, 439 neither CsADHComp54788 nor CsALDH3I1 are expected to occur within plastids, as judged by 440 TargetP analysis. Furthermore, none of the additional CsALDH enzymes, many of which are 441 highly similar to those identified by (Gomez-Gomez et al., 2017), showed a plastidial 442 localization in N. benthamiana leaves. Of course, it is still possible that a plastid-localized 443 ALDH is expressed at very low levels in C. sativus stigmas and therefore is not present in our 444 transcriptome data. 445 446 The third step: glycosylation of crocetin 447 448 In spite of several efforts, we were not able to retrieve, in our transcriptome or in that of Jain et 449 al. (2016), a sequence encoding UGTCs2, which has been claimed to perform both primary and 450 secondary glycosylation of crocetin (Moraga et al., 2004) and to reside in stigma chromoplasts 451 (Gomez-Gomez et al., 2017). We instead identified the close homolog CsUGT74AD1, which, 452 based on immunoblot analysis estimates, is a very abundant protein in C. sativus stigmas. 453 CsUGT74AD1 possesses all the characteristics of bona fide plant UGTs, including the presence 454 of His22 and Asp121, shown to be essential for enzymatic activity (Shao et al., 2005). Using an 455 in vitro assay, we showed that CsUGT74AD1 is able to perform primary, but not secondary

456 glycosylation of crocetin. CsUGT74AD1 shows a strong preference for crocetin as a substrate 457 and accepts both UDP-glc and, with lower affinity, UDP-gal as sugar donors. Similar to 458 CsALDH3I1, also the CsUGT74AD1 protein is much more expressed in stigma than in anthers 459 and tepals. Overall, the data suggest that CsUGT74AD1 mediates primary glycosylation of 460 crocetin in C. sativus stigmas. Thus, in C. sativus the situation seems to be similar to in G. 461 jasminoides, where the biosynthesis of crocins involves two UGTs acting hierarchically: one 462 (GjUGT75L6, a close homolog of CsUGT74AD1) produces crocin 1 and 2’, and a second one 463 (GjUGT94E5) is responsible for production of crocin 2, 3, and 4 (Nagatoshi et al., 2012). We 464 were unable to find bona fide orthologs of GjUGT94E5 in our transcriptome or in that reported 465 by Jain et al. (2016). Characterization of additional UGTs expressed in C. sativus stigmas will 466 elucidate their possible role in hierarchical crocin glycosylation. 467 468 The CsUGT74AD1 protein does not present obvious transmembrane domains, but it is insoluble 469 upon extract fractionation. A similar behavior has been observed for several enzymes in 470 carotenoid biosynthesis, such as phytoene desaturase, which is present in plastids in a soluble 471 complex with HSP70, and in a second, membrane-associated complex containing the active 472 enzyme (Al-Babili et al., 1996). The insolubility of CsUGT74AD1 was consistent with 473 immunogold labeling, showing that the enzyme (or a cross-reacting UGT) localizes to 474 cytoplasmic electron-dense structures reminiscent of membrane or cytoskeletal structures. 475 Confocal microscopy confirmed that the protein co-localizes with mCherry, a cytosolic marker, 476 in N. benthamiana leaves. This localization is in agreement with the cytosolic localization of the 477 majority of plant UGTs (Gachon et al., 2005) but in disagreement with the plastidial localization 478 described, based on proteomic data, for the very similar UGTCs2 (Gomez-Gomez et al., 2017). 479 Given the extremely high abundance of CsUGT74AD1 and its similarity to UGTCs2, we 480 believe that the plastidial-associated peptides identified by Gomez-Gomez et al. (2017) and 481 attributed to UGTCs2 belong instead to CsUGT74AD1. One possible explanation of the 482 plastidial localization claimed by Gomez-Gomez et al. (2017) for both ALDH and UGT 483 enzymes is a contamination of the chromoplast membrane preparations with non-plastidial 484 proteins, as suggested by the low-level mitochondrial and peroxisomal contamination observed 485 (Gomez-Gomez et al., 2017). 486 487 A model for crocin biosynthesis and trafficking from the plastid to the vacuole 488 489 Plastids and ER have “biochemical continuity”, as demonstrated by the fact that mutations in 490 plastid-localized enzymes affecting tocopherol biosynthesis can be complemented by directing

491 the same enzymes to the ER (Mehrshahi et al., 2013). This finding suggests that plastidial and 492 ER membranes are in close contact, allowing hydrophobic molecules like tocopherol 493 biosynthetic intermediates or crocetin dialdehyde to migrate from one compartment to the other 494 (Fig. 9). Our model (Fig. 9) suggests that the ER acts as a “transit center” for metabolites whose 495 biosynthesis starts in the chloroplast and ends in the vacuole. This type of compartmentation has 496 been described also for the synthesis of steviosides, which are glycosylated diterpenes that 497 accumulate in the vacuoles of Stevia rebaudiana leaves and confer an intensely sweet flavor. 498 Similar to crocins, the first dedicated step in the biosynthesis of steviosides is mediated by a 499 plastid-localized kaurene synthase and the second step by an ER-localized kaurene oxidase 500 (Brandle and Telmer, 2007). The model also predicts that the vacuolar transport of crocins and 501 steviosides, similar to that of other glycosylated secondary metabolites, is mediated by 502 tonoplast-localized transporters (Fig. 9; Martinoia et al., 2007). This model may apply to the 503 subcellular compartmentation of other pathways, such as the biosynthesis of ABA-GE (Dong et 504 al., 2015; Nambara and Marion-Poll, 2005) or of glycosylated apocarotenoids in leaves (Latari 505 et al., 2015). 506 507 Although the expression pattern, substrate-specificity, and tissue-specificity of CsALDH3I1 and 508 CsUGT74AD1 strongly suggest that they are involved in biosynthesis of crocins 1 and 2’, we 509 have no proof yet for their function in planta. Due to the genetic intractability of C. sativus, 510 such proof could be obtained only by heterologous expression in plant tissues containing 511 appropriate levels of the substrates, as already done for CCD2 in maize endosperm (Frusciante 512 et al., 2014). Unfortunately, this tissue contains an endogenous ALDH activity able to 513 dehydrogenate crocetin dialdehyde (Frusciante et al., 2014). Another limitation of the model is 514 that we have not shown that the substrates and products of the three enzymes are indeed 515 localized in the extrapastidial locations (except for crocins, which are localized in the vacuole). 516 This will be the subject of future studies.

517 518 Based on microscopic observations, Gomez-Gomez et al. (2017) proposed an alternative model, 519 i.e. that crocin biosynthesis takes place entirely in the plastid and that crocins accumulate in 520 “crocinoplast” vesicles that move from the plastid to the vacuole. Our model does not exclude 521 the existence of such a pathway. However, none of the ALDH and UGT enzymes we 522 characterized showed a plastidial localization. Similar to the ER-cytoplasmic pathway we 523 describe here, the enzymes involved in the hypothesized plastidial pathway must be isolated and 524 functionally characterized and their subcellular localization must be determined. 525

526 527

528 Materials and Methods

529 Transcriptomic and bioinformatic analyses

530 Transcript sequences for the putative enzymes were identify by homology with known enzymes 531 in 454 Titanium sequences of C. sativus stigmas at different developmental stages (Frusciante et 532 al., 2014; Aprea et al, in preparation) and confirmed in published transcriptomic data (Jain et al., 533 2016). Expression levels in different stigma developmental stages were obtained with Cufflinks 534 (Trapnell et al., 2012) from in-house data. Heat maps were created using Genesis as previously 535 described (Sturn et al., 2002; Diretto et al., 2010). Evolutionary relationships were inferred 536 using the neighbor-joining method (Saitou and Nei, 1987), and phylogenetic and molecular 537 evolutionary analyses were conducted using MEGA version 7 (Kumar et al., 2016) and CDD 538 NCBI tool (http://www.ncbi.nlm.nih.gov/Structure/cdd/cdd.shtml). Subcellular 539 compartmentation was deduced using TargetP 1.1 prediction servers and transmembrane 540 domains using TMHMM 2.0 software (http://www.cbs.dtu.dk/services/TMHMM/).

541 Cloning of C. sativus genes 542 C. sativus ALDH and UGT transcripts were isolated from C. sativus stigma RNA using the 543 Omniscript RT cDNA synthesis kit (Qiagen). CDSs were amplified from cDNA using Phusion 544 High Fidelity DNA polymerase (NEB) with the oligonucleotides listed in Supplemental Table 545 S4. Amplicons were cloned in the pBlueScript vector (Stratagene) digested with EcoRV, 546 verified by sequencing and then re-amplified with the oligonucleotides listed in Supplemental 547 Table S4. The PCR products were cloned in the pTHIO vector (Trautmann et al., 2013) fused to 548 an in frame 5′ thioredoxin gene and to 3′ VP5 epitope and 6xHIS-tag. The ALDH genes were 549 cloned in pTHIO (Ampr) vector obtaining the pTHIO-CsALDHs (Ampr) constructs. 550 CsUGT74AD1 was cloned in a modified pTHIO vector harboring the spectinomycin resistance 551 gene (Spectr) instead of Ampr, producing the pTHIO-CsUGT74AD1 (Spectr) construct. The 552 previously isolated CsCCD2 gene (Frusciante et al., 2014), was cloned in a modified pTHIO 553 vector harboring the chloramphenicol resistance gene (Cmr), obtaining the pTHIO-CsCCD2 554 (Cmr) construct.

555 In bacterio ALDH assay

556 The zeaxanthin accumulating strain of E. coli (Kanr), previously described (Frusciante et al., 557 2014), was transformed with pTHIO-CsCCD2 (Cmr) and one of the six pTHIO-CsALDHs 558 (Ampr) constructs or with the pTHIO-SynALDH (Ampr), that harbors the ALDH1 gene of 559 Synechocystis sp. PCC6803 (Trautmann et al., 2013). As a control, the strain was transformed 560 with pTHIO empty vector or with pTHIO-CsCCD2 (Cmr) alone. Overnight cultures of these

561 clones were inoculated into 50 mL of LB medium containing half-strength of antibiotics (25 562 μg/ml kanamycin, 12.5 μg/ml chloramphenicol, and/or 50 μg/ml ampicillin), grown at 37°C to

563 an OD600 of 0.7, and induced with 0.08% (w/v) arabinose at 20°C for 16 h. Cells were pelleted 564 and polar and non-polar fractions extracted. Polar and semi-polar metabolites were extracted as 565 previously described (Fasano et al., 2016; Rambla et al., 2016) with slight modifications: pellets 566 were re-suspended in 10 ml of 75% (v/v) methanol spiked cold (0.5 µg/ml formononetin, 567 Sigma-Aldrich), lysed on ice by triplicate sonication at 10 Hz output (10 seconds each) and 568 centrifuged at 18,000 x g for 30 min. The supernatant was then dried and re-dissolved in 200 μl 569 of 75% (v/v) methanol, centrifuged at 18,000 x g for 20 min to remove particles and aggregates, 570 and subjected to HPLC-PDA-HRMS analysis. Non-polar metabolites were extracted with the 571 same procedure using 100% acetone spiked cold (0.5 µg/ml α-tocopherol acetate, Sigma- 572 Aldrich) for extraction and chloroform for re-suspension.

573 In vitro ALDH and UGT assays

574 The pTHIO-CsALDH3I1 and pTHIO-CsUGT74AD1 plasmids were expressed in the E. coli 575 BL21(pGro7) strain and protein expression, solubilization with Triton X-100 and preparation of 576 lysates were performed as described (Trautmann et al., 2013; Frusciante et al., 2014). For 577 ALDH assays (Trautmann et al., 2013), 50 μg of protein extract were incubated with different 578 substrates (40 μM final concentration) in a 200 μl volume at 28°C in glass screw cap vials. In 579 the case of apocarotenals (crocetin dialdehyde, β-apo-8’-carotenal, and retinal), the substrates 580 were micellarized as described (Trautmann et al., 2013) and reactions were stopped by adding 581 400 µl acetone, extracted with petroleum/diethyl ether (1:2 v/v) and filtered using 0.22 μm filter 582 before HPLC-PDA-HRMS analysis. For the other aldehydes (dodecanal, hexanal, and 4-OH- 583 benzaldehyde), the reactions were stopped by derivatization with 2,4-dinitrophenylhydrazine 584 (DNPH). Briefly, an equal volume of 2 mM of 2,4-DNPH in ACN:1N HCl was added to the 585 reactions and incubated at 40°C for 30 min and then at 4°C overnight. The pH was then adjusted 586 to pH 4.0, samples centrifuged at 20,000 x g for 20 min and the supernatant was filtered before 587 HPLC-PDA-HRMS analysis. The percentage of substrate conversion was calculated based on 588 the peak area of each substrate in enzyme-containing assays (extract from induced cells 589 transformed with the pTHIO-CsALDH3I1 construct) compared to control incubations (extract 590 from induced cells containing the pTHIO empty vector).

591 For UGT assays (Moraga et al., 2004), 40 µg of protein extract were incubated in 100 µl of 592 reaction containing 100 µM of the various substrates, either encapsulated crocetin, or ABA, 593 naringenin, quercetin, 3-indole acetic acid, and cinnamic acid. UDP-glc or UDP-gal (2.5 mM)

594 were included as sugar donors. The reaction was incubated at 30°C and stopped by adding 100 595 µl of cold ethanol and immediately freezing at -20°C. The HPLC-PDA-HRMS analysis was 596 performed as following described and the percentage of substrate conversion was calculated as 597 described for CsALDH3I1 assays.

598 HPLC-PDA-HRMS analysis

599 Polar and non-polar extracts were analyzed with a Q-Exactive mass spectrometer (Thermo 600 Fisher Scientific), coupled to a HPLC system equipped with a photodiode array detector 601 (Dionex). HPLC separation of polar and semi-polar metabolites (crocetin, crocins, naringenin, 602 quercetin, cinnamic acid, ABA, and IAA) and 2, 4-DNPH-linked aldehydes was performed as 603 previously described (Alboresi et al., 2016; D'Esposito et al., 2017) with some modifications. 1- 604 5 µl of sample were injected on a C18 Luna reverse-phase column (100 x 2.1 mm, 2.5µm; 605 Phenomenex) using mobile phases water + 0.1% (v/v) formic acid (A) and acetonitrile + 0.1% 606 formic acid (v/v) (B) at a total flow rate of 250 µl/min. The separation of polar and semi-polar 607 metabolites was developed using 5% B for 0.5 min, followed by a 24 min linear gradient to 75% 608 B. The separation of the 2, 4-DNPH-linked aldehydes was developed using 20% B for 0.5 min, 609 followed by a 24 min linear gradient to 95% B. The ionization of polar and semi-polar 610 metabolites was performed using electrospray ionization (ESI) with nitrogen used as sheath and 611 auxiliary gas, set to 45 and 30 units, respectively. The vaporizer temperature was 270°C, the 612 capillary temperature was 30°C, the discharge current was set to 5 μA and S-lens RF level set at 613 50. The acquisition was performed in the mass range 110-1600 m/z both in positive and in 614 negative ion mode with the following parameters: resolution 70000, microscan 1, AGC target 615 1e6, maximum injection time 50. For the ionization of the 2, 4-DNPH-linked aldehydes, sheath 616 and auxiliary gas, were set to 40 and 10 units, respectively. The vaporizer temperature was 617 280°C, the capillary temperature was 250°C, the discharge current was set to 3.5 μA and S-lens 618 RF level set at 50. The acquisitions were performed as described above.

619 HPLC separation of non-polar metabolites (zeaxanthin, crocetin dialdehyde, β-apo-8’-carotenal, 620 and retinal) was performed as described previously (Liu et al., 2014; Su et al., 2015) injecting 1- 621 5 µl of sample on a C30 reverse-phase column (100 × 3.0 mm; YMC Europe). The mobile 622 phases used were composed by methanol (A), water/methanol (20:80, v/v) containing 0.2% 623 ammonium acetate (B), and tert-butyl methyl ether (C) at a total flow rate of 800 µl/min. The 624 separation was developed using 95% A/5% B for 1.3 min, followed by 80% A/5% B/15% C for 625 2.0 min and by a subsequent 9.2 min linear gradient to 30% A/5% B/65% C. After photodiode 626 array detection, the flow was split and 300 µl sent to the MS source. The ionization of non-polar

627 metabolites was performed with an atmospheric-pressure chemical ionization (APCI) source. 628 Nitrogen was used as sheath and auxiliary gas, set to 20 and 10 units, respectively. The 629 vaporizer temperature was 300°C, the capillary temperature was 250°C, the discharge current 630 was set to 5.5 μA and S-lens RF level set at 50. The acquisition was performed as described for 631 ESI. UV-VIS detection was continuous 220–700 nm. All solvents used were LC-MS grade 632 (Merck Millipore).

633 Identification was achieved on the basis of accurate masses and by comparison with authentic 634 reference substances. Representative mass chromatograms of the various analytes are shown in 635 Supplemental Figure S10. The ion peak areas were normalized to the ion peak area of the 636 internal standard (formononetin or α-tocopherol acetate for, respectively, polar/semi-polar and 637 non-polar metabolites).

638 Extract fractionation and immunoblot analysis

639 To analyze protein expression in bacterial clones, total proteins or soluble extracts from induced

640 100 μL induced cultures (OD600=0.7) were loaded on a 10% SDS-PAGE gel using a Bio-Rad 641 Mini Protean device. The gel was stained or subjected to immunoblot analysis as previously

642 described (Demurtas et al., 2016), using a mouse monoclonal anti-His6 antibody (Roche, Cat 643 No. 11922416001) at 1:200 dilution, followed by 1 hour incubation with 1:10000 dilution of 644 HRP-conjugated goat anti-mouse IgG antibody (GE Healthcare, Cat No. NA931). To analyze 645 the presence of the CsCCD2, CsALDH3I1, and CsUGT74AD1 enzymes in C. sativus flowers, 646 total proteins were extracted from fresh stigmas, stamens, and tepals (Zafferanami, Varedo, 647 Italy) by grinding the tissues to a fine powder in liquid nitrogen and re-suspending in 10 648 volumes (w/v) of SDS-loading buffer. Samples were then lysed on ice by triplicate sonication at 649 10 Hz output (10 seconds each) and boiled for 10 min. After centrifugation at 18,000 x g for 30 650 min, the supernatant was recovered. Total protein content was measured by colorimetry, loading 651 10 µl of each sample on a SDS-PAGE followed by Coomassie staining and using the ImageLab 652 4.0 software (Bio-rad) for total proteins quantification. An equal amount content of total 653 proteins (10 µg) was run on a 10% SDS-PAGE gel, followed by immunoblot analysis (see 654 below). 655 656 To analyze the solubility of the CsCCD2, CsALDH3I1, and CsUGT74AD1 enzymes in stigma 657 extracts, the ground material was subjected to sequential extractions. Stigma powder was re-

658 suspended and homogenized with an Ultraturrax in 5 volumes of PB buffer (20 mM Na2HPO4, 2

659 mM NaH2PO4; pH 7.2) containing protease inhibitors (complete, EDTA-free, Roche), sonicated 660 3 times at 10 Hz output (10 seconds each) and centrifuged at 18,000 x g for 30 min. The

661 recovered supernatant corresponded to the soluble fraction, whereas the pellet was re-suspended 662 in 3 volumes of PB buffer + 200 mM NaCl by vortexing for 5 min at 1,000 rpm, kept in a rotary 663 shaker for 30 min at 4°C and centrifuged at 18,000 x g for 30 min. The supernatant recovered 664 after centrifugation contained the extrinsic membrane proteins. Finally, the pellet was 665 resuspended in 3 volumes of SDS-loading buffer (insoluble fraction).

666 For all experiments, PVDF membranes were incubated 2 h at room temperature with 1 µg/ml of 667 a polyclonal anti-CsCCD2, anti-CsALDH3I1 or anti-CsUGT74AD1 antibodies (affinity- 668 purified sera of rabbits immunized with the synthetic peptides MANKEEAEKRKKKP, 669 YGGKRDEKRLKIAP, or EVMDGERSGKIREN, respectively, from GenScript Co., USA), 670 followed by incubation for 1 h with a secondary anti-rabbit antibody (GE-Healthcare) at 671 1:15,000 dilution. The bound antibody was revealed as previously described (Demurtas et al., 672 2016).

673 Electron microscopy

674 Fresh stigmas were collected and cut in transversal sections, 2 mm long, and treated as follows. 675 For Scanning Electron Microscopy (SEM), samples were fixed with 2% (w/v) 676 paraformaldehyde + 2.5% (w/v) glutaraldehyde in 0.05 M cacodylate buffer, pH 7.2, overnight 677 at 4°C. Samples were washed in the same buffer and then fixed in 1% (w/v) OsO4 in 0.05 M 678 cacodylate buffer pH 7.2 for 1 h at room temperature and washed again in the same buffer. 679 Samples were then dried according to the critical point method using CO2 in a Balzers Union 680 CPD 020, and attached to aluminum stubs using a carbon tape and sputter-coated with gold in a 681 Balzers MED 010 unit. The observation was made by a JEOL JSM 6010LA scanning electron 682 microscope.

683 For Immuno Electron Microscopy (IEM), specimens were fixed with a mixture of 4% (w/v) 684 paraformaldehyde + 0.25% (w/v) glutaraldehyde in 0.05 M phosphate buffer, pH 6.9 for 1h at 685 room temperature. After rinsing three times in the same buffer for 30 min, samples were 686 dehydrated in a graded ethanol series and embedded in medium grade LR White resin (Multilab 687 Supplies, Surrey, England). The resin was polymerized in tightly capped gelatin capsules for 48 688 h at 50°C. Ultrathin sections were cut with Reichert Ultracut and LKB Nova ultramicrotomes 689 using a diamond knife, and collected on nickel grids. For immunogold staining in post- 690 embedding (IGS), the incubation protocol suggested by Aurion was used (Aurion, Wageningen, 691 the Netherlands). Residual aldehyde activity was suppressed by using PBS with 0.05 M glycine, 692 pH 7.4 for 20 min. A subsequent block step was made with 5% (w/v) BSA, 5% (v/v) normal 693 goat serum, and 0.1% (w/v) cold water fish skin gelatin for 30 min. Sections were washed in

694 incubation buffer (PBS and 0.1% BSA-cTM, pH 7.4; 3x5 min). Incubation with the primary 695 antibodies was made overnight in a moist chamber at 4°C. Anti-CsCCD2, anti-CsALDH3I1, 696 and anti-CsUGT74AD1 antibodies, previously described, were diluted in incubation buffer and 697 used at the concentration of 5 µg/ml (anti-CsCCD2) and 1 µg/ml (anti-CsALDH3I1 and anti- 698 CsUGT74AD1). In addition, for CsALDH3I1 another primary antibody (affinity-purified sera 699 of rabbits immunized with the synthetic peptides VKELRESFNKGTTR, GenScript Co., USA), 700 at 1 µg/ml concentration, was also used. Sections were then washed in incubation buffer (6x5 701 min) and incubated for 1 h with a secondary goat anti-rabbit antibody conjugated to 20 nm gold 702 particles (British BioCell International, UK), diluted 1:10 in incubation buffer. After rinsing in 703 incubation buffer (6x5 min), the grids were washed in PBS (6x5 min). Sections were 704 subsequently stained with uranyl acetate and observed with a Jeol JEM EXII transmission 705 electron microscope at 100 kV. Micrographs were acquired by the Olympus SIS VELETA CCD 706 camera equipped the iTEM software. Control sections in which the primary antibodies were 707 omitted were also analyzed. 708 709 Transgene expression in N. benthamiana leaves and confocal microscopy

710 The C-terminus of CsALDHs and CsUGT74AD1 were fused to the N-terminus of enhanced 711 Green Fluorescent Protein (eGFP), with gene sequences cloned in the pBI-eGFP vector 712 (Frusciante et al., 2014) using Gibson assembly (Gibson et al., 2009): the vector was digested 713 with XbaI restriction enzyme, whereas CsALDHs and CsUGT74AD1 CDSs were amplified with 714 Q5 High Fidelity DNA polymerase (NEB, Cat No. M0491S) from pBluescript-CsALDHs and 715 pBluescript-CsUGT74AD1 constructs. A Pro-Gly-Pro tripeptide was introduced as a linker 716 between the analyzed polypeptides and eGFP. The oligonucleotides used are listed in 717 Supplemental Table S4. The purified PCR fragments were then assembled generating pBI- 718 CsALDHs:eGFP constructs and pBI-CsUGT74AD1:eGFP constructs and checked by 719 sequencing before transformation in Agrobacterium tumefaciens strain C58C1. To obtain the 720 pBI-CsCCD2:eGFP construct, harboring the full-length CsCCD2 sequence, comprising the 721 chloroplast transit peptide (Ahrazem et al., 2016) the sequence coding for the transit peptide 722 (ATGGAATCTCCTGCTACTAAATTACCTGCACCTCTGCTGATGTTATCTTCTTCTCCA 723 TTCCTTCTCCCTTCTCCTAATAAGAGCTCCTCCATCTTCCTTCCACGTAAATTAGGGC 724 CGCTACCTCCAAAATATTATTATTACAATTGCTGCCATCCTAAGAGTAGATCAATCT 725 CAGTAGTATCA) was synthesized by Genscript Co., USA and inserted by Gibson assembly at 726 the 5′ of the CsCCD2 gene inserted in the pBI-CsCCD2:eGFP construct, as described in 727 Frusciante et al. (2014). Agroinfiltration of N. benthamiana leaves was performed as described

728 (Hamilton and Baulcombe, 1999). Cultures with OD600 = 0.4 were incubated in a solution

729 containing 10 mM MgCl2, 10 mM MES, and 100 M acetosyringone for 2 hours. Young leaves 730 of 6-week-old N. benthamiana plants, grown under hydroponic conditions, were agroinfiltrated 731 with C58C1 strain containing one of the following constructs: pBI-eGFP; pBI-CsCCD2:eGFP; 732 pBI-CsALDHs:eGFP; pBI-CsUGT74AD1:eGFP; at least 4 independent leaves from 3 different 733 plants were agroinfiltrated with each construct. After 24 and 48 h, leaves were analyzed by a 734 confocal laser scanning microscope (Olympus FV1000). Lasers 488 nm (Ar) and 635 nm 735 (diode) were used to detect green and red fluorescence of eGFP and chlorophyll signals, 736 respectively. Images of 512x512 pixel were acquired in xyz scan mode using 20x objective 737 (N.A. 0.75) with optical zooming 3x, or 40x (N.A. 1.30) magnification and processed by 738 IMARIS (Bitplane, Switzerland) software. For co-localization studies, leaves were coinfiltrated 739 with C58C1 strains containing pBI121:CsALDH3I1:eGFP and pBI:RFP:HDEL (ER marker; 740 (Lee et al., 2013) or pBI121:CsUGT74AD1:eGFP and pBI:mCherry (cytosolic marker). GFP 741 and RFP/mCherry were excited at 488 nm and 561 nm respectively and detected in the 495–520 742 nm and 571–638 nm ranges respectively. Images were acquired on a Zeiss LSM880 confocal 743 microscope using a 63x (NA 1.4) oil immersion objective. 744 745 Supplemental Data 746 The following supplemental materials are available.

747 Supplemental Figure S1. Alignment of CsALDH, YLO-1, SynALDH, and BoALDH protein 748 sequences.

749 Supplemental Figure S2. Hydrophobic profiles of CsCCD2, ALDH, and UGT proteins.

750 Supplemental Figure S3. Simultaneous expression of CsCCD2 and different ALDHs in E. coli.

751 Supplemental Figure S4. Identification of trans- and cis-crocetin in E. coli.

752 Supplemental Figure S5. Expression and solubilization of CsALDH3I1:THIO from E. coli 753 BL21(pGro7).

754 Supplemental Figure S6. Endogenous E. coli activity on crocetin dialdehyde in vitro.

755 Supplemental Figure S7. Alignment of plant UGT protein sequences.

756 Supplemental Figure S8. Expression and solubilization of CsUGT74AD1:THIO from E. coli 757 BL21(pGro7).

758 Supplemental Figure S9. Subcellular localization of different CsALDH proteins in N. 759 benthamiana leaves.

760 Supplemental Figure S10. Representative HPLC-HRMS chromatograms of the reactions 761 reported in Supplemental Tables S2 and S3.

762 Supplemental Table S1. Predicted and experimentally confirmed subcellular localization of 763 CsCCD2, CsALDHs, and CsUGTs proteins and their characterized A. thaliana homologs.

764 Supplemental Table S2. CsALDH3I1 substrate preference. 765 Supplemental Table S3. CsUGT74AD1 substrate preference. 766 Supplemental Table S4. Oligonucleotides used to isolate and clone CsALDHs and 767 CsUGT74AD1 genes. 768

769 Accession numbers

770 Genbank accession numbers: CsALDH2B4 (MG672523); CsALDH2C4 (MF596160); 771 CsALDH3I1 (MF596165); CsALDH5F1 (MF596161); CsALDH6B2 (MG672524); 772 CsALDH7B4 (MF596162); CsUGT74AD1 (MF596166). Sequences will be made public upon 773 manuscript acceptance. 774

775 Acknowledgments

776 We thank Elisabetta Bennici (ENEA) for the growth of N. benthamiana plants; Salvatore 777 Chiavarini (ENEA) for suggestions on 2,4-dinitrophenylhydrazine derivatization; Lourdes 778 Gomez-Gomes and Angela Rubio-Moraga (University of Albacete) and Zafferanami (Milano) 779 for provision of C. sativus flowers. Gaetano Perrotta, Paolo Facella, and Fabrizio Carbone 780 (ENEA) for 454 sequencing, and Aparna Balakrishna (KAUST) for technical assistance. Part of 781 the computing resources used for this work have been kindly provided by 782 CRESCO/ENEAGRID High Performance Computing infrastructure and its staff (Ponti et al., 783 2014). This work was supported by the European Union [From discovery to products: A next 784 generation pipeline for the sustainable generation of high-value plant products, FP7 Contract 785 613153] and King Abdullah University of Science and Technology (KAUST), and benefited 786 from the networking activities within the European Cooperation in Science and Technology 787 Action CA15136 (EUROCAROTEN). 788 789 Figure Legends

790 Figure 1. Crocin biosynthesis in C. sativus stigmas.

791 A, C. sativus flower at anthesis with red stigmas. B, Proposed scheme of crocin biosynthesis 792 (Frusciante et al., 2014). The CsCCD2 enzyme cleaves zeaxanthin at the 7,8 and 7’,8’ positions, 793 producing 3-OH-β-cyclocitral and crocetin dialdehyde. Crocetin dialdehyde is oxidized to 794 crocetin by an aldehyde dehydrogenase (ALDH), then glycosylated to crocins by UGT 795 enzymes. C, Sugar moieties of the four most abundant C. sativus crocins (crocins 1–4).

796 Figure 2. Candidate genes for crocin biosynthesis in C. sativus stigmas.

797 A, Phylogenetic relationships between ALDHs of Crocus sativus (Cs), Arabidopsis thaliana 798 (At), Bixa orellana (Bo), Synechocystis spp. (Syn), and Neurospora crassa (YLO-1), inferred 799 using the neighbor-joining method. The subcellular localization of ALDH enzymes, 800 experimentally demonstrated by Stiti et al. (2011b) or predicted by TargetP, is indicated by 801 colored dots. Accession numbers: CsALDH2B4 (MG672523), CsALDH2C4 (MF596160), 802 CsALDH3I1 (MF596165), CsALDH5F1 (MF596161), CsALDH6B2 (MG672524) and 803 CsALDH7B4 (MF596162) (described in this paper, indicated by black arrows); AtALDHs 804 (refer to Stiti et al. 2011b); BoALDH (AJ548846) (Bouvier et al., 2003); SynALDH 805 (ALJ68758.1) (Trautmann et al., 2013); YLO-1 (XP_011394899.1) (Estrada, et al., 2008); 806 CsADHComp2946 (AQM36713.1), CsADHComp11367 (AQM36717.1), CsADHComp20158 807 (AQM36716.1), CsADHComp3893 (AQM36715.1), and CsADHComp54788 (AQM36714.1) 808 (Gomez-Gomez et al., 2017); B, Expression of C. sativus CCD2, ALDH, and UGT enzymes in 809 stigma tissue at different developmental stages. Data are expressed as log2 of fragments per 810 kilobase per million (FPKM). Developmental stages: yellow, orange, red, two days before 811 anthesis (-2da), day of anthesis (0da), and two days after anthesis (+2da). C, Phylogenetic 812 relationships between UGTs of Crocus sativus (Cs), Arabidopsis thaliana (At), Gardenia 813 jasminoides (Gj), and Medicago truncatula (Mt), inferred using the neighbor-joining method. 814 Accession numbers: CsUGT74AD1 (MF596166) (described in this paper); UGTCs2 815 (AAP94878.1) (Moraga et al., 2004); CsGT45 (ACM66950.1) (Moraga et al., 2009); 816 CsUGT85V1 (AIF76150.1), CsUGT85U1 (AIF76152.1) and CsUGT85U2 (AIF76151.1) 817 (Ahrazem et al., 2015; Gomez-Gomez et al., 2017); CsUGT707B1 (CCG85331.1) (Trapero et 818 al., 2012); AtUGT71B6 (NP_188815.1), AtUGT71B7 (NP_188816.1), and AtUGT71B8 819 (NP_188817.1) (Dong and Hwang, 2014); GjUGT94E5 (F8WKW8.1) and GjUGT75L6 820 (F8WKW0.1) (Nagatoshi et al., 2012); MtUGT71G1 (AAW56092.1) (Shao et al., 2005). The 821 biosynthetic products of the various UGTs are represented by colored triangles. In panels A and 822 C, the percentage of replicate trees that clustered together in the bootstrap test is indicated to the 823 left of the branches.

824 Figure 3. CsALDH3I1 mediates crocetin biosynthesis in E. coli.

825 A to C, Accurate mass chromatograms of zeaxanthin (A), crocetin dialdehyde (B), and crocetin 826 (C) extracted from bacterial clones harboring the pTHIO empty vector or overexpressing 827 CsCCD2 alone or in combination with CsALDH3I1 or CsALDH2C4. Polar and non-polar 828 fractions were extracted from bacterial cells and run on a HPLC-PDA-HRMS system alongside 829 authentic standards. The metabolites have an accurate mass and a chromatographic mobility 830 identical to that of the authentic standard. Two peaks were detected of crocetin (1: trans- 2: cis- 831 isomers, see Supplemental Fig. S4). D to F, Relative quantities of zeaxanthin (D), crocetin 832 dialdehyde (E) and (F) detected by HPLC-APCI-HRMS (D and E) and HPLC-ESI-HRMS (F) 833 in recombinant clones. Data are means ± standard deviations of three independent growth 834 batches. Asterisks indicate statistically significant difference (Student’s t-test; P < 0.01) 835 compared to CsCCD2 values. Fold IS= fold internal standard.

836 Figure 4. CsALDH3I1 mediates crocetin biosynthesis in vitro.

837 A, HPLC chromatograms (abs at 440 nm) of in vitro assays performed for 120 min in the 838 absence (THIO) and in the presence (CsALDH3I1:THIO) of CsALDH3I1. STANDARD = 839 crocetin dialdehyde authentic standard. In the presence of CsALDH3I1 the crocetin dialdehyde 840 is converted into crocetin (1: trans- 2: cis- isomers; see Supplemental Fig. S4). B, Time course 841 of crocetin dialdehyde conversion in the presence of CsALDH3I1. Data are the average ± 842 standard deviation of three biological replicates and expressed as fold internal standard (Fold 843 IS).

844 Figure 5. CsUGT74AD1 mediates the synthesis of crocins 1 and 2’ in vitro.

845 A, HPLC chromatograms (abs at 440 nm) of in vitro assay reactions performed for 60 min in the 846 absence (THIO) and in the presence of the CsUGT74AD1 enzyme (CsUGT74AD1:THIO) or 847 extracted from mature saffron (saffron extract). t=trans; c=cis. B, HPLC-ESI-HRMS 848 chromatograms (extracted accurate masses) of trans crocin 1 and trans crocin 2’ accumulated in 849 the bacterial clone overexpressing the CsUGT74AD1 enzyme. Mass and PDA spectra of peaks 850 are shown in the right and left boxes, respectively. C, Time course of crocetin conversion into 851 trans crocin 1 and trans crocin 2’ in the presence of UGT enzyme. Data are the average ± 852 standard deviation of three biological replicates and expressed as fold internal standard (Fold 853 IS).

854 Figure 6. Tissue specificity and solubility of enzymes involved in crocin biosynthesis.

855 A, Immunoblot analysis performed on total proteins (10 µg) extracted from C. sativus stigmas, 856 stamens, and tepals, performed with rabbit polyclonal antibodies raised against CsCCD2, 857 CsALDH3I1, and CsUGT74AD1 peptides. B, Immunoblot analysis performed on total protein

858 extract from C. sativus stigmas. 1: soluble proteins extracted with PB buffer; 2: extrinsic 859 membrane proteins extracted with PB buffer + 200 mM NaCl; 3: insoluble proteins extracted 860 with SDS loading buffer (for details, see Materials and Methods).

861 Figure 7. Subcellular localization of CsCCD2 and CsUGT74AD1 in C. sativus stigmas.

862 A and B, Scanning Electron Microscopy (SEM) images of C. sativus stigmas. C to G, Immuno 863 Electron Microscopy (IEM) of C. sativus stigmas. IEM reactions were performed with an anti- 864 CsCCD2 antibody (D and E) and an anti-CsUGT74AD1 antibody (F and G) followed by an 865 anti-rabbit secondary antibody conjugated to 20 nm gold particles. As control, labeling was 866 performed omitting primary antibodies (C). For both proteins, a general view (scale bars: 2 µm) 867 and a 4X detail (scale bars: 500 nm) are shown. CsCCD2 was detected only in chromoplasts (D 868 and E), nnnnnnn.nnnnnnnnjbbbbbbbbbbbbbbbbbbbbbbbbbbkstructures (membranes or 869 cytoskeletal-like structures) (G). N: nucleus; CW: cell wall; C: chromoplast; M: mitochondrion; 870 V: vacuole; CS: cytoskeleton.

871 Figure 8. Subcellular localization of CsCCD2, CsALDH3I1, and CsUGT74AD1 expressed 872 in N. benthamiana leaves.

873 A, For each construct, red (chlorophyll fluorescence), green (GFP fluorescence), merged 874 (overlap of chlorophyll and GFP fluorescence), and a 2.5 x zoom of merged are shown. GFP 875 shows atypical cytoplasmic-nuclear localization; CsCCD2 localizes to plastid-associated 876 speckles; CsALDH3I1 shows a cytoplasmic, reticulate localization; CsUGT74AD1 shows a 877 cytoplasmic localization. B, 878 mmgfzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzxzzCo- 879 localization of RFP:HDEL (ER marker) and CsALDH3I1:eGFP. C, Co-localization of mCherry 880 (cytoplasmic marker) and CsUGT74AD1:eGFP is cytosol-localized. Scale bars: 10 μm.

881 Figure 9. Proposed model for crocin biosynthesis/compartmentation in C. sativus stigmas.

882 CsCCD2 cleaves zeaxanthin in the choromoplast, producing crocetin dialdehyde which migrates 883 to the ER, where it is converted to crocetin by CsALDH3I1. The ER and plastid membranes are 884 contiguous through the action of an interphase stabilizing complex (ISC; Mehrshahi et al., 885 2013). Crocetin is converted to crocins 1 and 2’ by CsUGT74AD1, associated to cytoplasmic 886 membranes or to the cytoskeleton (CS). A second, unidentified UGT converts crocins 1 and 2’ 887 into crocins 2, 3, and 4, which are then transported into the vacuole through one or more 888 unidentified tonoplast transporters.

889

890

891

892

893

894 References

895 896 897 Ahrazem O, Rubio-Moraga A, Berman J, Capell T, Christou P, Zhu C, Gomez-Gomez L 898 (2016) The carotenoid cleavage dioxygenase CCD2 catalysing the synthesis of crocetin 899 in spring crocuses and saffron is a plastidial enzyme. New Phytol 209: 650-663 900 Ahrazem O, Rubio-Moraga A, Trapero-Mozos A, Climent MF, Gomez-Cadenas A, 901 Gomez-Gomez L (2015) Ectopic expression of a stress-inducible glycosyltransferase 902 from saffron enhances salt and oxidative stress tolerance in Arabidopsis while alters 903 anchor root formation. Plant Sci 234: 60-73 904 Al-Babili S, von Lintig J, Haubruck H, Beyer P (1996) A novel, soluble form of phytoene 905 desaturase from Narcissus pseudonarcissus chromoplasts is Hsp70-complexed and 906 competent for flavinylation, membrane association and enzymatic activation. Plant J 9: 907 601-612 908 Alavizadeh SH, Hosseinzadeh H (2014) Bioactivity assessment and toxicity of crocin: a 909 comprehensive review. Food Chem Toxicol 64: 65-80 910 Alboresi A, Perin G, Vitulo N, Diretto G, Block M, Jouhet J, Meneghesso A, Valle G, 911 Giuliano G, Marechal E, Morosinotto T (2016) Light Remodels Lipid Biosynthesis in 912 Nannochloropsis gaditana by Modulating Carbon Partitioning between Organelles. 913 Plant Physiol 171: 2468-2482 914 Azama K, Abe S, Sugimoto H, Davies E (2003) Lysine-containing proteins in maize 915 endosperm: a major contribution from cytoskeleton-associated carbohydrate- 916 metabolizing enzymes. Planta 217: 628-638 917 Bathaie SZ, Farajzade A, Hoshyar R (2014) A review of the chemistry and uses of crocins 918 and crocetin, the carotenoid natural dyes in saffron, with particular emphasis on 919 applications as colorants including their use as biological stains. Biotech Histochem 89: 920 401-411 921 Benghezal M, Wasteneys GO, Jones DA (2000) The C-terminal dilysine motif confers 922 endoplasmic reticulum localization to type I membrane proteins in plants. Plant Cell 12: 923 1179-1201 924 Bisti S, Maccarone R, Falsini B (2014) Saffron and retina: neuroprotection and 925 pharmacokinetics. Vis Neurosci 31: 355-361 926 Bouvier F, Dogbo O, Camara B (2003) Biosynthesis of the food and cosmetic plant pigment 927 bixin (annatto). Science 300: 2089-2091 928 Bouvier F, Suire C, Mutterer J, Camara B (2003) Oxidative remodeling of chromoplast 929 carotenoids: Identification of the carotenoid dioxygenase CsCCD and CsZCD genes 930 Involved in Crocus secondary metabolite biogenesis. Plant Cell 15: 47-62. 931 Brandle J, Telmer P (2007) Steviol glycoside biosynthesis. Phytochemistry 68: 1855-1863 932 Brocker C, Vasiliou M, Carpenter S, Carpenter C, Zhang Y, Wang X, Kotchoni SO, 933 Wood AJ, Kirch HH, Kopecny D, Nebert DW, Vasiliou V (2013) Aldehyde 934 dehydrogenase (ALDH) superfamily in plants: gene nomenclature and comparative 935 genomics. Planta 237: 189-210 936 Chryssanthi DG, Lamari FN, Georgakopoulos CD, Cordopatis P (2011) A new validated 937 SPE-HPLC method for monitoring crocetin in human plasma--application after saffron 938 tea consumption. J Pharm Biomed Anal 55: 563-568 939 Cinelli RA, Ferrari A, Pellegrini V, Tyagi M, Giacca M, Beltram F (2000) The enhanced 940 green fluorescent protein as a tool for the analysis of protein dynamics and localization: 941 local fluorescence study at the single-molecule level. Photochem Photobiol 71: 771-776

942 Cote F, Cormier F, Dufresne C, Willemot C (2001) A highly specific glucosyltransferase is 943 involved in the synthesis of crocetin glucosylesters in Crocus sativus cultured cells. 944 Journ Plant Physiol 158: 553-560 945 D'Esposito D, Ferriello F, Molin AD, Diretto G, Sacco A, Minio A, Barone A, Di Monaco 946 R, Cavella S, Tardella L, Giuliano G, Delledonne M, Frusciante L, Ercolano MR 947 (2017) Unraveling the complexity of transcriptomic, metabolomic and quality 948 environmental response of tomato fruit. BMC Plant Biol 17: 66 949 Demurtas OC, Massa S, Illiano E, De Martinis D, Chan PK, Di Bonito P, Franconi R 950 (2016) Antigen Production in Plant to Tackle Infectious Diseases Flare Up: The Case of 951 SARS. Front Plant Sci 7: 54 952 Diaz-Sanchez V, Estrada AF, Trautmann D, Al-Babili S, Avalos J (2011) The gene carD 953 encodes the aldehyde dehydrogenase responsible for neurosporaxanthin biosynthesis in 954 Fusarium fujikuroi. Febs j 278: 3164-3176 955 Diretto G, Al-Babili S, Tavazza R, Scossa F, Papacchioli V, Migliore M, Beyer P, Giuliano 956 G (2010) Transcriptional-metabolic networks in {beta}-carotene-enriched potato tubers: 957 the long and winding road to the "Golden" phenotype. Plant Physiol 154: 899-912 958 Dong T, Hwang I (2014) Contribution of ABA UDP-glucosyltransferases in coordination of 959 ABA biosynthesis and catabolism for ABA homeostasis. Plant Signal Behav 9: e28888 960 Dong T, Park Y, Hwang I (2015) Abscisic acid: biosynthesis, inactivation, homoeostasis and 961 signalling. Essays Biochem 58: 29-48 962 Emanuelsson O, Nielsen H, Brunak S, von Heijne G (2000) Predicting subcellular 963 localization of proteins based on their N-terminal amino acid sequence. J Mol Biol 300: 964 1005-1016 965 Estrada AF, Youssar L, Scherzinger D, Al-Babili S, Avalos J (2008) The ylo-1 gene encodes 966 an aldehyde dehydrogenase responsible for the last reaction in the Neurospora 967 carotenoid pathway. Mol Microbiol 69: 1207-1220 968 Fasano C, Diretto G, Aversano R, D'Agostino N, Di Matteo A, Frusciante L, Giuliano G, 969 Carputo D (2016) Transcriptome and metabolome of synthetic Solanum 970 autotetraploids reveal key genomic stress events following polyploidization. New 971 Phytol 210: 1382-1394 972 Frusciante S, Diretto G, Bruno M, Ferrante P, Pietrella M, Prado-Cabrero A, Rubio- 973 Moraga A, Beyer P, Gomez-Gomez L, Al-Babili S, Giuliano G (2014) Novel 974 carotenoid cleavage dioxygenase catalyzes the first dedicated step in saffron crocin 975 biosynthesis. Proc Natl Acad Sci U S A 111: 12246-12251 976 Gachon CM, Langlois-Meurinne M, Saindrenan P (2005) Plant secondary metabolism 977 glycosyltransferases: the emerging functional analysis. Trends Plant Sci 10: 542-549 978 Gibson DG, Young L, Chuang RY, Venter JC, Hutchison CA, 3rd, Smith HO (2009) 979 Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat Methods 980 6: 343-345 981 Gomez-Gomez L, Parra-Vega V, Rivas-Sendra A, Segui-Simarro JM, Molina RV, Pallotti 982 C, Rubio-Moraga A, Diretto G, Prieto A, Ahrazem O (2017) Unraveling Massive 983 Crocins Transport and Accumulation through Proteome and Microscopy Tools during 984 the Development of Saffron Stigma. Int J Mol Sci 18 985 Hamilton AJ, Baulcombe DC (1999) A species of small antisense RNA in posttranscriptional 986 gene silencing in plants. Science 286: 950-952 987 Jain M, Srivastava PL, Verma M, Ghangal R, Garg R (2016) De novo transcriptome 988 assembly and comprehensive expression profiling in Crocus sativus to gain insights into 989 apocarotenoid biosynthesis. Sci Rep 6: 22456 990 Kirch HH, Bartels D, Wei Y, Schnable PS, Wood AJ (2004) The ALDH gene superfamily of 991 Arabidopsis. Trends Plant Sci 9: 371-377 992 Kotchoni SO, Kuhns C, Ditzer A, Kirch HH, Bartels D (2006) Over-expression of different 993 aldehyde dehydrogenase genes in Arabidopsis thaliana confers tolerance to abiotic

994 stress and protects plants against lipid peroxidation and oxidative stress. Plant Cell 995 Environ 29: 1033-1048 996 Kumar S, Stecher G, Tamura K (2016) MEGA7: Molecular Evolutionary Genetics Analysis 997 Version 7.0 for Bigger Datasets. Mol Biol Evol 33: 1870-1874 998 Latari K, Wust F, Hubner M, Schaub P, Beisel KG, Matsubara S, Beyer P, Welsch R 999 (2015) Tissue-Specific Apocarotenoid Glycosylation Contributes to Carotenoid 1000 Homeostasis in Arabidopsis Leaves. Plant Physiol 168: 1550-1562 1001 Lee H, Sparkes I, Gattolin S, Dzimitrowicz N, Roberts LM, Hawes C, Frigerio L (2013) An 1002 Arabidopsis reticulon and the atlastin homologue RHD3-like2 act together in shaping 1003 the tubular endoplasmic reticulum. New Phytol 197: 481-489 1004 Liu M, Diretto G, Pirrello J, Roustan JP, Li Z, Giuliano G, Regad F, Bouzayen M (2014) 1005 The chimeric repressor version of an Ethylene Response Factor (ERF) family member, 1006 Sl-ERF.B3, shows contrasting effects on tomato fruit ripening. New Phytol 203: 206- 1007 218 1008 Martinoia E, Maeshima M, Neuhaus HE (2007) Vacuolar transporters and their essential role 1009 in plant metabolism. J Exp Bot 58: 83-102 1010 Masaki R, Yamamoto A, Tashiro Y (1994) Microsomal aldehyde dehydrogenase is localized 1011 to the endoplasmic reticulum via its carboxyl-terminal 35 amino acids. J Cell Biol 126: 1012 1407-1420 1013 Mehrshahi P, Stefano G, Andaloro JM, Brandizzi F, Froehlich JE, DellaPenna D (2013) 1014 Transorganellar complementation redefines the biochemical continuity of endoplasmic 1015 reticulum and chloroplasts. Proc Natl Acad Sci U S A 110: 12126-12131 1016 Moraga AR, Mozos AT, Ahrazem O, Gomez-Gomez L (2009) Cloning and characterization 1017 of a glucosyltransferase from Crocus sativus stigmas involved in flavonoid 1018 glucosylation. BMC Plant Biol 9: 109 1019 Moraga AR, Nohales PF, Perez JA, Gomez-Gomez L (2004) Glucosylation of the saffron 1020 apocarotenoid crocetin by a glucosyltransferase isolated from Crocus sativus stigmas. 1021 Planta 219: 955-966 1022 Nagatoshi M, Terasaka K, Owaki M, Sota M, Inukai T, Nagatsu A, Mizukami H (2012) 1023 UGT75L6 and UGT94E5 mediate sequential glucosylation of crocetin to crocin in 1024 Gardenia jasminoides. FEBS Lett 586: 1055-1061 1025 Nambara E, Marion-Poll A (2005) Abscisic acid biosynthesis and catabolism. Annu Rev Plant 1026 Biol 56: 165-185 1027 Nishihara K, Kanemori M, Kitagawa M, Yanagi H, Yura T (1998) Chaperone coexpression 1028 plasmids: differential and synergistic roles of DnaK-DnaJ-GrpE and GroEL-GroES in 1029 assisting folding of an allergen of Japanese cedar pollen, Cryj2, in Escherichia coli. 1030 Appl Environ Microbiol 64: 1694-1699 1031 Ponti G, Palombi F, Abate D, Ambrosino F, Aprea G, Bastianelli T, Beone F, Bertini R, 1032 Bracco G, Caporicci M (2014) The role of medium size facilities in the HPC 1033 ecosystem: the case of the new CRESCO4 cluster integrated in the ENEAGRID 1034 infrastructure. In High Performance Computing & Simulation (HPCS), 2014 1035 International Conference on. IEEE, pp 1030-1033 1036 Rambla JL, Trapero-Mozos A, Diretto G, Rubio-Moraga A, Granell A, Gomez-Gomez L, 1037 Ahrazem O (2016) Gene-Metabolite Networks of Volatile Metabolism in Airen and 1038 Tempranillo Grape Cultivars Revealed a Distinct Mechanism of Aroma Bouquet 1039 Production. Front Plant Sci 7: 1619 1040 Ross J, Li Y, Lim EK, Bowles DJ (2001) Higher plant glycosyltransferases. Genome Biol 2: 1041 reviews3004.3001-3006 1042 Rubio-Moraga A, Trapero A, Ahrazem O, Gomez-Gomez L (2010) Crocins transport in 1043 Crocus sativus: the long road from a senescent stigma to a newborn corm. 1044 Phytochemistry 71: 1506-1513 1045 Saitou N, Nei M (1987) The neighbor-joining method: a new method for reconstructing 1046 phylogenetic trees. Mol Biol Evol 4: 406-425

1047 Shao H, He X, Achnine L, Blount JW, Dixon RA, Wang X (2005) Crystal structures of a 1048 multifunctional triterpene/flavonoid glycosyltransferase from Medicago truncatula. 1049 Plant Cell 17: 3141-3154 1050 Stiti N, Adewale IO, Petersen J, Bartels D, Kirch HH (2011a) Engineering the nucleotide 1051 coenzyme specificity and sulfhydryl redox sensitivity of two stress-responsive aldehyde 1052 dehydrogenase isoenzymes of Arabidopsis thaliana. Biochem J 434: 459-471 1053 Stiti N, Missihoun TD, Kotchoni SO, Kirch HH, Bartels D (2011b) Aldehyde 1054 Dehydrogenases in Arabidopsis thaliana: Biochemical Requirements, Metabolic 1055 Pathways, and Functional Analysis. Front Plant Sci 2: 65 1056 Sturn A, Quackenbush J, Trajanoski Z (2002) Genesis: cluster analysis of microarray data. 1057 Bioinformatics 18: 207-208 1058 Su L, Diretto G, Purgatto E, Danoun S, Zouine M, Li Z, Roustan JP, Bouzayen M, 1059 Giuliano G, Chervin C (2015) Carotenoid accumulation during tomato fruit ripening is 1060 modulated by the auxin-ethylene balance. BMC Plant Biol 15: 114 1061 Tarantilis PA, Tsoupras G, Polissiou M (1995) Determination of saffron (Crocus sativus L.) 1062 components in crude plant extract using high-performance liquid chromatography-UV- 1063 visible photodiode-array detection-mass spectrometry. J Chromatogr A 699: 107-118 1064 Trapero A, Ahrazem O, Rubio-Moraga A, Jimeno ML, Gomez MD, Gomez-Gomez L 1065 (2012) Characterization of a glucosyltransferase enzyme involved in the formation of 1066 kaempferol and quercetin sophorosides in Crocus sativus. Plant Physiol 159: 1335-1354 1067 Trapnell C, Roberts A, Goff L, Pertea G, Kim D, Kelley DR, Pimentel H, Salzberg SL, 1068 Rinn JL, Pachter L (2012) Differential gene and transcript expression analysis of 1069 RNA-seq experiments with TopHat and Cufflinks. Nat Protoc 7: 562-578 1070 Trautmann D, Beyer P, Al-Babili S (2013) The ORF slr0091 of Synechocystis sp. PCC6803 1071 encodes a high-light induced aldehyde dehydrogenase converting apocarotenals and 1072 alkanals. Febs j 280: 3685-3696 1073 Wang X (2009) Structure, mechanism and engineering of plant natural product 1074 glycosyltransferases. FEBS Lett 583: 3303-3309 1075

B zeaxanthin OH

HO CCD2 3-OH-β-cyclocitral crocetin dialdehyde O O O

HO ALDH UGT? crocetin picrocrocin OH O O O OH R1 O UGTs ?

crocins R2 O safranal O O O O R1

C OH HO OH OH O O OH Crocin 1: R1= a; R2= H O O Crocin 2’: R1= R2 = a HO OH HO OH Crocin 2: R1= b; R2=H OH OH Crocin 3: R = a; R = b a b 1 2 Crocin 4: R1= R2= b

Figure 1. Crocin biosynthesis in Crocus sativus stigmas. A. Crocus sativus flower at anthesis with red stigmas. B. Proposed scheme of crocin biosynthesis (Frusciante et al., 2014). The CsCCD2 enzyme cleaves zeaxanthin at the 7,8 and 7’,8’ positions, producing 3-OH-β-cyclocitral and crocetin dialdehyde. Crocetin dialdehyde is oxidized to crocetin by an aldehyde dehydrogenase (ALDH), then glycosylated to crocins by UGT enzymes. C. Sugar moieties of the four most abundant C. sativus crocins (crocins 1-4).

Downloaded from on June 3, 2018 - Published by www.plantphysiol.org Copyright © 2018 American Society of Plant Biologists. All rights reserved. A Figure 2. Candidate genes for crocin biosynthesis Family in Crocus sativus stigmas. Compartments # cytoplasm A. Phylogenetic relationships of ALDHs from mitochondria Crocus sativus (Cs), Arabidopsis thaliana (At), plastids Bixa orellana (Bo), Synechocystis spp. (Syn) and other 2 Neurospora crassa (YLO-1) inferred using the neighbor-joining method. The subcellular localization of ALDH enzymes, experimentally demonstrated by (Stiti et al., 2011b) or predicted by 10 TargetP, is indicated by colored dots. Accession 5 numbers are: CsALDHs described in this paper (indicated by black arrows): CsALDH2B4 6 (MG672523), CsALDH2C4 (MF596160), 11 CsALDH3I1 (MF596165), CsALDH5F1 22 (MF596161), CsALDH6B2 (MG672524) and CsALDH7B4 (MF596162). AtALDHs: check Stiti - et al. (2011b); BoALDH (AJ548846) (Bouvier et 3 al., 2003); SynALDH (ALJ68758.1) (Trautmann et al., 2013); YLO-1 (XP_011394899.1) (Estrada, et al., 2008); CsADHComp2946 (AQM36713.1), 12 CsADHComp11367 (AQM36717.1), 7 CsADHComp20158 (AQM36716.1), B CsADHComp3893 (AQM36715.1), CsADHComp54788 (AQM36714.1) (Gomez- 0.0 11.01 Gomez et al., 2017); B. Expression of Crocus

sativus CCD2, ALDH and UGT enzymes in stigma red 0dA orange orange yellow yellow dA +2 -2dA CsCCD2 at different developmental stages; data are CsALDH2B4 CsALDH2C4 expressed as log2 of fragments per kilobase per CsALDH3I1 million (FPKM). Stigma stages: yellow, orange, CsALDH5F1 CsALDH6B2 red, two days before anthesis (-2da), day of anthesis CsALDH7B4 CsUGT74AD1 (0da), and two days after anthesis (+2da). C. CsUGT707B1 CsGT45 Phylogenetic relationships of UGTs from Crocus CsUGT85U1/U2 CsUGT85V1 sativus (Cs), Arabidopsis thaliana (At), Gardenia jasminoides (Gj) and Medicago truncatula (Mt), inferred using the neighbor-joining method: CsUGT74AD1 (MF596166); UGTCs2 C Products (AAP94878.1) (Moraga et al., 2004); CsGT45 ABA-GE (ACM66950.1) (Moraga et al., 2009); CsUGT85V1 crocins (AIF76150.1), CsUGT85U1 (AIF76152.1) and flavonoid glycosides CsUGT85U2 (AIF76151.1) (Ahrazem et al., 2015) auxin-GE (Gomez-Gomez et al., 2017); CsUGT707B1 triterpene glycosides (Trapero et al., 2012); AtUGT71B6 (NP_188815.1), B7 (NP_188816.1) and B8 (NP_188817.1) (Dong and Hwang, 2014); GjUGT94E5 (F8WKW8.1) and GjUGT75L6 (F8WKW0.1) (Nagatoshi et al., 2012); MtUGT71G1 (AAW56092.1) (Shao et al., 2005). The biosynthetic products of the various UGTs are represented by colored triangles. In panels A and C, the percentage of replicate trees that clustered together in the bootstrap test is indicated to the left Downloaded from on June 3, 2018of -the Published branches. by www.plantphysiol.org Copyright © 2018 American Society of Plant Biologists. All rights reserved. zeaxanthin zeaxanthin (M+H+ 569.4353) A D 160 *

120

1.4x108 STANDARD Fold IS Fold * * empty vector 40 * 7x107 CsCCD2 * CsCCD2/CsALDH3I1 0 Ion intensity 0 CsCCD2/CsALDH2C4 0 2 4 6 8 10 12 Time (min) crocetin dialdehyde B (M+H+ 297.1849) E 4 crocetin dialdehyde

3 *

* *

1.4x106 STANDARD 2 * * empty vector IS Fold 1 7x105 CsCCD2 CsCCD2/CsALDH3I1

Ion intensity 0 0 CsCCD2/CsALDH2C4 0 2 4 6 8 10 12 Time (min) crocetin C (M+H+ 329.1747) 1 F crocetin 0,25 * cis 0,2

2 trans 5 1.6x10 STANDARD 1 2 0,15 2 empty vector

1 IS Fold 8x104 CsCCD2 0,1 1 2 CsCCD2/CsALDH3I1

Ion intensity Ion 0,05 0 CsCCD2/CsALDH2C4 0 5 10 15 20 25 30 Time (min) 0

Figure 3. CsALDH3I1 mediates crocetin biosynthesis in E. coli cells. Accurate mass chromatograms of zeaxanthin (A), crocetin dialdehyde (B) and crocetin (C) extracted from bacterial clones harbouring the pTHIO empty vector or overexpressing CsCCD2 alone or in combination with CsALDH3I1 or CsALDH2C4. Polar and non-polar fractions were extracted from bacterial cells and run on a HPLC-PDA-HRMS system alongside authentic standards. The metabolites have an accurate mass and a chromatographic mobility identical to that of the authentic standard. Two peaks were detected of crocetin (1: trans- 2: cis- isomers, see figure S4). Relative quantities of zeaxanthin (D), crocetin dialdehyde (E) and (F) detected by HPLC-APCI-HRMS (D, E) and HPLC-ESI-HRMS (F) in recombinant clones. Results are the mean and standard deviations of three independent growth batches. Asterisks indicate statistical significance (Student’s t test; P < 0.01) over the CsCCD2 values. Fold IS= fold internal standard.

uAU uAU THIO 2x105 2 0 CsALDH3I1:THIO 5 10 15 20 25

B crocetin crocetin dialdehyde 14 12 10 8

Fold IS Fold 6 4 2 0 0 20 30 60 120 180 Time (min)

Figure 4. CsALDH3I1 mediates crocetin biosynthesis in vitro. A. HPLC chromatograms (abs at 440 nm) of in vitro assays performed for 120’ in the absence (THIO) and in the presence of CsALDH3I1 (CsALDH3I1:THIO). STANDARD = crocetin dialdehyde authentic standard. In the presence of CsALDH3I1 the crocetin dialdehyde is converted into crocetin (1: trans- 2: cis- isomers; see figure S4). B. Time course of crocetin dialdehyde conversion in the presence of CsALDH3I1. Data are the average ± standard deviation of three biological replicates and expressed as fold internal standard (Fold IS).

Downloaded from on June 3, 2018 - Published by www.plantphysiol.org Copyright © 2018 American Society of Plant Biologists. All rights reserved. t-crocetin A 6x104 4x104 uAU uAU 2x104 c-crocetin 0 THIO 6x104 t-crocin 2’

4 4x10 t-crocin 1 uAU uAU c-crocetin 2x104 t-crocetin 0 CsUGT74AD1:THIO 1.5x106 t-crocin 4 t-crocin 3 t-crocin 2’ c-crocin 4 1x106 t-crocin 2

uAU uAU 5x105 c-crocin 3 t-crocin 1 0 saffron extract 8 10 12 14 16 18 20 22 Time (min) B trans crocin 1 433 456 490.21981 491.22588 + 5 (M+H 491.2275) 1x10 M M+H+

4 261 5x10 309 492.22581

4 wavelength (nm) 497 Ion intensity 10 m/z trans crocin 2’ 439 462 653.28076 M+H+ (M+H+ 653.2803) 5x105

1x105 266 327

Ion intensity Ion 5x104 wavelength (nm) m/z

8 10 12 14 16 18 20 22 Time (min) C 8 crocetin crocin 1 crocin 2' 6

IS 4 Fold 2

0 0 5 10 20 60 120 Time (min)

Figure 5. CsUGT74AD1 mediates the synthesis of crocins 1 and 2’ in vitro. A. HPLC chromatograms (abs at 440 nm) of in vitro assay reactions performed for 60’ in absence (THIO) and in the presence of the CsUGT74AD1 enzyme (CsUGT74AD1:THIO) or extracted from mature saffron (saffron extract). t=trans; c=cis. B. HPLC-ESI-HRMS chromatograms (extracted accurate masses) of trans crocin 1 and trans crocin 2’ accumulated in the bacterial clone overexpressing the CsUGT74AD1 enzyme. Mass and PDA spectra of peaks are shown in the right and left boxes, respectively. C. Time course of crocetin conversion into trans crocin 1 and trans crocin 2’ Downloadedin the presence from on of June UGT 3, 2018 enzyme. - Published Data by arewww.plantphysiol.org the average ± standard deviation of three biological replicates and expressedCopyright as© 2018fold Americaninternal Societystandard of Plant (Fold Biologists. IS). All rights reserved. A anti-CsCCD2 anti-CsALDH3I1 anti-CsUGT74AD1 Tepal Stamen Tepal Stamen Stigma Tepal Stigma Stamen KDa KDa Stigma KDa 250 250 250 150 150 150 100 100 100 75 75 75 63 53 51 50 37 37 37 25

B anti-CsCCD2 anti-CsALDH3I1 anti-CsUGT74AD1 Stigma Stigma Stigma 1 2 3 1 2 3 1 2 3 KDa KDa KDa 250 250 250 150 150 150 100 100 100 75 75 75 63 53 51 50 37 37 37 25

Figure 6. Tissue specificity and solubility of enzymes involved in crocin biosynthesis. A. Western blot performed on total proteins (10 µg) extracted from C. sativus stigmas, stamens and tepals, performed with rabbit polyclonal antibodies raised against CsCCD2, CsALDH3I1, and CsUGT74AD1 peptides. B. Western blot performed on total protein extract from C. sativus stigmas. 1: soluble proteins extracted with PB buffer; 2: extrinsic membrane proteins extracted with PB buffer + 200 mM NaCl; 3: insoluble proteins extracted with SDS loading buffer (for details, see Materials and methods).

500 µm

BB C M CH CW V

N M CW N C

V C

C 2 µm200 µm 2 µm

D CW E C C M C N

C V

2 µm 500 nm

F V G CW

C CS M

N CS

V 2 µm 500 nm

Figure 7. Subcellular localization of CsCCD2 and CsUGT74AD1 in saffron stigmas. Scanning Electron Microscopy (SEM) (A-B) and Immuno Electron Microscopy (IEM) (C-G) of saffron stigmas. IEM reactions were performed with an anti-CsCCD2 antibody (D, E) and an anti-CsUGT74AD1 antibody (F, G) followed by an anti-rabbit secondary antibody conjugated to 20 nm gold particles. As control, labeling was performed omitting primary antibodies (C). For both proteins, a general view (scale bars: 2 µm) and a 4X detail (scale bars: 500 nm) are shown. CsCCD2 was detected only in chromoplasts (D, E), while CsUGT74AD1 was detected in the cytoplasm (F), in Downloaded from on June 3, 2018 - Published by www.plantphysiol.org association with filamentous structuresCopyright (membranes © 2018 American or cytoskeletal-like Society of Plant Biologists.structures) All rights(G). reserved.N: nucleus; CW: cell wall; C: chromoplast; M: mitochondrion; V: vacuole; CS: cytoskeleton. localized. Scale bars: 10 CsALDH3I1:eGFP. CsUGT74 localizes CsCCD2 zoom x 2.5 a and fluorescence) GFP A. Figure 8 For each construct, red (chlorophyll fluorescence(chlorophyll red construct, each For .

Subcellular Subcellular localization of CsALDH3I1CsCCD2, andCsUGT74 AD 1 hw a yolsi localization. cytoplasmic a shows A to C. C B lsi-soitd pcls CAD31 hw a yolsi, eiuae localization; reticulate cytoplasmic, a shows CsALDH3I1 speckles; plastid-associated CsUGT74AD1 CsALDH3I1 CsCCD2:GFP GFP

μ Co m. m. -localization Chlorophyll Chlorophyll mCHERRY mCHERRY RFP:HDEL RFP:HDEL Copyright ©2018American SocietyofPlant Biologists.All rightsreserved. Downloaded from of egd r son GP hw ayia ctpamcncer localization; cytoplasmic-nuclear atypical shows GFP shown. are merged of Cer (yolsi mre) n CsUGT74 AD and marker) (cytoplasmic mCherry GFP GFP CsUGT74AD1:GFP CsUGT74AD1:GFP CsALDH3I1:GFP CsALDH3I1:GFP on June3,2018 - Publishedby ), green (GFP fluorescence), merged (overlap of chlorophyll and chlorophyll of (overlap merged fluorescence), (GFP green B. Co Merged Merged -localization www.plantphysiol.org AD1 Merged, 2.5x 2.5x Merged, of Merged Merged Merged Merged Merged Merged F:DL E mre) and marker) (ER RFP:HDEL in

N. benthamiana

1 :eGFP :eGFP leaves. is cytosol- Chromoplast Zeaxanthin

ER CCD2

Crocetin ISC dialdehyde

ALDH3I1

UGT74AD1 Crocetin CS Vacuole Crocin 1,2’ UGT ? Crocins

Crocin 2, 3, 4

Figure 9. Proposed model for crocin biosynthesis/compartmentation in saffron stigmas. CsCCD2 cleaves zeaxanthin in the choromoplast, producing crocetin dialdehyde which migrates to the ER, where it is converted to crocetin by CsALDH3I1. The ER and plastid membranes are contiguous through the action of an interphase stabilizing complex (ISC) (Mehrshahi et al., 2013). Crocetin is converted to crocins 1 and 2’ by CsUGT74AD1, associated to cytoplasmic membranes or to the cytoskeleton (CS). A second, unidentified UGT converts crocins 1 and 2’ into crocins 2, 3 and 4, which are then transported into the vacuole through one or more unidentified tonoplast transporters.

Downloaded from on June 3, 2018 - Published by www.plantphysiol.org Copyright © 2018 American Society of Plant Biologists. All rights reserved. Parsed Citations Ahrazem O, Rubio-Moraga A, Berman J, Capell T, Christou P, Zhu C, Gomez-Gomez L (2016) The carotenoid cleavage dioxygenase CCD2 catalysing the synthesis of crocetin in spring crocuses and saffron is a plastidial enzyme. New Phytol 209: 650-663 Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Ahrazem O, Rubio-Moraga A, Trapero-Mozos A, Climent MF, Gomez-Cadenas A, Gomez-Gomez L (2015) Ectopic expression of a stress-inducible glycosyltransferase from saffron enhances salt and oxidative stress tolerance in Arabidopsis while alters anchor root formation. Plant Sci 234: 60-73 Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Al-Babili S, von Lintig J, Haubruck H, Beyer P (1996) A novel, soluble form of phytoene desaturase from Narcissus pseudonarcissus chromoplasts is Hsp70-complexed and competent for flavinylation, membrane association and enzymatic activation. Plant J 9: 601-612 Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Alavizadeh SH, Hosseinzadeh H (2014) Bioactivity assessment and toxicity of crocin: a comprehensive review. Food Chem Toxicol 64: 65-80 Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Alboresi A, Perin G, Vitulo N, Diretto G, Block M, Jouhet J, Meneghesso A, Valle G, Giuliano G, Marechal E, Morosinotto T (2016) Light Remodels Lipid Biosynthesis in Nannochloropsis gaditana by Modulating Carbon Partitioning between Organelles. Plant Physiol 171: 2468-2482 Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Azama K, Abe S, Sugimoto H, Davies E (2003) Lysine-containing proteins in maize endosperm: a major contribution from cytoskeleton- associated carbohydrate-metabolizing enzymes. Planta 217: 628-638 Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Bathaie SZ, Farajzade A, Hoshyar R (2014) A review of the chemistry and uses of crocins and crocetin, the carotenoid natural dyes in saffron, with particular emphasis on applications as colorants including their use as biological stains. Biotech Histochem 89: 401-411 Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Benghezal M, Wasteneys GO, Jones DA (2000) The C-terminal dilysine motif confers endoplasmic reticulum localization to type I membrane proteins in plants. Plant Cell 12: 1179-1201 Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Bisti S, Maccarone R, Falsini B (2014) Saffron and retina: neuroprotection and pharmacokinetics. Vis Neurosci 31: 355-361 Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Bouvier F, Dogbo O, Camara B (2003) Biosynthesis of the food and cosmetic plant pigment bixin (annatto). Science 300: 2089-2091 Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Bouvier F, Suire C, Mutterer J, Camara B (2003) Oxidative remodeling of chromoplast carotenoids: Identification of the carotenoid dioxygenase CsCCD and CsZCD genes Involved in Crocus secondary metabolite biogenesis. Plant Cell 15: 47-62. Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Brandle J, Telmer P (2007) Steviol glycoside biosynthesis. Phytochemistry 68: 1855-1863 Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Brocker C, Vasiliou M, Carpenter S, Carpenter C, Zhang Y, Wang X, Kotchoni SO, Wood AJ, Kirch HH, Kopecny D, Nebert DW, Vasiliou V (2013) Aldehyde dehydrogenase (ALDH) superfamily in plants: gene nomenclature and comparative genomics. Planta 237: 189-210 Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Chryssanthi DG, Lamari FN, Georgakopoulos CD, Cordopatis P (2011) A new validated SPE-HPLC method for monitoring crocetin in human plasma--application after saffron tea consumption. J Pharm Biomed Anal 55: 563-568 Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Cinelli RA, Ferrari A, Pellegrini V, Tyagi M, Giacca M, Beltram F (2000) The enhanced green fluorescent protein as a tool for the analysis of protein dynamics and localization: local fluorescence study at the single-molecule level. Photochem Photobiol 71: 771-776 Pubmed: Author and Title Downloaded from on June 3, 2018 - Published by www.plantphysiol.org Copyright © 2018 American Society of Plant Biologists. All rights reserved. Google Scholar: Author Only Title Only Author and Title Cote F, Cormier F, Dufresne C, Willemot C (2001) A highly specific glucosyltransferase is involved in the synthesis of crocetin glucosylesters in Crocus sativus cultured cells. Journ Plant Physiol 158: 553-560 Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title D'Esposito D, Ferriello F, Molin AD, Diretto G, Sacco A, Minio A, Barone A, Di Monaco R, Cavella S, Tardella L, Giuliano G, Delledonne M, Frusciante L, Ercolano MR (2017) Unraveling the complexity of transcriptomic, metabolomic and quality environmental response of tomato fruit. BMC Plant Biol 17: 66 Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Demurtas OC, Massa S, Illiano E, De Martinis D, Chan PK, Di Bonito P, Franconi R (2016) Antigen Production in Plant to Tackle Infectious Diseases Flare Up: The Case of SARS. Front Plant Sci 7: 54 Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Diaz-Sanchez V, Estrada AF, Trautmann D, Al-Babili S, Avalos J (2011) The gene carD encodes the aldehyde dehydrogenase responsible for neurosporaxanthin biosynthesis in Fusarium fujikuroi. Febs j 278: 3164-3176 Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Diretto G, Al-Babili S, Tavazza R, Scossa F, Papacchioli V, Migliore M, Beyer P, Giuliano G (2010) Transcriptional-metabolic networks in {beta}-carotene-enriched potato tubers: the long and winding road to the "Golden" phenotype. Plant Physiol 154: 899-912 Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Dong T, Hwang I (2014) Contribution of ABA UDP-glucosyltransferases in coordination of ABA biosynthesis and catabolism for ABA homeostasis. Plant Signal Behav 9: e28888 Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Dong T, Park Y, Hwang I (2015) Abscisic acid: biosynthesis, inactivation, homoeostasis and signalling. Essays Biochem 58: 29-48 Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Emanuelsson O, Nielsen H, Brunak S, von Heijne G (2000) Predicting subcellular localization of proteins based on their N-terminal amino acid sequence. J Mol Biol 300: 1005-1016 Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Estrada AF, Youssar L, Scherzinger D, Al-Babili S, Avalos J (2008) The ylo-1 gene encodes an aldehyde dehydrogenase responsible for the last reaction in the Neurospora carotenoid pathway. Mol Microbiol 69: 1207-1220 Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Fasano C, Diretto G, Aversano R, D'Agostino N, Di Matteo A, Frusciante L, Giuliano G, Carputo D (2016) Transcriptome and metabolome of synthetic Solanum autotetraploids reveal key genomic stress events following polyploidization. New Phytol 210: 1382- 1394 Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Frusciante S, Diretto G, Bruno M, Ferrante P, Pietrella M, Prado-Cabrero A, Rubio-Moraga A, Beyer P, Gomez-Gomez L, Al-Babili S, Giuliano G (2014) Novel carotenoid cleavage dioxygenase catalyzes the first dedicated step in saffron crocin biosynthesis. Proc Natl Acad Sci U S A 111: 12246-12251 Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Gachon CM, Langlois-Meurinne M, Saindrenan P (2005) Plant secondary metabolism glycosyltransferases: the emerging functional analysis. Trends Plant Sci 10: 542-549 Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Gibson DG, Young L, Chuang RY, Venter JC, Hutchison CA, 3rd, Smith HO (2009) Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat Methods 6: 343-345 Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Gomez-Gomez L, Parra-Vega V, Rivas-Sendra A, Segui-Simarro JM, Molina RV, Pallotti C, Rubio-Moraga A, Diretto G, Prieto A, Ahrazem O (2017) Unraveling Massive Crocins Transport and Accumulation through Proteome and Microscopy Tools during the Development of Saffron Stigma. Int J Mol Sci 18 Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Downloaded from on June 3, 2018 - Published by www.plantphysiol.org Copyright © 2018 American Society of Plant Biologists. All rights reserved. Hamilton AJ, Baulcombe DC (1999) A species of small antisense RNA in posttranscriptional gene silencing in plants. Science 286: 950- 952 Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Jain M, Srivastava PL, Verma M, Ghangal R, Garg R (2016) De novo transcriptome assembly and comprehensive expression profiling in Crocus sativus to gain insights into apocarotenoid biosynthesis. Sci Rep 6: 22456 Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Kirch HH, Bartels D, Wei Y, Schnable PS, Wood AJ (2004) The ALDH gene superfamily of Arabidopsis. Trends Plant Sci 9: 371-377 Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Kotchoni SO, Kuhns C, Ditzer A, Kirch HH, Bartels D (2006) Over-expression of different aldehyde dehydrogenase genes in Arabidopsis thaliana confers tolerance to abiotic stress and protects plants against lipid peroxidation and oxidative stress. Plant Cell Environ 29: 1033-1048 Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Kumar S, Stecher G, Tamura K (2016) MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol Biol Evol 33: 1870-1874 Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Latari K, Wust F, Hubner M, Schaub P, Beisel KG, Matsubara S, Beyer P, Welsch R (2015) Tissue-Specific Apocarotenoid Glycosylation Contributes to Carotenoid Homeostasis in Arabidopsis Leaves. Plant Physiol 168: 1550-1562 Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Lee H, Sparkes I, Gattolin S, Dzimitrowicz N, Roberts LM, Hawes C, Frigerio L (2013) An Arabidopsis reticulon and the atlastin homologue RHD3-like2 act together in shaping the tubular endoplasmic reticulum. New Phytol 197: 481-489 Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Liu M, Diretto G, Pirrello J, Roustan JP, Li Z, Giuliano G, Regad F, Bouzayen M (2014) The chimeric repressor version of an Ethylene Response Factor (ERF) family member, Sl-ERF.B3, shows contrasting effects on tomato fruit ripening. New Phytol 203: 206-218 Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Martinoia E, Maeshima M, Neuhaus HE (2007) Vacuolar transporters and their essential role in plant metabolism. J Exp Bot 58: 83-102 Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Masaki R, Yamamoto A, Tashiro Y (1994) Microsomal aldehyde dehydrogenase is localized to the endoplasmic reticulum via its carboxyl-terminal 35 amino acids. J Cell Biol 126: 1407-1420 Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Mehrshahi P, Stefano G, Andaloro JM, Brandizzi F, Froehlich JE, DellaPenna D (2013) Transorganellar complementation redefines the biochemical continuity of endoplasmic reticulum and chloroplasts. Proc Natl Acad Sci U S A 110: 12126-12131 Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Moraga AR, Mozos AT, Ahrazem O, Gomez-Gomez L (2009) Cloning and characterization of a glucosyltransferase from Crocus sativus stigmas involved in flavonoid glucosylation. BMC Plant Biol 9: 109 Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Moraga AR, Nohales PF, Perez JA, Gomez-Gomez L (2004) Glucosylation of the saffron apocarotenoid crocetin by a glucosyltransferase isolated from Crocus sativus stigmas. Planta 219: 955-966 Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Nagatoshi M, Terasaka K, Owaki M, Sota M, Inukai T, Nagatsu A, Mizukami H (2012) UGT75L6 and UGT94E5 mediate sequential glucosylation of crocetin to crocin in Gardenia jasminoides. FEBS Lett 586: 1055-1061 Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Nambara E, Marion-Poll A (2005) Abscisic acid biosynthesis and catabolism. Annu Rev Plant Biol 56: 165-185 Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Nishihara K, Kanemori M, Kitagawa M, Yanagi H, Yura T (1998) Chaperone coexpression plasmids: differential and synergistic roles of DnaK-DnaJ-GrpE and GroEL-GroESDownloaded in assisting from folding on June of 3, an 2018 allergen - Published of Japanese by www.plantphysiol.org cedar pollen, Cryj2, in Escherichia coli. Appl Copyright © 2018 American Society of Plant Biologists. All rights reserved. Environ Microbiol 64: 1694-1699 Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Ponti G, Palombi F, Abate D, Ambrosino F, Aprea G, Bastianelli T, Beone F, Bertini R, Bracco G, Caporicci M (2014) The role of medium size facilities in the HPC ecosystem: the case of the new CRESCO4 cluster integrated in the ENEAGRID infrastructure. In High Performance Computing & Simulation (HPCS), 2014 International Conference on. IEEE, pp 1030-1033 Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Rambla JL, Trapero-Mozos A, Diretto G, Rubio-Moraga A, Granell A, Gomez-Gomez L, Ahrazem O (2016) Gene-Metabolite Networks of Volatile Metabolism in Airen and Tempranillo Grape Cultivars Revealed a Distinct Mechanism of Aroma Bouquet Production. Front Plant Sci 7: 1619 Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Ross J, Li Y, Lim EK, Bowles DJ (2001) Higher plant glycosyltransferases. Genome Biol 2: reviews3004.3001-3006 Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Rubio-Moraga A, Trapero A, Ahrazem O, Gomez-Gomez L (2010) Crocins transport in Crocus sativus: the long road from a senescent stigma to a newborn corm. Phytochemistry 71: 1506-1513 Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Saitou N, Nei M (1987) The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol 4: 406-425 Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Shao H, He X, Achnine L, Blount JW, Dixon RA, Wang X (2005) Crystal structures of a multifunctional triterpene/flavonoid glycosyltransferase from Medicago truncatula. Plant Cell 17: 3141-3154 Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Stiti N, Adewale IO, Petersen J, Bartels D, Kirch HH (2011a) Engineering the nucleotide coenzyme specificity and sulfhydryl redox sensitivity of two stress-responsive aldehyde dehydrogenase isoenzymes of Arabidopsis thaliana. Biochem J 434: 459-471 Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Stiti N, Missihoun TD, Kotchoni SO, Kirch HH, Bartels D (2011b) Aldehyde Dehydrogenases in Arabidopsis thaliana: Biochemical Requirements, Metabolic Pathways, and Functional Analysis. Front Plant Sci 2: 65 Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Sturn A, Quackenbush J, Trajanoski Z (2002) Genesis: cluster analysis of microarray data. Bioinformatics 18: 207-208 Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Su L, Diretto G, Purgatto E, Danoun S, Zouine M, Li Z, Roustan JP, Bouzayen M, Giuliano G, Chervin C (2015) Carotenoid accumulation during tomato fruit ripening is modulated by the auxin-ethylene balance. BMC Plant Biol 15: 114 Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Tarantilis PA, Tsoupras G, Polissiou M (1995) Determination of saffron (Crocus sativus L.) components in crude plant extract using high-performance liquid chromatography-UV-visible photodiode-array detection-mass spectrometry. J Chromatogr A 699: 107-118 Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Trapero A, Ahrazem O, Rubio-Moraga A, Jimeno ML, Gomez MD, Gomez-Gomez L (2012) Characterization of a glucosyltransferase enzyme involved in the formation of kaempferol and quercetin sophorosides in Crocus sativus. Plant Physiol 159: 1335-1354 Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Trapnell C, Roberts A, Goff L, Pertea G, Kim D, Kelley DR, Pimentel H, Salzberg SL, Rinn JL, Pachter L (2012) Differential gene and transcript expression analysis of RNA-seq experiments with TopHat and Cufflinks. Nat Protoc 7: 562-578 Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Trautmann D, Beyer P, Al-Babili S (2013) The ORF slr0091 of Synechocystis sp. PCC6803 encodes a high-light induced aldehyde dehydrogenase converting apocarotenals and alkanals. Febs j 280: 3685-3696 Pubmed: Author and Title Google Scholar: Author Only Title Only Author and Title Wang X (2009) Structure, mechanism and engineering of plant natural product glycosyltransferases. FEBS Lett 583: 3303-3309 Pubmed: Author and Title Downloaded from on June 3, 2018 - Published by www.plantphysiol.org Copyright © 2018 American Society of Plant Biologists. All rights reserved. Google Scholar: Author Only Title Only Author and Title