1

2

3

4

5

6 Organization and Function of Drosophila Odorant Binding Proteins

7

8

9

10

11 Nikki K. Larter1,2, Jennifer S. Sun1, and John R. Carlson1,2*

12 1Dept. Molecular, Cellular and Developmental Biology

13 2Interdepartmental Neuroscience Program

14 Yale University

15 New Haven, CT 06520

16

17

18

19

20

21

22

23 *corresponding author: [email protected] 2

24 ABSTRACT

25 Odorant binding proteins (Obps) are remarkable in their number, diversity, and

26 abundance, yet their role in olfactory coding remains unclear. They are widely believed to be

27 required for transporting hydrophobic odorants through an aqueous lymph to odorant receptors.

28 We construct a map of the Drosophila antenna, in which the abundant Obps are mapped to

29 olfactory sensilla with defined functions. The results lay a foundation for an incisive analysis of

30 Obp function. The map identifies a sensillum type that contains a single abundant Obp, Obp28a.

31 Surprisingly, deletion of the sole abundant Obp in these sensilla does not reduce the magnitude

32 of their olfactory responses. The results suggest that this Obp is not required for odorant

33 transport and that this sensillum does not require an abundant Obp. The results further suggest a

34 novel role for this Obp in buffering changes in the odor environment, perhaps providing a

35 molecular form of gain control.

36

37

38 INTRODUCTION

39 Like many animals, insects rely on their sense of smell to navigate through the

40 environment towards food sources and mates. The Drosophila antenna is covered with olfactory

41 sensilla that fall into three main morphological classes: basiconic, trichoid and coeloconic

42 sensilla (Figure 1A, B) (Shanbhag et al. 1999). Basiconic sensilla detect many fruit odors (de

43 Bruyne et al. 2001, Hallem and Carlson 2006, Hallem et al. 2004); trichoid sensilla sense

44 pheromones (Clyne et al. 1997, Dweck et al. 2015, Ha and Smith 2006, van der Goes van Naters

45 and Carlson 2007); coeloconic sensilla detect organic acids and amines (Abuin et al. 2011, Ai et

46 al. 2010, Benton et al. 2009, Silbering et al. 2011, Yao et al. 2005). Each class can in turn be

47 divided into functional types. For example, 10 types of basiconic sensilla, designated ab1 3

48 (antennal basiconic 1) through ab10, detect different subsets of odorants (Couto et al. 2005, de

49 Bruyne et al. 2001, Elmore et al. 2003, Hallem et al. 2004, Marshall et al. 2010). Olfactory

50 sensilla are perforated by pores or channels through which odorants can pass, and they contain an

51 aqueous lymph in which the dendrites of up to four olfactory receptor neurons (ORNs) are

52 bathed (Figure 1C). Many sensilla contain two ORNs, designated A and B based on their spike

53 amplitudes. Sensilla also contain a thecogen (sheath) cell, a trichogen (shaft) cell, and one or

54 two tormogen (socket) cells. These cells produce the lymph and wrap around the ORNs

55 (Shanbhag et al. 2000).

56

57 Two broad classes of proteins are believed essential for the responses of sensilla to

58 odorants. One class, the odor receptors, have been mapped to specific types of sensilla and to

59 individual neurons within those sensilla, and their functional specificities have been

60 characterized (Ai et al. 2010, Benton et al. 2009, Couto et al. 2005, Hallem and Carlson 2006,

61 Hallem et al. 2004, Silbering et al. 2011). The other class, called odorant binding proteins

62 (Obps), have been the subject of much investigation in many insects but remain poorly

63 understood (Leal 2013, Pelosi et al. 2006, Vogt and Riddiford 1981).

64

65 Obps are remarkable in three ways: they are numerous, being encoded by a family of 52

66 genes in Drosophila; they are abundant, with some encoded by the most abundant mRNAs in

67 the antenna; they are diverse, with members sharing only 20% amino acid identity on average

68 (Hekmat-Scafe et al. 2002, Menuz et al. 2014). They are small proteins, on the order of 14 kDa,

69 and despite their high sequence divergence they are believed to have a common structure

70 (Graham and Davies 2002). Many are found in the lymph of olfactory sensilla, where ORN 4

71 dendrites are located (Shanbhag et al. 2001a). They bind odorants, with different degrees of

72 affinity and selectivity reported for different Obps (Gong et al. 2010, Leal et al. 2005). Within a

73 species, different Obps are expressed in different antennal sensilla (McKenna et al. 1994,

74 Pikielny et al. 1994, Schultze et al. 2013), and some are expressed in the taste system (Galindo

75 and Smith 2001, Jeong et al. 2013, Pikielny et al. 1994, Shanbhag et al. 2001b) or in larval

76 chemosensory organs (Galindo and Smith 2001, Park et al. 2000).

77

78 Despite numerous studies of Obps, much remains to be learned about their function.

79 They are widely believed to bind, solubilize, and transport hydrophobic odorants across the

80 aqueous sensillum lymph to receptors in the dendrites (Gomez-Diaz et al. 2013, Sandler et al.

81 2000, Vogt et al. 1985, Wojtasek and Leal 1999, Xu et al. 2005). Obps have also been proposed

82 to accelerate the termination of odor response, by removing odorants from receptors or from the

83 sensillar lymph (Vogt and Riddiford 1981, Ziegelberger 1995). A variety of studies support a

84 role for Obps in olfactory perception in vivo (Biessmann et al. 2010, Pelletier et al. 2010, Swarup

85 et al. 2011). However, to date, the physiological role of only one Obp, Obp76a, has been

86 thoroughly investigated in the olfactory system of Drosophila (Gomez-Diaz et al. 2013, J. D.

87 Laughlin et al. 2008, Xu et al. 2005). Obp76a, also called LUSH, is required in trichoid sensilla

88 for normal response of the odor receptor Or67d to the pheromone cis-vaccenyl acetate (cVA),

89 although responses of Or67d to cVA have been detected in the absence of Obp76a (Benton et al.

90 2007, Gomez-Diaz et al. 2013, Li et al. 2014, van der Goes van Naters and Carlson 2007).

91 LUSH has been found to bind cVA in vitro (Kruse et al. 2003, J.D. Laughlin et al. 2008), but

92 also binds other insect pheromones (Katti et al. 2013), short-chain alcohols (Bucci et al. 2006,

93 Thode et al. 2008), and phthalates (Zhou et al. 2004). 5

94

95 One reason the role of Obps has remained unclear is that their molecular organization has

96 not been established. Previous work has not defined which Obps are expressed in individual

97 sensilla, nor in which sensilla individual Obps are expressed. Thus it has been difficult to carry

98 out well-defined manipulations of Obp content. Here we take advantage of a recent RNA-Seq

99 analysis that quantified Obp expression in the antenna (Menuz et al. 2014). We examine the

100 expression of the abundant Obps at the level of sensillum morphology, sensillum functional type,

101 and cell type. The results illustrate basic principles of olfactory system organization, and they

102 allow construction of an Obp-to-sensillum map. The map identifies a sensillum type that

103 contains only one highly expressed Obp, Obp28a. We delete this Obp gene and analyze the

104 effects physiologically. Surprisingly, we find that deletion of the only abundant Obp in this

105 sensillum type does not reduce the magnitude of its ORN responses. Additionally, we find

106 evidence suggesting that this Obp plays a role not previously demonstrated for Obps, in

107 buffering sudden increases in odorant levels. This Obp could provide a molecular mechanism of

108 gain control that acts prior to receptor activation. Together, this work provides a foundation for

109 incisive studies of Obp function, suggests that some sensilla do not require an abundant Obp for

110 odorant transport, and encourages a broader view of the functions performed by the large and

111 diverse family of Obps. 6

112 RESULTS

113 Diverse expression patterns of abundant Obps

114 We systematically analyzed the expression patterns of the 10 Obps that are expressed

115 most abundantly in the antenna. The remaining Obps are all expressed at much lower levels

116 (Figure 1D, Figure 1 – figure supplement 1). In situ hybridization was used to identify the

117 regions of the antenna and the morphological classes of sensilla in which the abundant Obps are

118 expressed.

119

120 These Obps are expressed in a wide diversity of spatial patterns (Figure 2A). Expression

121 of some of the Obps was distributed broadly (e.g. Obp19d), expression of another was

122 concentrated narrowly (Obp59a), and others showed intermediate patterns (Obp76a). The

123 expression levels of these 10 Obps are striking not only in their magnitude but also in their wide

124 range, from ~30,000 RPKM to ~2,000 RPKM in the third antennal segment (Figure 1D) (Menuz

125 et al. 2014). Consistent with the breadth of their spatial patterns, Obp19d is the most abundant

126 transcript, and Obp59a is the least abundant of the 10 Obps.

127

128 Expression was observed in each of the three major morphological classes of sensilla

129 (Figure 2B). Four, such as Obp19a, are expressed in basiconic sensilla; four, including Obp76a,

130 are detected in trichoid sensilla; two, including Obp84a, are expressed in coeloconic sensilla

131 (Figure 2B,C). Some Obps are expressed only in basiconic sensilla, some only in trichoid

132 sensilla, and some only in coeloconic sensilla, but two Obps were expressed in both basiconic

133 and trichoid sensilla, consistent with an earlier report (Hekmat-Scafe et al. 1997).

134 7

135 Of the two Obps in coeloconic sensilla, Obp84a is expressed in most if not all coeloconic

136 sensilla on the antennal surface as well as those of the sacculus, a three-chambered cavity of the

137 antenna. Obp59a was detected only in the sacculus. The localization of Obp84a and Obp59a to

138 coeloconic sensilla is thus consistent with their absence in the antennae of atonal, a mutant

139 lacking coeloconic sensilla, as revealed by an RNA-Seq analysis (Menuz et al. 2014).

140

141 Obp19d and Obp56d appear to be expressed not in olfactory sensilla but rather in

142 epidermal cells, some of which flank olfactory sensilla and some of which are associated with

143 uninnervated spinules (Figure 2B). Obp56d is also expressed in the arista, a feathery structure

144 associated with thermosensation and mechanosensation (Figure 2A) (Foelix et al. 1989, Ni et al.

145 2013).

146

147 An Obp-to-sensillum map of the Drosophila antenna

148 Having mapped the abundant Obps to morphological classes of sensilla, we next mapped

149 them at higher resolution, to functional types of sensilla. We focused on the basiconic sensilla,

150 whose function has been analyzed in particular detail (de Bruyne et al. 2001, Hallem et al. 2004).

151 Our goal was to determine which of the abundant Obps are expressed in each of 10 individual

152 functional types of basiconic sensilla.

153

154 We used 10 Or-GAL4 drivers, each chosen to label a particular type of basiconic

155 sensillum. For example, Or42b-GAL4 labels an ORN located in the ab1 type, and Or59b-GAL4

156 labels an ORN in the ab2 type. We systematically carried out a double-label analysis with 10 8

157 Or-GAL4 drivers and in situ hybridization probes for each of the four Obps that are expressed in

158 basiconic sensilla (Figure 3).

159

160 In this manner we found that ab1, one of whose ORNs is labeled green in the left column

161 of Figure 3A, contained a cell labeled with Obp83a (red). Likewise, ab2, ab3, ab7, and ab10 all

162 express Obp83a; in each case the dendrite of the labelled ORN in the sensillum appears to be

163 surrounded by a cell expressing Obp83a. By contrast, the other five types of basiconic sensilla

164 (ab4, ab5, ab6, ab8, and ab9) did not express detectable levels of Obp83a. The Obp83b gene,

165 which lies less than 1 kb from Obp83a and encodes a protein with 68% amino acid identity to

166 Obp83a (Hekmat-Scafe et al. 1997), maps to the same set of basiconic sensilla. By contrast,

167 Obp19a maps to a different subset of sensilla. There are sensilla that express Obp83a and b but

168 not Obp19a, sensilla that express Obp19a but not Obp83a or b, sensilla that express all, and

169 sensilla that express none (Figure 3B). Interestingly, Obp28a is expressed in all 10 types of

170 basiconic sensilla, suggesting that it could play a broad role in odor coding.

171

172 In summary, different Obps map to different functional subsets of basiconic sensilla, and

173 basiconic sensilla express distinct subsets of Obps. A conclusion of particular interest is that ab8,

174 which has been well characterized (Elmore et al. 2003), expresses a single abundant Obp, as

175 considered further below.

176

177 Obps map to different cell types

178 We next examined Obp expression at still higher resolution: at the level of individual

179 cell types. Olfactory sensilla contain not only neurons, but also thecogen, tormogen, and 9

180 trichogen cells (Shanbhag et al. 2000). We found no evidence for expression of any Obps in

181 neurons: i) we did not observe axons or dendrites in the cells labeled by any of the 10 Obp

182 probes (Figures 3,4); ii) none of the Obp in situ hybridization probes co-labeled the neurons

183 labeled by any of the 10 Or-GAL4 drivers in the double-labeling analysis (Figure 3); iii) we

184 carried out additional double-label experiments with Obps and GAL4 drivers that label neurons

185 in basiconic, trichoid, and coeloconic sensilla, and found no co-labeling (Figure 4 – figure

186 supplement 1).

187

188 We observed expression of Obps in thecogen and tormogen cells, as judged by double-

189 label analysis using Obp probes and GAL4 drivers that have previously been used as markers of

190 these cell types in other tissues (Barolo et al. 2000, Chung et al. 2001, Jeong et al. 2013). For

191 example, an in situ hybridization probe for Obp84a labels cells that express a marker of thecogen

192 cells, nompA-GAL4 (Figure 4A,B), and an Obp19a probe labels cells that express a marker of

193 tormogen cells, ASE5-GAL4 (Figure 4A,C).

194

195 A systematic double-label analysis was carried out with all 10 Obps and the thecogen and

196 tormogen cell markers (Figure 4D). Besides Obp84a, only one other Obp, Obp28a, was

197 coexpressed with the thecogen marker, and this Obp28a-thecogen coexpression was observed in

198 a very limited number of cells per antenna. Six of the Obps were coexpressed with the tormogen

199 marker (Figure 4D, E). Obp84a, which showed strong labeling of thecogen cells, did not label

200 tormogen cells. Obp76a did not label cells with either marker, suggesting that it is expressed in

201 trichogen cells, a suggestion that we have been unable to confirm directly for lack of a suitable

202 marker specific for trichogen cells in olfactory sensilla. Moreover, most of the Obp probes 10

203 (including Obp83a, Obp83b, Obp28a, Obp19a, Obp69a, Obp76a) seem likely to be expressed in

204 trichogen cells, based on the substantial number of cells they label in antenna sensilla that are not

205 labeled by thecogen or tormogen markers; for example, Obp83a is not co-expressed with the

206 thecogen marker (Figure 4F) and labels many cells that are not labeled by the tormogen marker

207 (Figure 4G). Many individual sensilla contain more than one Obp-labeled cell, as can be seen in

208 each of the two neighboring sensilla shown in Figure 4H. This finding is consistent with the

209 interpretation that some Obps label more than one cell type (Shanbhag et al. 2001a, Steinbrecht

210 et al. 1992). Obp19d and Obp56d, which label cells located between sensilla, do not co-localize

211 with either marker (Figure 4D,E), consistent with the interpretation that they are expressed in

212 epidermal cells.

213

214 Finally, we note with interest that Obp19a labeled the same cell as the tormogen marker

215 in some sensilla (Figure 4I) but a different cell in other sensilla (Figure 4J). A simple

216 interpretation of this result is that Obp19a is expressed in different cell types in different

217 basiconic sensilla.

218

219 Robust and increased responses to short odor pulses in the absence of an abundant Obp

220 The construction of an Obp-to-sensillum map provided an unprecedented opportunity to

221 investigate Obp function in an incisive way. Of particular interest, the map shows that some

222 sensilla express a single abundant Obp, Obp28a (Figure 3B). We sought to remove Obp28a

223 genetically, with the goal of examining olfactory physiology in a sensillum whose Obp content

224 had been drastically reduced if not eliminated.

225 11

226 Accordingly, we created a CRISPR/Cas9-mediated deletion of Obp28a (Figure 5 – figure

227 supplement 1 and Supplementary file 1) and then outcrossed the deletion five times to a control

228 genetic background. The mutation was verified by PCR analysis both before and after

229 outcrossing, and we further confirmed the loss of Obp28a RNA by qPCR (not shown). We then

230 analyzed the olfactory response of mutant ab8 sensilla via single-unit electrophysiology to assess

231 the effect of removing its only abundant Obp.

232

233 Since Obps have been proposed to be required for the transport of hydrophobic odorants

234 through the aqueous sensillum lymph, we first examined the effect of removing Obp28a on the

235 detection of 1-octanol, an odorant that is highly hydrophobic (logP = 3.07). This odorant is

236 found in citrus fruits and other plants, and it elicits modest responses from the receptors of both

237 ab8A and ab8B neurons. Due to the difficulty of sorting spikes from the two ab8 neurons, we

238 quantified the total number of spikes following stimulation.

239

240 We were surprised to find that the mutant sensillum responded robustly to the odorant

241 across a broad concentration range, despite the lack of its single abundant Obp (red line in Figure

242 5A). The simplest interpretation of this result is that this sensillum can maintain a strong

243 olfactory response with little if any Obp. Moreover, we were surprised to find that not only was

244 the response robust, but that it was greater in the Obp mutant than in the control, over a broad

245 concentration range.

246

247 To investigate the effect of Obp depletion in more detail, we examined the dynamics of

248 olfactory response. Rather than focusing on the total number of spikes in a single 0.5s interval, 12

249 as in Figure 5A, we examined the numbers of spikes in 50ms intervals and plotted the results as a

250 peri-stimulus time histogram (PSTH)(Figure 5B). Again we observed a robust response in the

251 mutant. The shape of the response was affected by Obp depletion, with the greatest effect

252 occurring during the initial phase of the response. The peak response of the mutant was greater

253 than that of the control across a broad range of 1-octanol concentrations. We note that the

254 baseline firing rate was the same in the Obp mutant and the control (Figure 5B, 500-1000ms).

255

256 Robust response and abnormal recovery from long odor stimuli

257 The preceding analysis concerned a brief odor stimulus: 0.5s. In nature, flies also

258 experience sustained olfactory stimuli. For example, flies spend prolonged periods of time in

259 direct contact with food sources, which are intense sources of odor. We were interested in the

260 possibility that Obp28a might be essential for response to such prolonged stimuli or for the

261 recovery therefrom. The extremely high levels of Obp28a expression might have evolved to

262 enhance odor coding under extreme conditions of olfactory stimulation.

263

264 We delivered a strong 1-octanol stimulus for 30s. Consistent with our earlier results, the

265 initial response of the mutant was greater than that of the control immediately following odor

266 onset (Figure 6A). During the ensuing long stimulus period, the response of the mutant was

267 comparable to that of the control, supporting the notion that the ab8 sensillum is capable of a

268 robust olfactory response to a prolonged stimulus in the absence of an abundant Obp.

269

270 We then terminated the odor stimulus and measured the response. If Obp28a played an

271 essential role in clearing high levels of odorant from the sensillum lymph, one might expect the 13

272 Obp28a+ control to show a faster decline in response than its Obp28a- counterpart. The opposite

273 result was observed (Figure 6A). These findings argue against the possibility that Obp28a plays

274 an essential role in clearing 1-octanol from the sensillum lymph after intense stimulation.

275

276 Robust and increased responses to short stimuli superimposed upon long stimuli

277 Having thus analyzed responses to both short and long odor stimuli, we then tested the

278 response to short stimuli superimposed upon long stimuli. In nature, the olfactory system is

279 often faced with the challenge of detecting an olfactory signal against a high background of

280 odorant, for example in assessing local variation in the quality of a food source. Accordingly,

281 we delivered a sustained background of 1-octanol and measured the response to a pulse of 1-

282 octanol that was superimposed upon this background. More specifically, we kept the

283 background at a constant level, and measured the responses to a series of superimposed 1-octanol

284 pulses of increasing intensity.

285

286 Three results were obtained. First, prior to the odor pulses, the background firing rate

287 was the same in the mutant as in the control (Figure 6B), consistent with the equivalent firing

288 rates of mutant and control during the prolonged stimulus applied in Figure 6A. Second, the

289 mutant responded robustly to superimposed pulses of odor, with a threshold between 10-3 and

290 10-2 dilutions (Figure 6C). Third, the magnitude of the mutant firing level in response to a pulse

291 was greater than that of the control at all doses above the threshold, consistent with our earlier

292 findings with pulses delivered in the absence of a background stimulus (Figure 5).

293

294 14

295 Robust and increased responses to diverse odorants

296 The preceding analysis used a highly hydrophobic odor that elicited modest responses

297 (<50 spikes/s) even at high doses. We wanted to determine whether the depletion of an Obp

298 would affect: i) responses to a more hydrophilic odorant; ii) strong responses; iii) responses of

299 both the ab8A and ab8B neurons. Although extensive screening (n>170 odorants) did not

300 identify a highly hydrophobic odorant that strongly activated ab8A or ab8B (not shown), the

301 more hydrophilic odorants ethyl acetate (logP = 0.73) and butyric acid (logP = 0.79) elicit strong

302 responses (n>100 spikes/s) from the receptors of ab8A and ab8B, respectively (Hallem and

303 Carlson 2006).

304

305 We tested the response of the Obp28a mutant to 0.5s pulses of butyric acid and ethyl

306 acetate and found robust responses over a broad concentration range for both odorants (red lines

307 in Figures 7A and B). The mutant responded more strongly than the control to each odorant at

308 one or more concentrations. Butyric acid elicited a stronger response from the mutant over a

309 wide range of concentrations (Figure 7A), and ethyl acetate elicited a stronger response from the

310 mutant at one dose in the middle of its dynamic range (Figure 7B).

311

312 PSTH analysis revealed higher peak responses in the mutant for both butyric acid and

313 ethyl acetate across a wide range of doses (Figures 7C, D). Following the termination of these

314 short, 0.5s stimuli, decay dynamics appeared comparable in the two genotypes for butyric acid,

315 but were faster in the mutant following stimulation with the highest ethyl acetate doses, arguing

316 against a model in which the Obp is essential for clearing these odorants after such pulses.

317 15

318 We then tested a diverse panel of other odorants to ask whether the loss of an abundant

319 Obp affected the response profile of the ORNs in ab8. A priori, Obp28a could differentially

320 expedite the transport of a subset of odorants, or perhaps selectively filter some odorants so as to

321 reduce their access to the dendrites in the sensillum. We selected a panel of eight odorants

322 representing eight chemical classes--a sulfur compound, a lactone, a terpene, an aromatic, an

323 aldehyde, a ketone, an alcohol and an ester—that elicit responses from the odor receptors of ab8

324 neurons (Hallem and Carlson 2006). The odorants were tested at 10-2 dilutions, and also at 10-3

325 dilutions in the cases of the odorants that elicited the strongest responses. Each was delivered as

326 a 0.5s pulse and the responses of both neurons were summed.

327

328 The response profiles appeared very similar in Obp28a- and Obp28a+ (Figure 7E). The

329 mean responses varied over a broad range, from 50 spikes/s to >200 spikes/s, and for both

330 genotypes the lowest mean response was to 3-methylthio-1-propanol and the greatest response

331 was to ethyl-3-hydroxybutyrate. In between these extremes, the rank order of stimuli was similar.

332 The Obp28a mutant showed greater responses than the control to a subset of the compounds

333 tested. In no case was the response of the mutant lower than that of the control. 16

334 DISCUSSION

335 We have analyzed the molecular organization of the abundant Obps in the Drosophila

336 antenna. We have established an Obp-to-sensillum map that illustrates principles of olfactory

337 system organization and that allows a defined physiological analysis of the function of one Obp,

338 Obp28a.

339

340 The molecular organization of Obps

341 Our expression analysis highlights the great diversity of Drosophila Obps. The 10

342 abundant Obps are expressed in diverse antennal regions and in different morphological classes

343 of sensilla. Within a morphological class, they are expressed in distinct functional types, and

344 within different cell types. The diversity of these genes in expression pattern and amino acid

345 sequence, together with their remarkably high abundance, provokes questions about their roles in

346 olfactory function. The Obp-to-sensillum map lays a foundation for addressing these questions.

347

348 Most of these Obps are expressed in only one morphological class of sensillum. It seems

349 likely that many Obps have evolved to fill specialized needs of particular sensilla. For example,

350 coeloconic sensilla express a subset of Obps that does not overlap with those expressed by other

351 sensilla. This pattern of mutually exclusive expression may reflect the ancient origin of the

352 coeloconic sensilla, their unique double-walled architecture (Shanbhag et al. 1999), their

353 response to many polar odorants (Silbering et al. 2011), or their expression of a different family

354 of receptors, IRs (Abuin et al. 2011, Benton et al. 2009, Croset et al. 2010). The Obp-to-

355 sensillum map now provides a foundation for designing ectopic expression experiments in which

356 the function of an individual Obp can be examined in different sensillum types. 17

357

358 All 10 of the basiconic sensillum types express at least one of the abundant Obps. Most

359 if not all of the coeloconic and trichoid sensilla also express at least one abundant Obp (Hekmat-

360 Scafe et al. 1997, Pikielny et al. 1994, Shanbhag et al. 2001a). These results are consistent with

361 the concept that Obps are essential to the coding of olfactory information within sensilla.

362

363 The map reveals that some functionally distinct basiconic sensilla, such as ab1 and ab2,

364 contain the same subset of abundant Obps. This finding supports the notion that Obps do not

365 dictate the response profile of ORNs; rather, it is consistent with the conclusion from “empty

366 neuron” and heterologous expression analysis that the odor response profile of an ORN is

367 conferred by the odor receptor that it expresses (Abuin et al. 2011, Benton et al. 2009, Dobritsa

368 et al. 2003, Hallem et al. 2004, Silbering et al. 2011). When Ors from eight functional types of

369 basiconic sensilla, ab1-ab8, were individually expressed in the empty neuron, all yielded

370 response profiles that agreed well with those observed in their endogenous neurons (Hallem et al.

371 2004). The map reveals that the sensillum used in the empty neuron expression system, ab3,

372 expresses all four of the abundant Obps expressed in basiconic sensilla. Thus any abundant Obp

373 that might be essential to the response of one of the 10 basiconic sensilla would be present in the

374 ab3 test system.

375

376 We note that the Obp-to-sensillum map also invites analysis of the regulatory

377 mechanisms by which it is established. A receptor-to-neuron map allowed incisive investigation

378 of mechanisms by which individual ORNs select, from among 60 Or genes, which to express

379 (Barish and Volkan 2015, Ray et al. 2008, Ray et al. 2007). Likewise, it should now be possible 18

380 to elucidate mechanisms by which individual sensilla select which Obps to express, for example

381 by comparing regulatory regions of co-expressed Obps.

382

383 Responses of a sensillum in vivo in the absence of an abundant Obp

384 We were surprised to find that elimination of the sole abundant Obp from a sensillum did

385 not reduce the magnitude of its response to the tested odorants. We tested odorants of widely

386 varying hydrophobicity and chemical class, including odorants that activate each of the ORNs in

387 the sensillum. The results do not support the widespread belief that Obps are essential for the

388 transport of odorants to receptors within all sensilla (Figure 8A); rather, the simplest

389 interpretation of our results is that ab8 does not require an Obp to transport odorants to receptors.

390

391 How could a hydrophobic odorant traverse the aqueous sensillum lymph of ab8, if not via

392 an Obp? Many sensilla of widely diverse insects contain tubular structures called pore tubules

393 (Steinbrecht 1997) (Figure 8B,C). These structures, which can be up to 1μm long and 15-20nm

394 in diameter, extend from the wall pores of the sensilla into the interior of the sensillum, often

395 making contact with dendritic membranes. The number of pore tubules per pore ranges up to 20,

396 and the estimated number of pore tubules per sensillum ranges as high as 83,000 (Steinbrecht

397 1997). In Drosophila, pore tubules have been observed in basiconic sensilla, but not in trichoid

398 sensilla (Shanbhag et al. 1999) , where Obp76a is expressed.

399

400 Pore tubules have been proposed as a conduit for the transport of hydrophobic odorants

401 from the wall pores to the dendritic membranes. Thus an odorant would follow a three-

402 dimensional trajectory through the air to the antenna, a two-dimensional path in the hydrophobic 19

403 antennal surface cuticle to a wall pore, and then a one-dimensional trajectory toward the

404 dendritic membrane via a pore tubule (Figure 8B)(Adam and Delbruck 1968, Kaissling et al.

405 1987, Steinbrecht 1997). There is evidence that pore tubules consist largely of lipids and

406 proteins (Keil 1982), likely allowing for diffusion of a hydrophobic odorant.

407

408 After the discovery of Obps, the view that Obps transport odorants to receptors was

409 proposed and has prevailed in the field for over 30 years. Our results support the possibility that

410 in some sensilla, pore tubules provide an alternative mechanism. We acknowledge that the

411 following formal possibilities can not be excluded:

412 i) deletion of Obp28a may result in a massive upregulation of another Obp. However, we

413 tested this possibility by qPCR analysis and found no change (p>0.05) in the levels of four other

414 Obp transcripts (Obp19a, Obp19d, Obp83a, and Obp83b, not shown).

415 ii) Obp28a may be essential for response to highly hydrophobic odorants that elicit very

416 strong responses from neurons in ab8. However, we have not been able to test this possibility

417 because a screen for such odorants (n>170) was unsuccessful.

418 iii) the ab8 sensillum may be atypical. However, a limited analysis of ab4, which

419 expresses Obp28a and one other abundant Obp, Obp19a, revealed responses of comparable

420 magnitudes in Obp28a- and in an Obp28a+ control (13 odorants; Figure 7 – figure supplement 1).

421 iv) the function of Obp28a in ab8 could be redundant with that of another Obp that is

422 expressed at drastically lower levels in ab8. However, the most abundant unmapped Obp is

423 expressed at <5% the level of Obp28a (Menuz et al. 2014). Moreover, we did not detect labeling

424 of ab8 by in situ hybridization with this Obp, nor with the following three in descending rank

425 order, nor with any of four other Obps tested (Figure 1D, Figure 1 – figure supplement 1; the 20

426 Obps tested were Obp57c, Obp57b, Obp83ef, Obp19b, Obp44a, Obp57a, Obp58b, Obp83cd, not

427 shown). We note finally that abundance has been quantified in terms of RNA levels, which

428 provide an imperfect reflection of protein levels.

429

430 A second surprise was that the response to an odor pulse was greater in the mutant, for a

431 number of odorants. The mutant also showed an accelerated decline in the firing level following

432 the termination of a prolonged odor stimulus. The overall response profile to a panel of diverse

433 odorants, however, was similar between the mutant and control. These results are interesting

434 because they argue against some alternative models of Obp28a function. Specifically, in

435 addition to transporting odorants, Obps have been proposed to protect odorants from degradative

436 enzymes, to inactivate odorants following stimulus termination, or to filter them (Kaissling 2001,

437 Leal 2013, Pelosi and Maida 1995). If Obp28a protected odorants in ab8 we would expect a

438 greater initial response in the control than in Obp28a mutants. If Obp28a inactivated odorants at

439 the end of the odor response, we would expect a faster decline in the control at the end of odor

440 stimulation. If Obp28a selectively filtered certain odorants, we would expect differences in the

441 response profiles of mutant and control. We note moreover that the similarity in response

442 profiles is consistent with results from the empty neuron system. If Obp28a selectively filtered

443 certain odorants, we would expect the Or35a receptor to confer a different odor response profile

444 in basiconic sensilla, which express Obp28a, and in coeloconic sensilla, which do not (Figure

445 2C). By contrast, the response profiles of Or35a in the two sensillum types are very similar

446 (Hallem et al. 2004).

447 21

448 We do not claim that the role of Obp28a in ab8 can be extrapolated to all Obps and all

449 olfactory sensilla. Obp28a is expressed in all basiconic sensilla, and could play a broader role

450 than Obps expressed in only a subset of sensilla. One of the most intriguing aspects of Obps and

451 sensilla is their diversity. Different Obps are likely to have different functions: there is evidence

452 for reduction in olfactory function following reduction in the levels of certain Obps (Biessmann

453 et al. 2010, Pelletier et al. 2010, Swarup et al. 2011, Xu et al. 2005), and another Obp has been

454 found to contribute to the inhibition of neurons in the taste system (Jeong et al. 2013). In this

455 regard, we found that the most abundant Obp transcript in the antenna, Obp19d, is expressed in

456 epidermal cells and not accessory cells, consistent with the findings of (Park et al. 2000), and is

457 thus unlikely to be secreted into sensillar lymph. It seems plausible that Obp19a binds ligands

458 other than odorants, as may other Obps that are expressed outside the olfactory system (Arya et

459 al. 2010, Li et al. 2004, Pitts et al. 2014). Not only are Obps highly diverse, but sensilla also are

460 diverse in structure and function, as illustrated by the lack of visible pore tubules in trichoid

461 sensilla of Drosophila (Shanbhag et al. 1999). We have focused on a single Obp and a single

462 sensillum type because the map constructed in this study allowed us to manipulate them with

463 unparalleled definition.

464

465 How does the presence of Obp28a reduce the initial response to odorant and prolong the

466 response following termination of a long, intense stimulus? It is possible that following the

467 sudden influx of an odor stimulus, some of the odorant binds to Obp28a, thereby reducing the

468 amount available for receptor activation. After the termination of a prolonged stimulus, odorant

469 released from the Obp-odorant complex might increase the level available for receptor binding.

470 In both cases the Obp would buffer the system against sudden changes in odor level. 22

471

472 The olfactory circuit has evolved a cellular mechanism of gain control, in which local

473 interneurons inhibit ORNs (Olsen and Wilson 2008, Root et al. 2008). This gain control is

474 believed to play a critical role in preventing network saturation and in improving odorant

475 discrimination. It is possible that Obp28a provides an additional mechanism of gain control,

476 which acts at the molecular level as opposed to the cellular level. This molecular form of gain

477 control would precede the cellular form, occurring even before the odor receptor or the neuron

478 were activated.

479

480 We note finally that even small effects on ORN firing rate can have large effects on odor

481 perception and behavior. ORNs form synapses with second-order neurons called projection

482 neurons (PNs), and the relationship between the firing rates of ORNs and PNs is non-linear

483 (Olsen and Wilson 2008). Moreover, PNs also appear to respond most vigorously to odor onset

484 (Olsen and Wilson 2008, Wilson 2013). Thus, even a modest alteration in the firing rate during

485 the initial phase of response could have an important effect on the way olfactory information is

486 represented in the CNS and on the behavior that it drives. 23

487 MATERIALS AND METHODS

488 Drosophila stocks

489 Or-GAL4 drivers were from the Bloomington Drosophila Stock Center (NIH P40OD018537).

490 nompA-GAL4 and ASE5-GAL4 were provided by C. Montell and described previously (Barolo et

491 al. 2000, Chung et al. 2001). GAL4 drivers were crossed to a UAS-mCD8:GFP line (Lee and

492 Luo 1999). white Canton-S (wCS) and Obp28a- flies (described below) were used for

493 electrophysiology experiments. Obp28a- was outcrossed for five generations to wCS to reduce

494 the risk of background effects.

495

496 Transgenic fly generation

497 Guide chiRNA cloning

498 Gibson Assembly was used to clone pU6-BbsI-chiRNA plasmids containing each of the chiRNAs

499 (Barnes 1994), following protocols for the Gibson Assembly Master Mix (New England

500 BioLabs). Primers for this technique contain extended regions which are digested by

501 exonucleases to create single-stranded 3’ overhangs, which are filled and sealed by polymerase

502 and DNA ligase, respectively. While the reverse primer is complementary to the plasmid itself

503 (Primer #1, Figure 5 – figure supplement 1), the forward primers also include the 20-nt guide

504 chiRNA sequence with the PAM sequence omitted (Primers #2 & 3, Figure 5 – figure

505 supplement 1). Primer sequences complementary to the plasmid are represented in Figure 5 –

506 figure supplement 1 in lowercase letters. 20-nt guide chiRNAs were selected with the aid of the

507 CRISPR Optimal Target Finder resource on the flyCRISPR website (Gratz et al. 2014). CRISPR

508 targets with 5’ G and NGG PAM sequences were selected for optimal U6-driven transcription 24

509 and subsequent cleavage stringency. Selected cut sites were located 19-nt downstream of the 5’

510 end, and 37-nt downstream of the 3’ end, of the Obp28a coding sequence.

511

512 Homology-driven repair template cloning

513 Homology arms extending 0.65 kb upstream and 1.02 kb downstream of the cut site were

514 incorporated into multiple cloning sites of the pHD-DsRed-attP vector (Gratz et al. 2014), using

515 amplification primers #4-7 indicated in Figure 5 – figure supplement 1. To facilitate screening

516 of Obp28a deletion mutants, this replacement donor plasmid contains a removable LoxP-flanked

517 DsRed, which was thus inserted in the genome at the same locus. An attP ΦC31 site was

518 simultaneously inserted to facilitate future targeting of this locus.

519

520 Embryo injection

521 300 y2 cho2 v1; P(nos-Cas9, y+, v+)3A/TM6C, Sb Tb (CAS-0003) (Kondo and Ueda 2013)

522 embryos were injected with guide chiRNA and donor plasmids by Bestgene, Inc. (Chino Hills,

523 CA). CAS-0003 flies express Cas9 under the control of nos regulatory sequences, inserted in the

524 third chromosome. These flies were optimal for Obp28a gene deletion due to the intact second

525 chromosome, as well as the visible and removable endogenous Cas9 gene. Of the 150 surviving

526 larvae, ~60 G0 adults were crossed to w1118. Two non-sibling G1 adults expressing DsRed were

527 identified, and were individually backcrossed to wCs for five generations.

528

529 PCR screening

530 Primer pairs extending beyond the Obp28a coding sequence (Primers #9 & 10, Figure 5 – figure

531 supplement 1) and homology arms (Primers #8 & 11, Figure 5 – figure supplement 1) were used 25

532 to verify the gene deletion, in two independent experiments, one before and one after

533 backcrossing.

534

535 RNA probe synthesis for in situ hybridization

536 The coding region of each Obp was amplified from CS antennal cDNA and cloned into the

537 pGEM-T Easy vector (Invitrogen) for transcription. For genes with multiple transcripts, the

538 primers were designed to encompass the region present in all versions. Plasmids were linearized

539 with SpeI, NotI, or AatII (New England BioLabs). Digoxigenin (DIG) and Fluorescein (FITC)

540 labeled probes were created using DIG RNA Labeling Kit SP6/T7 and Fluorescein-labeled UTP

541 (Roche), and purified with the RNEasy Cleanup Kit (QIAGEN).

542

543 In situ hybridization and immunohistochemistry

544 We used 7 day-old flies in all staining experiments except that we used flies less than 1-day-old,

545 many within a few hours of eclosion, when labeling with ASE5-Gal4 and nompA-Gal4 because

546 these markers are developmentally regulated and staining was weak in older flies. Male and

547 female flies were anesthetized, placed in a collar, covered with OCT (Tissue-Tek), and frozen on

548 dry ice. 14µm antennal cryosections were collected on slides and stained as previously described

549 (Menuz et al. 2014). In brief, sections were fixed and acetylated at room temperature, pre-

550 hybridized, and then incubated with DIG and/or FITC probes at 65oC overnight. Detection of

551 probes was carried out with anti-DIG-POD or anti-FITC-POD in 1% Blocking Reagent (Roche)

552 and amplified with Cy3 or Cy5 TSA (Perkin Elmer). GFP was detected with mouse-anti-GFP

553 (Roche) and Alexa-fluor-488 donkey-anti-mouse antibodies (Invitrogen). All microscopy was 26

554 performed using a Carl Zeiss LSM 510 Laser Scanning Confocal Microscope and images were

555 processed with ImageJ software.

556

557 Electrophysiology

558 We used 6-8 day old female flies for single-sensillum recordings essentially as described

559 previously (Dobritsa et al. 2003). Filtered AC signals (50-2000Hz) were recorded and digitized

560 with a Digidata 1440 digitizer and Axoscope 10.5 software (Molecular Devices). Action

561 potentials were detected and counted using custom Matlab (MathWorks) scripts written by

562 Carlotta Martelli (Martelli et al. 2013), with few if any modifications. All spikes were counted

563 due to difficulty in reliably sorting A and B neurons in ab8 sensilla. Impulse responses are

564 defined as the firing rate during the stimulus period minus the baseline firing rate. Odors

565 typically take 100ms to reach the antenna, due to the length of the odor delivery tube, so the

566 stimulus period is considered to start 100ms after the opening of the odor delivery valve and

567 persists for the length of the pulse, which in nearly all cases was 500ms. The baseline firing rate

568 was calculated by counting the number of spikes during the 500ms period prior to odorant

569 release. To generate dose response curves, each sensillum was tested with all concentrations of

570 odor in ascending order of dose, and no more than 3 sensilla were analyzed per fly. ab8 sensilla

571 were identified by their location and physical attributes and confirmed by their strong response to

572 10-3 2,3-butanediol (Hallem and Carlson 2006). Spikes for peri-stimulus time histograms

573 (PSTHs) were binned in 50ms intervals except that in the 30s stimulus paradigm they were

574 binned in 1s intervals. Statistical significance was assessed using Prism’s (GraphPad) two-way

575 repeated measures ANOVA followed by Bonferroni’s post-hoc test. Values shown are the mean

576 +/- SEM. 27

577

578 Odor stimuli

579 Odor stimuli were prepared and delivered essentially as described previously (Hallem et al.

580 2004). 1-octanol, butyric acid, 3-methylthio-1-propanol, γ-hexalactone, furfural, 2-pentanone, 2-

581 pentanol, ethyl-3-hydroxybutyrate, and were purchased from Sigma Aldrich, methyl benzoate

582 and linalool oxide were purchased from Fluka, and ethyl acetate was purchased from J.T. Baker.

583 Odorants of the highest grade available were used and were then diluted in paraffin oil (Fluka).

584 For 500ms pulses, 50μl of diluted odorant was applied to a 13mm filter paper disc inside a

585 Pasteur pipette and capped with a 1ml pipette tip to create an odor cartridge. Cartridges were

586 allowed to equilibrate for 20min before use. Each cartridge was used no more than three times

587 and with more than 10min between uses, to allow the odor to re-equilibrate. Mutant and control

588 flies were tested in parallel, on the same day, and in the same manner. Stimuli were presented by

589 placing the tip of the cartridge into a glass tube delivering a humidified air stream (~2000

590 ml/min) to the fly, and administering a 500ms pulse of air (~200 ml/min) through the cartridge.

591 For experiments with a 30s odor stimulus, 25ml pipettes were used in place of Pasteur pipettes,

592 with three filter papers, each 55mm in diameter, and 1ml of odor dilution. These large cartridges

593 were used up to 8 times, since independent PID measurements showed no substantial decrease in

594 odor concentration after more than 10 uses. For experiments with a background odor, a 125ml

595 flask with 5ml of odor dilution was inserted between the main airstream and the odor delivery

596 tube. Flies were exposed to the background odor for more than 5min before beginning the

597 experiment. 28

598 ACKNOWLEDGEMENTS

599 We thank M. Harrison, K. O’Connor-Giles, and J. Wildonger for plasmids pDsRed-attP

600 (Addgene plasmid 51019; unpublished) and pU6-BbsI-chiRNA (Addgene plasmid 45946;

601 Gratz et al., 2013). We thank T. Emonet, C. Martelli, M. Demir, and S. Gourur-Shandilya for

602 discussion and help. We thank C. Montell for fly lines. We thank T.-W. Koh, K. Menuz, and

603 C.-Y. Su for experimental advice, and F. Marion-Poll, Z. He, and F. Vonhoff for comments on

604 the manuscript. The work was supported by NSF Graduate Research Fellowships to NKL and

605 JSS, by the Dwight N. and Noyes D. Clark Scholarship Fund and NIH T32 GM007499 (JSS),

606 and by grants from the NIH to JRC. 29

607 REFERENCES

608 Abuin, L., Bargeton, B., Ulbrich, M. H., Isacoff, E. Y., Kellenberger, S. and Benton, R. (2011)

609 Functional architecture of olfactory ionotropic glutamate receptors. Neuron, 69(1), pp.

610 44-60.

611

612 Adam, G. and Delbruck, M. (1968) Reduction of dimensionality in biological diffusion processes.

613 in Rich, A. and Davidson, N., (eds.) Structural chemistry and molecular biology.: W. H.

614 Freeman and Co. San Francisco. pp. 198-215.

615

616 Ai, M., Min, S., Grosjean, Y., Leblanc, C., Bell, R., Benton, R. and Suh, G. S. (2010) Acid

617 sensing by the Drosophila olfactory system. Nature, 468(7324), pp. 691-5.

618

619 Arya, G. H., Weber, A. L., Wang, P., Magwire, M. M., Negron, Y. L. S., Mackay, T. F. C. and

620 Anholt, R. R. H. (2010) Natural Variation, Functional Pleiotropy and Transcriptional

621 Contexts of Odorant Binding Protein Genes in Drosophila melanogaster. Genetics, 186,

622 pp. 1475-1485.

623

624 Barish, S. and Volkan, P. C. (2015) Mechanisms of olfactory receptor neuron specification in

625 Drosophila. Wiley Interdiscip Rev Dev Biol, 4(6), pp. 609-21.

626

627 Barnes, W. M. (1994) PCR amplification of up to 35-kb DNA with high fidelity and high yield

628 from lambda bacteriophage templates. Proc Natl Acad Sci U S A, 91(6), pp. 2216-20.

629 30

630 Barolo, S., Walker, R. G., Polyanovsky, A. D., Freschi, G., Keil, T. and Posakony, J. W. (2000)

631 A notch-independent activity of suppressor of hairless is required for normal

632 mechanoreceptor physiology. Cell, 103(6), pp. 957-69.

633

634 Benton, R., Vannice, K. S., Gomez-Diaz, C. and Vosshall, L. B. (2009) Variant ionotropic

635 glutamate receptors as chemosensory receptors in Drosophila. Cell, 136(1), pp. 149-62.

636

637 Benton, R., Vannice, K. S. and Vosshall, L. B. (2007) An essential role for a CD36-related

638 receptor in pheromone detection in Drosophila. Nature, 450(7167), pp. 289-93.

639

640 Biessmann, H., Andronopoulou, E., Biessmann, M. R., Douris, V., Dimitratos, S. D., Eliopoulos,

641 E., Guerin, P. M., Iatrou, K., Justice, R. W., Krober, T., Marinotti, O., Tsitoura, P.,

642 Woods, D. F. and Walter, M. F. (2010) The Anopheles gambiae odorant binding protein

643 1 (AgamOBP1) mediates indole recognition in the antennae of female mosquitoes. PLoS

644 One, 5(3), pp. e9471.

645

646 Bucci, B. K., Kruse, S. W., Thode, A. B., Alvarado, S. M. and Jones, D. N. (2006) Effect of n-

647 alcohols on the structure and stability of the Drosophila odorant binding protein LUSH.

648 Biochemistry, 45(6), pp. 1693-1701.

649

650 Chung, Y. D., Zhu, J., Han, Y. and Kernan, M. J. (2001) nompA encodes a PNS-specific, ZP

651 domain protein required to connect mechanosensory dendrites to sensory structures.

652 Neuron, 29(2), pp. 415-28. 31

653

654 Clyne, P., Grant, A., O'Connell, R. and Carlson, J. R. (1997) Odorant response of individual

655 sensilla on the Drosophila antenna. Invert Neurosci, 3(2-3), pp. 127-35.

656

657 Couto, A., Alenius, M. and Dickson, B. J. (2005) Molecular, anatomical, and functional

658 organization of the Drosophila olfactory system. Curr Biol, 15(17), pp. 1535-47.

659

660 Croset, V., Rytz, R., Cummins, S. F., Budd, A., Brawand, D., Kaessmann, H., Gibson, T. J. and

661 Benton, R. (2010) Ancient protostome origin of chemosensory ionotropic glutamate

662 receptors and the evolution of insect taste and olfaction. PLoS Genet, 6(8), pp. e1001064.

663

664 de Bruyne, M., Foster, K. and Carlson, J. R. (2001) Odor coding in the Drosophila antenna.

665 Neuron, 30(2), pp. 537-52.

666

667 Dobritsa, A. A., van der Goes van Naters, W., Warr, C. G., Steinbrecht, R. A. and Carlson, J. R.

668 (2003) Integrating the molecular and cellular basis of odor coding in the Drosophila

669 antenna. Neuron, 37(5), pp. 827-41.

670

671 Dweck, H. K., Ebrahim, S. A., Thoma, M., Mohamed, A. A., Keesey, I. W., Trona, F., Lavista-

672 Llanos, S., Svatos, A., Sachse, S., Knaden, M. and Hansson, B. S. (2015) Pheromones

673 mediating copulation and attraction in Drosophila. Proc Natl Acad Sci U S A, 112(21), pp.

674 E2829-35.

675 32

676 Elmore, T., Ignell, R., Carlson, J. R. and Smith, D. P. (2003) Targeted mutation of a Drosophila

677 odor receptor defines receptor requirement in a novel class of sensillum. J Neurosci,

678 23(30), pp. 9906-12.

679

680 Foelix, R. F., Stocker, R. F. and Steinbrecht, R. A. (1989) Fine structure of a sensory organ in the

681 arista of Drosophila melanogaster and some other dipterans. Cell Tissue Res, 258(2), pp.

682 277-87.

683

684 Galindo, K. and Smith, D. P. (2001) A large family of divergent Drosophila odorant-binding

685 proteins expressed in gustatory and olfactory sensilla. Genetics, 159(3), pp. 1059-72.

686

687 Gomez-Diaz, C., Reina, J. H., Cambillau, C. and Benton, R. (2013) Ligands for pheromone-

688 sensing neurons are not conformationally activated odorant binding proteins. PLoS Biol,

689 11(4), pp. e1001546.

690

691 Gong, Y., Tang, H., Bohne, C. and Plettner, E. (2010) Binding conformation and kinetics of two

692 pheromone-binding proteins from the Gypsy moth Lymantria dispar with biological and

693 nonbiological ligands. Biochemistry, 49(4), pp. 793-801.

694

695 Graham, L. A. and Davies, P. L. (2002) The odorant-binding proteins of Drosophila

696 melanogaster: annotation and characterization of a divergent gene family. Gene, 292(1-2),

697 pp. 43-55.

698 33

699 Gratz, S. J., Ukken, F. P., Rubinstein, C. D., Thiede, G., Donohue, L. K., Cummings, A. M. and

700 O'Connor-Giles, K. M. (2014) Highly specific and efficient CRISPR/Cas9-catalyzed

701 homology-directed repair in Drosophila. Genetics, 196(4), pp. 961-71.

702

703 Ha, T. S. and Smith, D. P. (2006) A pheromone receptor mediates 11-cis-vaccenyl acetate-

704 induced responses in Drosophila. J Neurosci, 26(34), pp. 8727-33.

705

706 Hallem, E. A. and Carlson, J. R. (2006) Coding of odors by a receptor repertoire. Cell, 125(1), pp.

707 143-60.

708

709 Hallem, E. A., Ho, M. G. and Carlson, J. R. (2004) The molecular basis of odor coding in the

710 Drosophila antenna. Cell, 117(7), pp. 965-79.

711

712 Hekmat-Scafe, D. S., Scafe, C. R., McKinney, A. J. and Tanouye, M. A. (2002) Genome-wide

713 analysis of the odorant-binding protein gene family in Drosophila melanogaster. Genome

714 Res, 12(9), pp. 1357-69.

715

716 Hekmat-Scafe, D. S., Steinbrecht, R. A. and Carlson, J. R. (1997) Coexpression of two odorant-

717 binding protein homologs in Drosophila: implications for olfactory coding. J Neurosci,

718 17(5), pp. 1616-24.

719 34

720 Jeong, Y. T., Shim, J., Oh, S. R., Yoon, H. I., Kim, C. H., Moon, S. J. and Montell, C. (2013) An

721 odorant-binding protein required for suppression of sweet taste by bitter chemicals.

722 Neuron, 79(4), pp. 725-37.

723

724 Kaissling, K. E. (2001) Olfactory perireceptor and receptor events in moths: a kinetic model.

725 Chem Senses, 26(2), pp. 125-50.

726

727 Kaissling, K. E., Zack Strausfeld, C. and Rumbo, E. R. (1987) Adaptation processes in insect

728 olfactory receptors. Mechanisms and behavioral significance. Ann N Y Acad Sci, 510, pp.

729 104-12.

730

731 Katti, S., Lokhande, N., Gonzalez, D., Cassill, Z. and Renthal, R. (2013) Quantitative analysis of

732 pheromone-binding protein specificity. Insect Molecular Biology, 22(1), pp. 31-40.

733

734 Keil, T. A. (1982) Contacts of pore tubules and sensory dendrites in antennal chemosensilla of a

735 silkmoth: demonstration of a possible pathway for olfactory molecules. Tissue Cell, 14(3),

736 pp. 451-62.

737

738 Kondo, S. and Ueda, R. (2013) Highly improved gene targeting by germline-specific Cas9

739 expression in Drosophila. Genetics, 195(3), pp. 715-21.

740 35

741 Kruse, S. W., Zhao, R., Smith, D. P. and Jones, D. N. M. (2003) Structure of a specific alcohol-

742 binding site defined by the odorant binding protein LUSH from Drosophila melanogaster.

743 Nature Structural & Molecular Biology, 10, pp. 694-700.

744

745 Laughlin, J. D., Ha, T. S., Jones, D. N. and D.P., S. (2008) Activation of pheromone-sensitive

746 neurons is mediated by conformational activation of pheromone-binding protein. Cell,

747 133(7), pp. 1255-1265.

748

749 Laughlin, J. D., Ha, T. S., Jones, D. N. and Smith, D. P. (2008) Activation of pheromone-

750 sensitive neurons is mediated by conformational activation of pheromone-binding protein.

751 Cell, 133(7), pp. 1255-65.

752

753 Leal, W. S. (2013) Odorant reception in insects: roles of receptors, binding proteins, and

754 degrading enzymes. Annu Rev Entomol, 58, pp. 373-91.

755

756 Leal, W. S., Chen, A. M., Ishida, Y., Chiang, V. P., Erickson, M. L., Morgan, T. I. and Tsuruda,

757 J. M. (2005) Kinetics and molecular properties of pheromone binding and release. Proc

758 Natl Acad Sci U S A, 102(15), pp. 5386-91.

759

760 Lee, T. and Luo, L. (1999) Mosaic analysis with a repressible cell marker for studies of gene

761 function in neuronal morphogenesis. Neuron, 22(3), pp. 451-61.

762 36

763 Li, Z., Ni, J. D., Huang, J. and Montell, C. (2014) Requirement for Drosophila SNMP1 for Rapid

764 Activation and Termination of Pheromone-Induced Activity. PLoS Genet, 10(9), pp.

765 e1004600.

766

767 Li, Z.-X., Pickett, J., Field, L. and Zhou, J.-J. (2004) Identification and Expression of Odorant-

768 Binding Proteins of the Malaria-Carrying Mosquitoes Anopheles gambiae and Anopheles

769 arabiensis. Archives of Insect Biochemistry and Physiology, 58, pp. 175-189.

770

771 Marshall, B., Warr, C. G. and de Bruyne, M. (2010) Detection of volatile indicators of illicit

772 substances by the olfactory receptors of Drosophila melanogaster. Chem Senses, 35(7),

773 pp. 613-25.

774

775 Martelli, C., JR, C. and Emonet, T. (2013) Intensity invariant dynamics and odor-specific

776 latencies in olfactory receptor neuron response. Journal of Neuroscience, 33(15), pp.

777 6285-6297.

778

779 McKenna, M. P., Hekmat-Scafe, D. S., Gaines, P. and Carlson, J. R. (1994) Putative Drosophila

780 pheromone-binding proteins expressed in a subregion of the olfactory system. J Biol

781 Chem, 269(23), pp. 16340-7.

782

783 Menuz, K., Larter, N. K., Park, J. and Carlson, J. R. (2014) An RNA-seq screen of the

784 Drosophila antenna identifies a transporter necessary for ammonia detection. PLoS Genet,

785 10(11), pp. e1004810. 37

786

787 Ni, L., Bronk, P., Chang, E. C., Lowell, A. M., Flam, J. O., Panzano, V. C., Theobald, D. L.,

788 Griffith, L. C. and Garrity, P. A. (2013) A gustatory receptor paralogue controls rapid

789 warmth avoidance in Drosophila. Nature, 500(7464), pp. 580-584.

790

791 Olsen, S. R. and Wilson, R. I. (2008) Lateral presynaptic inhibition mediates gain control in an

792 olfactory circuit. Nature, 452(7190), pp. 956-60.

793

794 Park, S. K., Shanbhag, S. R., Wang, Q., Hasan, G., Steinbrecht, R. A. and Pikielny, C. W. (2000)

795 Expression patterns of two putative odorant-binding proteins in the olfactory organs of

796 Drosophila melanogaster have different implications for their functions. Cell Tissue Res,

797 300(1), pp. 181-92.

798

799 Pelletier, J., Guidolin, A., Syed, Z., Cornel, A. J. and Leal, W. S. (2010) Knockdown of a

800 mosquito odorant-binding protein involved in the sensitive detection of oviposition

801 attractants. J Chem Ecol, 36(3), pp. 245-8.

802

803 Pelosi, P. and Maida, R. (1995) Odorant-binding proteins in insects. Comp Biochem Physiol B

804 Biochem Mol Biol, 111(3), pp. 503-14.

805

806 Pelosi, P., Zhou, J. J., Ban, L. P. and Calvello, M. (2006) Soluble proteins in insect chemical

807 communication. Cell Mol Life Sci, 63(14), pp. 1658-76.

808 38

809 Pikielny, C. W., Hasan, G., Rouyer, F. and Rosbash, M. (1994) Members of a family of

810 Drosophila putative odorant-binding proteins are expressed in different subsets of

811 olfactory hairs. Neuron, 12(1), pp. 35-49.

812

813 Pitts, J. R., Liu, C., Zhou, X., Malpartida, J. C. and Zwiebel, L. J. (2014) Odorant receptor-

814 mediated sperm activation in disease vector mosquitoes. Proceedings of the National

815 Academy of Sciences, 111(7), pp. 2566-2571.

816

817 Ray, A., van der Goes van Naters, W. and Carlson, J. R. (2008) A regulatory code for neuron-

818 specific odor receptor expression. PLoS Biol, 6(5), pp. e125.

819

820 Ray, A., van Naters, W., Shiraiwa, T. and Carlson, J. R. (2007) Mechanisms of odor receptor

821 gene choice in Drosophila. Neuron, 53(3), pp. 353-69.

822

823 Root, C. M., Masuyama, K., Green, D. S., Enell, L. E., Nassel, D. R., Lee, C. H. and Wang, J. W.

824 (2008) A presynaptic gain control mechanism fine-tunes olfactory behavior. Neuron,

825 59(2), pp. 311-21.

826

827 Sandler, B. H., Nikonova, L., Leal, W. S. and Clardy, J. (2000) Sexual attraction in the silkworm

828 moth: structure of the pheromone-binding protein-bombykol complex. Chem. Biol., 7, pp.

829 143-151.

830 39

831 Schultze, A., Pregitzer, P., Walter, M. F., Woods, D. F., Marinotti, O., Breer, H. and Krieger, J.

832 (2013) The co-expression pattern of odorant binding proteins and olfactory receptors

833 identify distinct trichoid sensilla on the antenna of the malaria mosquito Anopheles

834 gambiae. PLoS One, 8(7), pp. e69412.

835

836 Shanbhag, S. R., Hekmat-Scafe, D., Kim, M. S., Park, S. K., Carlson, J. R., Pikielny, C., Smith,

837 D. P. and Steinbrecht, R. A. (2001a) Expression mosaic of odorant-binding proteins in

838 Drosophila olfactory organs. Microsc Res Tech, 55(5), pp. 297-306.

839

840 Shanbhag, S. R., Muller, B. and Steinbrecht, R. A. (1999) Atlas of olfactory organs of

841 Drosophila melanogaster - 1. Types, external organization, innervation and distribution of

842 olfactory sensilla. International Journal of Insect Morphology & Embryology, 28(4), pp.

843 377-397.

844

845 Shanbhag, S. R., Muller, B. and Steinbrecht, R. A. (2000) Atlas of olfactory organs of

846 Drosophila melanogaster 2. Internal organization and cellular architecture of olfactory

847 sensilla. Arthropod Struct Dev, 29(3), pp. 211-29.

848

849 Shanbhag, S. R., Park, S. K., Pikielny, C. W. and Steinbrecht, R. A. (2001b) Gustatory organs of

850 Drosophila melanogaster: fine structure and expression of the putative odorant-binding

851 protein PBPRP2. Cell Tissue Res, 304(3), pp. 423-37.

852 40

853 Silbering, A. F., Rytz, R., Grosjean, Y., Abuin, L., Ramdya, P., Jefferis, G. S. and Benton, R.

854 (2011) Complementary function and integrated wiring of the evolutionarily distinct

855 Drosophila olfactory subsystems. J Neurosci, 31(38), pp. 13357-75.

856

857 Steinbrecht, R. A. (1973) Der Feinbau olfaktorischer Sensillen des Seidenspinners (Insecta,

858 Lepidoptera). Zeitschrift für Zellforschung und Mikroskopische Anatomie, 139(4), pp.

859 533-565.

860

861 Steinbrecht, R. A. (1997) Pore structures in insect olfactory sensilla: A review of data and

862 concepts. International Journal of Insect Morphology & Embryology, 26(3-4), pp. 229-

863 245.

864

865 Steinbrecht, R. A., Ozaki, M. and Ziegelberger, G. (1992) Immunocytochemical localization of

866 pheromone-binding protein in moth antennae. Cell Tissue Res, 270(2), pp. 287-302.

867

868 Swarup, S., Williams, T. I. and Anholt, R. R. (2011) Functional dissection of Odorant binding

869 protein genes in Drosophila melanogaster. Genes Brain Behav, 10(6), pp. 648-57.

870

871 Thode, A. B., Kruse, S. W., Nix, J. C. and Jones, D. N. (2008) The role of multiple hydrogen-

872 bonding groups in specific alcohol binding sites in proteins: insights from structural

873 studies of LUSH. Journal of Molecular Biology, 376(5), pp. 1360-1376.

874 41

875 van der Goes van Naters, W. and Carlson, J. R. (2007) Receptors and neurons for fly odors in

876 Drosophila. Curr Biol, 17(7), pp. 606-12.

877

878 Vogt, R. G. and Riddiford, L. M. (1981) Pheromone binding and inactivation by moth antennae.

879 Nature, 293, pp. 161-163.

880

881 Vogt, R. G., Riddiford, L. M. and Prestwich, G. D. (1985) Kinetic properties of a sex

882 pheromone-degrading enzyme: the sensillar esterase of Antheraea polyphemus. Proc Natl

883 Acad Sci U S A, 82(24), pp. 8827-31.

884

885 Wilson, R. I. (2013) Early olfactory processing in Drosophila: mechanisms and principles. Annu

886 Rev Neurosci, 36, pp. 217-41.

887

888 Wojtasek, H. and Leal, W. S. (1999) Conformational change in the pheromone-binding protein

889 from Bombyx mori induced by pH and by interaction with membranes. J Biol Chem,

890 274(43), pp. 30950-6.

891

892 Xu, P., Atkinson, R., Jones, D. N. and Smith, D. P. (2005) Drosophila OBP LUSH is required for

893 activity of pheromone-sensitive neurons. Neuron, 45(2), pp. 193-200.

894

895 Yao, C. A., Ignell, R. and Carlson, J. R. (2005) Chemosensory coding by neurons in the

896 coeloconic sensilla of the Drosophila antenna. J Neurosci, 25(37), pp. 8359-67.

897 42

898 Zhou, J. J., Zhang, G. A., Huang, W., Birkett, M. A., Field, L. M., Pickett, J. A. and Pelosi, P.

899 (2004) Revisiting the odorant-binding protein LUSH of Drosophila melanogaster:

900 evidence for odour recognition and discrimination. FEBS Letters, 558(1-3), pp. 23-26.

901

902 Ziegelberger, G. (1995) Redox-shift of the pheromone-binding protein in the silkmoth Antheraea

903 polyphemus. Eur J Biochem, 232(3), pp. 706-11.

904

905 43

906

907 Figure 1. Organization of the antenna and expression of Obps

908 A Scanning electron micrograph of antennae (arrowheads) on a Drosophila head. Adapted from

909 http://www.sdbonline.org/sites/fly/aimain/images.htm, (Menuz et al. 2014). B Higher

910 magnification image of antennal surface showing basiconic (B), trichoid (T), and coeloconic (C)

911 sensilla surrounded by non-innervated spinules (Sp). Adapted from (Menuz et al. 2014,

912 Shanbhag et al. 1999). C A generic sensillum containing two ORNs and thecogen (Th),

913 trichogen (Tr), and tormogen (To) cells, separated from neighboring sensilla by epidermal cells

914 (E). Adapted from (Menuz et al. 2014, Steinbrecht et al. 1992). D Members of the Obp gene

915 family detected in the third antennal segment, where olfactory sensilla are located, at >1 read per

916 million mapped reads in each of three samples. Genes are listed in decreasing order of 44

917 expression level, indicated in terms of reads per million mapped reads per kilobase of gene

918 length (RPKM). Obp76a is also known as LUSH. Adapted from (Menuz et al. 2014). 45

919

920 Figure 1 – figure supplement 1. Obp expression levels

921 Members of the Obp gene family detected with at least 1 read per million mapped reads (RPM)

922 in each of three samples in the third antennal segment of Canton-S (CS) flies. The 27 genes

923 detected at this level are listed in decreasing order of reads per million mapped reads per kilobase

924 of gene length (RPKM). Adapted from (Menuz et al. 2014). 46

925

926 Figure 2. Diverse expression patterns of abundant Obps in the antenna

927 A In situ hybridization of Obp antisense RNA probes to antennal sections. Scale bar = 20μm.

928 Male and female antennae were examined with each probe and no sexual dimorphism was

929 observed except that females appeared to show stronger labeling than males with Obp56d in the

930 region where trichoid sensilla are found. B Higher magnification images of sensilla labeled with

931 Obp probes: Obp19a in a basiconic sensillum (B), Obp76a in a trichoid sensillum (T), Obp84a

932 in a coeloconic sensillum (C), and Obp19d in cells that are located between sensilla and that are

933 associated with uninnervated spinules (Sp). Scale bar = 2μm. C Summary of Obp expression

934 patterns. +a indicates expression in the arista as well as in cells between sensilla of the third

935 antennal segment. 47

936

937 Figure 3. Obps are differentially expressed within basiconic sensillum types

938 A Confocal images of in situ hybridization to antennal sections labeled with antisense probes for

939 the Obps (red) and an antibody against GFP (green) driven by Or42b-GAL4 (ab1), Or59b-GAL4

940 (ab2), Or22a-GAL4 (ab3), Or56a-GAL4 (ab4), Or82a-GAL4 (ab5), Or49b-GAL4 (ab6), Or67c-

941 GAL4; Or98a-GAL4 (used together to label ab7), Or43b-GAL4 (ab8), Or 67b-GAL4 (ab9), and

942 Or49a-GAL4 (ab10). Many panels show more than one sensillum. Thus in some panels, such as

943 Obp83a/ab2, two sensilla are labeled by both the Or-GAL4 driver and the Obp probe. In some

944 other panels, such as Obp28a/ab1, Obp probes label multiple neighboring sensilla of which some

945 are unlabeled by the GAL4 driver. Scale bar = 5μm. B Summary of Obp expression in ten

946 basiconic types. An Obp is considered to be expressed in a sensillum type if it labeled a cell that 48

947 wraps around the dendrites of ORNs in the majority of labeled sensilla examined. Obp

948 expression was more difficult to identify with confidence in ab9 because of its proximity to other

949 sensilla with strong Obp expression. 49

950

951 Figure 4. Obps are expressed in different cell types

952 A Diagram of a generic sensillum containing ORNs, thecogen cells labeled with nompA-GAL4,

953 trichogen cells (Tr), and tormogen cells labeled with ASE5-GAL4, separated from neighboring

954 sensilla by epidermal (E) cells. Adapted from (Steinbrecht et al. 1992). B-D,F-J Confocal

955 images of antennal sections labeled with Obp antisense probes (red) and an antibody against GFP

956 (green) driven by the thecogen cell driver nompA-GAL4 (B,D,F), and the tormogen cell driver

957 ASE5-GAL4 (C-D,G-J). Yellow indicates coexpression. E Summary of coexpression 50

958 experiments. The dark, solid red rectangle indicates that Obp84a was co-expressed with the

959 thecogen cell type marker sensilla consistently in those sensilla that express Obp84a. In many

960 cases, indicated by light, stippled red rectangles, an Obp was co-expressed in a specific cell type

961 in some but not all sensilla. An empty rectangle indicates that the Obp did not co-localize with

962 that cell type marker in any sensilla examined. F,G Images of whole antennal sections. Obp83a

963 is expressed in many cells that are not labeled by the thecogen (F) or tormogen cell driver (G).

964 H Two trichoid sensilla that each house one tormogen cell (green) and two Obp83b-expressing

965 cells (red). I Obp19a is coexpressed with the tormogen cell driver in one sensillum. The image

966 shows the same cell as in C but in a different focal plane. J Obp19a is not coexpressed with the

967 tormogen cell driver in another sensillum. Scale bars = 2μm. 51

968

969 Figure 4 – figure supplement 1. Lack of Obp expression in ORNs

970 Confocal images of antennal sections labeled with antisense probes for the indicated Obps (red)

971 and an antibody against GFP (green) driven by neuronal GAL4 drivers. A The Obp28a probe

972 labels all basiconic sensilla. Orco-GAL4 labels all ORNs in basiconic sensilla, as well as all

973 ORNS in trichoid sensilla (Larsson et al. 2004). Coexpression is not observed. B The Obp76a

974 probe labels most if not all trichoid sensilla. Or67d-GAL4 labels an ORN in at1 sensilla (Couto

975 et al. 2005). Coexpression is not observed. C The Obp84a probe and IR8a-GAL4 label most

976 coeloconic sensilla (Abuin et al. 2011). Coexpression is not observed. Scale bars = 10μm. 52

977

978 Figure 5. Robust and increased response of ab8 to 1-octanol in an Obp28a mutant

979 A Dose-response curves of control (black) and Obp28a- (red) ab8 neuronal responses to a 0.5s

980 pulse of 1-octanol. Responses were quantified by subtracting the spontaneous firing rate from 53

981 the rate during the stimulus. The spike rates of both neurons were summed. B Peri-stimulus

982 time histograms (PSTHs) of ab8 responses to increasing doses of 1-octanol. Gray boxes denote

983 0.5s stimulus presentations. The baseline firing rates of the mutant and control are comparable.

984 Graphs display 2s time windows in 50ms bins. Shaded areas surrounding each curve indicate

985 SEM. * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001, n = 12. 54

Restriction Primer # Primer Name Sequence Enzyme 1 chiRNA R gaagtattgaggaaaacata 2 28a5pchiRNA F GGTGGTCCAGGTAACTTTATgttttagagctagaaatagc 3 28a3pchiRNA F GCAGTCTACTCCAATCATTCgttttagagctagaaatagc 4 28aH1 F GCGCCTgaattcCTCTAACCACTTTTTCTTCACTTTACTT EcoRI 5 28aH1 R GCGCCTgaattcCTCTAACCACTTTTTCTTCACTTTACTT SacII 6 28aH2 F GCGCCTactagtTGATTGGAGTAGACTGCATGATGCTA SpeI 7 28aH2 R GCGCCTctcgagCCAAAAGCAAAAGTTACACGCAATCA XhoI 8 Screen28F GCACCGCTGAGCCG 9 Screen28aH1F CTCTAACCACTTTTTCTTCACTTTACTT 10 Screen28aH2R CCAAAAGCAAAAGTTACACGCAATCA 11 Screen28R GCTACTGTGACTCTCGC 986

987 Figure 5 – figure supplement 1. CRISPR mutant cloning and verification primers

988 Primers #1-3 were used for creating CRISPR Guide chiRNA, primers #4-7 were used for

989 constructing the CRISPR donor plasmid, and primers #8-11 were used to verify Obp28a deletion

990 in transgenic flies. 55

991

992 Figure 6. Altered responses of Obp28a in prolonged stimulus paradigms

993 A PSTH of ab8 responses to 30s presentations of a 10-1.5 dilution of 1-octanol in control (black)

994 and Obp28a- (red). Gray box indicates stimulus presentation. Shaded areas display SEM. The

995 graph displays a 60s time window in 1s bins. • P < 0.05, n = 18; we note that for five of the bins,

996 P < 0.0001. We also asked whether the increased initial response of the mutant, indicated by *,

997 was significant when the responses were examined in 50ms bins, as in Figure 5, and found that P

998 < 0.05. B Background firing rates in response to prolonged (>5min) stimulation of a 10-2.5

999 dilution of 1-octanol. Each bar represents data prior to the administration of a short pulse of the

1000 indicated dose. ns = not significant, n = 16. C Dose-response curves of ab8 neurons to

1001 increasing doses of 1-octanol superimposed on the 10-2.5 1-octanol background. Spike rates are

1002 calculated from the number of spikes during the stimulus period, without subtracting the

1003 background firing rate. ****, P < 0.0001, n = 16. 56

1004 57

1005 Figure 7. Obp28a mutants show robust and increased responses to other odorants that

1006 activate ab8A or ab8B

1007 Dose-response curves of control (black) and Obp28a- (red) ab8 neuronal responses to a 0.5s

1008 pulse of butyric acid (A) and ethyl acetate (B). Responses were quantified by subtracting the

1009 spontaneous firing rate from the rate during the stimulus. * P < 0.05, ** P < 0.01, *** P < 0.001.

1010 PSTHs of butyric acid (C) and ethyl acetate (D) responses are shown, with shaded areas

1011 indicating SEM. Gray boxes indicate 0.5s stimulus presentations. Graphs depict 2s time

1012 windows with spikes summed in 50ms bins. • indicates P < 0.05 in all cases and P<0.01 in 80%

1013 of these cases. n = 12 (A,C) and 13 (B,D). (E) Responses of control (black) and Obp28a- (red)

1014 ab8 neurons to 0.5s pulses of odorants of different chemical classes: 3-methylthio-1-propanol

1015 (sulfur compound), γ-hexalactone (lactone), linalool oxide (terpene), methyl benzoate (aromatic),

1016 furfural (aldehyde), 2-pentanone (ketone), 2-pentanol (alcohol), and ethyl-3-hydroxybutyrate

1017 (ester). Responses were quantified by subtracting the spontaneous firing rate from the rate during

1018 the stimulus. * P < 0.05, ** P < 0.01. n = 12. 58

1019

1020 Figure 7 – figure supplement 1. Robust responses from ab4 sensilla of Obp28a mutants to

1021 odorants that activate ab4A or ab4B

1022 Responses of control (black) and Obp28a- (red) ab4 neurons to 0.5s pulses of the odorants

1023 representing different chemical classes that were tested against ab8 as well as additional odorants

1024 that elicit strong responses from ab4A (E2-hexenal) and ab4B (geosmin). Responses were

1025 quantified by subtracting the spontaneous firing rate from the rate during the stimulus. **** P<

1026 0.0001 n=12. 59

1027

1028 Figure 8. Models of odorant transport via Obps or pore tubules

1029 A Odorant transport via Obps in a sensillum. An odorant molecule contacts the membrane,

1030 diffuses in the surface of the cuticle (dark gray) until it reaches a pore, enters the sensillum

1031 lymph through the pore, binds to an Obp (red hexagon), and is transported to an olfactory

1032 receptor (green square) on an ORN dendrite (D). B Odorant transport via pore tubules. An

1033 odorant molecule contacts and diffuses on the cuticle surface, enters a pore, and is transported

1034 along a pore tubule to an olfactory receptor on a dendrite (D). An Obp could bind to the odorant

1035 at any point after the odorant reaches the pore. C Transmission electron micrograph of the pore

1036 (P) and pore tubules (Pt) of a trichoid sensillum of Bombyx mori. Adapted from (Steinbrecht

1037 1973). Pore tubules can be seen to contact an ORN dendrite (D) in two locations (arrowheads).

1038 Scale bar = 0.1μm. 60

1039 AATCACAAATGAAACAAAAACCAATGTAGCAAAGTTTTGAGGTTTACAAAACCGTTACTCGTTCGTTAATCGCACTCGTAAACTG 1040 TTACTGTTGCCGTGACTGCTACTGTGACTCTCGCTTCACATTTCATACCCATAATGGAAGATAACTAAATTATGATCGATATATGAT 1041 TTTACATTTAAACACTTTACAAAAATCACTCTGCGAAATAAAGAAGAAAGAGAGGGAACTCTTAACCTTAAGTTTAAGTTGCTTTA 1042 AATACTTTTACCTAAACTGTATGTTAATTAATTATGACTTAAGTTTAACCAAACGCAAAAACCACAACATCAATGAATTGATGACT 1043 CACGAATAGAATTTGCATGCCGCATTCAATGTATATATATGTAGGAGCGATGTATAATTCTCGATCCACATACGGATCTGTCGAAA 1044 TTAATTATGACTATTTTATTTTCTAATCGATTACTGAAATACCAATAACCGACAAATGAAAGCCACGCAAATTAAAACCAAGCAA 1045 GTGGTATATGGGAAATGAATTCCAAAAGCAAAAGTTACACGCAATCATTAATTTTGTCTTTGAAATCTATCCGATAAGTACCGCG 1046 AATAATTGTTTTTGTTGAGATGCATTATCATTTTTATTGTGTAAAGTATAAAAAACCAACAAATATATGCAAAATATATGGAATAT 1047 ATACAAAATATGTTGTTTTAAATGGATTTTCAATGGGAAAAATAATTTTACGCACGATTAGAAAGGTTTTGAAATTTCAAAAATGG 1048 ATTTTCATATTTTATATGGTTTATGGTCTGCAGGATTGCACATCTGATAGACAATTTTGATACTTATGAATTATGTGTAACGAAGCA 1049 CATATGCAAGTCATGTTGACATGGGGTTGGGACACTTTTTTAATCACTTAGACCTTTTCTGGGGATGTGCGTGTCTTATGGGGGCG 1050 GTCAGCACTTATTGGTCGACCGGCTACATTTTGTTAGCTGATCCATTAGCTGAAAACCCCTAATAACGATCACGATGCGGCCAATT 1051 AAGCGACCATTGTAAAGATTGTTAAACGATGTACTATATTATTTCACAGCCGAGCGAGTCACCGATTTAGCTATAAAAGCCTGAG 1052 TCTCTCATCAGCATAGACAAGTTCCGTTCAGACACACCGACCTAGCATCATGCAGTCTACTCCAATCATTCTGGTGGCAATC 1053 GTCCTTCTCGGCGCCGCACTGGTGCGAGCCTTTGACGAGAAGGAGGCCCTGGCCAAGCTGATGGAGTC 1054 AGCCGAGAGCTGCATGCCGGAAGTGGGGGCCACCGATGCCGATCTGCAGGAAATGGTCAAGAAGCAG 1055 CCAGCCAGCACATATGCCGGCAAGTGCCTGCGCGCCTGCGTGATGAAGAACATCGGAATTCTGGACGC 1056 CAACGGAAAACTGGACACGGAGGCAGGTCACGAGAAGGCCAAGCAGTACACGGGCAACGATCCGGC 1057 CAAGCTAAAGATTGCCCTGGAGATCGGCGACACCTGTGCCGCCATCACTGTGCCGGATGATCACTGCG 1058 AGGCCGCCGAAGCCTATGGCACTTGCTTCAGGGGCGAGGCCAAGAAACATGGACTCTTGTAATCATTG 1059 ATGCAGCGCTACCCACCTGGACACGCCGATAAAGTTACCTGGACCACCACACTTGTATCTATAAGTTTTGAATAATCG 1060 AGGTCGAGTAAAATAAATGCATTAAAAAAGGATTTGGAAGTCTGCAATTTCTATGTTTAAATTTCTGCGTAGCGGGAAAAATTCA 1061 AGACATCACTTTTTTGAAAGCTATTTTTGAAAGTAGCTTAAAAGAGTTTTAAATTAACAAATACAAAAAAGTTTAAAACGCTGAAT 1062 AGATGGTAAATATGTAAAAGTTTATGGATTTCATAGAAGTTAACAGTTGTATTATTATTTCATACTTTATTATCTCATATTTATTAT 1063 CTACATTTCCTTTTTAACTAGTTTGAAAAATAACAGTCTTGTGTTGCCTGGCCACACTTTTATACAGTCACTTAACAGAGCCTCTGT 1064 TACTGAAAGAAACTGGTTCGAGTCACTGCTAAATCATATCATTTTCCGCAACCGAGGGTAGTTGCTCTGATGGCGGTATTTTGCCA 1065 CACTTGCAAGTATTTTTTAGTGAATTGTTCTGCTTCATGTTATTATTGCCCCAACAAATTGCGTTCCCCAAAAGTCGGTGGATCTCG 1066 TTCGCGTGAGGAGCTCAGCGCTCTGTTAGCGGCAATTCGAAAAGCCAAACTCCACGCCAATACGGTTCGTTCAAATCGCCGCTGC 1067 AAACGCACAAACACCTTAAACGCCAAACGCACGTAAATTGCGAGTAATCAACCAGATAATAAAAATGTGTAAACAGCTGTGTGT 1068 AGCTCGTTAAAATATATTGTTTATATTCTTAATCGGGATGCTAGAAGCCTGAGGCTGCTAAAAATATTTGCCGTGGGTGTTTGTGT 1069 TTTTTTCGCCAAGACCCCCCTCATTCATGCCAAAAGGGGCGTGGGAATTACAGCGTGCGTGTATTGGTGTTTTGTGTATAACATGG 1070 ATATTCAGGAATTTCGCAGATGAATCCTTTTTACGACAATTTATAGTATTGCCTTAATGCACTTTTGAATTTCTAAATGGAGAGGG 1071 GAAAGTAAAGTGAAGAAAAAGTGGTTAGAGCAAGGATAACGTATTAGTCATCGTTGGCAGCGACGTCGACTGCGCAGTCGGCAG 1072 CGCATCCTGGCTGCCTGTGCGTGTGTGCGTGCGTGTGTTGGTCTCTCTATTTTTGAATTTCCGCCGGTTTCTGCACAACAACAACAA 1073 AAGCAACTGAGCGGGAGAAACAGTGCCCGTGCGACAAAAACAACAACTTGTTTGTTTGATCCCTGAAAGAGAGCACGGAAGAGA 1074 GCAGGATGGAGCGAAAGTTTACGCGCGGCTTAAATAAGCTCGGCTCAGCGGTGCAAATGAGAGAGAATGTCTCTCAGCTGGTGC 1075 GAGAGAGCGCGGTTTTGGTAAGTTCAGAAATTCCCTTATTACACCTGCTTATTGCCATCTCACTCACTCCCCCTAGACTATTTTTGA 1076 CTTTCAGAAGTGCAGTTGTTGGTTTTCATACATGTGTATATGC 1077 1078 Annotated sequence legend: 1079 Green highlight = PAM sequence 1080 Yellow highlight = Seed sequence 1081 Red highlight = Remainder of seed sequence past Cas9 cut site 1082 Teal highlight = Screening primers 1083 Blue text = Coding sequence 1084 Larger font = Excised portion (replaced by DsRed cassette) 1085 Underlined text = Homology arms 1086 1087 Supplementary file 1. Deleted regions of Obp28a gene

1088 Sequence of Obp28a genomic region. PAM cleavage sites were located 19-nt downstream of the

1089 5’ end and 37-nt downstream of the 3’ end of the Obp28a coding sequence.