REGULATION OF STARVATION AND NONCULTURABILITY IN THE

MARINE PATHOGEN, Vibrio vulnificus

S. Diane McDougald

A thesis submitted for the degree of Doctor of Philosophy

School of Microbiology and Immunology

University of New South Wales

Sydney, Australia

August 2000 ACKNOWLEDGEMENTS

First I would like to express my sincere appreciation to my supervisor, Staffan

Kjelleberg, for always having a positive attitude, even during my worst failures, and for always having time for discussions. I also would like to thank Staffan for his gently way of guidance and for letting me follow my ideas, no matter how wild.

I would also like to thank Dr. Jim Oliver, whose enthusiasm in this project inspired me to pursue a Ph.D. in the first place. I look forward to continued collaboration; thank you for teaching me to be a scientist. Also, I would like to thank Michael Givskov and Lone Gram for their helpful discussions and encouragement.

Special thanks go to Christine Paludin-Muller, Dieter Weichart, Daniel Tillett and

Sujatha Srinivasan for collaborations on this project. Thanks Dieter for companionship and help during all those long days and nights and all those 2D gels! I especially thank Sujatha who has been down the long road with me.

Working with you on this project has certainly made it more enjoyable.

I would like to thank all the members of the SK group and CMBB for all their companionship and for making the lab an enjoyable place to work. For their help with sanity-inducing maintenance of cognition (SIMC), a VERY special thanks goes to "The Girls"; Emma Beacham, Katie Crass, Su Egan, Julie Lim, Carolina Tillett, and Hanna Banana for all those times; and the boys, Mike Manefield and

Greg Fallon, for all those Friday lunches.

I would also like to thank my mother for her many years of support and encouragement, without which I would never have accomplished this. Finally, I would like to thank my husband, Scott Rice for all the help and suggestions with experiments, papers and ideas on this project, as well as for bringing sanity to my life and being my very best friend. TO MY FAMILY

“Research is seeing what everyone else has seen and thinking what no one else has thought” Alber Szent-Gyorgyi

“The hypothesis outlined in this communication is controversial. Thus, disagreement is expected and welcomed since in the words of Eugene Odum

(Odum, E. P., 1977. The emergence of ecology as a new intergrative discipline.

Science 195:1289-1293.) disagreement … is certain not only to generate useful knowledge but (also) to promote the art and science of both the experimental and analytical approaches.” Harold Stevenson ABSTRACT

Vibrio vulnificus is a model environmental organism exhibiting a classical starvation response during nutrient limitation as well as a non-culturable state when exposed to low temperatures. In addition to these classic global responses, this organism is an opportunistic pathogen that exhibits numerous virulence factors. This organism was chosen as the model organism for the identification of regulators of the viable but nonculturable response (VBNC) and the starvation- induced maintenance of culturability (SIMC) that occurs when cells are starved prior to low temperature incubation. In order to accomplish this, three indirect approaches were used; proteomics, investigation of intercellular signalling pathways and genetic analysis of regulators involved in these responses.

Two-dimensional gel electrophoresis was used to identify proteins expressed under conditions that induced SIMC. It was determined that carbon and long- term phosphorus starvation were important in the SIMC response. V. vulnificus was shown to possess genes, luxS and smcR, that are homologues of genes involved in signalling system system 2 in Vibrio harveyi. Signal molecules were produced upon starvation and the entry to stationary phase in V. vulnificus.

Furthermore, a null mutation in smcR, a transcriptional regulator was shown to have pleiotropic effects in V. vulnificus, including up-regulation of numerous virulence factors and a defect in starvation survival and development of the SIMC response. We propose that V. vulnificus possesses a signalling system analogous to that of system 2 in V. harveyi, and that this system is involved in the regulation of stationary phase and starvation adaptation in this organism. i

TABLE OF CONTENTS

1 GENERAL INTRODUCTION AND LITERATURE REVIEW...... 1 1.1 GENERAL INTRODUCTION...... 1 1.2 DESCRIPTION OF THE MODEL ORGANISM - Vibrio vulnificus ....2 1.2.1 Historical perspective ...... 3 1.2.2 Syndromes of disease caused by V. vulnificus ...... 3 1.2.3 Virulence factors ...... 6 1.2.4 Population heterogeneity...... 8 1.2.5 Distribution of V. vulnificus ...... 9 1.2.6 Adaptive responses of V. vulnificus...... 10 1.3 NUTRIENT LIMITATION...... 13 1.3.1 Ultramicrobacteria...... 15 1.3.2 Starvation-induced differentiation...... 17 1.3.3 Expression of proteins in response to starvation...... 22 1.3.4 Effect of limiting nutrient on starvation response ...... 23 1.3.5 Global regulators of starvation response...... 27 1.3.6 Conclusions ...... 37 1.4 THE VIABLE BUT NONCULTURABLE RESPONSE...... 38 1.4.1 Historical Perspective ...... 38 1.4.2 The Viable but Nonculturable State ...... 39 1.4.3 Formation of VBNC cells ...... 40 1.4.4 Methods of assessing the VBNC state...... 41 1.4.5 Physiology of nonculturable cells ...... 49 1.4.6 Nucleic acids of nonculturable cells...... 50 1.4.7 Potential virulence of VBNC cells ...... 51 1.4.8 Reports of in vitro resuscitation ...... 54 1.4.9 Genetics of the VBNC response...... 59 1.4.10 Conclusions ...... 64 1.5 INTERCELLULAR SIGNALLING ...... 66 1.5.1 Signalling in Gram-positive bacteria...... 68 1.5.2 Signalling in differentiating Gram-negative bacteria ...... 69 ii

1.5.3 Signalling in non-differentiating Gram-negative bacteria ...... 70 1.5.4 Eucaryotic interactions...... 78 1.5.5 Conclusions ...... 79 2 STARVATION-INDUCED MAINTENANCE OF CULTURABILITY81 2.1 ABSTRACT...... 81 2.2 INTRODUCTION...... 82 2.3 MATERIALS AND METHODS...... 83 2.3.1 Bacterial strains and culture conditions ...... 83 2.3.2 Determination of colony forming units ...... 85 2.3.3 Pre-starvation and cold incubation experiments ...... 85 2.3.4 Pulse-labelling of C7184(T) for two-dimensional PAGE ...... 86 2.3.5 Resolution of pulse-labelled cell proteins of two-dimensional PAGE ...... 87 2.4 RESULTS...... 88 2.4.1 Starvation survival of Vibrio vulnificus C7184(T)...... 88 2.4.2 Effect of pre-starvation on culturability at 4°C...... 89 2.4.3 Two-dimensional gel analysis of proteins induced after 1 hour of carbon, nitrogen, phosphorus or multiple-nutrient starvation...... 97 2.5 DISCUSSION ...... 110 2.5.1 Starvation survival at 24°C ...... 111 2.5.2 Effects of starvation conditions on culturability at 4°C...... 112 2.5.3 Analysis of protein synthesis during starvation ...... 116 2.6 ACKNOWLEDGEMENTS...... 118 3 MOLECULAR ANALYSIS OF THE VBNC RESPONSE ...... 119 3.1 ABSTRACT...... 119 3.2 INTRODUCTION...... 120 3.3 MATERIALS AND METHODS...... 124 3.3.1 Bacterial stains and plasmids ...... 124 3.3.2 Media, growth and screening conditions ...... 127 3.3.3 Fixation of bacterial cells...... 128 3.3.4 Hybridisation...... 129 3.3.5 Permeabilisation of cells ...... 129 iii

3.3.6 DNA and RNA digestion ...... 130 3.3.7 Visualisation...... 130 3.3.8 Determination of colony forming units (CFU) ...... 131 3.3.9 Recombinant DNA techniques...... 131 3.3.10 Construction of a promoter-probe transposon and delivery system for generation of stable insertion mutants...... 132 3.3.11 Mobilisation and transposition ...... 141 3.4 RESULTS ...... 142 3.4.1 Nucleic acids in VBNC cells of Vibrio vulnificus...... 142 3.4.2 Staining with DAPI after differential digestion with DNase and RNase...... 142 3.4.3 Degradation of DNA during cold incubation...... 143 3.4.4 Generation of stable insertion mutants ...... 148 3.5 DISCUSSION ...... 150 3.6 ACKNOWLEDGMENTS ...... 156 4 THE MARINE PATHOGEN VIBRIO VULNIFICUS ENCODES A PUTATIVE HOMOLOGUE OF THE VIBRIO HARVEYI REGULATORY GENE, LUXR: A GENETIC AND PHYLOGENETIC COMPARISON...... 157 4.1 ABSTRACT...... 157 4.2 INTRODUCTION...... 157 4.3 MATERIALS AND METHODS...... 160 4.3.1 Bacterial strains and growth conditions...... 160 4.3.2 DNA techniques ...... 163 4.3.3 Southern hybridisation with a Vibrio cholerae hapR probe...... 163 4.3.4 Isolation of the Vibrio harveyi luxR homologue from Vibrio vulnificus ...... 164 4.3.5 DNA sequencing and analysis...... 165 4.4 RESULTS ...... 166 4.4.1 Identification of luxR homologues in Vibrio species...... 166 4.4.2 Sequence analysis...... 168 4.4.3 Phylogenetic analysis of smcR and other luxR homologues ...... 172 iv

4.5 DISCUSSION ...... 178 4.6 ACKNOWLEDGMENTS ...... 181 5 GENERATION OF A SMCR MUTATION IN VIBRIO VULNIFICUS AND ITS EFFECT ON VIRULENCE...... 182 5.1 ABSTRACT...... 182 5.2 INTRODUCTION...... 182 5.3 MATERIALS AND METHODS...... 186 5.3.1 Bacterial strains and growth conditions...... 186 5.3.2 Preparation of cell-free supernatants ...... 189 5.3.3 V. harveyi bioassay for the detection of AI-2 activity...... 190 5.3.4 Molecular biology techniques ...... 191 5.3.5 Generation of V. vulnificus smcR null mutants ...... 193 5.3.6 Electron microscopy ...... 195 5.3.7 Biofilm assays ...... 196 5.3.8 Motility assay ...... 196 5.3.9 Capsule production ...... 196 5.3.10 Exoenzyme assays ...... 197 5.3.11 Assay for siderophore production ...... 198 5.4 RESULTS ...... 199 5.4.1 Production and regulation of AI-2 activity in V. vulnificus ...... 199 5.4.2 Characterisation of a mutant in V. vulnificus of the luxR transcriptional regulator homologue...... 210 5.5 DISCUSSION ...... 231 5.6 ACKNOWLEDGMENTS ...... 237 6 STARVATION ADAPTATION IN VIBRIO VULNIFICUS IS REGULATED BY CELL TO CELL SIGNALLING...... 238 6.1 ABSTRACT...... 238 6.2 INTRODUCTION...... 239 6.3 MATERIALS AND METHODS...... 240 6.3.1 Bacterial strains and culture conditions ...... 240 6.3.2 Determination of colony forming units ...... 241 6.3.3 Preparation of supernatant extracts...... 242 v

6.4 RESULTS ...... 243 6.4.1 A null mutation in smcR affects starvation survival of V. vulnificus 243 6.4.2 A null mutation in smcR affects the culturability of V. vulnificus at low temperatures in a starvation-dependent manner ...... 245 6.4.3 Effect of a signal antagonist on the SIMC response in V. vulnificus 247 6.4.4 Effect of supernatant extract from V. angustum on the SIMC response of V. vulnificus ...... 247 6.4.5 Supernatant extracts from V. angustum and V. vulnificus can provide protection from the loss of culturability induced by compound 2...... 252 6.5 DISCUSSION ...... 255 6.6 ACKNOWLEDGMENTS ...... 259 7 DISCUSSION...... 260 8 REFERENCES...... 268 vi

LIST OF TABLES Table 1.1. Studies investigating the viable but nonculturable response ...... 42 Table 1.2. Methods for assessment of activity of VBNC cells ...... 47 Table 2.1. Long-term survival of V. vulnificus C7184(T) at 24°C during starvation...... 91 Table 2.2. Numbering and grouping of starvation-induced proteins of V. vulnificus...... 108 Table 3.1. Bacterial strains and plasmids...... 125 Table 4.1. Bacterial strains and plasmids...... 161 Table 4.2. Percent identities, similarities for DNA and protein...... 171 Table 4.3. Rates of change at synonymous sites (per million years) for luxR homologues...... 176 Table 5.1. Bacterial strains and plasmids...... 187 vii

LIST OF FIGURES Figure 1.1. Model for the VBNC response of Vibrio vulnificus...... 63 Figure 1.2. Model for the regulation of quorum sensing in V. fischeri...... 72 Figure 1.3. Model for the regulation of quorum sensing in Vibrio harveyi...... 75 Figure 2.1. Survival of V. vulnificus C7184(T) during starvation at 24°C...... 90 Figure 2.2. Culturability of V. vulnificus C7184(T) at 4°C after pre-starvation for carbon or after multiple nutrient starvation...... 93 Figure 2.3. Culturability of V. vulnificus C7184(T) at 4°C after various times of pre-starvation for multiple nutrients (CNP)...... 95 Figure 2.4. Culturability of V. vulnificus C7184(T) at 4°C after pre-starvation for nitrogen...... 96 Figure 2.5. Culturability of V. vulnificus C7184(T) at 4°C after pre-starvation for phosphorus for 3-15 hours...... 98 Figure 2.6. Culturability of V. vulnificus C7184(T) at 4°C after phosphorus pre- starvation for 12-40 hours...... 99 Figure 2.7. Culturability of V. vulnificus C7184(T) at 4°C after pre-starvation for phosphorus for 15-40 hours at high and low cell densities...... 100 Figure 2.8. Autoradiograms of two-dimensional protein gels of V. vulnificus labelled with [35S]methionine...... 103 Figure 2.9. Venn diagram of the numbers of proteins induced after various nutrient starvations...... 109 Figure 3.1. The construction of pMAC01...... 134 Figure 3.2. Digestion of pMac01 to determine orientation of gusA...... 136 Figure 3.3. Generation of pMac14...... 137 Figure 3.4. PCR of the gusA insertion into pBSL180 to generate pMac14...... 138 Figure 3.5. Construction of pMac20...... 139 Figure 3.6. Epifluorescence microscopic images of DAPI-stained cells of V. vulnificus C7184(T)...... 144 Figure 3.7. Electrophoretic image of chromosomal DNA extracted from logarithmic-phase and nonculturable cells of V. vulnificus...... 147 Figure 3.8. Isolation of transposon mutants of V. vulnificus...... 152 Figure 4.1. The identification of V. harveyi luxR homologues in Vibrio spp. ...167 viii

Figure 4.2. DNA sequence of the V. vulnificus smcR gene...... 169 Figure 4.3. Genomic organisation of the smcR gene...... 173 Figure 4.4. Protein alignment of V. vulnificus SmcR with V. harveyi LuxR, V. parahaemolyticus OpaR and V. cholerae HapR...... 175 Figure 4.5. Phylogenetic tree based on synonymous site substitutions of luxR homologues...... 177 Figure 5.1. Production of bioluminescence in V. harveyi by cell-free supernatants of V. vulnificus strains...... 200 Figure 5.2. The effect of growth medium on the production of signal molecules in V. vulnificus...... 203 Figure 5.3. Effect of growth phase on the production of substances able to induce luminescence in V. harveyi BB170...... 204 Figure 5.4. V. vulnificus produces a substance that induces luminescence in the V. harveyi reporter strain BB170 under starvation conditions...... 206 Figure 5.5. Signal antagonists do not inhibit production of the autoinducer activity in V. vulnificus...... 207 Figure 5.6. The effect of heat treatment on signal activity...... 209 Figure 5.7. Nucleotide alignment of luxS homologues...... 211 Figure 5.8. Construction of the smcR mutant, Vibrio vulnificus DM7...... 215 Figure 5.9. smcR regulates capsule production in V. vulnificus...... 219 Figure 5.10. V. vulnificus lacking SmcR is hypermotile...... 220 Figure 5.11. SmcR affects fimbriation...... 221 Figure 5.12. Biofilm formation by smcR mutant cells...... 224 Figure 5.13. The expression of alkaline phosphatase activity...... 225 Figure 5.14. Exoprotease activity of V. vulnificus C7814(O) and DM7 (smcR::Sm)...... 227 Figure 5.15. Furanone compound 2 inhibits production of exoprotease in V. vulnificus...... 230 Figure 6.1. SmcR affects starvation survival at room temperature...... 244 Figure 6.2. SmcR affects starvation-induced maintenance of culturability (SIMC) at low temperature...... 246 ix

Figure 6.3. Furanone compound 2 can inhibit the starvation-induced maintenance of culturability (SIMC) at low temperature at concentrations that are not growth inhibitory...... 248 Figure 6.4. Effect of supernatant extract from V. angustum on SIMC in V. vulnificus...... 251 Figure 6.5. Effect of the addition of V. vulnificus supernatant extracts to V. angustum cells starved in the presence of furanone compound 2...... 253 Figure 6.6. Effect of the addition of V. angustum supernatant extract to V. vulnificus cells starved in the presence of furanone compound 2...... 254 x

LIST OF ABBREVIATIONS

2D PAGE two-dimensional polyacrylamide gel electrophoresis

AHL N-acyl-homoserine lactone

AI-1 autoinducer 1

AI-2 autoinducer 2

Amp ampicillin

AODC Acridine orange direct count bp base pair(s) cAMP cyclic AMP

CFU colony forming units

CPS capsular polysaccharide

CTC cyanoditolyl tetrazolium chloride

DAPI 6-diamidino-2-phenylindole

DGGE denaturing gradient gel electrophoresis

DIG digoxigenin

DNA deoxyribonucleic acid

DPM degradations per minute

DSB double stranded breaks

DVC direct viable count

ERIC enterobacterial repeat intergenic consensus

GASP growth advantage in stationary phase

GUS b-glucuronidase

HA/P V. cholerae metalloprotease

HPA Hyde powder azure xi

HSL homoserine lactone

INT 2-(4-iodophenyl)-3-(4-nitrophenyl)-5-phenyltetrazolium chloride kb kilobase(s)

LB Luria-Bertani

MOPS morpholinepropanesulfonic acid

ORF open reading frame

PAGE polyacrylamide gel electrophoresis

PBS phosphate-buffered saline

PCR polymerase chain reaction

Pex post-exponential

PHB poly-ß-hydroxybutyrate

PFGE pulsed-field gel electrophoresis ppGpp guanosine 3'-diphosphate 5'-diphosphate

PTS phosphotransferase system

RAPD randomly amplified polymorphic DNA

ROS reactive oxygen species

SDS sodium dodecyl sulfate

SIMC starvation-induced maintenance of culturability

Sm streptomycin

Sp spectinomycin

SSC 0.15 M NaCl/0.015 M Na3 ·citrate pH 7.6

Sti starvation-induced

TAE Tris-acetate buffer

TBE Tris-borate buffer xii

TE 10 mM Tris-HCl, 0.1 mM EDTA, pH 8.0

VBNC Viable but nonculturable

VVP V. vulnificus metalloprotease

XGal 5-bromo-4-chloro-3-indolyl-ß-D-galactopyranoside

X-GlcA 5-bromo-4-chloro-3-indolyl-b-D-glucuronide 1

1 GENERAL INTRODUCTION AND LITERATURE REVIEW

1.1 GENERAL INTRODUCTION

Bacteria in the natural environment are continually presented with abruptly changing microenvironments. Successful persistence of microorganisms in the natural environment therefore depends on their ability to quickly and efficiently sense environmental changes and adapt gene and protein expression to these conditions (198, 242, 305, 378, 524). Most species have evolved highly complex global regulatory networks that modulate the expression of genes participating in numerous cellular processes in response to environmental and physiological demands. These effects are mediated in a large part through the activation or repression of mRNA transcript initiation by DNA-binding proteins, sigma factors and signal transduction systems as well as through post-transcriptional mechanisms. It has recently become evident that intercellular signalling is also a central theme in the regulation of such networks. This dissertation addresses the adaptive strategies of an estuarine bacterium, Vibrio vulnificus, involved in its survival and persistence in the marine environment. In particular, the role of starvation-induced responders involved in the maintenance of culturability and the role of intercellular signalling in adaptive responses will be addressed.

Bacterial populations in the environment are frequently exposed to stresses due to limitations and changes in nutrient availability, temperature, salinity, solar illumination, and oxygen saturation (334, 340). Therefore, those cells have 2

developed survival strategies to cope with these conditions and several different stress-induced responses exist. Probably the most common stress encountered is that of nutrient limitation (89). In fact, most microorganisms in the environment survive in extended states of starvation with infrequent bouts of feast conditions

(340). The ability to survive long-term depletion of energy and carbon sources and yet be able to quickly take advantage of nutrient availability would be a successful and competitive strategy for marine microorganisms.

1.2 DESCRIPTION OF THE MODEL ORGANISM - Vibrio vulnificus

Vibrio species generally comprise a significant portion of the culturable fraction of marine and estuarine bacteria, as well as a significant fraction of the gastro- intestinal microflora of marine fish and invertebrates. For example, Vibrio spp. have been isolated from estuarine water filtrates (passing through 0.2 µm filters)

(289), the marine water column (367), from seawater filtrates (0.45 µm filters)

(13) and from deep ocean bottom water filtrates (0.45 µm filters) (502). In the report by Tabor et al. (502), 15 out of 27 identified isolates were shown to be

Vibrios. Due to their ubiquitous occurrence in these environments, it is apparent that these organisms are well adapted to the lifestyle of 'feast and famine'. For a more complete list of Vibrio species and their sites of isolation and pathogenicity, see (398).

The marine bacterium, Vibrio vulnificus is used as a model organism in this project due to the fact that it is a human pathogen displaying many of the relevant virulence factors expressed by other pathogens, including Vibrio cholerae and 3

Pseudomonas aeruginosa. In addition, this organism displays a range of adaptive phenotypes, such as starvation and cold adaptation, as well as being the paradigm organism for the study of the viable but nonculturable response. Thus all of these phenotypic responses and their possible interactions and coordinations, can be studied in the one organism.

1.2.1 Historical perspective

Vibrio vulnificus was named from the Latin word which means "wounding".

Infections characteristic of V. vulnificus have been described in the literature back to the days of Hippocrates (259). 'Hippocrates described the case of a 5th century

BC man who developed "violent pain in his foot" as well as fever, chills, nausea and confusion…and finally the development of small black blisters on the foot.'

The patient died after 2 days and was hypothesised by historians to have died from V. vulnificus infection (17). The organism was isolated by the Center for

Disease Control (CDC) in 1964 and was formally named in 1979 (120).

1.2.2 Syndromes of disease caused by V. vulnificus

Although the risk of infection by V. vulnificus in healthy individuals is relatively low, the prognosis is poor for those who are immuno-compromised or have chronic liver disease. A correlation is found with liver disease and infections by

V. vulnificus, probably due to the organisms requirement of iron for growth. V. vulnificus is able to grow rapidly in situations where a large amount of iron is freely available in the bloodstream. People who are most susceptible to infection 4

usually suffer from chronic disease that affects either liver function or the immune system (504). Liver disease includes cirrhosis or alcoholic liver disease, hepatitis or history of hepatitis, metastatic cancer or liver transplantation. Other conditions that predispose people to V. vulnificus infections include those with compromised immune systems such as AIDS, and other chronic diseases including diabetes mellitus and renal disease.

V. vulnificus is unique in its ability to cause three distinct syndromes of infection.

Out of 422 infections reported to the CDC between 1988 and 1996, 45% were wound infections, 43% primary septicemia and 5% gastroenteritis (7% were from undetermined exposure) (459). A combined mortality of 39% was determined, although for patients presenting with primary septicemia, 61% of the infections were fatal. Of these cases reported to the CDC, it was determined that 96% of primary septicemia cases reported ingestion of raw oysters, while the other 4% had ingested either raw clams or cooked shrimp (459). Among the primary septicemia infections, the median duration of illness was 3 days in fatal infections and 16 days in nonfatal infections. Primary septicemia was correlated with underlying liver disease: 80% of overall cases and 87% of fatal cases. Liver diseases associated with V. vulnificus primary septicemia infections were 58% cirrhosis or alcoholic liver disease; 24% hepatitis; 16% with both cirrhosis and hepatitis; 1% cancer and 1% liver transplant. Patients with primary septicemia usually present with sudden onset of fever and chills often accompanied by vomiting, diarrhoea and abdominal pain. Within 24 hr, secondary lesions begin to appear on the extremities and often become large and filled with hemorrhagic 5

fluid, and may become necrotic and gangrenous requiring debridement and often amputation. Up to 60% suffer septicemic shock (493) and those patients who become hypotensive within 12 hours are more than two times more likely to die compared with patients with normal blood pressure (245). The mortality rate for septic shock patients is 92% (245).

Wound infections follow exposure of a wound to seawater or from handling raw seafood. Often the wound is acquired at the time of exposure, such as those incurred while cleaning fish or shellfish. Patients present with fever, inflammation and intense pain at the site of the wound, which often becomes necrotic. Often these patients also become septicemic and suffer symptoms similar to primary septicemia. The fatality rate for wound infections is lower than that for primary septicemia, ranging from 20 - 30%. While healthy individuals are susceptible to wound infections, it has been reported in some surveys that up to 68% do have pre-existing conditions (459). The median duration of illness ranged from 3 days for fatal infections to 11 days for nonfatal infections.

Gastroenteritis was rarely reported but was almost always preceded by ingestion of raw shellfish (83%) or other seafood. There is no systemic shock or cellulitis as is common for primary septicemia or wound infection. The majority of gastroenteritis cases are self-limiting and probably go largely unreported. In addition to these three main types of infections, V. vulnificus has been implicated in numerous other infection pathologies, including peritonitis (555), meningitis

(231), corneal ulcers (93), epiglottitis (321), myositis (236), pneumonia (235), endometritis (517) and osteomyelitis (527). 6

1.2.3 Virulence factors

Numerous virulence factors have been proposed for this organism. Capsule expression is important for survival in the human host (469) and may also be important for colonisation of oysters since the translucent strains are readily cleared by oyster phagocytic hemocytes while encapsulated strains avoid phagocytosis and persist in oyster tissue (175). The presence of capsular polysaccharide (CPS) has been correlated with virulence (469) as loss of capsule resulted in a loss of virulence, hydrophobicity and serum resistance (559). The

CPS increases resistance to the bacteriocidal effects of human serum and reduces phagocytosis by polymorphonuclear leucocytes (256, 568). The expression of

CPS is dependent on growth phase and other environmental conditions, specifically temperature (558). V. vulnificus produces both hydroxymate and phenolate siderophores (468) and may have the ability to obtain iron from transferrin (467) and haemoglobin (186). Type IV pili have been shown to be involved in the attachment of V. vulnificus cells to HEp-2 and clinical strains were shown to have higher numbers of pili per cell than environmental strains (145).

The organism can bind to human intestinal cells and in vitro studies show that a short binding time and exposure to the cytotoxin is required to induce cytotoxic effects (258). In vivo animal studies have shown that V. vulnificus is found in the systemic circulation four hours after inoculation into the duodenum (203).

The extensive tissue damage which is characteristic of infections suggests involvement of several specific toxins. An extracellular metalloprotease is produced that is secreted into the interstitial space, resulting in an increase in 7

vascular permeability and development of skin lesions (252, 328). In its purified form, this protease has been shown to induce hemmorhagic damage, enhance vascular permeability and oedema and is lethal to mice when administered intraperitoneally or intravascularly (329). In addition, the metalloprotease has been implicated in the release of iron bound to transferrin or lactoferrin (383). A cytolysin is produced by V. vulnificus that shows some homology to the structural gene for the V. cholerae El Tor hemolysin (564). This cytolysin lyses mammalian erythrocytes and is extremely cytotoxic to a variety of tissue culture cells lines (164). In its purified form, the cytolysin was shown to be lethal to mice and to cause extensive oedema and damage to capillary endothelial cells

(163). In addition to the protease and cytolysin, a number of other macromolecular-degrading enzymes have been described, including amylase, chitinase, chondroitinase, collagenase, deoxyribonuclease, elastase, gelatinase, lecithinase, mucinase and phospholipase (335, 395, 435).

In conclusion, V. vulnificus is an exceptionally virulent pathogen capable of rapidly fatal infections. Indeed, reports of fatalities have occurred after the ingestion of as few as 2 raw oysters in susceptible individuals and often reveal a blood level of 108 up to 1010 V. vulnificus cells ml-1 (210). Because of the widespread necrosis seen in skin lesions, early surgical debridement and aggressive antibiotic treatment should be an essential part of therapy as patients often die within 48 hours of hospitalisation. Just as this organism produces a wide range of virulence factors, which makes it an aggressive pathogen, it also 8

has a range of adaptive phenotypes that enable its persistence in the environment for extended periods of time.

1.2.4 Population heterogeneity

Various studies have shown a high degree of diversity among V. vulnificus strains isolated from estuarine environments as determined by pulsed-field gel electrophoresis (PFGE) (505) and randomly amplified polymorphic DNA

(RAPD) analysis (539), although a unique band was found in all of the clinical isolates tested in the 1998 study conducted by Warner and Oliver (539). In fact, a recent study showed that for three oysters sampled, the upper limits of different strains per oyster could be between 600 and 1,000 (52). Numerous studies have reported no discernible phenotypic differences between environmental and clinical isolates (518) and that the virulence characteristics between strains isolated from clinical and environmental samples do not differ (483). Similarly, the arbitrarily-primed-PCR (AP-PCR) fingerprints of V. vulnificus isolates from numerous patients fatally infected after raw oyster consumption revealed that there was a high degree of diversity among strains between patients (529).

However, the predominance of a single strain in postmortem examination of patients has been demonstrated, even though there was high genetic diversity in the strains in case-associated oysters (210), which indicates that V. vulnificus infections result from the proliferation of a single pathogenic strain. These data indicate that V. vulnificus strains in the environment are highly heterogenous, with numerous strains present in a single oyster, and that there is no clear 9

difference between those strains isolated from the environment and those isolated from clinical infections.

1.2.5 Distribution of V. vulnificus

Vibrio vulnificus has been shown to occur ubiquitously in temperate and tropical waters. This species has been isolated from water, sediment, plankton and animals (380, 381, 394) along the eastern coast of the US and was shown to compose approximately 10% of the total heterotrophic bacterial populations in water and oyster samples during warmer months in the Chesapeake Bay area

(556). In addition to the East Coast of the USA, V. vulnificus has been isolated from the intestine of fish from the Gulf of Mexico (92) and from US West Coast estuaries in shellfish, water and sediment (230). Incidence of this organism is not, however, limited to the US estuarine and marine environments, as isolations from seawater and mussels in Brazil (307, 435) and shrimp from Mexico and Ecuador

(38) have also been reported. In addition to the Americas, isolations have been reported from seawater and sand in the Mediterranean (150), from fish intestines in India (510), from water and shellfish in Australia (309), Korea (463) and

Malaysia (422) and from numerous infected patients in Taiwan (73).

Surprisingly, recent reports have demonstrated the isolation of V. vulnificus from the colder waters of the Dutch coast (528) (after 5 cases of infection from the

North Sea area), from water, sediment and fish in Denmark (193) and from

Sweden (322). These isolations indicate that this organism can be found even in cold marine waters when the temperature rises above 10°C, even for short periods of time. Perhaps the most puzzling reports of V. vulnificus occurrence are the 10

incidences of infections occurring after exposure of wounds to inland brackish waters. For example, a scalp wound became infected with V. vulnificus after exposure to brackish creek water in New Mexico and an insect bite became infected after the patient went fishing in a reservoir in Okalahoma (503).

1.2.6 Adaptive responses of V. vulnificus

The incidence of V. vulnificus has been correlated to temperature (193) and salinity, as numbers are greater when the temperature is between 13 and 22°C and the salinity is between 5 and 25 ppt (230, 234, 347). It is now recognised that at low temperatures, V. vulnificus is able to enter a viable but nonculturable (VBNC) state (see section 1.4) in which the cells are able to maintain metabolic activity but are unable to grow on routine laboratory media. Low temperature is the only factor required for inducing the VBNC state in V. vulnificus as demonstrated in microcosms containing artificial seawater as well as complex nutrient media

(385). It is likely that the changes which occur upon VBNC formation, such as alterations in membrane stability and permeability, probably allow for development of mechanical cellular stability as well as cross-protection to other stresses that may be encountered. For example, VBNC cells of V. vulnificus are significantly more resistant to sonication than log phase cells (541). Cells entering the VBNC state exhibit a size reduction (281) without evidence of the reductive division exhibited by starving cells. In addition, it has been shown that these cells possess a significantly reduced density of ribosomal and nucleic acid material, while maintaining a normal cytoplasmic membrane. Upon temperature downshift, there is a rapid decrease in DNA, RNA and protein synthesis (345). It 11

has been shown that amino acid uptake is only slightly affected at 9°C while almost totally inhibited at 2°C (393). In contrast, respiration of the transported amino acids is relatively unaffected at even the lowest temperature. This indicates that at the lowest temperature, less of the amino acid is being incorporated; i.e. most is being respired. This increase in the percentage of respiration at VBNC-inducing temperatures has also been reported for other organisms (21, 437). In addition, it has been shown that inhibition of peptidoglycan synthesis by ampicillin addition results in rapid loss of culturability of cold incubated cells (385) indicating that peptidoglycan synthesis is required in the early stages of the VBNC response. Thus, the VBNC response may involve an increase in cellular resistance to mechanical and other stresses that may be encountered in the environment, increasing the probability that a small proportion of the population will persist until conditions again become favourable. In addition to stability, pre-adaptation may then allow the cell to resuscitate and establish a new growing population.

V. vulnificus enters a VBNC state when shifted directly from high to low temperature, but is able to adapt to an intermediate temperature when incubated for at least 3 h prior to the shift to low temperature. When shifted from 35 to

15°C for 3 h, cells were able to remain culturable for longer after a subsequent shift to 6°C (51) than cells that were directly shifted from 35 to 6°C. Inhibition of protein synthesis with chloramphenicol during the incubation at 15°C resulted in poor viability at 6°C, indicating that cold temperature adaptation is dependent on the expression of cold-induced proteins. A study by McGovern and Oliver (318) 12

revealed that V. vulnificus cells shifted to an intermediate temperature (13°C) exhibited a decrease in the doubling time without a significant lag phase, such as the lag seen upon temperature downshift of Escherichia coli. The rate of protein synthesis, as determined by two-dimensional polyacrylamide gel electrophoresis

(PAGE), showed a sharp decline with forty proteins being synthesised at higher levels during cold stress. Thus, this organism appears to induce a cold-responsive adaptation response upon exposure to low temperature that involves the synthesis of proteins needed for cold-temperature survival.

Likewise, the VBNC response is delayed when stationary phase cells are incubated under VBNC-inducing conditions (384). This effect is related to the starvation adaptation program, as starvation for carbon or phosphorous can significantly delay the formation of nonculturability (402), an effect referred to herein as the starvation-induced maintenance of culturability (SIMC) (Chapter 2).

The identification of specific genes that are important for development of the

SIMC or VBNC responses will allow us to address whether the VBNC response is a true life cycle event or a default response that occurs is the absence of maintenance of culturability. Thus, in the case of V. vulnificus, low temperature incubation will induce the VBNC response and room temperature starvation or cold-adaptation can delay VBNC formation while other stresses result in cell death following loss of culturability.

While low temperature incubation of V. vulnificus induces the VBNC state (384), the organism exhibits a classic starvation response at room temperature (346,

402). Two-dimensional PAGE experiments conducted by Morton and Oliver 13

(346) have reported that V. vulnificus displays an induction of six temporal classes of starvation-induced (Sti) proteins during carbon starvation and that proteins required for survival during starvation are produced within the first 4 hours of starvation. Of the 34 total proteins induced in a 26 h period of starvation, 23 were induced within the first 20 min.

V. vulnificus displays a repertoire of adaptive strategies allowing it to persist under adverse environmental conditions, including but not limited to starvation and cold adaptation and the VBNC response. This dissertation investigates the regulation and coordination of the starvation response and the VBNC state in this model marine organism. The following sections contain information on how adaptive responses are regulated in other organisms in order to provide insight into how these adaptive responses may be regulated in V. vulnificus.

1.3 NUTRIENT LIMITATION

The two main factors limiting bacterial growth in the marine environment are water temperature and the availability of nutrient (340), with carbon concentrations in aquatic environments varying from 80 µM in surface waters to

40 µM in deep waters (460, 548). A large portion of this carbon concentration may be in particulate form and thus is unavailable for utilisation by microorganisms. Therefore, in nature, brief periods of rapid growth interspersed with long periods of non-growth are common. Many of the Vibrio spp. have incredibly fast doubling times during feast conditions which allows them to 14

quickly take advantage of nutrient availability and out-compete other species

(154).

Early researchers realised that the study of starving or 'senescent phase' bacteria was important to the understanding of microbial ecology. Steinhaus and

Birkeland (482) studied cultures over periods of greater than a year and showed fluctuations in CFUs over time, indicating the cultures were not static but were experiencing spurts of death and regrowth. These researchers also showed that microorganisms were able to grow on dead bacterial cells as the only source of nutrition. Postgate and Hunter (420) determined that the maximum cryptic growth possible was one new organism at the expense of about forty-seven dead ones. Thus, starving cultures are not static but are dynamic systems, involving death of a large percentage of the cells and growth of sub-populations of cells, resulting in population shifts. Studies with aging cultures have revealed that cells starved for some time differ physiologically from younger cells (570) in a phenotype termed GASP (growth advantage in stationary phase), and are able to overtake a culture of younger cells completely. The GASP phenotype has been shown to be due to mutations in the starvation and stationary phase sigma factor,

RpoS. In fact, studies of bacterial populations in starving cultures have shown that surviving cell populations were highly dynamic, even after many months of incubation (125). 15

1.3.1 Ultramicrobacteria

Marine waters contain large numbers of ultramicrocells, a significant proportion of which have been demonstrated to be starved cells. The first report of membrane-filterable bacteria was made by Oppenheimer in 1952 where up to 12 viable cells per millilitre of seawater were able to pass through a membrane filter with a pore size of 0.4 µm (396). Several species isolated from filtered seawater by Anderson and Heffernan (13) were no longer filterable after laboratory cultivation, prompting the authors to speculate that the small forms could be

'reproductive elements' or could possibly reflect a change is the size of the parent cell. The formation of 'round bodies' was later described for aged cultures of

Vibrio marinus (123).

Upon starvation of Ant-300, a marine Vibrio, there was an initial increase in cell number (200 to 92,000% depending on the initial cell density) (368) and after 3 weeks 50% of the population was able to pass through a 0.4 µm pore size filter

(367). These cells changed shape from rods to cocci while maintaining normal cellular structures and were demonstrated to remain viable for at least 2.5 years

(12) under starvation conditions. When these cells were inoculated into nutrient rich medium, they increased in size and resumed a rod shape. Likewise, water samples from a Gulf Coast estuary were passed through a 0.2 µm filter and incubated with dilute nutrient broth for 21 days, after which normally sized

Vibrio, Pseudomonas, Aeromonas and Alcaligenes spp. were isolated (289). In another study, it was demonstrated that from 0.5 - 77% of the total viable 16

population of water samples from the surface and from deep ocean were able to pass through a 0.45 um filter (502).

Heterotrophic bacteria are defined either as copiotrophs, those that reproduce at high concentrations of dissolved organic carbon, or as oligotrophs, those that reproduce at very low dissolved organic carbon concentrations (140, 341).

Oligotrophs have been isolated from seawater by extinction dilution (55) and often fail to grow when transferred to high-nutrient media. One well- characterised oligotrophic strain is Sphingomonas strain RB2256, isolated by extinction dilution from Resurrection Bay, Alaska (454). This strain has been labelled an ultramicrobacterium due to its small cell size and small genome, and is of interest because it possesses a high-affinity nutrient uptake system and the fact that vegetative cells of this strain are inherently resistant to high levels of stress-inducing agents (114). In addition, RB2256 has been shown to possess a single rRNA operon and can immediately respond to nutrient upshift without exhibiting a lag phase (122) which clearly demonstrates this strain is fundamentally different from fast-growing copiotrophs.

Although most of the aquatic ecosystems are oligotrophic, the existence of

"oligotrophic bacteria" has been questioned and there is no definitive proof that they exist (299) as many supposed oligotrophs have been found to grow on rich media. Nearly all experiments for determination of oligotrophy are based on the utilisation of peptones with no addition of other supplements (such as vitamins, amino acids, trace elements etc.) (343). Recently, it has been reported that most of the sequences resolved by denaturing gradient gel electrophoresis (DGGE) of 17

DNA isolated from cells that passed through a 0.2 µm filter represented starved forms of marine bacteria instead of 'ultramicrobacteria' per se (171).

While the majority of bacteria in aquatic environments are small, they are metabolically active. Tabor and Neihof (501) determined that at least 73% of bacteria present in a water sample from the Chesapeake Bay incorporated tritiated thymidine and up to 94% took up amino acids. It is now understood that large cells may be a product of laboratory culture and are not indicative of cells in the environment, and that starving cells are able to persist in this state for very long periods of time. The decrease in cell size provides the cell with an increased surface to volume ratio and thus a more efficient substrate scavenging capacity. It has also been shown that small cells are better able to escape predation (158, 159) than larger cells. Consequently, the formation of small cells by starving bacteria may be a multi-factorial response enhancing nutrient uptake and escape from predation.

1.3.2 Starvation-induced differentiation

In the Pacific Ocean, the residence times for water masses are from 2 to 100 years for the water mass which sinks in the subantarctic, and 1000 or more years for the deep water which sinks below the Antarctic convergence (340). Bacteria travelling with these water masses would thus need strategies for long-term survival under starvation conditions. The longest laboratory experiment investigating long-term starvation survival showed that 14 strains of

Pseudomonas syringae survived in distilled water for at least 24 years with only a 18

2 to 3 log decrease in CFU (342). Some procaryotes are differentiating and thus respond to nutrient and energy deprivation by the formation of stable structures such as spores of Myxococcus and Streptomyces, or the endospores of Bacillus spp. and Clostridium spp. Upon nutrient limitation, these organisms enter a genetically defined program that involves de novo gene expression and leads to the formation of distinct morphological structures and ultimately the formation of spores.

Non-sporulating Gram-negative bacteria are non-differentiating but yet exhibit an elaborate and highly developed starvation adaptation program that involves alterations in gene expression as well as physiological changes (188, 240, 249,

306, 465). This transition between growth and non-growth is typically characterised by such changes as a reduction in cell volume, DNA and ribosome content, and the rate of protein synthesis. In addition, a general cross-protection against other stresses, such as oxidative, osmotic and temperature stress, develops

(114, 135, 151, 176, 214, 215, 221, 222, 524).

The first response of microorganisms to nutrient limitation is the induction of nutrient scavenging systems that may allow for utilisation of additional or alternative substrates. In the event that cells experience further limitation, a defined program of response which includes major biochemical and morphological changes occurs (306, 375, 428, 475, 476). The first stage of the starvation adaptation response has been defined as the stringent response phase and is governed by the temporary accumulation of guanosine 3'-diphosphate 5'- diphosphate (ppGpp) (63). This phase is exemplified by the shutdown of 19

macromolecular synthesis with an increase in the rate of protein degradation allowing for extensive reorganisation of cellular components.

Protein, RNA and DNA content decreased in starving cultures of Ant-300 (12,

369) while the ATP content was shown to decrease initially and then increase again to 92% of the initial level. Vibrio cholerae experienced a loss of 88.7% of its total carbohydrates and 99.8% of total lipids during 7 days of multiple nutrient starvation (200), the loss of poly-3-hydroxybutyrate (PHB) was demonstrated to occur in starving cells of Vibrio angustum (290), and decreases in lipids and fatty acids have been reported to occur in Vibrio sp. Ant-300 (392). These decreases in carbohydrates and lipids may reflect the cell's utilisation of available endogenous sources of energy for the active reorganisation that occurs early during starvation.

The fatty acid composition of the inner membrane changes dramatically in response to starvation with a reduction of mono-unsaturated fatty acids and an increase in cyclopropyl derivatives which has been shown to be at least in part under control of the stationary phase regulator, RpoS (170, 537). These changes probably account, in part, for the increased resistance of stationary phase membranes.

Degradation of rRNA (approximately 80% of the total cellular RNA) begins immediately when cells are placed in a carbon-limited medium (84, 538). In fact, it has been proposed that the major cause of death during prolonged starvation is excessive loss of ribosomes (84). However, it has been reported that in V. angustum, ribosomes exist in large excess over the requirement for synthesis during carbon starvation (127). Such excess would allow for degradation and 20

reorganisation of phosphorus pools during short-term phosphorus limitation, but would prove lethal in the long term if ribosome degradation proved to be excessive. Indeed, numerous strains have been shown to exhibit reduced viability during phosphorus starvation (110, 157, 199, 255). However, it has been reported that inactive ribosomes may be protected from degradation during starvation when they are converted into 100S dimers (535).

Starving cultures of Escherichia coli were shown to rapidly degrade protein at the onset of starvation (292) and mutants of E. coli which were deficient in protein degradation were shown to have impaired protein synthesis and survival during starvation (429). The advent of two-dimensional polyacrylamide gel electrophoresis (379) (2D-PAGE) has allowed the identification of total protein expression in response to a given stimulus and has greatly advanced the investigation of global response networks in non-differentiating bacteria (400).

Amy and Morita (11) used 2D-PAGE to show that in starved cells of Ant-300, protein degradation was not uniform, but that specific proteins were degraded while other proteins unique to starvation were synthesised. These data suggest that proteins that are produced during the exponential phase of growth are quickly degraded and new starvation-specific proteins are synthesised in the early stages of starvation and that these newly synthesised proteins are important for subsequent resistance and survival (see section 1.3.3). It follows that some starvation-induced (Sti) proteins which are synthesised early during starvation may be proteases specific to starvation, may possess altered specificity to those 21

produced during growth, and may therefore be involved in the degradation of growth-associated proteins (169).

In the second stage of the starvation adaptation program (0.5 - 6 h), there is a decrease in ppGpp with a concomitant increase in macromolecular synthesis.

There are reorganisations which may include shifts in the fatty acid composition of the membranes (96, 290, 392), degradation of reserve material (199, 290) and onset of development of resistance against a variety of stress conditions (151,

176, 214, 215, 378, 457, 524).

In the third phase, there is a gradual decline in macromolecular synthesis and metabolic activities, such as endogenous respiration. These changes prepare the cell for successful survival under continued stress conditions and will allow for outgrowth should conditions become favourable for regrowth. It has been demonstrated that in V. angustum, de novo RNA synthesis was not required for the initial phases of outgrowth, indicating that rRNA and ribosomes needed for growth were already present in the starving cell (2, 127). An increase in the mean mRNA half-life brought about by global mRNA stabilisation and the presence of long-lived starvation-specific messages will allow for continued protein synthesis in long-term starved cells (1). The stability of chloramphenicol acetyltransferase

(cat) mRNA increased fourfold during stationary phase cultures of E. coli and was available for immediate translation upon dilution into fresh nutrient broth with no transcription needed (264). In Aerobacter aerogenes, it was shown that the ability to synthesise ß-galactosidase decreased in parallel to the synthesis of protein and RNA when cells were starved, but that these starved cells were able to 22

synthesise the enzyme at a more rapid rate than fresh cells when supplied with nutrient (491). Thus, when starved cells are presented with a suitable energy source, the machinery needed to utilise the substrate immediately is present and there is no need to manufacture the energy expensive protein-synthesising macromolecules.

The starvation response of Vibrio anguillarum is quite different from most other organisms studied to date. V. anguillarum cells do not exhibit a long-term reduction in metabolic activity, rather the cells first decrease and then later increase metabolic activity (361). After 7 days of multiple nutrient starvation, V. anguillarum cells exhibited a rate of incorporation of 75% that of exponentially growing cells. In addition, these cells elongate and form helical filaments instead of ultramicrocells and develop only transient cross-protection against other stresses.

1.3.3 Expression of proteins in response to starvation

Most Sti proteins are synthesised early during starvation and seem to be the most important for survival as inhibitors of protein synthesis added for a brief time at the onset of starvation, significantly affects long-term starvation survival (378).

In fact, Matin (305) has demonstrated that the proteins synthesised in the first four hours of starvation are required for maximal resistance to subsequent stresses in

E. coli. Further studies have demonstrated the existence of a temporal program of gene expression involving 40 to 80 genes belonging to two classes: the cst

(carbon starvation) genes which require cAMP and are required for outgrowth 23

following nutrient upshift, and the pex (post-exponential) genes which are cAMP- independent and are required for resistance to other stresses (305, 453). V. vulnificus displays an induction of six temporal classes of starvation-induced proteins during carbon starvation (346) with 23 of the 34 Sti proteins induced within the first 20 min. As with E. coli, the proteins required for survival during long-term starvation were produced within the first 4 hours. The analysis of proteins expressed in starved V. angustum cells indicated that 19 cell envelop proteins and 66 temporally expressed starvation proteins were synthesised (374,

375). In a more recent study employing high-resolution 2D-PAGE, it was observed that the relative rate of protein synthesis of 760 analysed proteins was increased for 157 proteins and decreased for 144 proteins after one hour of carbon starvation in V. angustum (399, 400). The identification of temporal classes of proteins induced during starvation indicates that the response to starvation is an ordered progression of a programmed sequence of events that allows for survival during stress.

1.3.4 Effect of limiting nutrient on starvation response

Many of the early studies on starvation survival employed total nutrient and energy limitation. Investigators have subsequently begun to evaluate cellular responses to individual nutrient starvation in E. coli (169, 304), Salmonella typhimurium (475, 477) and Bacillus subtilis (184). Two-dimensional PAGE has been used to determine that E. coli synthesised 55, 35 and 47 polypeptides unique to starvation upon carbon, phosphorus or nitrogen exhaustion respectively (304).

Some proteins were shown to be specific to each condition, while 15 Pex proteins 24

were common to all starvation conditions. Carbon-starved cells of V. angustum were shown to survive significantly better than nitrogen- or phosphorus-starved cells (378) and were able to develop resistance to other stresses such as high temperature, UV, near-UV and CdCl2. Cells starved simultaneously for all three nutrients had a similar viability to the carbon-starved cultures. This is similar to the starvation response exhibited by V. vulnificus (402), as reported in Chapter 2.

Carbon and total nutrient starvation allowed for prolonged survival and the maintenance of culturability during low-temperature incubation. It is also shown that, unlike V. angustum, long-term phosphorus starvation (for more than 18 h) also provides similar protection. Phosphorus-starved cells of V. angustum showed an initial increase in optical density probably due to the accumulation of

PHB (296, 378). These cells exhibited only transient development of stress resistance and failed to survive long-term phosphorus starvation. The response of

V. angustum to nitrogen starvation was similar to its response to phosphorus limitation. Thus carbon starvation alone is the determinant for the development of starvation and stress resistance in this organism.

Nitrogen starvation does not induce a strict stationary phase such as the cessation of growth seen during carbon starvation. This is mainly due to the continued growth resulting from the use of intracellular reserves of nitrogenous polymers

(303). Similar utilisation of internal reserves of phosphorus will delay the onset of phosphorus limitation. Thus the response to carbon starvation which results in both nutrient and energy limitation appears to provoke a very different response than phosphorus or nitrogen. 25

Starvation for phosphorus results in the spoT-dependent accumulation of ppGpp.

Low phosphorus levels are detected by PhoR, which then activates PhoB, the primary phosphate regulator, which in turn regulates the expression of about 30 genes. Polyphosphates are linear polymers of inorganic phosphate and have been found in all organisms examined. Inorganic polyphosphate has been shown to be essential for adaptation to stress and survival in stationary phase (425). It was shown in E. coli that there was massive accumulation of polyphosphate when cells are starved for amino acids and phosphate (426), and when this accumulation was prevented by a mutation in the polyphosphate synthase gene, cells failed to survive in stationary phase. These data lead to the speculation that the induction of ppGpp may be an important factor in the development of cross protection, as carbon and phosphorus limitation result in its accumulation, and, at least in V. vulnificus, carbon and phosphorus starvation allow for maintenance of culturability at low temperatures. Recently, a role for the phosphate regulon

(groups of operons that share a common regulator) has been indicated in the intestinal colonisation of mice for V. cholerae (533), which suggests that phosphorus levels alone may not control the Pho regulon in vivo.

Starvation of E. coli for carbon, nitrogen or phosphorus induces proteins expressed during oxidative stress (103, 215). Most of the oxidative stress proteins expressed during carbon starvation were shown to be members of the oxyR regulon (103). Metabolic activity in starving cells produces reactive oxygen species that cause oxidative damage of macromolecules (160). For a discussion on the oxidative stress response, see section 1.4.9. 26

Recent data suggests that under starvation conditions, E. coli can reduce the production of respiratory substrate and components of aerobic respiration in order to avoid the generation of reactive oxygen species (371), thereby protecting itself from oxidative stress. However, it appears that cells starved of phosphorus maintain aerobic metabolism (84, 526) and therefore do not restrict the generation of reactive oxygen species. Nyström (376) suggests that unrestrained degradation of ribosomes could result from unchecked respiratory activity generating high levels of reactive oxygen species. The possibility that phosphorus-starved cells experience oxidative damage may explain the report that DNA-repair genes of the

LexA regulon are induced during phosphorus but not glucose starvation (101). It has been demonstrated that RpoS and LexA regulons are important for protection of E. coli from oxidative stress during phosphorus starvation (149). In addition, phosphorus-starved cells are dependent upon RecBCD, RecA, RecG and

RuvABC, which are required to repair double-stranded breaks (DSB) (288). This indicates that DSBs are the main DNA damage in phosphorus-starved cells (149).

It should be pointed out that recent evidence indicates that the carbon, nitrogen and phosphorus starvation stimulons are likely to be linked. It has been demonstrated by Matin and coworkers that some carbon-starvation induced genes are regulated primarily by the alternative sigma factor, RpoN (238), which regulates the nitrogen starvation stimulon. The rpoN operon also encodes two proteins homologous to the phosphotransferase system (PTS) of the carbon starvation stimulon (421). In addition, genetic evidence has provided a link between phophorus and carbon metabolism, as a phoB mutant, which encodes the 27

positive gene activator of the phosphorus starvation regulon, was shown to be defective in carbon metabolism (177). Undoubtedly, the interactions among the regulation of various starvation and stress regulons will prove to be much more complex than previously imagined.

1.3.5 Global regulators of starvation response

There is an ever-increasing list of regulators that have been demonstrated to be involved in the global regulation of starvation and growth arrest. Groups of operons that share a common regulator have been defined as regulons. Protein responders may belong to more than one regulon and thus exhibit overlapping expression patterns. The use of 2D-PAGE has allowed the investigation of such global responses in bacterial cells and has illustrated the complexity of these responses (for a review on global analysis in marine Vibrio species, see (400)).

Recently, the development of DNA array technology has provided another technique for the investigation of global gene expression in response to a stimulus. For example, the entire set of E. coli genes has been used to measure expression patterns of cells in late log on minimal glucose medium and on LB with glucose (507). It was shown that cells growing in rich medium expressed the majority of translation apparatus genes (tRNA, translation factors and ribosomal proteins) while cells growing on minimal medium showed elevated expression of genes involved in the biosynthesis of building blocks, most notably the amino acid biosynthetic pathways. Nearly 50% of the known RpoS- dependent genes were expressed at higher levels in minimal medium than in rich medium, as was rpoS expression itself. Other regulators with increased 28

expression in minimal medium included lrp and dps. In rich medium, other regulators were expressed at higher levels including fadR, cspA and fis.

Techniques such as these will continue to broaden our knowledge of the interactions of major response regulators and their responders involved in bacterial adaptation.

1.3.5.1 The starvation/stationary phase sigma factor, RpoS

While the importance of RpoN during starvation is currently being explored,

RpoS has been shown to be the main regulator of stationary phase gene expression. The rpoS-encoded sigma factor is a central regulator of many stationary phase-responsive genes (267) as well as genes involved in responses to a diverse number of stresses, including starvation, osmotic stress, acid shock, cold shock, heat shock and oxidative damage (more than 50 genes). RpoS has been demonstrated to induce one of the two catalases of E. coli (449) as well as one of the proteins involved in cellular recovery from oxidative damage. The use of mutants in E. coli and S. typhimurium have revealed a role for RpoS in the development of cross-protection to various environmental stresses (119, 311).

The DNA-binding protein Dps, which has important roles in both global gene expression and DNA protection during stationary phase and oxidative stress (6), is dependent on sS for stationary phase expression (8). The changes that occur in central carbon flux upon starvation or entry into stationary phase are also in part regulated by RpoS, as sS is required for glycogen synthesis. In addition, RpoS is required for the expression of virulence traits in some organisms (119, 254). The dependence on RpoS for regulation of genes involved in such numerous and 29

diverse responses verifies that RpoS is a global regulatory protein of central importance during starvation adaptation or entry into stationary phase (187).

The promoter determinants recognized by sS and s70 are very similar and the two sigma factors are structurally and functionally closely related, indicating that sS is a second primary sigma factor (506). Whether a promoter is recognized by sS or s70 is probably determined by the relative concentrations of the two holoenzymes, activity of any other regulatory proteins that affect binding and by the topological state of the promoter region (187). Competition between sigma factors for RNA core polymerase may also be affected by the binding of a stationary phase protein,

Rsd, with s70 which interferes with holoenzyme formation (218). Modulation of

RNA polymerase may also be involved in the transition from exponential growth to stationary phase. It has been reported that altered stationary phase forms of

RNA polymerase showed altered promoter recognition (401) and may be involved in the global switch of gene expression during the transition from exponential to stationary phase. The cellular content of ss is controlled at the transcriptional (148, 265), posttranscriptional (287, 310), translational as well as post-translational (266) level.

Transcriptional control involves guanosine 3',5'-bispyrophosphate (ppGpp) (148) and polyphosphate (462) as positive regulators and cAMP - cAMP receptor protein complex (cAMP-CRP) as a negative regulator (267). The translation of rpoS mRNA is controlled by a cascade of interacting factors, including Hfq, H-

NS, dsrA RNA, LeuO, and oxyS RNA that primarily modulate the stability of a 30

region of secondary structure in the ribosome-binding region of the rpoS mRNA

(266). The ribosome-binding site and initiation codon are located in regions of secondary structure and are inaccessible for ribosome binding when the stem and loop structure is formed. The destabilisation of the rpoS RNA requires a small

RNA-binding protein, Hfq (351), which prevents stable secondary structure formation and allows translation initiation of the mRNA. H-NS, a histone-like

DNA-binding protein, has been associated with a decrease in sS levels in exponential phase and is involved in osmotic and growth phase regulation of sS

(25, 565).

During low temperature accumulation of sS, a small untranslated regulatory

RNA, DsrA, is required (470, 471). DsrA RNA represses translation of hns mRNA by RNA:RNA interactions (274) which antagonises the role of H-NS in repressing translation of RpoS, in addition to promoting efficient translation of sS. LeuO acts as a repressor of dsrA RNA synthesis thereby reducing rpoS translation at low temperature. In addition, H-NS is a repressor of leuO.

Repression of rpoS translation directly by H-NS in addition to the repression of leuO results in an increase in the levels of DsrA RNA and allows activation of rpoS translation. Thus H-NS has a dual role in the control of RpoS levels.

Another regulator of rpoS translation is a nontranslated RNA encoded by oxyS in response to oxidative stress (9). oxyS RNA reduces sS synthesis by binding Hfq, thereby repressing rpoS translation (571). 31

An alteration in the stability of sS allows post-translational control of sS levels.

The stability of sS increases substantially after the transition to stationary phase

(266). In exponential phase, sS is sensitive to proteolysis by CplPX protease

(455). Degradation of sS is promoted by the response regulator RssB (350) and inhibited by the chaperone DnaK (349) in response to environmental signals.

RssB activity is determined by its phosphorylation state, which is controlled by environmental stimuli (33). Thus, certain conditions will trigger the dephosphorylation of RssB and its affinity for RpoS would be reduced, thereby stabilising RpoS. In addition, further regulation of RpoS activity by the anti- sigma factor activity of RssB has recently been proposed (34).

In addition to the above regulators of RpoS levels in the cell, there may also be modulation by trehalose and glutamate, as well as homoserine lactone (HSL)

(204) and UDP-glucose (46). RpoS has been shown to play a pivotal role in the regulation of starvation related phenotypes, such as general stress resistance and cell division, in numerous Gram-negative bacteria. The effect of other global regulators on its transcription, translation and stability ensures coordinate control of bacterial phenotypes when exposed to stress.

1.3.5.2 Carbon storage regulator (CsrA)

CsrA (RsmA in Erwinia) is a global regulator that controls the expression of numerous genes. CsrA acts to repress many starvation- or stationary phase- induced genes in exponential phase while activating other exponential phase- induced genes. It is a small RNA binding protein that facilitates the decay of 32

mRNA to which it is bound by an unknown mechanism. Numerous genes expressed in stationary phase are repressed by CsrA while exponential phase metabolic pathways are activated (439, 440). csrA homologues have been found in V. vulnificus and several families of the a and d subdivisions of proteobacteria and in B. subtilis (544). Regulation of csrA has been shown to be independent of cAMP and ppGpp (440).

A second component of the Csr system is csrB, which encodes an untranslated mRNA that forms a large ribonucleoprotein with 18 CsrA subunits (439). CsrB

RNA competes with cellular mRNAs for binding to CsrA and antagonises its activity (284). Hence, csrB mRNA binds and sequesters the mRNA decay factor,

CsrA. Investigators have recently identified a third component of the Csr system in Erwinia and have determined that RsmC positively regulates the expression of rsmA and negatively regulates rsmB (80).

In E. coli, csrA inhibits glycogen biosynthetic genes and gluconeogenesis (440) in addition to repressing biofilm formation, mucoidy, and fimbriae expression. In

Erwinia carotovora, a homologue of csrA (rsmA) represses exoenzyme synthesis and HSL synthesis as well as pathogenicity (79). Overexpression of rsmA on a low-copy plasmid resulted in the repression of antibiotic synthesis, flagella formation and extracellular polysaccharide production (354). Thus, in Erwinia, rsmA functions as a global regulator of secondary metabolism as well as controlling host interaction. Recently, it has been reported that RpoS positively regulates rsmA expression (355) in Erwinia. 33

1.3.5.3 The stringent response

The level of intercellular ppGpp is increased as a result of either amino acid

(regulated by relA) (62, 139) or carbon and energy source deprivation (regulated by spoT) (560), in what is termed the stringent response (63). In addition, spoT was recently shown to regulate accumulation of ppGpp in response to phosphorus starvation (479). ppGpp synthase is activated on the ribosome when a non- aminoacylated tRNA binds to the receptor site (180), which occurs when amino acids are not available. Increased levels of ppGpp decrease expression of genes involved in the protein synthesis system while up-regulating amino acid biosynthesis gene expression. This results in the prevention of peptide elongation during amino acid limitation thereby preventing complete exhaustion of the aminoacyl-tRNA pool while increasing the pool of amino acids. This ensures that reserves are available for adaptation to stress during growth arrest. In addition, ppGpp has been shown to regulate the transcription and translation of rpoS (265).

The stringent control network serves as a master regulation of gene expression during stasis and is of the utmost importance for the bacterial prevention of stationary phase death. Mutants that are unable to elicit stringency die prematurely during stasis (372). It is likely that translational errors and continued synthesis of stable RNA, ribosomal proteins and failure to induce the RpoS- dependent starvation genes have a great impact on the loss of cellular viability. 34

1.3.5.4 Control of DNA Topology

Numerous changes in the environment, such as osmotic or anaerobic stress (40), cold shock (333) and carbon starvation (20, 382) have been shown to affect the supercoiling of the bacterial chromosome. Promoter sensitivity to supercoiling has also been demonstrated (47) and evidence linking environmentally induced supercoiling changes and transcriptional regulation has been suggested (98). In fact, relaxation of supercoiling in vivo has been demonstrated to change the expression levels of the majority of randomly tested promoters (224). Changes in the supercoiling of the chromosome may thereby contribute to the very different array of actively expressed gene products in starved cells compared with growing cells.

It is likely that gyrase is the key participant contributing to environmental responsiveness of DNA supercoiling, but several other DNA-topology-altering proteins also contribute to environmental responses. H-NS is an abundant component of the bacterial genome and has a preference for binding to curved

DNA (474). H-NS can affect transcription directly by acting as a repressor or indirectly by affecting overall chromosomal supercoiling (205). Compaction of the chromosome has been observed in starved bacteria (348) possibly due to H-

NS in these cells and over-expression of H-NS induces an immediate cessation of growth, as well as a reduction in DNA supercoiling and a severely depressed rate of transcription (317). The presence of increased amounts of H-NS causes a prolonged period of non-growth where cells were still viable but not able to divide. This state has similarities to the viable but nonculturable (VBNC) state 35

(see section 1.4) and may thus be involved in the silencing of transcription observed upon induction of this response. H-NS is involved in the modulation of expression of numerous genes, such as virulence genes in Shigella flexneri (99), type-1 fimbriae in E. coli (100), outer membrane proteins (497) and rRNA in response to such diverse environmental cues as temperature, osmolarity, anaerobiosis and pH.

Dps (DNA-binding protein from starved cells) is a starvation-inducible DNA- binding protein that does not exhibit sequence specificity (6). The synthesis of

Dps is induced upon growth arrest and is RpoS-dependent. Dps is abundant in starved cells where synthesis may continue for up to 3 days. Mutants that lack

Dps show dramatic alterations in protein expression during starvation and fail to develop starvation-induced cross protection to other stresses. These results indicate that Dps not only functions to protect DNA from physical damage, but also affects the global pattern of gene expression.

1.3.5.5 ToxR

ToxR is a transcription factor located in the inner membrane of V. cholerae that senses the environment and activates the expression of virulence traits in response to these environmental cues. ToxR regulates expression of factors such as cholera toxin (CT) and toxin co-regulated pilus (TCP) in addition to at least 17 other genes involved in production of virulence factors (95, 413). ToxR homologues in

S. typhimurium (19) and Vibrio parahaemolyticus (280) have been found to regulate invasion gene expression and hemolysin production respectively. The 36

activity of ToxR is enhanced by the ToxS protein, which interacts with and stabilises ToxR. ToxR transcriptionally activates a second regulator ToxT (95) that positively controls the expression of CT and other genes that are essential for intestinal colonisation. An additional layer of regulation is provided by the TcpP and TcpH proteins which activate toxT in response to environmental cues, such as temperature and pH (357), ensuring coordination between environmental cues and virulence factor expression. ToxR mutants of V. cholerae are unable to synthesise TCP and CT, exhibited increased swarming on motility agar as well as an increase in protease production and HEp-2 cell binding (146). Intriguingly, a null mutation in the smcR gene of V. vulnificus (see Chapter 5), which is a homologue of the V. harveyi luxR resulted in similar phenotypes.

1.3.5.6 Signalling molecules

Signalling molecules have been demonstrated to regulate cell-density dependent gene expression in bacteria (see section 1.5). A role for signalling molecules in the regulation of starvation-stress responses and the entry into stationary phase has recently been demonstrated (26, 27, 272, 314). Homoserine lactone (HSL) induces the expression of RpoS in E. coli (204) and an acylated homoserine lactone (AHL) regulates RpoS in Pseudomonas aeruginosa (410), but in

Ralstonia solanacearum, the production of an acylated homoserine lactone (AHL) requires RpoS (130). In Rhizobium leguminosarum (162) and P. aeruginosa

(569), induction of stationary phase is regulated by diffusible signal molecules.

Conditioned supernatants have been shown to induce carbon-starvation proteins in V. angustum (480) and a dependence on the signal system has been 37

demonstrated to control survival of carbon and nitrogen starvation in R. leguminosarum (514). In Vibrio fischeri, the production of an AHL appears to be indirectly stimulated by decreasing glucose concentrations via cAMP (106, 108).

Chapters 5 and 6 demonstrate that a mutation in smcR of V. vulnificus, a homologue of the Vibrio harveyi luxR, effects several phenotypes whose expressions are normally induced in the stationary phase of growth.

Thus, signalling molecules may serve to integrate starvation responses as well as control density-dependent gene expression through the regulation of transcription factors, like RpoS, that respond to starvation. Part of the quorum response may thus induce genes whose products are useful during the transition to stationary phase.

1.3.6 Conclusions

The adaptation to nutrient limitation by non-differentiating bacteria involves a highly organised series of intercellular events leading to the formation of a stress resistant cell, similar to the development of resistant spores of differentiating bacteria. Numerous global regulators are involved in the alterations in phenotype that occur in response to starvation, allowing for assimilation of various environmental cues and coordination of the starvation response. These phenotypic responses function to ensure persistence of the cell in the environment and prepare the cell for subsequent reactivation when conditions become favourable for growth. 38

1.4 THE VIABLE BUT NONCULTURABLE RESPONSE

1.4.1 Historical Perspective

Early researchers discovered the apparent concept of dormant or nonculturable organisms existing in the environment many years ago. Jannasch and Jones (212) showed that direct counts of sea water samples revealed the presence of from 18 to 9,700 times as many bacteria as culture methods, and direct counts on membrane filters were 150 times higher than plate counts. Using continuous culture techniques Jannasch (211) was able to show that cultures of marine bacteria would not divide in seawater containing limiting substrate concentrations, and suggested that below certain levels of substrate, cultures were surviving but inactive. In their seminal paper on starvation survival (420),

Postgate and Hunter remarked;

"We have used the term 'dead' to describe bacteria that failed to multiply in the arbitrary favourable environment provided by our slide-culture medium. This is a legitimate usage, since microbiologists are usually concerned with the ability of the organisms to initiate a fresh population rather than its survival as an individual. Our organisms retained their osmotic barriers after death and may thus have been in some sense 'alive'".

Similarly, Stevenson (488) addressed the possibility of the occurrence of dormant bacteria;

"The plaucity of physiological data suggesting a dormant state for bacteria in the water column is not surprising: it borders on heresy to 39

suggest that bacteria in this environment are not active. Partly because of historical precedence and partly because of a preoccupation with the influence of man, aquatic microbiologists have demonstrated an almost religious adherence to the proposition that bacteria are metabolically active in aquatic systems."

While it is generally accepted that non-differentiating bacteria are capable of developing starvation and stress resistance through a series of differentiation-like genetic programs (240), the existence and nature of a viable but nonculturable

(VBNC) state has been the topic of intense debate for over 15 years. This dissertation only addresses the VBNC state which occurs in response to natural environmental stresses. Cells in the VBNC state are considered herein to be metabolically active and therefore possible of resuscitation and regrowth, while not being culturable on or in routine media used for its growth. Sub-lethal injury which occurs as a result of exposure to treatments such as freeze/thaw, antibiotics, chlorine or other chemicals are not considered relevant to the VBNC response and thus are not discussed here. Injury-induced changes in cell populations may appear to be similar to the VBNC state, but instead these cells are culturable under the proper conditions and do not need to be resuscitated in order to become culturable. Likewise, 'unculturable' bacteria that have never been isolated or grown on laboratory media are not considered.

1.4.2 The Viable but Nonculturable State

It is now generally accepted that a number of culturable, non-differentiating bacteria, upon encounter with certain environmental stresses, are not recoverable 40

by normal culture techniques. It has been proposed that viability may be maintained in the absence of culturability, and that this VBNC (viable but non- culturable) response is analogous to the stress responses of the differentiating bacteria (e.g. spore formation). The formation of VBNC cells has been proposed by some as a survival strategy (313, 316, 385, 386, 433) and as such, is an active process involving the induction of global control networks leading to sequentially regulated differentiation responses. To complete this analogy, the VBNC cells must be able to exit this survival state and return to an actively metabolising state when conditions become favourable. Conversely, others argue that the VBNC state may be a moribund state in which cells become progressively debilitated until cell death finally occurs (23, 24, 233). These cells may maintain signs of metabolic activity or respiration for some time but are not able to ‘resuscitate’.

Therefore, the VBNC debate centres around two related points. Firstly, is the

VBNC response a genetically determined developmental cycle principally analogous to the starvation response of other differentiating bacteria? Secondly, are VBNC cells capable of resuscitation, or is the increase in cell numbers reported in a large number of publications on this issue merely the result of growth of a few viable cells?

1.4.3 Formation of VBNC cells

Evidence for a VBNC state was first reported by Colwell and workers (78, 561) when it was demonstrated that cells which had become nonplateable on media normally used to culture these organisms still possessed indications of metabolic activity. The definition for a VBNC cell was subsequently stated as “a cell which 41

can be demonstrated to be metabolically active, while being incapable of undergoing the sustained cellular division required for growth in or on a medium normally supporting growth of that cell” (385). Since that time, there have been numerous reports of Gram-negative bacteria which have been shown to enter this state [reviewed in (313, 316, 385)] and recently Gram-positive bacteria have been reported to exhibit a VBNC response (285, 494) (Table 1.1). In addition, there have been numerous reports of resuscitation and even virulence of VBNC cells.

Conditions shown to induce nonculturability differ according to the organism and include such diverse factors as starvation, salinity, visible light and temperature.

Initially, publications on the VBNC response focused on the physiology of the

VBNC cell in order to conclusively demonstrate that VBNC cells were truly viable or “alive”. While it has now become generally excepted that many bacteria respond to stressful environmental conditions by entering a VBNC state, the lack of reproducible resuscitation in many cases has fuelled the debate over whether this response is a true life cycle response or simply an end of life response. This shift in focus is reflected in the types of studies of the VBNC response which are now partly turning to the regulation of the VBNC response in addition to unequivocally determining the role and identity of resuscitation factors and conditions. Indeed, if the VBNC state is a true life cycle event then it follows that there must be regulators involved in its control.

1.4.4 Methods of assessing the VBNC state

One point of discussion related to the VBNC debate is the determination of viability. While some authors argue that a non-dividing cell must be considered 42

Table 1.1. Studies investigating the viable but nonculturable response

Bacterium Resuscitation condition Reference

Aeromonas salmonicida Nutrient addition (5, 112, 113, 124, 207, 336, 338, 441)

Agrobacterium tumefaciens (57, 291)

Alcaligenes eutrophus (407)

Campylobacter jejuni Animal passage; injection (39, 54, 59, 60, 115, into embryonated eggs 121, 183, 220, 271, 320, 437, 448, 485, 511)

C. coli (54, 196, 197, 485)]

Cytophaga allerginae (185)

Enterobacter aerogenes (57)

E. cloacae (407)

Enterococcus faecalis Nutrient and temp. upshift (22, 285, 286) 43

Table 1.1. Continued

Escherichia coli Rabbit ileal loop passage; (21, 22, 78, 83, 102, addition of betaine to 105, 131, 168, 281, osmotically shocked 332, 362, 370, 391, VBNC cells; nutrient and 416, 417, 434, 442, temp. upshift in the 445, 472, 561)

presence of H2O2- degrading compounds

Francisella tularensis (134)

Helicobacter pylori (44, 64, 167, 458)

Klebsiella pneumoniae (57)

K. planticola (185)

Lactococcus lactis (494)

Legionella pneumophila Injection into (208, 405, 481, 563) embryonated eggs; incubation with amoeba

Micrococcus flavus (57)

Pasteurella piscicida Addition of nutrient (297, 298)

Photobacterium damselae Temperature increase (136)

Photorhabdus luminescens (337) 44

Table 1.1. Continued

Pseudomonas aeruginosa (41)

P. fluorescens Transfer of N starved (42, 66, 118, 391, cells to fresh medium 519) without glucose

P. putida (339)

P. syringae (391, 551)

Rhizobium meliloti (291)

Salmonella enteritidis Nutrient addition (69, 370, 442, 443)

S. typhi (70)

S. typhimurium (61, 370, 472)

Serratia marcescens (185)

Shigella dysenteriae (209, 423, 424)

S. flexneri (78)

S. sonnei (78)

Streptococcus faecalis (57)

Vibrio anguillarum (192)

V. campbelli (554) 45

Table 1.1. Continued

V. cholerae Rabbit ileal loop passage; (77, 78, 88, 250, heat shock; human 427, 554, 561) intestine

V. fischeri (275)

V. harveyi (105)

V. mimicus (554)

V. natriegens (554)

V. parahaemolyticus Temperature upshift (217, 331, 554)

V. proteolyticus (554)

V. vulnificus Temperature upshift; (167, 281, 364, 384, injection into mice; 389, 390, 393, 541, environmental chamber 546, 554)

Xenorahbdus nematophilus (337)

Yersinia enterocolitica (472)

Yersinia ruckeri Addition of nutrient (438) 46

to be 'dead' in microbiological terms (23, 233), the possibility of resuscitation and regrowth of nonculturable cells requires that these cells be considered 'alive' or viable. A number of methods have been proposed to assess the viability of nonculturable cells, all of which have advantages and disadvantages (Table 1.2).

Hence, there is no one method that has been agreed upon as suitable in all cases.

These methods assess viability by one of two criteria, demonstration of metabolic activity or maintenance of cellular structures.

Methods which have been used as indications of cellular metabolic activity include the use of microautoradiography (424) as well as inducible enzyme activity (370) as an indicator of de novo protein synthesis, the direct viable count method (DVC) (246) which is based on the enlargement of cells upon addition of nutrient, and the reduction of tetrazolium salts as an indication of an active electron transport chain (436). There are, however, disadvantages associated with the use of these methods. DVC and tetrazolium salt reduction assays require nutrient addition (436, 512) and are thus dependent upon the ability of the organism to respond to the nutrient supplied. Measurements of respiration also have their drawbacks. A range of factors have been shown to affect formazan deposit formed from tetrazolium salt reduction (512), and a recent report indicates that the tetrazolium salt, 5-cyano-2,3-ditoyl tetrazolium chloride (CTC) inhibits bacterial metabolism (520).

Cell viability assays have also been developed based on the staining of cells with fluorochromes. These methods assess viability by the maintenance of stable 47

Table 1.2. Methods for assessment of activity of VBNC cells

Method employed Activity tested References

Microautoradiography de novo protein synthesis (201, 424)

Inducible enzyme activity de novo protein synthesis (370)

Direct viable count Cell elongation (246)

INT / CTC reduction Electron transport (436, 574)

Rhodamine 123, Oxanol Membrane potential (82, 216)

Propidium iodide Membrane permeability (298, 444, 562)

Nucleic acid stains (Dapi, Maintenance of intact nucleic acids (251, 419) AO, Hoechst) 48

cellular structures. Acridine orange direct counts (AODC) (251) and 4’,6- diamidino-2-phenylindole (DAPI) staining (419) have been used as an indication of the maintenance of intact nucleic acids. Rhodamine 123 has been used extensively as an indicator of membrane potential and with the development of flow cytometry, there has been a surge of methods for characterisation of the physiological status of the cells (82). Permeability of these dyes may be a problem in some organisms. The presence of intact nucleic acids has also been used to examine the physiological potential of VBNC cells (542, 563).

Measurements of nucleic acids can be performed either by hybridisation or PCR.

There appears to be considerable variability in the ability to amplify chromosomal

DNA from nonculturable cells. This variability may be due to the condensation of the nucleoid by DNA-binding proteins or increased mechanical stability of the cells due to thickening of the cell membrane, thus making the extraction of DNA less efficient. Nonetheless, PCR amplification of chromosomal DNA has been used successfully with some organisms, such as Vibrio vulnificus (49), Shigella dysenteriae (209) and Enterococcus faecalis (285), indicating that these organisms retain intact DNA while in the VBNC state. Recently, a competitive

PCR method has been developed that is sensitive enough to detect low amounts of DNA (0.1 pg) and can quantify cells in the culturable and nonculturable state

(286). This method has been used to detect VBNC cells of E. faecalis in natural environmental samples. While many of these methods have limitations, it is apparent that VBNC cells maintain certain characteristics of viable cells, such as the potential for metabolic activity and respiration as well as cellular integrity. 49

1.4.5 Physiology of nonculturable cells

Cells which enter the VBNC state undergo some definite, predictable changes which allow them to persist in the environment for extended periods of time

(385). These changes involve stabilisation of the cell wall and membrane, thereby increasing the stability of the cell. Most VBNC cells undergo a decrease in size without the reductive division commonly observed in starving cells. Cells which enter the VBNC state appear to maintain gross membrane integrity although changes in membrane composition have been reported. For example, there are reports of cells maintaining a normal cytoplasmic membrane with a decrease of up to 60% of the major fatty acid species compared with culturable cells (281, 336) with the concomitant appearance of new long-chain fatty acids

(281).

The outer and cell membranes of VBNC cells of Vibrio cholerae were found to be intact with a thickening of the peptidoglycan layer observed (250). Likewise, electron micrographs of VBNC Campylobacter jejuni (437) revealed intact but asymmetric membrane structures. Studies with Aeromonas salmonicida (112) revealed a decrease in protein content and DNA with no change in LPS profiles.

Likewise, cells of Helicobacter pylori that had been nonculturable for 3 months were shown to maintain an intact cell wall, membrane, cytoplasm and flagella

(44).

VBNC cells of C. jejuni were shown to have an increase in cell volume, a decrease in internal potassium content and membrane potential, a decrease in pH 50

differential with the extracellular environment and a low adenylate energy charge

(511). However, others have reported an initial decrease in cellular ATP levels, followed by recovery to constant levels for long periods of time (183, 337). It has been shown that there is a decrease in the synthesis of macromolecules in V. vulnificus (345) and a reduction of overall protein content in A. salmonicida

(112), while it has also been reported that VBNC cells are capable of active uptake and incorporation of methionine into protein (424). Nonculturable cells of numerous organisms have been shown to retain the ability to exhibit inducible enzyme activity (83, 370).

Many of these changes occurring in the transition to the VBNC state are related to the stabilisation of the cell wall and membrane, thus assuring the ability of these cells to persist in the environment for long periods of time. These alterations of the membrane may be analogous to the development of resistant cells during starvation, which is believed to occur partly as a result of changes in cell wall cross-linking. Whatever the mechanism, it is evident that these changes occur in numerous bacterial species and serve to allow for increased cellular stability during environmental stress.

1.4.6 Nucleic acids of nonculturable cells

In some cases, VBNC cells have been reported to maintain normal amounts of

DNA while in other cases DNA amounts decrease. Most studies, however, report decreases of RNA content in VBNC cells. VBNC cells of V. vulnificus have been shown to possess reduced ribosomal and nucleic acid material (385). In the early 51

stages of VBNC formation, V. vulnificus cells maintain intact DNA and RNA, which is followed by a gradual loss of RNA first and then DNA (542) (see

Chapter 2). Similar results have been obtained in other organisms (285, 563).

PCR has been used successfully in some cases for the detection of VBNC cells

(179, 275, 278, 285, 423, 563) whereas others have shown that increased amounts of DNA of VBNC cells are required for amplification to occur (49, 76). It is possible that this is due to condensation of DNA upon entry into the VBNC state.

In fact, it has been proposed that H-NS may be involved in the condensation of V. vulnificus DNA in the VBNC state (76, 539). Dps is another DNA-binding protein that has been shown to be important in the development of starvation- induced resistance to oxidative stress and to gene expression during stationary phase (6). The generation of oxygen radicals during starvation has been shown to cause double-stranded breaks (DSB) and Dps has been shown to be important in the protection of DNA from DSB (301). Dps is an RpoS-inducible protein (8) and as such, is induced during starvation or stress and thus, possibly during the induction of the VBNC state. The possibility that the DNA of VBNC cells is condensed by DNA-binding proteins along with the concurrent thickening of the cell wall, which may affect the efficiency of DNA extraction, may make PCR less efficient in VBNC cells compared to culturable cells.

1.4.7 Potential virulence of VBNC cells

The maintenance of potential pathogenicity by VBNC cells is supported by numerous reports of in vivo resuscitation. Experiments with animal models have shown that nonculturable cells may be resuscitated by animal passage and may, in 52

some cases, retain virulence. VBNC V. cholerae and enteropathogenic

Escherichia coli were shown to regain culturability after animal passage (78).

Similarly, VBNC cells of E. coli retained the ability to produce enterotoxin (416) and were resuscitated by introduction into ligated rabbit ileal loops, after which culturable cells were recovered (168). Human volunteers developed clinical symptoms of cholera after ingestion of VBNC V. cholerae, with the pathogen subsequently being isolated in the culturable form from stools of the volunteers

(77). Culturable cells were isolated from faeces of volunteers who ingested cells which had been VBNC for 23 days, but not from those ingested cells of V. cholerae that had been VBNC for 4 weeks. This indicates that maintenance of infectivity of VBNC cells may be confined to "young cells" while those in the

VBNC state longer, may lose infectivity. This loss of infectivity of VBNC cells that occurs with time is further evidence for the proposed stages of the VBNC state. Those cells in the first stage maintain the potential for resuscitation and pathogenicity, while cells in the later stage are in the process of gradual loss of cellular integrity and are thus not capable of resuscitation or colonisation.

In another study, suspensions of four different C. jejuni strains, which were shown to be nonculturable, were fed to suckling mice (220). Colonisation of mice was established by two of the four strains. Similarly, VBNC C. jejuni cells were resuscitated upon passage through rat gut (448); were shown to colonise 1- week-old chicks (485); and retained the ability to adhere to HeLa cells after resuscitation in embryonated eggs (60). Recently, the murine model was compared to the 1-day chick model for recovery of VBNC C. jejuni (59). The 53

murine model proved 5 to 8 times more efficient in the recovery of VBNC cells.

In contrast, others have demonstrated (320) a lack of colonisation of the intestines of 1-day-old chicks when VBNC cells of C. jejuni were administered orally.

Likewise, no resuscitation was observed in simulated stomach, ileal, or colon environments (39). Recent evidence indicates that the coccoid form of C. jejuni, which has been assumed to be the proportion of the population exhibiting nonculturability, may in fact be a degenerate form (stage 2) while nonculturable cells remain spiral (59, 121, 271). Furthermore, the formation of coccoid cells is dependent on exposure to high oxygen tension during carbon starvation (178).

The VBNC response of C. jejuni appears to be strain specific as well. A study of

36 strains indicated that only 3 of the strains entered the VBNC state during starvation (121) while the others lost viability as assessed by DVC and CTC -

DAPI double staining. The VBNC cells retained spiral morphology and metabolic activity and were recovered using the newborn mouse model, which indicates that resuscitation may be strain dependent as well.

The injection of chick embryos with VBNC Legionella pneumophila resulted in lethal infection (208) indicating maintenance of virulence of the nonculturable cells. VBNC cells of S. dysenteriae were found to remain cytopathic to cultured

HeLa cells (424) to maintain biologically active Shiga toxin and to adhere to intestinal epithelial cells (423). Likewise, V. vulnificus cells which had been

VBNC for more than 8 months were shown to be cytopathic to murine macrophage cultures and resuscitation of cells was demonstrated (385).

Furthermore, maintenance of virulence for VBNC cells of V. vulnificus was 54

demonstrated by Oliver and Bockian (389) when infection of mice with <0.04

CFU resulted in death. It was reported, however, that virulence decreases significantly as cells enter the VBNC state and continued to decrease with time after cells became nonculturable, similar to V. cholerae. Thus, the possibility of resuscitation and subsequent virulence of human pathogens has been demonstrated repeatedly and therefore requires consideration, as we cannot exclude the possible health risk posed by VBNC cells.

Collectively, the studies discussed above indicate that cells that were initially

VBNC retain the capacity to cause disease and are therefore still active.

However, at this point it is not obvious if VBNC cells are sufficient to cause disease or if they must first resuscitate and can then cause disease. Furthermore, it appears that even though they are initially VBNC, cells can be activated upon passage through a host. This suggests that some factor is supplied by the host to induce resuscitation and completion of the VBNC cycle. It is unclear what factors are required for resuscitation; it could be an environmental factor or a signal from other actively growing bacterial cells present in the host.

Unequivocal determination of these factors may come from attempts to resuscitate cells in vitro.

1.4.8 Reports of in vitro resuscitation

A principal controversy relates to whether reports of in vitro resuscitation depict true resuscitation of viable cells or growth of few viable cells that escaped detection. There have been numerous reports of resuscitation induced by 55

mechanisms such as nutrient addition (443), transfer to fresh medium (118) temperature upshift (364) heat shock (427). In most of these reports, resuscitation could only be accomplished with those cultures that had been VBNC for a short period of time. There have also been a number of reports which refute these data and have concluded that the increase in culturable cell numbers are the result of regrowth of a few undetected culturable cells remaining in samples (336, 543).

For example, Bogosian et al. (45) have recently developed a mixed culture method to show that reactivation of several strains was due to the regrowth of culturable cells and was not due to the resuscitation of VBNC cells. However, some authors report a mixture of both resuscitation of VBNC cells and the regrowth of the culturable cells (48). The most likely explanation for such reports is that there is some regrowth of culturable cells in addition to the resuscitation of a small subpopulation of VBNC cells. These reports highlight the need to separate possible regrowth from bona fide resuscitation. This is an especially important issue so that the conditions and factors required for resuscitation can be investigated and identified.

Despite the difficulties of separating regrowth from resuscitation, there have been several convincing reports of resuscitation in recent years. VBNC cells of E. faecalis (285) were shown to be competent to take up and incorporate amino acids into proteins and were also shown to resuscitate after the addition of dilute nutrient. Regrowth of culturable cells was ruled out by the use of penicillin prior to addition of nutrient to kill dividing cells. Ekweozor et al. (115) have reported transient and synchronous increases in CFUs in declining cultures of C. jejuni 56

incubated in human faecal emulsions. These authors have determined the increases were not due to sampling or experimental error. Whitesides and Oliver

(546) have reported the resuscitation of V. vulnificus using a multitube assay containing <0.0001 CFU/ml thus limiting the possibility of culturable cells contributing to the observed reactivation. In addition, the authors reported that if the observed resuscitation were the result of the regrowth of culturable cells in the population, those cells would have to have an incredible doubling time of 6 min.

Finally, VBNC cells V. vulnificus have been demonstrated to resuscitate in warm estuarine waters when suspended in environmental chambers (390). Roth et al.

(445) demonstrated a rapid loss of culturability when cells of E. coli were exposed to 0.8 M NaCl. These cells accumulated ATP intracellularly and were resuscitated by the addition of the osmoprotectant, betaine, to the culture. After the addition of betaine, the number of colony forming units returned to the control level within 2 hours. This resuscitation was seen even when chloramphenicol was added to the culture, precluding the possibility of growth of a few cells and also suggests that the necessary components for resuscitation were already present. Heat shock treatment induced resuscitation of VBNC cells of V. cholerae (536). These cells had been nonculturable for up to 86 days and became culturable on solid media after exposure to 45°C for 1 min. Growth of culturable cells was not detected without prior heat shock.

While there appear to be many clear reports of resuscitation, the fact remains that, for most organisms, the exact conditions required for resuscitation have not been identified. The possibility that 'reactivation factors' produced by culturable cells 57

are needed for resuscitation to occur may further complicate attempts to induce resuscitation in cultures where culturable cells have been excluded. Such a

“resuscitation-promoting factor” has been shown to be necessary for the reactivation of dormant cells of Micrococcus luteus (352, 353). While these cells have been reported to be “dormant” as opposed to VBNC (82) and thus show no evidence of metabolic activity when assessed by the methods used to indicate activity in VBNC cells, the results from this study may nonetheless be applicable to resuscitation of VBNC cells. It was reported that in a microcosm exhibiting a culturability of <0.001%, 70% of the cells could be lysed upon inoculation into fresh lactate minimal medium containing penicillin, showing that a significant portion of the cells had the capacity to engage in cell wall synthesis. This population was shown to be heterogeneous and consisted of sub-populations of viable, nonculturable and dead cells (227). The resuscitation capacity of these populations was 1000-100,000-fold greater when samples were diluted into liquid media containing supernatants taken from batch cultures in stationary phase, suggesting that viable cells can produce a factor which stimulates the resuscitation of dormant cells (229). Further, the requirement for the presence of viable cells in a population before resuscitation of dormant cells was demonstrated (534). This

‘resuscitation factor’ has been purified and characterised (228). These authors report the resuscitation of dormant cells of M. luteus was increased 100-fold when the purified factor was added to cultures of dormant cells at ng ml-1 concentrations. The requirement for viable cells in the induction of resuscitation of VBNC cells, may further complicate the distinction between regrowth and resuscitation. 58

It is not known for certain how long VBNC cells in the environment will remain stable and at which point they are no longer capable of resuscitation. It is known that they remain intact for long periods of time and have been shown to retain plasmids for extended periods in the laboratory (56, 337). There have even been recent reports of VBNC cells capable of plasmid transfer in seawater (66).

Based on such reports dealing with the entry into the nonculturable state, it is likely that there is first a loss of platability with maintenance of respiration and membrane permeability. This is followed by the loss of respiration and membrane permeability and finally, there is a loss of intact nucleic acids (223,

542). For resuscitation to occur, these processes may be reversed starting with an increase in membrane potential and adenylate charge that must occur for the cells to become active. This would then be followed by an increase in metabolic activity which could potentially be detrimental if the buildup of reactive oxygen species occurs without abate in the absence of peroxidase or superoxide dismutase. Continuous generation of reactive oxygen species (ROS) in cells that are not dividing leads to oxidative stress due to the lack of cell division, which would dilute the ROS (see section 1.4.9). These types of processes would suggest the involvement of a genetically programmed series of events.

In general, it remains unclear whether resuscitation conditions are just not known for most organisms or whether these cells are incapable of resuscitation. It is most likely that, within a population of VBNC cells, only a small percentage are capable of resuscitation and this percentage decreases with time. The possibility that extracellular signal molecules or metabolites produced by culturable cells are 59

required in order for resuscitation to occur will make the identification of conditions needed for reactivation even more elusive. This requirement for the presence of viable cells in resuscitation cultures may be due to either, the presence of the cells themselves, or to the secretion of some signal that ‘awakens’ the VBNC population and may explain the inconsistency of resuscitation experiments. Clearly, the possibility of signal molecules involved in the entry into and exit from the VBNC state has far reaching ramifications. In addition, there may be host factors important in the reactivation process of pathogens, for example, L. pneumophila requires the host amoebae for reactivation (481). These reactivated cells were shown to be infective for guinea pigs, however VBNC cells that had not been previously reactivated were not capable of infection.

1.4.9 Genetics of the VBNC response

Formation of nonculturable cells occurs under conditions that are limiting for the continued growth and maintenance of an active cell population, such as starvation and high or low temperature. It is therefore likely that genes involved in stress responses and stasis are at least partially involved in the regulation (or prevention) of nonculturability. In fact, it has been shown that in E. coli and Salmonella

- typhimurium, there is an induction of the VBNC state in stationary phase in rpoS strains when they are incubated aerobically at low osmolarity (356). This effect was not seen however, at high osmolarity or in logarithmic phase cells. The authors demonstrate that rpoS was expressed post-transcriptionally during starvation in seawater and hypothesised that the VBNC response of aerobically 60

grown E. coli cells in oligotrophic water may be regulated at the transcriptional level. Perhaps the function of such regulators may be to delay VBNC formation until the cell has acquired stress-induced cross protection which will better its chances for survival upon the reversal of adverse conditions. This appears to be the case for the starvation-induced delay of VBNC in V. vulnificus (384, 402).

One may also assume that other stress response regulators, such as OxyR and

SoxRS, which are activated by oxidative stress, and ArcA which is activated during aerobic starvation and limits the production of oxygen radicals by limiting activity of dehydrogenases, may also be involved in such activities.

Reactive oxygen species can damage DNA, lipid membranes and proteins and have been implicated as a cause of cellular aging due to nongrowth conditions

(103, 104, 373, 376). Stasis caused by a variety of conditions induces the expression of regulators involved in the prevention and repair of oxidative- induced damage to cellular components. This resistance is partly dependent on

RpoS (267, 311). The growth arrest observed in VBNC cells may be phenotypically similar to that of stasis-induced growth arrest and may require similar repair processes, although different inducers are involved in its onset.

OxyR (72) is a regulator of an operon that provides protection against oxidative stress and is induced by hydrogen peroxide or by a shift in the redox potential of the cell (15) while SoxR is required for the induction of genes in response to superoxide-generating agents (166). OxyR becomes oxidised upon removal from a reducing environment, leading to the formation of a disulfide bond between two cysteine residues and is only capable of activating transcription in its oxidised 61

form (573). A conformational change in the protein alters its interaction with

RNA polymerase and causes transcription activation. SoxR is a trans-acting positive factor needed for transcriptional activation of genes induced in response to superoxide or nitric oxide (90). soxR and soxS encode a sensor/regulator system that acts sequentially in the induction of a superoxide dismutase (sodA), an endonuclease (nfo) and a dehydogenase (zwf). These SoxR-regulated genes are involved in the prevention and repair of damage caused by superoxide radicals and provides resistance to immune cells that produce nitric oxide.

In cultures of E. coli (14), the addition of increasing concentrations of hydrogen peroxide, one of the photo-products formed in natural aquatic systems, gave rise to the formation of nonculturable cells. On the other hand, in illuminated microcosms the addition of compounds which eliminate hydrogen peroxide (i.e., catalase, sodium pyruvate, and thioglycolate) had a protective effect, as the CFU counts on minimal medium and on recuperation medium were significantly higher than those detected in the absence of these compounds. One could infer from these results that it is the damage experienced from the oxidative burst that occurs in resuscitating cells upon the resumption of metabolism that prevents the recovery of a subpopulation of the nonculturable cells in the population. OxyR- deficient mutants of E. coli lose platability on nutrient plates but can be recovered by plating anaerobically or with high levels of catalase added to plates (104), indicating the involvement of oxidative deterioration in loss of culturability.

Likewise, nonculturable cells of Vibrio parahaemolyticus and E. coli were resuscitated on media containing catalase or sodium pyruvate (331, 332). Similar 62

results have been obtained with nonculturable cells of V. vulnificus (data not shown). In fact, catalase has been proposed as an important addition to media for the recovery of cells (50, 132, 300). The oxidation of proteins has been shown to be specific for certain proteins and is hypothesised to be generated by imbalances between macromolecular synthesis and catabolism (104).

ArcA functions to reduce the production of components of the aerobic respiratory apparatus during growth arrest and thus also protects the cell against oxidative stress (376). E. coli cells starving for carbon will reduce the production of TCA cycle enzymes while increasing glycolytic enzymes, which is reminiscent of the response of cells to anaerobiosis. ArcA is involved in controlling the TCA cycle enzymes but not the glycolysis enzymes during aerobic starvation thereby reducing the level of respiration (reduction in electron donors).

The identification of genes that are induced by the VBNC trigger would provide evidence that the VBNC response is a genetically programmed response and hence, part of the life cycle of the organism (Fig. 1.1). The recent release of whole genome sequences will allow researchers to screen the genome for candidate genes involved in the nonculturable response. The limitation of this approach is the lack of preexisting knowledge of genes that play a role in such adaptive responses. Nonetheless, the regulators known to be involved in starvation or stationary phase responses are likely to be involved either directly or indirectly in nonculturability, due to the similarities in stasis observed for starving and nonculturable cells. 63

Growing cells Nutrien t limi tat io n Sigma factors, Signals Virulent, Culturable, Active

Stress Recovery Virulent resistant Upshift 4 ˚C Resuscit atio n ? proteins dependent on Sigma factors VBNC Low specific genes and Induction, signals activity Signal Loss of cellular regulated, structures and measures of activity Starved cells specific Prolong ed VBN C genetic program 4 ˚C Genetically programed Moribund or SIMC response, dead cells inhibition of VBNC Not Intact cell culturable structures

Cellular Virulent? activity

VBNC population

Figure 1.1. Model for the VBNC response of Vibrio vulnificus.

Text in capital letters refers to cell populations, italicised text refers to conditions that induce the responses and plain text indicates possible factors involved in the response. 64

1.4.10 Conclusions

In several cases, VBNC cells have been shown to maintain some potential for metabolic activity as well as possible infectivity. It has been demonstrated that V. cholerae 01 can be detected in the natural environment through the use of fluorescent antibodies in large numbers of samples from which the organism could not be cultured. Enterotoxigenic E. coli was shown to produce enterotoxin while in the VBNC state (416). The fact that these pathogens can persist in the environment and produce toxin while not culturable is a true public health concern. Thus, study of the VBNC state is not merely one of pure curiosity but rather one that involves genetics, physiology and public health concerns.

Numerous studies have indicated the heterogeneous nature of most cultures of

VBNC cells. It has been shown for both V. vulnificus (542) and L. pneumophila

(563) that the VBNC cultures contain some cells with intact DNA and RNA

(nonculturable) while a significant proportion of the population consists of cells which maintain DNA and RNA that has undergone degradation (nonviable cells).

A similar trend was seen for induced enzyme activity with a subpopulation remaining responsive while the activity was lost in other cells (370).

The physiological and molecular basis for entry into and exit from the VBNC state remains obscure. We propose that there are sub-populations within VBNC cultures and that these sub-populations are a reflection of the stages of VBNC formation. In the initial stage, cells lose culturability while maintaining intact 65

membranes and RNA and DNA. These cells thus maintain the potential for resuscitation (viability). In the later stages of the VBNC state cells gradually experience degradation of nucleic acids and thus lose the potential for resuscitation (nonviable). Definitive proof that the VBNC state represents a true programmed physiological response will depend on the identification and characterisation of the genetic determinants that regulate this response, which will allow for an understanding of the biology of this phenomenon.

Additionally, we are also gaining a better appreciation for the complexity of the

VBNC response and must begin to consider the interplay of signalling molecules, starvation, and other factors such as oxidative stress. In particular, these factors may be especially important for studies of resuscitation where signals may be required, where resuscitation may be inhibited by the production of toxic metabolites, and the possibility that only a portion of long term VBNC cells may be competent to resuscitate. From this perspective it is evident that the VBNC response is not an isolated, adaptive response, but rather is survival strategy that has become integrated into the organisms repertoire of adaptive responses which include starvation, heat, and cold adaptation strategies. The development of molecular techniques and genomics has poised the field for studies of the identification of genes and gene products that are important for development of the VBNC response. In addition, the possibility that signalling molecules are involved in the regulation of the VBNC response is an exciting new area of investigation. Indeed, Chapter 6 of this dissertation addresses such a role for signalling molecules in V. vulnificus. 66

1.5 INTERCELLULAR SIGNALLING

Bacteria communicate through the secretion and uptake of small diffusible molecules that induce coordination of phenotypic expression and provide a selective advantage in the natural environment. Autoinducer circuits, where the autoinducer accumulates during growth until a threshold concentration is attained, at which point the system is switched on, are considered to be cell density-sensing systems. Since the autoinducer accumulates extracellularly and increases in concentration as a function of population density, a coordinated response will occur only when a critical cell density is reached (i.e. when enough autoinducer accumulates) and the phenotypes regulated by these autoinducers are only adaptive at this time and not earlier. For example, the regulation of virulence determinants by autoinduction systems functions to evade host defences in many pathogenic bacteria. The premature expression of bacterial toxins might be a poor strategy as it could alert the host and elicit defensive responses. Quorum sensing delays virulence factor production until cell numbers are high enough to result in a productive infection. However, it should be stated that, theoretically, the density of signalling molecules could also be increased by limiting the space around the cells or by altering diffusion of the autoinducer, rather than by increasing the cell number.

In addition to ensuring the presence of effective numbers before expression of signal-regulated phenotypes, it is now apparent that a range of other regulatory mechanisms interface with quorum sensing to ensure that a suitable niche is occupied before activation of cell-density phenotypes occurs. Thus, the simple 67

addition of signal molecules is not sufficient to induce phenotypic expression in most systems. For example, in Pseudomonas aeruginosa, RpoS and the RhlRI

AHL system are interrelated (94, 269, 545), ensuring that the signalling system is interrelated to environmental sensing. Furthermore, additional environmental information is transduced to the signalling system via other regulators of gene expression (3, 268, 430).

These signalling systems represent a means of intercellular communication within a population of bacteria. It seems probable that the complex chemical communication systems of eucaryotes evolved from the simpler chemical signalling systems of procaryotes. Despite the diversity of intercellular signalling systems that exist in bacteria, certain general themes of population density- dependent can be discerned. Regulation is mediated by the accumulation of one or more self-produced signal molecules in the environment. The widespread occurrence of signalling systems and the fact that many different bacteria produce identical or nearly identical autoinducers indicates that signals can be perceived not only by the producing species but also by other, unrelated species. It is therefore possible that bacteria can examine the surrounding environment and modulate their own behaviour in response to the presence of other species. The large number of bacteria that have been demonstrated to activate luminescence in

Vibrio harveyi (28, 165) suggests this may be the case. Recent evidence also suggests that signal systems may play a more central role in the physiology of bacteria by regulating starvation adaptation pathways and entrance into stationary 68

phase (section 1.3.5.6). Evidence for such a role by signal system 2 in Vibrio vulnificus is presented in Chapters 5 and 6.

1.5.1 Signalling in Gram-positive bacteria

Several processes in Gram-positive bacteria are known to be regulated in a cell density-dependent manner. Examples of phenotypes regulated by peptides in

Gram-positives include genetic competence in Bacillus (273, 408, 473) and

Streptococcus (181, 182), virulence in Staphylococcus (366), conjugation in

Enterococcus (75, 277) and production of anti-microbial peptides by several species of Gram-positive bacteria, including the lactobacilli (244, 363).

Streptomyces are filamentous, fungus-like soil bacteria with a complex multicellular life cycle in which cell to cell signalling controls the formation of a spore-forming aerial mycelium (547). The essential regulatory molecules produced by Streptomyces are g-butyrolactones that function in controlling antibiotic production and differentiation (202).

The common theme in cell density-dependent regulation of Gram-positives, with the exception of the g-butyrolactones, is that the signal molecule is a post- transcriptionally processed secreted peptide. Peptide signalling molecules are actively secreted via ABC exporter proteins and recognised by the input domain of a typical sensor component of a two-component signal transduction system that interacts with cytoplasmic response regulator proteins. Thus, the signal molecule is not internalised but can be sensed by the sensor molecule on the outer surface of the cytoplasmic membrane. These two-component systems, consisting of a 69

sensor and response-regulator protein which use phosphorylation as a means to transfer information, form a major mechanism of signal transduction in bacteria and play a role in many of the adaptive changes in cellular physiology in response to changes in the environment (490). Another common theme of many of these quorum sensing systems is that both the gene encoding the precursor peptide and the genes encoding the proteins involved in the two-component regulatory system, and those involved in the secretion of the peptide, are transcriptionally linked. In addition, the synthesis of the peptide pheromones appears to be an auto-regulated process.

1.5.2 Signalling in differentiating Gram-negative bacteria

Myxobacteria are unique Gram-negative procaryotes in that they have a developmental life cycle that results in a fruiting body composed of thousands of cells and even during growth, they occur as populations of cells rather than single cells. Cells move over surfaces as swarm populations that can fragment and coalesce without disrupting the swarm. The formation of fruiting body formation requires nutrient starvation, high cell density and a surface to facilitate gliding

(484). In Myxococcus, four sequential intercellular signals control the development of spores from vegetative cells (225). The changes in morphology and gene expression are controlled by at least four cell-cell interactions. For at least one early and one late developmental signal, cell density determines the efficiency of intercellular signalling. Amino acids (A signal) (263) serve as a long-range diffusible signal while a cell-associated protein (C signal) (237) 70

functions over a short range and requires the contact of signal producing cells and responding cells.

Starvation induces the production of the freely diffusible A signal in Myxococcus that functions to test the cell density of the population. Only when A signal is transmitted (when the cell density is high enough), do the cells express A- dependent genes and proceed through the early stages of development. C signal functions later by stimulating cells to aggregate and differentiate into spores. C signalling requires cells achieve properly packed arrays prior to the initiation of development. Recently, a novel type of signal molecule, called a stigmolone, has been isolated and identified in the myxobacterium Stigmatella aurantiaca (415).

1.5.3 Signalling in non-differentiating Gram-negative bacteria

The most thoroughly studied signalling system in bacteria is the acylated homoserine lactone (AHL) signalling system. AHLs have been shown to control a variety of phenotypes including but not limited to plasmid conjugal transfer

(414), swarming motility (111) and antibiotic and pigment production in Serratia

(513), production of virulence factors in P. aeruginosa (144, 404) and Yersinia enterocolitica (515), antibiotic production and pathogenicity in Erwinia (18, 32).

1.5.3.1 The AHL system

The paradigm for intercellular signalling between bacteria is quorum sensing in the symbiotic marine bacterium, Vibrio fischeri (Fig. 1.2). Bioluminescence is regulated in a cell density-dependent manner by a signalling molecule or 71

autoinducer (AI). The autoinducer of V. fischeri is an acylated-homoserine lactone (AHL) (109), synthesised by the luxI gene product (autoinducer synthase) and detected by the luxR encoded receptor/transcriptional activator. When the concentration of AHL in the cells reaches a certain level, such as in the light organ of the squid, a signal transduction cascade is initiated that leads to the production of luciferase (116) due to the association of the AHL-LuxR complex with the lux operon promoter and transcription of the lux operon (117). LuxR binds to a region in the lux operator called the lux box (486, 487) to stimulate expression. luxI is transcribed at a low basal rate, which allows for a constant, low concentration of autoinducer production. When the cell density is low, the autoinducer produced by luxI diffuses away from the cells. As the population increases, autoinducer will accumulate and eventually the concentration inside the cell reaches a threshold level and interacts with LuxR. The AHL-LuxR complex is then capable of stimulating transcription of luxI, which leads to even more

AHL production, thus forming a positive feedback loop termed autoinduction.

This autoinduction circuit allows for a rapid increase in signal production and dissemination and therefore leads to a rapid induction of phenotypic expression by members of the population (Fig 1.2).

V. fischeri produces a second autoinducer (VAI-2) which is encoded by ainS

(153). This second autoinducer has no similarities to the LuxI family of autoinducers but does show some similarity to the LuxM protein of V. harveyi 72

CRP binding site lux box luxR luxI luxCDABEG - + LuxI LuxR LuxR

OHHL

Figure 1.2. Model for the regulation of quorum sensing in V. fischeri.

Bioluminescence is controlled by the signalling molecule, N-(3-oxohexanoyl)-L- homoserine lactone (OHHL), which is synthesised by the action of the LuxI protein. This molecule can diffuse out of the cell, so the intercellular concentration of OHHL is dependent on cell density. OHHL binds to the LuxR protein, allowing it to initiate transcription of luxI and the lux structural genes. Positive feedback leads to autoinduction and an increase in OHHL concentrations. cAMP and CRP activate transcription from the luxR promoter. Transcriptional repression and activation are indicated by - and +, respectively. 73

(see below). VAI-2 interferes with the stimulation of luminescence by VAI-1, probably by competing with VAI-1 for the response regulator, AinR (262). This inhibitory activity has been suggested to help prevent premature induction of luminescence at low population densities. Recently, a LuxO homologue has been found in V. fischeri as well (327) which indicates that this organism also has components signalling system as found in V. harveyi (see below). The occurrence of multiple signalling systems may thus be a general regulatory mechanism in luminescent bacteria.

Conditions known to increase lux expression include reduced levels of nutrient, iron and oxygen, and the presence of toxins or DNA-damaging agents (359). cAMP and CRP control many of the LuxI/LuxR systems and are required for transcription of luxR (106-108). Control of quorum regulation by cAMP might serve to channel information about the nutritional status of the cell into the quorum sensing mechanism and delay stimulation of the response when nutritional levels and growth rates are high. This has lead to the expression of lux being equated to a stress response, as it appears to be inversely modulated to favourable growth conditions.

This AHL system has been described in over 30 species of Gram-negative bacteria for the control of density-dependent functions (142, 143, 499), and a number of strains produce more than one AI synthase/regulator pair (261, 412).

Additional complexity exists in many of these LuxI/LuxR systems. In the opportunistic pathogen, P. aeruginosa, two synthase/receptor pairs (LasI/LasR, 74

RhlI/RhlR) operate in tandem to regulate virulence factor expression (270, 406,

409). Furthermore, in some of organisms, the AHL system is controlled by other global regulators such as GacA and GacS in Pseudomonas aureofaciens (65) or

PAME (3-hydroxypalmitic acid methyl ester) in Ralstonia solanacearum (128)

1.5.3.2 Signal system 2 in Gram-negative bacteria

The free-living marine bacterium V. harveyi possesses two autoinducer-response systems that function to control luminescence, siderophore production and colony morphology (31). This bacterium has an AHL system (system 1) in addition to a second non-AHL system (system 2). Signalling system 1 is composed of an autoinducer synthase (luxLM) which produces AI-1 (HBHL) (58) and sensor 1

(luxN). The response regulator, LuxN, which responds to and binds the AHL is not, however a homologue of the V. fischeri LuxR, but rather is a membrane- bound member of a two-component signal transduction system (29). Signalling system 2 is composed of the autoinducer synthase 2 (LuxS) which produces a chemically unidentified signal, AI-2, and sensor 2 (LuxPQ), another two- component regulatory pair (29) (Fig. 1.3). Information from sensor 1 and sensor

2 is relayed to LuxO via the phosphorelay protein, LuxU (138). LuxU is responsible for integrating signalling events from LuxN and LuxQ to the common response regulator, which acts to control luminescence and siderophore production, and interaction with the sensor LuxN and LuxQ is proposed to activate LuxO. LuxN and LuxQ phosphorylate LuxO at low cell density, causing

LuxO to interact with RpoN to activate transcription of genes necessary for siderophore production, rugose colony morphology (279) and a negative regulator 75

LuxR +

luxLM luxN luxCDABEGH luxS luxPQ

LuxLM LuxN -

s54 HAI-2 LuxPQ HBHL LuxO

PO LuxN 4 HAI-2 LuxPQ HBHL PO 4 LuxU PO 4

Figure 1.3. Model for the regulation of quorum sensing in Vibrio harveyi. Under conditions of low cell density, in the absence of autoinducers, HBHL and HAI-2, the sensor kinases LuxN and LuxQ autophosphorylate and then phosphorylate the phosphorelay protein LuxU. LuxU subsequently transfers phosphate to the regulator protein LuxO. Phosphorylation of LuxO activates it, and with sigma 54, LuxO activates an unknown repressor of lux operon. Under conditions of high cell density, interaction of the autoinducers stimulates LuxN and LuxQ sensors to switch from kinase to phosphatases. This results in dephosphorylation of LuxO and inactivation of its function. Inactivation of LuxO allows activation of the lux operon by LuxR. 76

of luminescence (137). The concentration of autoinducers accumulates as the cell density increases and binding of the autoinducers to LuxN and LuxP in conjunction with LuxQ causes LuxN and LuxQ to switch from kinases to phosphatases. Dephosphorylation of LuxO inactivates its activity and allows for derepression of the bioluminescence genes which are then transcriptionally activated by LuxR, which is not homologous to the V. fischeri LuxR (29) (Fig.

1.3).

The signal molecule involved in system 2 has not been identified (27, 29, 31), but the gene responsible for AI-2 activity has been demonstrated to be luxS (496).

Database analysis has identified luxS homologues in a wide range of bacteria, including both Gram-negative and Gram-positive organisms. The system 2 signalling circuit has been implicated in the regulation of capsule production in

Vibrio parahaemolyticus (312), metalloprotease production in Vibrio cholerae

(219), expression of the type III secretion system in enterohemorrhagic and enteropathogenic Escherichia coli (478), initiation of chromosome replication in

E. coli (553) and regulation of numerous virulence factors as well as starvation adaptation in V. vulnificus (314) (Chapters 5 and 6).

It appears that the two signal systems function to allow V. harveyi to respond to signals from either conspecific or nonconspecific bacteria. The majority of other species able to stimulate bioluminescence do so via system 2. These species include V. cholerae, Vibrio anguillarum, Vibrio angustum, Vibrio alginolyticus and V. vulnificus (see Chapter 4), as well as more distantly related species, 77

including some Gram-positives (28). In addition, the two systems may respond to different environmental cues and could thus allow for the integration of multiple cues in the regulation of signalling phenotypes. The system 2 signalling molecules in V. vulnificus and V. angustum are involved in the regulation of starvation and/or stationary phase phenotypes (315, 480).

Possible explanations for the induction of bioluminescence in the presence of other species may be related to the environment in which this phenotype occurs.

V. harveyi typically colonises the enteric tract of fishes, along with a diverse population of bacteria. Induction of bioluminescence in such habitats may function to lower the ambient oxygen tension (luciferase has a high affinity for oxygen) and decrease potential oxidative damage or competition from aerobes

(359, 531). In fact, it has recently been reported that luminescence in V. harveyi allows for repair of UV-damaged DNA by a photoreactivation process (81).

1.5.3.3 Other signalling molecules

Another class of signalling molecules recently identified, is the cyclic dipeptides

(CDPs) (195). These molecules appear to be widely disseminated and have been isolated from P. aeruginosa (195), V. parahaemolyticus (35) and Micrococcus

(489). The biological role of the molecules has not been elucidated. Likewise, the fatty acid derivative, 3-hydroxypalmitic acid methyl ester (PAME), has been demonstrated to autoregulate the expression of virulence in R. solanancearum

(128, 129) through its regulation of the AHL signalling system in this organism.

In addition, the production of another type of signal molecule, a quinolone, has 78

also been identified in P. aeruginosa and has been shown to regulate one of the

AHL systems in a density-independent manner during late stationary phase (30 -

42 hours post-inoculation) (319, 411). Thus, numerous examples of previously unrecognised signal molecules are being discovered, and often multiple signal systems are integrated to function coordinately to regulate both density-dependent and density-independent gene expression, as is seen in V. harveyi.

1.5.4 Eucaryotic interactions

Another important aspect of quorum sensing is the role it plays in interactions of bacteria with higher organisms. Luminescence in V. fischeri and virulence in P. aeruginosa and Agrobacterium tumefaciens are strictly regulated in accordance with a eucaryotic habitat (523, 530, 552). Plants produce extracellular factors that induce AHL mediated phenotypes in Agrobacterium (414, 572). V. fischeri rapidly colonises the light organs of the squid, Eupymna scolopes. The bacteria produce light that provides the squid with a camouflage strategy called counterillumination (359). Counterillumination is used for hunting in shallow water above reefs and when viewed from underneath, the light appears to be moonlight or starlight from above, preventing a shadow being cast by the squid.

Each morning, over 90% of the population of bacterial cells are expelled from the light organ, and bioluminescence decreases (446). By the following evening, the residual population has proliferated and restored the full potential for luminescence. This continuous cycle maintains a metabolically active population of bacterial cells that are capable of competitive dominance in the light organs. 79

Other organisms may secrete similar autoinducer signals that function as competitors that could create false-positive or false-negative signals leading to unproductive responses. An example of eucaryotic interference with bacterial signalling comes from the control of bacterial fouling on the marine algae,

Delisea pulchra (for a review see (432)). This alga produces a number of halogenated furanone compounds that are able to specifically inhibit signal- regulated phenotypes via both AHL and non-AHL signalling systems (293, 480), such as swarming in Serratia (156) and Proteus (161), attachment of marine bacteria (243) to surfaces and virulence of the prawn pathogen, V. harveyi (294).

Thus, this is a case of a eucaryotic organism using the production and secretion of

AHL antagonists in order to block colonisation phenotypes thereby limiting the fouling of the plant surface by bacteria. Undoubtedly, many other such systems will be identified in the near future.

1.5.5 Conclusions

Several chemically distinct families of quorum sensing molecules have been identified in bacteria and many of these are able to 'cross-talk' with other systems.

Many of the phenotypes regulated by these signalling systems are involved in colonisation and/or pathogenicity and are an advantage only when there is a high cell density. For example, the premature expression of virulence factors during the early stages of infection will alert the host and induce a defensive response from the host. In the case of luminescence, the production of light by single cells is energy-expensive and provides the cell with no selective advantage since a single luminescent cell is not detectable by animals. 80

It is now clear that AHL-mediated quorum sensing is far more complex than the original lux paradigm proposed for V. fischeri. Quorum sensing can no longer be viewed in terms of individual signal molecules controlling a specific phenotype, but instead as an integration of density sensing with the metabolic state of the cell, as is best exemplified by the autoinduction cascade in P. aeruginosa.

Perhaps more importantly, the new classes of signal molecules, such as the V. harveyi system 2 and quinolones, are more likely to indicate the state of fatty acid metabolism and nutritional status of the cells (194, 319, 411). These signals will therefore be involved in the signalling of stressful conditions encountered during starvation and stationary phase instead of sensing cell density as such. Regardless of the reason for their generation, it is clear not only that autoinducers are an effective means of promoting bacterial unity in the coordination of gene expression, but also that the existence of these signals in the environment will incite a reciprocal response in other bacteria and eucaryotic cells, resulting in interorganismal communication. 81

2 STARVATION-INDUCED MAINTENANCE OF CULTURABILITY

2.1 ABSTRACT

The response of the estuarine human pathogen Vibrio vulnificus to starvation for carbon, nitrogen or phosphorus, or all three nutrients simultaneously (multiple- nutrient), was examined with respect to the maintenance of culturability during incubation at low temperature. V. vulnificus showed similar survival patterns during starvation for the individual nutrients when kept at 24°C. On the other hand, cultures prestarved at 24°C and then shifted to 5°C maintained culturability at low temperature in a starvation-condition-dependent manner. Carbon and multiple-nutrient starvation were indistinguishable in their ability to mediate maintenance of culturability in the cold. Prolonged starvation for phosphorus had a similar effect, but nitrogen starvation did not allow for maintenance of culturability. Protein synthesis during starvation for individual nutrients was analysed by two-dimensional polyacrylamide gel electrophoresis of pulse-labelled proteins. Carbon and multiple-nutrient starvation gave nearly identical protein induction patterns involving at least 34 proteins, indicating that carbon starvation determines both responses. Nitrogen starvation for 1 h induced 24 proteins, while phosphorus starvation induced a set of 10 proteins after 1 h and about 40 proteins after 18 h. It is suggested that starvation for carbon or phosphorus induces maintenance of culturability of V. vulnificus incubated at low temperature via the synthesis of distinct sets of starvation-specific proteins. 82

2.2 INTRODUCTION

Vibrio vulnificus is a pathogenic, estuarine bacterium associated with primary septicemia and severe wound infections. This organism is part of the estuarine microflora and is found in high numbers in filter feeding shellfish. While this bacterium can be readily isolated from seawater and shellfish in the warmer months, there have been numerous reports that document the inability of researchers to culture this organism during the colder months. It is now clear that this inability to culture V. vulnificus from colder waters is due to its entry into a viable but nonculturable (VBNC) state and not from cell ‘die-off’. The VBNC response of this organism has been studied in detail (364, 386, 387) and it is known that exposure to temperatures below 10°C is the only inducing factor of nonculturability.

It has been shown, however, that the time required to become nonculturable at low temperatures is directly related to the physiological age of the cells (384), as cells which are in stationary phase remain culturable significantly longer than log phase cells at low temperature. It has been proposed that the synthesis of starvation-induced (Sti) proteins may be involved in this prolonged maintenance of culturability displayed during low-temperature incubation. Indeed, it has been reported by Morton and Oliver, that V. vulnificus displays an induction of six temporal classes of Sti proteins during carbon starvation (346) and that proteins required for survival during starvation are produced within the first 4 hours of starvation. Of the 34 total proteins induced in a 26 h period of starvation, 23 were induced within the first 20 min. 83

The aim of this study was to obtain a more detailed understanding of the starvation-induced maintenance of culturability (SIMC) in V. vulnificus at 4°C.

The SIMC response of V. vulnificus was examined after pre-starvation for carbon, nitrogen, phosphorus or for all three (multiple nutrient starvation). The use of two-dimensional polyacrylamide gel electrophoresis (PAGE) allowed for the analysis of induction of proteins in response to differing starvation conditions.

These proteins were correlated with the culturability of cells during subsequent cold incubation. It is believed that the investigation of the processes that allow for maintenance of culturability at low temperature may allow identification of processes that regulate the formation of VBNC cells and may thus lead to an understanding of the VBNC state and its biological significance. The majority of the data in this chapter has been published (402).

2.3 MATERIALS AND METHODS

2.3.1 Bacterial strains and culture conditions

Vibrio vulnificus C7184(T) is a spontaneously derived, non-encapsulated, and thus non-virulent, mutant of the virulent and encapsulated strain C7184(O) (394) which was isolated from drainage of a hand wound. It exhibits the same response to cold incubation as the opaque variant (554). The designations (T) and (O) refer either to a translucent or an opaque colony morphology respectively, on agar plates, which is related to capsular polysaccharide production. 84

Strains were maintained at -70°C in Luria-Bertani (LB) (324) broth (10 g tryptone

(Oxoid Australia Pty., Melbourne, Vic, Australia), 5 g yeast extract (Oxoid) and

10 g NaCl per litre of distilled water) containing 15% (vol/vol) glycerol (Research

Organics). Prior to each experiment, cells were inoculated from frozen stocks into LB broth overnight and then plated onto LB agar (LB with 15 g agar

(Research Organics) per litre distilled water) to check for purity. Cells of

C7184(T) were routinely grown at 24°C on a rotary shaker at 200 rpm in 2M medium containing single defined inorganic nitrogen and phosphorus sources

(9.25 mM NH4Cl; 1.32 mM K2HPO4), and 0.2% (w/v) glucose as the sole carbon source. 2M medium is identical to the ‘marine minimal medium’ (MMM) (397) described by Östling et al. (1991) modified to contain 50% of the salts (0.5 X

NSS). MMM was devised from the 40 mM morpholinepropanesulfonic acid

(MOPS)-buffered medium for Escherichia coli (360), and supplemented with the salts of the artificial seawater NSS (296). The diluent, 0.5 X NSS consisted of:

NaCl, 8.8 g; Na2SO4, 0.735 g; NaHCO3, 0.04 g; KCl, 0.125 g; KBr, 0.02 g;

MgCl2 · 6H2O, 0.935 g; CaCl2 · 2H2O, 0.205 g; SrCl2 · 6H2O, 0.004 g; H3BO3,

0.004 g; double distilled H2O, 1000 ml. The pH was adjusted to 6.5 prior to autoclaving with KOH so that the pH after autoclaving is 7.5. 2M was prepared by separately autoclaving and, after cooling to 50°C, mixing the following solutions: (i) 920 ml 0.55 X NSS; (ii) 10 ml 132 mM K2HPO4; (iii) 10 ml 952 mM NH4Cl (pH 7.8), and the following sterile filtered solutions; (iv) 10 ml 0.4 M tricine, 1 mM FeSO4 · 7H2O (pH 7.8); (v) 10 ml of a glucose stock solution to give the appropriate final concentration; (vi) 40 ml of a 1 M solution of MOPS

(pH 8.2). To achieve starvation conditions, the cells were collected in exponential 85

phase, washed twice and resuspended in the appropriate starvation medium.

Different nutrient limitations were achieved by resuspending the cells in 2M lacking either carbon (2M-C), nitrogen (2M-N), phosphorus (2M-P) or lacking all three simultaneously (2M-CNP). Cultures were starved for various times at room temperature without shaking prior to incubation at 4°C.

2.3.2 Determination of colony forming units

To assess the culturability of C7184(T) upon cold incubation, samples were taken at the indicated times and diluted in the respective starvation medium. Drop plate counts were performed as described by Hoben and Somasegaran (191) on VNSS agar plates (377) (V-medium modified from Väätänen (522)) containing 50% of the reported salt concentrations to equal the growth and starvation medium

(DVNSS) (1.0 g peptone (Oxoid), 0.5 g yeast extract (Oxoid), 0.5 g glucose, 0.01 g FeSO4 · 7H2O, 0.01 g Na2HPO4 per litre of 2M salts). Plates were dried and incubated for 24 h at 37°C before the assessment of colony forming units (CFU).

It was determined that the CFU obtained after incubation of the plates for 24 h at

37°C was always equal to plates incubated at 24°C for 48 h. Prolonged incubation of plates at room temperature for up to 7 days revealed no further colony development.

2.3.3 Pre-starvation and cold incubation experiments

Cells of C7184(T) were grown overnight at room temperature in 2M medium, transferred to fresh medium at a dilution of 1:50 and grown overnight. Cells were 86

then transferred to fresh medium at a dilution of 1:100. The cells were grown to mid-exponential phase (optical density at 610 nm = 0.15 - 0.2; 1.8 - 4.0 X 108

CFU ml-1) and split into four 25 ml samples, each of which was harvested by centrifugation (12,000 X g, 10 min, 24°C, Sorvall RC5B plus centrifuge, SS34 rotor) and washed twice in the appropriate starvation medium. Cells were resuspended at either high or low density (see below) in the appropriate starvation suspension. Sub-samples of these cell suspensions were starved for different periods of time at 24°C and then shifted to 4°C. The starvation time was calculated from the start of the first wash. For comparison, exponentially growing cells were directly transferred to 4°C or washed and resuspended in 2M-

CNP or 2M prior to cold incubation. There was no significant difference in the kinetics of VBNC cell formation between cells washed prior to cold incubation and those transferred directly to 4°C. Initial CFUs prior to cold incubation were between 1.7 and 3.5 X 106 CFU ml-1 in low density experiments (suspensions diluted 1:100 in starvation medium) and between 1.2 – 4.9 X 108 CFU ml-1 in high density experiments (undiluted suspensions).

2.3.4 Pulse-labelling of C7184(T) for two-dimensional PAGE

Cells of C7184(T) were grown in 2M medium at 24°C to exponential phase and labelled after 1 hour of carbon, nitrogen or multiple nutrient starvation, and after

1, 18, 21 or 24 hours of phosphorus starvation at 24°C. Labelling was performed at 24°C by incubating 0.5 ml of the cultures with 64 µCi (2.38 MBq) [35S]- methionine (specific activity, 1000 Ci mmol-1 [43 TBq mmol-1], ICN

Pharmaceuticals, Inc., Costa Mesa, CA, USA). The incorporation was allowed to 87

proceed for 10 min for cells in exponential growth, for 15 min after starvation for

1 hour, and for 60 min after starvation for 18, 21 or 24 hours. Incorporation was stopped by chasing with 50 mM unlabelled methionine for 4 minutes, the cell suspensions were centrifuged (4°C, 20 min, 20,000 X g, Heraeus Sepatech

Biofuge 17RS, rotor 1379) and the pellets frozen at –70°C.

The bacterial pellets were lysed with 0.3 % (w/v) SDS, 200 mM ß- mercaptoethanol, 28 mM Tris-HCl and 22 mM Tris-base by incubation at 100°C for 2 min, followed by 5 min at 24°C, and subsequently placed on ice. DNase (1 mg ml-1) and RNase (0.25 mg ml-1) were added in a buffer consisting of 24 mM

Tris base, 476 mM Tris-HCl and 50 mM MgCl2 and the suspensions incubated on ice for 20 min. Pre-heated (37°C) lysis buffer [9.9 M Urea, 4 % (v/v) Nonidet P-

40, 2.2 % (v/v) Ampholytes (Millipore pH 4-8), 5 % ß-mercaptoethanol] was added to extract the precipitated protein. To prevent contamination of the protein samples, cell debris was removed by centrifugation for 20 minutes (20,000 X g,

4°C, see above for centrifuge and rotor) before loading of the samples onto the first dimension. General chemicals were purchased from Sigma (Sigma Chemical

Co., St. Louis, MO, USA) unless otherwise indicated.

2.3.5 Resolution of pulse-labelled cell proteins of two-dimensional PAGE

Two-dimensional polyacrylamide gel electrophoresis (2D-PAGE) was performed by the method of O’Farrell (379) with modifications using the Investigator

System (Millipore Corp., Bedford, MA, USA). Equivalent amounts of radioactivity (106 DPM) were loaded for each set of gels. The first dimension 88

was an isoelectric focusing gel containing 4.1 % (w/v) polyacrylamide and 6.25

% (v/v) ampholytes (pH 4-8, Millipore), and the second dimension was an 11.5 %

(w/v) Duracryl (Millipore Corp.) polyacrylamide gel. Gels were fixed overnight with gentle shaking in 50% ethanol and 10% acetic acid. After rinsing for 2 to 5 hours in double distilled water, the gels were placed on filter paper (3MM

Whatman) and dried at 80°C for approximately 1 h 20 min with a model 583 Bio-

Rad Gel Dryer (Bio-Rad Laboratories, Hercules, CA, USA).

Autoradiograms were prepared by exposure to Fuji RX film (Fuji Photo Film Co.

Ltd.) for 8 days to permit visualisation of the 35S-labelled proteins. All settings and conditions were according to Millipore specifications. Pulse-labelling and electrophoretic analysis of proteins were carried out at least in duplicates from separate experiments, and data reported are representative of these experiments.

General chemicals used were purchased from Sigma and all chemicals used in 2D

PAGE were purchased from Millipore (Millipore Corp., Bedford, MA, USA).

2.4 RESULTS

2.4.1 Starvation survival of Vibrio vulnificus C7184(T)

Exponentially growing cells of Vibrio vulnificus were washed and resuspended in defined starvation media which lacked either one essential nutrient (C, N or P) or all three at the same time (multiple starvation, -CNP), and held at 24°C without shaking. There was an initial increase in cell count [more notably when the cells were inoculated at low cell density (106 CFU ml-1)], followed by a gradual 89

decrease in cell number (Fig. 2.1). Culturability was maintained at similar levels under all starvation conditions tested for up to 45 days at 24°C (Table 2.1). In order to verify that the cells were growth-limited by the respective nutrient, the lacking nutrient was added back to a sub-sample of the experimental culture after one day of starvation, and the cultures kept at 24°C with shaking (data not shown). After an additional 24 hours of incubation, the amended samples showed an increase in CFU of 35.5, 30.1 and 40.8 times the initial count for the carbon, nitrogen and phosphorus starved cultures, respectively. The unamended samples, on the other hand, showed a slight decrease in CFU, providing evidence that the starving cultures were growth-limited for the lacking substrate. In the case of cells starved for multiple-nutrients, only the simultaneous addition of all three nutrients (C, N and P) lead to growth; no single nutrient (C, N or P), and no combination of two of the three nutrients, lead to an increase in CFU after 24 hours at 24°C. This control experiment verifies that multiple-nutrient starved cells are limited for all three nutrients.

2.4.2 Effect of pre-starvation on culturability at 4°C

In order to determine which starvation condition allows for maintenance of culturability upon subsequent incubation of cells at 4°C, the cells were starved for carbon, nitrogen, phosphorus or for all three simultaneously and culturability was assessed during subsequent incubation at 4°C. For comparison, non-starved exponentially growing cells were transferred directly to 4°C and their culturability was determined. 90

1.0x1007

1.0x1006

1.0x1005

1.0x1004

1.0x1003 0 1 2 3 4 5 6 7 8 Time (Days)

Figure 2.1. Survival of V. vulnificus C7184(T) during starvation at 24°C.

Cells of C7184(T) were starved for carbon (q), nitrogen (∆), phosphorus (◊) or all three simultaneously (°) at room temperature. Results shown are from a representative experiment. 91

Table 2.1. Long-term survival of V. vulnificus C7184(T) at 24°C during starvation.

Survival (% of initial CFU)a Time (Days)

Carbon Phosphorus Nitrogen Multipleb

10 18.4c (4.3)d 44.0 (13.0) 23.9 (16.1) 17.2 (5.4)

20 7.8 (2.1) 18.8 (7.1) 5.33 (2.5) 10.5 (3.2)

45 3.9 (3.7) 6.5 (4.4) 4.0 (2.8) 4.0 (1.8)

AInitial CFUs were between 2.19 X 106 and 3.5 X 106 ml-1 bPercentage CFU for carbon, nitrogen and phosphorus multiple starvation dStandard deviation cMean % CFU of control 92

Exponentially growing cells that were transferred to 4°C without prior starvation displayed a rapid decline in CFU during the first 2 days to less than 1% of the initial colony count of 1.7 X 106 CFU ml-1. After 11 days, less than 0.0001% culturable cells could be detected (Fig. 2.2). One hour of pre-starvation for carbon (C) or for multiple nutrients (CNP) at 24°C resulted in prolonged culturability at 4°C. After 3 days, cell numbers equivalent to approximately 10% of the initial CFUs ml-1 were still culturable, compared to 0.12% of the non- starved cells (Fig. 2.2). After 8 days of cold incubation, the culturability of cells pre-starved for 1 hour closely resembled that of non-starved cells (Fig. 2.2). Pre- starvation for carbon or for multiple nutrients (CNP) for 24 hours resulted in a significant delay in the loss of culturability of the cell population. Of cells that had been pre-starved for 24 hours prior to cold incubation, approximately 7% remained culturable after 7 days and 1% after 12 days (Fig. 2.2).

To more closely examine the temporal effect of pre-starvation on the maintenance of culturability upon subsequent incubation at 4°C, exponentially growing cells were pre-starved for multiple nutrients for 0, 0.5, 1, 2, 4, 6, 8 and 24 hours prior to cold incubation. Cells that had been pre-starved for as little as 30 minutes exhibited a slight increase in culturability at 4°C when compared to non-starved cells (Fig. 2.3). However, the samples starved for 4 hours or more were greatly delayed in the loss of culturability at 4°C when compared to the non-starved samples. After 3 days of cold incubation, when the percentage of culturable cells in the non-starved samples was less than 0.1%, the percentage of culturable cells 93

1.0x1003 1.0x1002 1.0x1001 1.0x1000 1.0x10-01 1.0x10-02 1.0x10-03 1.0x10-04 1.0x10-05 0.0 2.5 5.0 7.5 10.0 12.5 15.0 Time (Days)

Figure 2.2. Culturability of V. vulnificus C7184(T) at 4°C after pre-starvation for carbon or after multiple nutrient starvation.

Exponentially growing cells of C7184(T) were diluted in 2M-CNP and immediately shifted to 4°C (q), or were pre-starved for carbon (G, u) or CNP (∆, s) for 1 hour (open symbols) or 24 hours (closed symbols) prior to cold incubation. Data are presented as percentages of the initial count (1.7 X 106 CFU ml-1) and are representative of three experiments. Error bars represent the 95% confidence interval. 94

in the 4 hour or 24 hour-starved cultures was 22.8% and 78.6% respectively (Fig

2.3). The percentage of non-starved culturable cells had fallen below 0.1% by day 3 whereas, for the 4 hour-starved cells, culturability remained above this level for 11 days. The 24 hour-starved cells still exhibited 0.7% of the initial counts of culturable cells after 13 days (Fig. 2.3).

One and 24 hours of pre-starvation at 24°C for nitrogen resulted in a decline in culturability to 0.25% and 1.5% culturable cells after 3 days of cold incubation, respectively, and to less than 0.01% after 9 days (Fig 2.4). Increasing the time of pre-starvation for nitrogen at 24°C to 72 hours did not allow for maintenance of culturability at 4°C. Thus, cells starved for nitrogen prior to cold incubation displayed a loss of culturability similar to that of non-starved cells irrespective of the duration of starvation.

One hour of pre-starvation for phosphorus resulted in a decline in culturability at

4°C which is indistinguishable from the situation in the absence of starvation;

0.1% remained culturable after 2 days of cold incubation, and 0.001% after 8 days

(Fig 2.5). Starvation for phosphorus for up to 15 hours was observed to have negligible effect, while pre-starvation for 18 hours lead to significantly prolonged culturability at low temperature (Fig. 2.5 and Fig. 2.6). Longer periods of pre- starvation led to further delay in the loss of culturability; when pre-starved for 24 hours, after 2 days of cold incubation at 4°C, approximately 20% and after 10 days approximately 1% of the initial CFU ml-1 was retained (Fig. 2.6). In all 95

0 h 1.0x1004 0.5 h 1 h 2 h 4 h 1.0x1002 6 h 8 h 24 h 1.0x1000

1.0x10-02 0.0 2.5 5.0 7.5 10.0 12.5 15.0 Time (Days)

Figure 2.3. Culturability of V. vulnificus C7184(T) at 4°C after various times of pre-starvation for multiple nutrients (CNP).

Exponentially growing cells were diluted in 2M-CNP and immediately transferred to 4°C or were pre-starved for multiple nutrients for the indicated times. Data are presented as percentages of the initial count (3.0X 104 CFU ml-1) and are representative of three experiments. 96

1.0x1004

1.0x1000

1.0x10-04

1.0x10-08 0.0 2.5 5.0 7.5 10.0 12.5 15.0 Time (Days)

Figure 2.4. Culturability of V. vulnificus C7184(T) at 4°C after pre-starvation for nitrogen.

Cultures were pre-starved for nitrogen at 24°C for 1 hour (G), 24 hours (m) or 72 hours (5), or for multiple nutrients at 24°C for 0 hour (q) or 24 hours (∆), prior to shifting to 4°C. Data are presented as percentages of the initial count (2.5 X

106 CFU ml-1) and are representative of three independent experiments. 97

cases, starved cells maintained at 24°C remained culturable throughout the experiment (Table 2.1, Fig 2.1, 2.5 and 2.6).

Cold incubation experiments were performed at both low and high cell densities.

Cultures were subjected to starvation and cold incubation either undiluted or diluted 1:100 in the respective starvation medium, with final densities of approximately 2 X 108 CFU ml-1 and 2 X 106 CFU ml-1, respectively. No difference in the kinetics of the loss of culturability between the experiments with different cell densities was observed for carbon, nitrogen, or multiple (CNP) starvation (data not shown). In contrast, prolonged phosphorus starvation at high cell densities induces an enhanced rate of loss of culturability at 4°C relative to phosphorus starvation at low cell densities (Fig. 2.7). Thus, it appears that the starvation-induced alteration in the kinetics of VBNC cell formation appears at later times at high cell density. Data from high cell density experiments were used as the basis for the interpretation of the two-dimensional electrophoretic analysis of proteins induced by phosphorus starvation.

2.4.3 Two-dimensional gel analysis of proteins induced after 1 hour of

carbon, nitrogen, phosphorus or multiple-nutrient starvation

Proteins expressed by cells subjected to carbon, phosphorus, nitrogen or multiple- nutrient starvation were detected by pulse-labelling and subsequent two- dimensional gel electrophoresis. In order to compare the protein induction profiles from cells exposed to various starvation conditions, cells were pulse 98

1.0x1003 1.0x1002 1.0x1001 1.0x1000 1.0x10-01 1.0x10-02 1.0x10-03 1.0x10-04 1.0x10-05 1.0x10-06 0 10 20 30 40 Time (Days)

Figure 2.5. Culturability of V. vulnificus C7184(T) at 4°C after pre-starvation for phosphorus for 3-15 hours.

Cultures were pre-starved for phosphorus at 24°C for 1 hour (q), 3 hours (∆), 6 hours (G), 9 hours (m), 12 hours (S) or 15 hours (5), prior to incubation at 4°C.

For comparison, the data from a parallel sample kept at 24°C throughout the experiment in shown (n). Data are presented as percentages of the initial count

(2.2 X 108 CFU ml-1) and are representative of three independent experiments.

Error bars represent the 95% confidence interval. 99

1.0x1003 1.0x1002 1.0x1001 1.0x1000 1.0x10-01 1.0x10-02 1.0x10-03 1.0x10-04 1.0x10-05 0 10 20 30 40 Time (Days)

Figure 2.6. Culturability of V. vulnificus C7184(T) at 4°C after phosphorus pre- starvation for 12-40 hours.

Cultures were pre-starved for phosphorus at 24°C for 12 hour (q), 15 hours (∆),

18 hours (G), 24 hours (m), 40 hours (5). For comparison, the data from a parallel sample kept at 24°C throughout the experiment in shown (S). Data are presented as percentages of the initial count (2.2 X 108 CFU ml-1) and are representative of three independent experiments. 100

1.0x1003 1.0x1002 1.0x1001 1.0x1000 1.0x10-01 1.0x10-02 1.0x10-03 1.0x10-04 1.0x10-05 0 10 20 30 40 Time (Days)

Figure 2.7. Culturability of V. vulnificus C7184(T) at 4°C after pre-starvation for phosphorus for 15-40 hours at high and low cell densities.

Cultures were pre-starved for phosphorus at 24°C for 15 hour (q, n), 18 hours

(∆, s) or 40 hours (G, u) at high (open) or low (closed) cell density. For comparison, the data from a parallel sample kept at 24°C throughout the experiment in shown (m, l). Data are presented as percentages of the initial counts (2.5 X 106 CFU ml-1 for low density and 2.2 X 108 CFU ml-1 for high density experiments) and are representative of three independent experiments. 101

labelled at the same time of starvation for all the conditions explored. Based on the results presented above, the labelling of proteins with [35S]methionine was carried out after 1 hour of starvation at 24°C since both carbon and multiple- nutrient samples starved for 1 hour exhibited a significant effect on the culturability of the cells during subsequent cold incubation. This was the earliest time at which a significant effect was seen and it is likely that proteins involved in this starvation-induced maintenance of culturability (SIMC) effect are produced prior to 1 hour. In addition, cells were also pulse-labelled at 18, 21 and 24 hours of phosphorus starvation, which corresponds to the time of development of prolonged culturability at 4°C by cells starved under these conditions.

The profiles of protein expression under the different starvation conditions were compared with that during exponential growth in 2M medium (Fig. 2.8A) by visual inspection of the autoradiograms. Induced proteins were given a number designation as summarised in Table 2.2. Autoradiograms of representative gels are shown in Fig. 2.8, and an analysis of the proteins induced by the different conditions is depicted in Fig. 2.9.

After 1 hour of starvation, the repression of many proteins was detected, and for each individual starvation condition examined, a specific group of proteins was induced compared to those expressed during exponential growth. Each response consisted of a unique set of induced proteins and subsets common to other conditions. The greatest overlap of induced proteins was observed between the carbon and multiple-nutrient starvation responses, which appeared to be almost 102

identical. The least overlap was detected between phosphorus starvation and any other starvation condition (Fig 2.8). Two of the proteins (33 and 34) were induced after 1 hour under all the starvation conditions examined.

Thirty-four proteins (nos. 1-34) were induced after 1 hour of carbon starvation as well as after 1 hour of multiple-nutrient starvation. The only difference in the protein profiles of these two starvation conditions was protein no. 35, which was specifically induced during multiple-nutrient starvation (Fig 2.8B). Twenty-five

(nos. 1-25) of the induced proteins were unique for carbon and multiple-nutrient starvation. Seven induced proteins (nos. 26-32) were common to carbon, multiple-nutrient and nitrogen starvation.

When the protein pattern displayed by cells after 1 hour of nitrogen starvation was compared to an exponentially growing cell culture, 24 induced proteins could be detected (Fig. 2.8C). Of these, 14 proteins (nos. 36-49) were unique for nitrogen starvation, while the remaining proteins were also induced by other conditions. In addition to the 7 proteins induced during both nitrogen and carbon starvation and the 2 general starvation proteins (see above), 1 protein (no. 50) was common to nitrogen and phosphorus starvation.

Ten proteins were induced after 1 hour of phosphorus starvation. Of these, 7 proteins (no. 51-57) were uniquely induced by phosphorus starvation and 3 (nos.

33, 34, and 50) were also part of other responses, as described above. After 18 hours of phosphorus starvation (Fig. 2.8D), the phosphorus-starvation-proteins 103

Figure 2.8. Autoradiograms of two-dimensional protein gels of V. vulnificus labelled with [35S]methionine.

Cells were labelled during exponential growth at 24°C in 2M medium (A), after 1 hour starvation for carbon, nitrogen and phosphorus (CNP, multiple starvation)

(B), after 1 hour starvation for nitrogen (C) and after 18 hours starvation for phosphorus (D). The pattern induced by starvation for carbon was almost identical to that pattern induced by multiple starvation (B), with the exception of protein no. 35, see Table 2.2 and text), and is thus not shown. The proteins induced after 1 hour phosphorus starvation are all part of the pattern obtained after 18 hours phosphorus starvation see (Table 2.2 and text); an autoradiogram with the protein pattern induced after 1 hour is thus not shown. The gels depicted are representative of duplicates; induced proteins are indicated by arrows numbered according the Table 2.2. The left side of the photographs correspond to the acidic end of the isoelectric focusing gels. On the right margin, the positions of protein molecular mass standards on the gels are indicated. 104

A kDa

94

67

43

30

14

Acidic Basic 105

B kDa 94

67

43

30

Acidic Basic 106

C kDa

94

67

43

30

Acidic Basic 107

kDa D

94

67

43

30

Acidic Basic 108

Table 2.2. Numbering and grouping of starvation-induced proteins of V. vulnificus.

Proteins induced after 1 hour of starvation at 24°C for carbon (C), nitrogen (N), phosphorus (P) or all three nutrients simultaneously (multiple) compared to an exponentially growing culture, are numbered and grouped according to their starvation-induction profile.

Starvation for Proteins induced

C & multiple 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19

20 21 22 23 24 25

C, N & multiple 26 27 28 29 30 31 32

C, N, P & multiple 33 34 multiple 35

N 36 37 38 39 40 41 42 43 44 45 46 47 48 49

N & P 50

P 51 52 53 54 55 56 57 109

N 14 6 CCNP 25 2 1 4 1 1

30 - 35 7

P (18h) P

Figure 2.9. Venn diagram of the numbers of proteins induced after various nutrient starvations.

Proteins induced after 1 hour of starvation (solid circles, bold type) for carbon

(C), nitrogen (N), phosphorus (P) or all three simultaneously (CNP) compared to an exponentially growing culture. Proteins induced after 18 hours starvation for phosphorus are contained within the dashed circle (normal typescript). The analysis is based on the autoradiograms in Fig. 2.8, and has been verified by comparison with the gels of samples from independent experiments. 110

nos. 51-57 were still induced, but the other proteins (nos. 33, 34 and 50) were repressed. Instead, several of the proteins belonging to the nitrogen-starvation- stimulon (nos. 41, 42, 45 and 48) and, in addition, protein no. 27 (also induced after 1 hour of carbon, nitrogen, or multiple starvation), were induced by 18 hours of phosphorus starvation. An additional set of 30 to 35 proteins was detected to be induced at this time; these proteins are not induced after 1 hour of starvation for phosphorus, nitrogen or carbon, and are thus part of the "late" response of phosphorus-starved cells. After 21 and 24 hours of phosphorus starvation (data not shown), the protein patterns were very similar to those obtained at 18 hours; no new proteins could be observed to be induced in addition to those detected at

18 hours, and most proteins remained induced at very similar levels during the subsequent hours of starvation. Some proteins, such as nos. 53 and 57 and several of the "late" group of phosphorus starvation proteins, however, were repressed at 24 hours of starvation for phosphorus (data not shown), indicating that a major part of the response to phosphorus starvation was concluded at this time.

2.5 DISCUSSION

Starvation has been demonstrated to induce a multitude of responses in bacteria

(174, 241, 303, 306, 373, 525). In addition, numerous studies have identified specific protein responders to various starvation conditions (11, 152, 157, 169).

Amy and Morita (11) used 2D-PAGE of starved cells of the marine Vibrio sp.,

Ant-300, to show that the degradation of proteins that occurs upon the induction 111

of starvation was specific, i.e. that certain proteins were degraded while other proteins unique to starvation were synthesised. In this study, the effect of starvation for individual nutrients on the maintenance of culturability of Vibrio vulnificus during cold incubation and the initial phases of starvation by 2D-PAGE of pulse-labelled proteins was examined.

Starvation conditions in batch cultures may be attained in two ways (i) by harvesting and washing cells from log cultures and resuspension in the same medium lacking one or several nutrients, or (ii) by allowing the culture to exhaust one essential nutrient and enter the stationary phase. The first approach has been used in this study to ensure that cell growth ceases quickly and all excreted metabolites, cell components, and intercellular signal molecules etc. are removed.

This results in a more synchronous culture, in which the cells enter starvation simultaneously and ensures that the effects seen are induced by starvation itself and are not due to the presence of metabolites etc.

2.5.1 Starvation survival at 24°C

In V. vulnificus, starvation for carbon, nitrogen or phosphorus, or for all three simultaneously, led to similar survival patterns, as assayed by culturable counts, when the cells were held at 24°C (Fig. 2.1 and Table 2.1). In Vibrio angustum, the most thoroughly studied marine bacterium, starvation for carbon and multiple nutrients leads to the formation of ultramicrocells with maintained culturability, whereas starvation for phosphorus or nitrogen induces abnormal cell morphology, delays recovery and causes loss of culturability (199, 378). Pseudomonas putida 112

KT2442 maintains near complete culturability during carbon and multiple- nutrient starvation, and responds similarly during nitrogen starvation, but appears to be sensitive to phosphorus starvation (157). Protein synthesis and ribosome concentrations are gradually reduced during early phosphorus deprivation, with

ATP levels initially reduced but returning to near-normal during long-term starvation (110). Interestingly, phosphorus limitation in P. putida allows for the development of increased resistance to environmental stresses. Starvation for C,

N, P or CNP in Vibrio anguillarum results in an initial increase in the CFU in the first 6 to 24 hours followed by a decrease in culturable cells counts (361). The morphology of cells of V. vulnificus starved of carbon, phosphorus, nitrogen or multiple nutrients is very similar to that described for cells of V. angustum starved for the same nutrient(s). For example, cells of both species starved for carbon or multiple nutrients are small coccoid cells or short rods while phosphorus starvation results in swollen filaments with several inclusion bodies, which may represent poly-ß-hydroxybutyrate (PHB) granules. Nitrogen starvation results in cells with very irregular morphology ranging from long filaments to swollen or coccoid cells (data not shown). Interestingly, starved cells of V. anguillarum elongate into helical filaments, regardless of the depleted nutrient.

2.5.2 Effects of starvation conditions on culturability at 4°C

In earlier reports, multiple-nutrient starvation prior to cold incubation has been shown to prolong the culturability of V. vulnificus at 4°C, and thus delay the formation of VBNC cells (384, 543). However, the specificity of the limiting nutrient for the development of prolonged culturability during starvation has not 113

been investigated. In this chapter, the effect of starvation for carbon, nitrogen, phosphorus or all three simultaneously on the maintenance of culturability upon subsequent cold incubation in V. vulnificus has been examined. Carbon and multiple-nutrient starvation were almost indistinguishable in their effect on culturability of V. vulnificus during cold exposure (Fig. 2.2). Both gave rise to a significant effect on culturability after one hour of starvation at 24°C, and a pronounced effect after 24 hours. A more in depth study of the time course for the development of SIMC during multiple-nutrient starvation revealed that there is indeed a sequential increase in the maintenance of culturability upon subsequent cold incubation for cells starved for increasing increments of time prior to cold incubation (Fig. 2.3). There is a significant increase for cells that have been starved for 2 hours and again a large increase for cells starved 4 to 8 hours.

Notably, phosphorus starvation was almost as efficient in prolonging culturability of V. vulnificus cells during cold exposure as carbon and multiple starvation, although the response to phosphorus starvation appeared to be delayed (Figs. 2.5 and 2.6). Phosphorus starvation at 24°C for up to 15 hours does not lead to detectable increases in maintenance of culturability at low temperature (Fig. 2.5), while increasing the starvation time to 18 hours does allow for an increase in

SIMC that continues to increase up to at least 40 hours (Fig. 2.6). In fact, it has been shown that Escherichia coli exhibits two distinct responses to phosphorus starvation, inducing one set of genes early during growth in limiting phosphorus medium in response to the external phosphate concentration and another set upon 114

growth rate reduction in response to the internal phosphorus concentration (475).

The acquisition of SIMC only after 15 hours of phosphorus starvation indicates that there are at least two sets of phosphorus-starvation proteins induced in V. vulnificus as well, and it is the later set involved in the SIMC response. This delay for up to 15 hours of both growth arrest (data not shown) and the response leading to maintenance of culturability during subsequent cold incubation (Fig.

2.6) could be due to transient continuation of growth in the absence of external sources of phosphorus by utilisation of phosphorus-containing membrane constituents in analogy to observations in a marine Pseudomonas fluorescens

(326) or due to the utilisation of internal phosphorus reserves such as PHB. In E. coli, phosphorous starvation has been reported to result in the degradation of ribosomes (84) which allows for the redistribution of limited phosphate to DNA, tRNA, phospholipid and lipopolysaccharide fractions. E. coli was also shown to maintain an active metabolism for at least 3 days of phosphorus starvation (149).

Pseudomonas sp. S9 and V. angustum exhibited delayed responses to phosphorus and nitrogen starvation with an increase in respiration (296), suggesting that there is an energy dependent reorganisation of cellular components under these starvation conditions.

Typically, carbon exhaustion commonly causes an abrupt cessation of growth with practically no deceleration phase. However, after nitrogen and phosphorus source depletion, considerable growth may occur due to the mobilisation and relocation of intracellular reservoirs as well as to the accumulation of carbonaceous storage compounds. Both during phosphorus and nitrogen 115

depletion, the carbon source in the medium is continuously metabolised, and a second starvation stimulus is imposed when the carbon and energy source is exhausted (126).

Starvation for nitrogen did not promote prolonged culturability in V. vulnificus during incubation at low temperature, even when the pre-starvation times were extended to 72 hours (Fig. 2.4). From this, we can conclude that the induction of general post-exponential (Pex) proteins does not allow for prolonged maintenance of culturability during cold exposure in V. vulnificus. These Pex proteins have been reported to provide the basis of starvation-induced cross protection in E. coli

(214, 215) and possibly also P. putida (238). It is not known why nitrogen starvation does not allow maintenance of culturability in V. vulnificus, while the survival of the organism in the absence of an external source of nitrogen is not impaired at 24°C (Fig. 2.1 and Table 2.1). The synthesis and turnover of proteins are reported to be unaffected or even increased in nitrogen limited E. coli due to breakdown of ribosomes (292). It is therefore possible that the failure to maintain culturability at low temperature after nitrogen starvation could be due to the inability of the organism to balance amino acid or protein pools in order to prepare the cells for the shutdown of protein synthesis caused by cold stress.

Without a detailed molecular analysis of adaptation processes, however, these interpretations remain speculative. 116

2.5.3 Analysis of protein synthesis during starvation

In order to elucidate the molecular determinants for maintenance of culturability, the analysis of the proteins induced during the initial phases of starvation for the different nutrients was commenced. In this chapter, a set of more than 34 proteins were identified which were induced during 1 hour of carbon- or multiple-nutrient starvation and which might be involved in the maintenance of culturability during cold incubation. As pre-starvation for phosphorus for 18 hours allowed for prolonged culturability analogous to that afforded by 1 hour of carbon starvation, the proteins induced after 18 hours were included in the analysis. Starvation for phosphorus induces a response which is clearly different from that to carbon or multiple-nutrient starvation: ten proteins were induced after 1 hour, and additionally 30 to 35 proteins were induced after 18 hours of phosphorus starvation. In the protein patterns, as visualised by two-dimensional gel electrophoresis, the overlap between the three responses (C, P, and multiple starvation) only comprises proteins which are also induced by nitrogen starvation; after 1 hour 2 proteins and after 18 hours 1 protein (nos. 33, 34, and 27 respectively; Table 2.2, Fig. 2.9). As nitrogen starvation itself did not allow for prolonged culturability at 4°C, it may be concluded that these proteins do not mediate maintenance of culturability of cold incubated cells. It is postulated that the proteins induced by carbon and phosphorus starvation are part of independent responses that allow for maintenance of culturability at low temperature.

Induction patterns similar to those described here have been reported in other bacteria; in E. coli (215), Salmonella typhimurium (476), P. putida (157) and V. 117

angustum (378), sets of unique responders for the individual starvation conditions, as well as overlapping responses, were found. In all cases, a fraction of the protein responders is induced regardless of the starvation condition encountered, and the individual starvation conditions share particular subgroups of induction. It appears as if specific regulators and general regulatory mechanisms interact on many levels in the coordination and modulation of starvation responses. This phenomenon of multi-level regulation may be concluded to exist in several organisms including Vibrio species.

The proteins induced by carbon starvation in V. vulnificus include nearly all proteins induced by multiple starvation, resulting in an almost complete overlap between the two responses, whereas the patterns induced by other conditions overlap only to a minor fraction with the response induced by multiple starvation

(Fig. 2.9). This indicates that carbon starvation determines or dominates the response to multiple starvation in V. vulnificus. In V. angustum, the protein pattern characteristic for multiple starvation does not show any greater resemblance to that characteristic for carbon starvation than it does to those patterns typical for other starvation conditions (378). In addition, in V. angustum a large group of proteins is induced by multiple starvation only, and not by the individual starvation conditions, while we have only detected one such protein in the initial phase of starvation in V. vulnificus. The results obtained for starvation survival, maintenance of prolonged culturability at low temperature and starvation-induced protein synthesis indicate that the starvation responses in V. vulnificus are different from those in V. angustum. This is further supported by 118

the previously reported observation that the induction of stress proteins by carbon starvation is dissimilar in the two Vibrio species (198).

The results reported here constitute the first step in determining the cellular mechanism behind the interaction between starvation and the cold-induced loss of culturability of cells of V. vulnificus. Carbon (or multiple -nutrient) starvation and phosphorus starvation have been identified as conditions that induce maintenance of culturability during cold exposure. The analysis of the patterns of induced proteins has allowed the conclusion that carbon starvation determines the response of the organism to multiple-nutrient starvation, and that carbon and phosphorus starvation may elicit maintenance of culturability via induction of different proteins, indicating the possibility of different specific molecular responses. A better understanding of the physiology and genetic control of the starvation state and its involvement in the maintenance of culturability, and thus in the regulation of the formation of viable but nonculturable cells, will provide us with knowledge that will allow us to better understand the ecology and epidemiology of this pathogen. We propose that the characterisation at a molecular level of the processes leading to the loss of culturability, as well those responsible for the initiation of resuscitation, will facilitate the development of possible control measures.

2.6 ACKNOWLEDGEMENTS

I would like to thank Christine Paluden-Müller and Dieter Weichart for collaboration on this chapter. 119

3 MOLECULAR ANALYSIS OF THE VBNC RESPONSE

3.1 ABSTRACT

This chapter describes two methods for the study of nonculturability in Vibrio vulnificus. The first method assessed the viability of nonculturable cells based on the maintenance of nucleic acids. Low temperature-induced nonculturable cells of V. vulnificus retained nucleic acids for more than 5 months. However, analysis of the nucleic acids extracted from formaldehyde-fixed cells indicated that the nucleic acids in a portion of the VBNC population had degraded. The fraction of nonculturable cells that maintained DNA and RNA structures decreased gradually during cold incubation. After 5 months at 5°C, less than 0.05 % of the cells could be observed to retain DNA and RNA after permeabilisation. It is hypothesised that there are two phases of the formation of nonculturable cells of V. vulnificus: the first involves a loss of culturability with maintenance of cellular integrity and intact RNA and DNA (and thus possible viability), and the second phase is typified by gradual degradation of nucleic acids. A small number of nonculturable cells, however, retain DNA and RNA, and thus may still be viable despite having reduced culturability.

The second method was aimed at identifying genes involved in the VBNC response. Mini-Tn10 transposons containing a promoterless gusA gene, encoding b-glucuronidase (GUS), with a strong Shine-Dalgarno translation initiation site that can act as a promoter-probe transposon for the generation of stable insertion 120

mutants were constructed for use in LacZ positive bacteria, such as V. vulnificus.

The GUS transposons were constructed on suicide delivery systems that allow for the transfer of the transposons to Gram-negative bacteria by conjugation. These transposons were used to generate stable insertion mutants in V. vulnificus. These mutants were evaluated for the induction of gene expression during starvation and cold incubation in order to identify genes that may be involved in the regulation of nonculturability. The viability of those mutants that exhibit an alteration in their VBNC or SIMC responses can be monitored during low temperature incubation via the maintenance of stable RNA and DNA.

3.2 INTRODUCTION

Vibrio vulnificus has been shown to enter the viable but nonculturable (VBNC) state during low temperature incubation (384, 385, 387). Entry into the VBNC state is related to the physiological state of the cells, as stationary phase cells are able to delay entry into the VBNC state (384). This starvation-induced maintenance of culturability (SIMC) has been demonstrated to occur during starvation for carbon, multiple nutrient or long-term phosphorus starvation [Chap.

2 and (402)]. While VBNC cells undergo specific alterations in cellular physiology, the debate as to whether VBNC cells are viable cells capable of resuscitation or are simply dead or dying cells remains. Two of the critical aspects of the VBNC response addressed in this thesis are the determination of viability and the development of methods to allow the identification of determinants of the VBNC response. A better understanding of the physiology and genetic control of the starvation state and its involvement in the VBNC state 121

will provide us with knowledge that will allow us to understand the metabolic aspects, as well as the genetic determinants of nonculturability.

Approximately 1 to 10% of cold-induced nonculturable populations of V. vulnificus display respiratory activity as assayed by the reduction of tetrazolium salts [2-(4-iodophenyl)-3-(4-nitrophenyl)-5-phenyltetrazolium chloride (INT) and cyanoditolyl tetrazolium chloride (CTC)] (167, 436, 574) and retain the capacity for elongation in response to substrate addition as assayed by incubation in the presence of nalidixic acid (246, 247). The lack of respiratory activity and the inability to elongate as observed for the majority of the cells in nonculturable populations may be interpreted as either loss of viability or entry into a state of dormancy (226, 488).

Cellular integrity and the presence of nucleic acids, ribosomes, and machinery for protein synthesis may be considered necessary but not sufficient criteria for viability. The detection of DNA by polymerase chain reaction (PCR) or hybridisation (49, 179, 286), as well as the detection of ribosomal RNA by hybridisation (10, 278) or detection of protein synthesis by means of inducible enzyme activity (370, 417) are techniques that can identify cells as potentially viable. While each of these methods have been used to determine the viability of nonculturable cells, each has its limitations as well (Chapter 1). For example, the detection limits of these techniques do not permit a reliable determination of viability in natural, starved or stressed populations. Therefore, a more sensitive and accurate assessment of viability might be the presence of nucleic acids. 122

The low level of metabolic activity of VBNC cells also hampers global analysis of the cells. Chapter 2 describes the use of two-dimensional PAGE as a method for the identification of proteins responsible for the SIMC response. However, the number of proteins that were identified to have increased expression under

SIMC-inducing conditions was too great for reverse genetics to be of use. In addition, analysis of the VBNC response has proven intractable by two- dimensional PAGE due to the extremely low, or nonexistent, incorporation rates of VBNC cells. Furthermore, protein expression, and thus methionine incorporation, may be impaired or reduced in VBNC cells due to energy or ribosome constraints. Therefore, an alternative to protein analysis is needed to identify the genetic program of the VBNC response.

Transposable elements have been used extensively in bacterial genetics in order to identify genes, to characterise the organisation and regulation of operons, and to facilitate the identification, retrieval, cloning and sequencing of genes of interest

(37). The use of transposons with reporter gene fusions allows for the characterisation of genes that do not produce a readily detectable product, or whose inactivation does not lead to an easily observed phenotype. The use of reporter gene transposons and broad host range plasmids allows for the study of environmentally regulated genes in organisms for which no genetic systems are available.

An appropriate reporter gene requires that there be no detectable background activity in the organism themselves, and that assays are available for its detection that are simple, quantitative, sensitive and affordable. Many environmental 123

bacterial strains, including V. vulnificus, produce b-galactosidase, making the use of lacZ reporter gene constructs unsuitable. The gusA gene, encoding b- glucuronidase (GUS), was originally isolated from Escherichia coli (213) and is found in numerous intestinal bacteria (549), but is not found in many environmental strains of bacteria (550). To date, use of the gusA gene as a marker in bacteria has been largely restricted to plant molecular biology because there is no background activity in plants, although it is now becoming adopted as a reporter gene for microbial ecology, especially in plant-associated bacteria (550).

Numerous substrates are available for use allowing a variety of quantitative, histochemical and selective assays for GUS expression. The substrate 5-bromo-

4-chloro-3-indolyl-b-D-glucuronide (X-GlcA) gives rise to an indigo colour when cleaved by GUS and can thus be used for the screening of bacteria in liquid or on solid media. In addition, there are quantitative assays that rely on coloured (p- nitrophenol glucuronide, pNPG) or fluorescent products (4-methyl umbelliferyl glucuronide, MUG) (358) that can be measured by spectrophotometry.

The use of these two complementary methods allows for the generation of gusA fusions to starvation- and cold-inducible genes, and a simple method for the assessment of viability of these mutants once in the VBNC state. The identification of mutants whose viability is altered during low temperature incubation will provide insight into whether or not the VBNC state is a genetically programmed response or simply an end of life response.

This chapter describes two alternative approaches for the study of nonculturability in V. vulnificus. A simple method to detect DNA and RNA by differential in situ 124

digestion of DNA and RNA and its application to the analysis of VBNC suspensions of V. vulnificus is presented here. Based on results obtained with this method, we propose the existence of two phases of the VBNC state; the first occurring immediately after loss of culturability and characterised by maintenance of cellular integrity, and the second occurring as gradual degradation of nucleic acids with eventual loss of viability in the majority of the nonculturable population. The significance of the results is discussed in terms of the survival of the organism during cold incubation, as well as with regard to the general usefulness of the approach for the study of natural populations. This chapter also describes the construction of a transposable reporter gene for the isolation of mutants with an altered VBNC response. Reporter gene fusions that were induced by starvation and cold incubation have been isolated. These mutants will be assessed for alterations in their VBNC response. Those identified as having and altered response will be assessed for viability profiles while in the nonculturable state with the in situ analysis of DNA and RNA. The in situ analysis of nonculturable cells was a previously published collaborative effort with Dieter Weichart and Daniel Tillett (542).

3.3 MATERIALS AND METHODS

3.3.1 Bacterial stains and plasmids

The Escherichia coli strains and plasmids used in this study and their relevant properties are listed in Table 3.1. Vibrio vulnificus C7184 (both opaque and translucent morphotypes) (394), a clinical isolate, was used for the generation of 125

Table 3.1. Bacterial strains and plasmids

Strain or Description Reference Plasmid or source Strains E. coli CC118lpir araD139 ∆(ara leu)7697 ∆lacX74 ∆phoA20 (189) galE galK thi rpsE rpoB argE(Am) recA1 pir+ BW20767 Smr, (RP4-2 tet : Mu-1kan::Tn7 integrant) tra+ leu-63::IS10 recA1 creC510 hsdR17 endA1 zbf-5 (323) uidA(Mlu1):pir+ thi SM10lpir Kmr, thi-1, thr, leu, tonA, lacY, supE, (325) recA::RP4-2-Tc::Mu, lpir S17-1lpir Tpr, Smr, recA, thi, pro, hsdR-M+ RP4-2- (466) Tc:Mu:Km Tn7, lpir Plasmids pCAM140 Smr/Spr, Apr, miniTn5 SSgusA40 (promoterless gusA for transcriptional fusions) in pUT/mini- (550) Tn5 Sm/Sp) pBSL180 Kmr, Apr, MCS of pBluescript II, mob RP4, ori (4) R6K, miniTn10 pKV32 Apr, Cmr, (promoterless lacZYA inserted into (532) pBSL181) pMac01 Kmr, Apr pBSL180 with ~2 kb insert containing This study gusA from pCAM140 pMac14 pMac01 with the gusA in the reverse orientation [nptII originally from pK18 (accession no. This study M17626) nt 7 to 1174 with SphI and PstI sites removed] 126

Table 3.1. Continued

pMac20 Apr, Cmr, promoterless gusA inserted into pKV32 [cat originally from pBR325 (accession This study no. L08855) nt4358 to 5310, with removal of EcoRI site] 127

transposon mutants. The lpir lysogen, E. coli CC118 (lpir) (189), was used as the routine strain for maintenance of the pir-dependent plasmids. Strains were stored at -70°C in Luria-Bertani (LB) broth (10 g l-1 tryptone (Oxoid Australia

Pty., Melbourne, Vic), 10 g l-1 NaCl, 5 g l-1 yeast extract (Oxoid)) with 30% glycerol (vol/vol) added. Antibiotics were used at the following concentrations: ampicillin, 50 µg ml-1; kanamycin, 50 µg ml-1; colistin, 100 µg ml-1; streptomycin, 100 µg ml-1; and chloramphenicol, 34 µg ml-1.

3.3.2 Media, growth and screening conditions

Growth media were purchased from Sigma (Sigma Chemical Co., St. Louis, MO,

USA), unless otherwise stated. The E. coli and V. vulnificus strains were grown routinely at 37°C with shaking on a rotary shaker (Thermoline Scientific

Equipment Pty. Ltd., Smithfield, NSW, Australia) at 200 rpm. For conjugation experiments, E. coli was routinely grown in LB and V. vulnificus in BHI (brain heart infusion) broth (Oxoid Australia Pty., Melbourne, Vic) with a final NaCl concentration of 2%.

The minimal medium, 2M (402) containing single defined inorganic nitrogen and phosphorus sources (9.25 mM NH4Cl; 1.32 mM K2HPO4), and 0.2 or 0.04% (w/v) glucose as the sole carbon source, was used for the screening of starvation inducible GUS fusions. The chromogenic substrate, 5-bromo-4-chloro-3-indolyl- b-D-glucuronide (X-GlcA) (AGP Trading TA Molecular Bioscience, Upper

Mount Gravatt, Queensland, Australia), used to detect b-glucuronidase activity, 128

was dissolved in N,N-dimethyl formamide and added to plates at a concentration of 50 µg ml-1. For experiments involving the induction of nonculturability, cells of V. vulnificus C7184(T) (394, 469) were grown in DVNSS (402) at 24°C with shaking and harvested in the logarithmic phase of growth by centrifugation at 12

000 X g for 15 min at 15°C (Sorvall RC5B plus centrifuge, SS34 rotor). The cells were then washed and resuspended in the morpholinepropanesulfonic acid

(MOPS)-buffered minimal medium 2M (402), lacking carbon, nitrogen and phosphorus sources (2M-CNP). The cell density after resuspension was between

8 X 107 and 4 X 108 CFU ml-1. The experiments were performed statically at

24°C for starvation, and at 5°C for cold incubation.

3.3.3 Fixation of bacterial cells

Paraformaldehyde fixative [4% w/v; (10)] was prepared as follows. Twenty microlitres of 10 M NaOH was added to 16.5 ml of water, which had been heated to 60°C in a 75 ml flask, followed by 1 g of paraformaldehyde. After dissolution of the paraformaldehyde, 8.3 ml of 3 X PBS (390 mM NaCl, 30 mM NaPO4 buffer, pH 7.2) was added. The solution was cooled to 0°C, adjusted to a pH of

7.2, filter sterilised and used within 24 h.

One-millilitre aliquots of cell culture were harvested by centrifugation at 8,000 X g (Heraeus Sepatech Biofuge 17RS, rotor 1379) at 5°C for 30 min, after which the cell pellets were resuspended in 250 µl of the supernatant. Fresh paraformaldehyde fixative (750 µl) was added, the tubes vortexed for 1 min and left to incubate at 5°C for 20 hours. The cells were pelleted at 8,000 X g and 5°C 129

for 30 min, the supernatant was decanted and the pellet was resuspended in 450 µl of 1 X PBS. Fifty microlitres of 0.1% Nonidet-P40 (NP40) was added and the cells were vortexed, pelleted and resuspended in 0.1% NP40, pelleted again, and resuspended in 30 µl of 2 X storage buffer (40 mM Tris, 0.2% NP40, pH 7.5). An equal volume of 100% ethanol was added and the cells were stored at -20°C.

3.3.4 Hybridisation

Cells were fixed with paraformaldehyde as described above, and hybridised with a fluorescein isothiocyanate (FITC)-labelled eubacterial probe EUB338, directed against the 16S rRNA (155), by standard procedures (10) with the following parameters: probe concentration 2.5 µg µl-1, 30% formamide, and incubation at

37°C for 2 hours.

3.3.5 Permeabilisation of cells

One to two microlitres of the fixed cell suspensions were spread on clean six-well

Teflon-coated glass hybridisation slides (Cel-Line Assoc. Inc., Newfield, NJ,

USA) and allowed to air dry for 1 h. The slides were placed for 2 min in a 50, 90 and 100% ethanol wash series and dried. Slides were cooled to 0°C and 40 µl of ice-cold lysozyme solution (5 mg ml-1 of lysozyme (Boehringer Mannheim,

Germany) in 100 mM Tris-HCl, pH 7.5) added to the cell smear. After 10 min of digestion the slides were washed for 2 min in 0°C TE (10 mM Tris-HCl, 0.1 mM

EDTA, pH 7.5) and for 2 min in a 50, 90 and 100% ethanol series and allowed to air dry. 130

3.3.6 DNA and RNA digestion

Twenty five microlitres of the DNase mixture [2.5 µl of 10 X buffer (100 mM

Tris-HCl, 100 mM MgCl2, 10 mM dithiothreitol, pH 7.5), 2.5 µl 100 mM CaCl2,

2.5 µl of 10 mg ml-1 bovine serum albumin, 5 U of RQ1 RNase-free DNase

(Promega, Madison, WI)], and H20 to 25 µl were added to the permeabilised fixed cells. Individual slides were carefully placed into a 50 ml Falcon tubes containing a small amount of damp tissue paper and incubated at 37°C for 1 h. The RNase digestion was performed as above substituting 25 µl of RNase mix for the DNase

(50 mM Tris-HCl, 10 mM EDTA, 100 µg ml-1 RNase A (Promega), pH 7.5) and added to the cells for 30 min at 25°C. The slides were washed for 2 minutes in

50, 90 and 100% ethanol before staining, which was performed with 10 µg of 4',

6-diamidino-2-phenylindole (DAPI) ml-1 in distilled water for 2 min, followed by washing with 100% ethanol.

3.3.7 Visualisation

Microscopy was performed using an Axioskop epifluorescence microscope (Carl

Zeiss, Oberkochem, Germany) fitted with an HBO 50-W mercury lamp and a 100

X 1.3-numerical-aperture oil immersion lens. Cells were visualised under UV illumination using filter set 10 (Carl Zeiss), and the fraction of stained cells was determined by counting at least 200 cells (in the case of low percentages of stained cells, 2000 cells) per sample. Photographs were taken using Ektachrome

400 film (Eastman Kodak, Rochester, N.Y.). 131

3.3.8 Determination of colony forming units (CFU)

To assess the culturability of C7184(T), samples were taken at indicated times and diluted in 2M-CNP. Drop plate counts (191) were performed on agar plates prepared with DVNSS medium. Plates were incubated for 24 hours at 24°C before the assessment of colony forming units (CFU). Further incubation, up to 7 days, did not result in additional colony formation.

3.3.9 Recombinant DNA techniques

Molecular biology techniques were performed as generally described by

Sambrook et al. (450). Restriction endonucleases, molecular weight markers, alkaline phosphatase and T4 DNA ligase were purchased from Boehringer

Mannheim (Germany) and used according to the manufacturer's suggestions.

Plasmid DNA was isolated by the alkaline lysis method using the QIAFILTER®

Maxi Plasmid kit (QIAGEN, Pty. Ltd., Clifton Hills, Vic., Australia).

Chromosomal DNA extractions were performed as described by Chomcyzynski and Sacchi (71). Briefly, cells were pelleted and the pellet was resuspended in 1 ml guanidinium thiocyanate which had been preheated to 65°C. After lysis of cells, 1 ml of buffered phenol preheated to 65°C was added to the suspension followed by 2.5 ml of chloroform. The solution was mixed vigorously several times while incubated at 65°C. The solution was then placed on ice for 10 min, the aqueous layer removed, and the DNA precipitated with ethanol. DNA was analysed on a 1% agarose gel. 132

For the purification of gel fragments, DNA digested with the appropriate restriction endonuclease was electrophoresed in a 0.7% agarose (preparative grade, Seakem) gel in Tris-acetate (TAE) buffer. The fragment was cut from the gel and the DNA was electroeluted from the gel slice and concentrated by ethanol precipitation. Ligated fragments were used to transform CaCl2 competent E. coli

CC118lpir. For conjugations, plasmids that had been isolated from CC118lpir were transferred to other E. coli strains by transformation.

PCR was performed to verify the orientation of gusA in pMac14 using the primers

KS (5' tcgaggtcgacggtatc) and GA (5' gattgatgaaactgctgc) derived from the multiple cloning site of pBluescript II (Stratagene) and the gusA sequence

(Accession no. M14641) respectively. Primers were purchased from Gibco BRL

(Life Technologies Pty).

3.3.10 Construction of a promoter-probe transposon and delivery system for

generation of stable insertion mutants

A promoter-probe transposon that would allow for the monitoring of gene expression in V. vulnificus was constructed as described in Fig. 3.1. The gusA gene was removed from pCAM140 (550) as a NotI fragment (Fig. 3.1A) and ligated into the NotI site of pBSL180 (4) (Fig. 3.1B). In order for the gusA to function properly as a reporter gene, the insert must be oriented so that insertion of the transposon into the genome allows gusA to be expressed from a native promoter. In order to determine the orientation of the gusA gene in pMac01 (Fig.

3.1C), a HindIII digest was performed (Fig. 3.2). Digestion with HindIII resulted 133

in two fragments of approximately 6.0 and 2.3 kb, which indicates that gusA was oriented as shown in Fig. 3.2B and Fig. 3.1C. Thus, transposition of the cassette will not allow for expression of GUS from a chromosomal promoter. To directionally clone gusA from pMac01 to pBSL180, the reporter gene was removed from pMac01 as an EcoRI-HindIII fragment and religated into the

EcoRI-HindIII sites of pBSL180 as shown in Fig. 3.3. The resulting plasmid, pMac14 was digested with BamHI to determine the orientation of the inserted gusA. Digestion resulted in two fragments of approximately 7.8 and 0.5 kb, which indicated that the insert had the proper orientation. Further verification was obtained by polymerase chain reaction (PCR) using the primers KS (5' tcgaggtcgacggtatc) and GA (5' gattgatgaaactgctgc) derived from the multiple cloning site (Stratagene) and the gusA sequence (Accession no. M14641) respectively. An 800 bp product was obtained when PCR was performed using the KS and GA primers, indicating that the orientation of the gusA gene was correct (Fig. 3.4).

Use of this system in V. vulnificus, resulted in a high background of spontaneous kanamycin resistant colonies, no matter what concentration of kanamycin was used. Therefore, a second delivery system, pMac20, was constructed that carried the chloramphenicol resistance gene on the transposon. The construction of 134

A

NotI digest

EcoRV NH EcoRV B SE NH

gusA

Figure 3.1. The construction of pMAC01.

The gusA gene was removed from pCAM140 as a NotI fragment (A) and ligated into pBSL180 to make pMac01 (B). Arrows indicate direction of transcription and restriction endonucleases are designated as follows: BamHI, B; EcoRI, E; HindIII, H; NotI, N; SnaBI, S. 135

Figure 3.1. Continued

B

C 136

A

IS10 N NH EH IS10 gusA npt II

B

NH NHE IS10 IS10 gusA npt II

Figure 3.2. Digestion of pMac01 to determine orientation of gusA.

The plasmid, pMac01 was digested with HindIII and the resulting DNA fragments were electrophoresed on an agarose gel. The possible orientations of the GUS gene are shown with restriction sites. Restriction endonucleases are designated as follows: EcoRI, E; HindIII, H; NotI, N. The kanamycin resistance cassette is indicated as nptII and the GUS coding region as gusA. If the orientation is as shown in A, digestion with HindIII will result in two fragments of approximately

8.2 and 0.1 kb sizes, while if the orientation is opposite (B), digestion will result in fragments of 6.0 and 2.3 kb. 137

HindIII NotI EcoRI

gusA

HindIII EcoRI

npt lacIq tnp AmpR mobRP4 R6K ori pBSL180

Figure 3.3. Generation of pMac14.

The gusA gene of pMac01 was removed as an EcoRI-HindIII fragment and religated into the EcoRI-HindIII sites of pBSL180 as shown to generate pMac14. Boxes indicate genes and arrows show direction of transcription. The solid boxes indicate the IS10 ends of the transposon (digestion has occurred within the transposon). npt, lacIq and tnp encode for kanamycin resistance, the lac operon repressor and transposase respectively. 138

SK GA KS

MCS gusA MCS

SK GA KS

MCS gusA MCS

PCR

800 bp

Figure 3.4. PCR of the gusA insertion into pBSL180 to generate pMac14.

PCR was performed on the plasmid, pMac14, which resulted from the insertion of gusA into pBSL180 to confirm the orientation of the gusA gene. PCR with the primers KS and GA would result in no product formation if the direction of transcription was as shown in the upper diagram, or an 800 bp product if it was as shown in the lower diagram. An 800 bp product was obtained using KS and GA primers, verifying the direction of insertion. Large arrows indicate the direction of transcription and the smaller arrows indicate primer sequences. 139

A pKV32

ClaI 6.0 kb XbaI

cat lacIq tnp AmpR mobRP4 R6K ori

pMac14

ClaI 2.0 kb XbaI

MCS gusA MCS

Figure 3.5. Construction of pMac20. pKV32 and pMac14 were digested with XbaI and HindIII as shown in (A). The

6.0 kb fragment from pKV32 and the 2.0 kb fragment from the pMac14 digest were gel purified and ligated as shown in (B) to generate pMac20. Filled boxes represent the IS10 ends and the grey box represents the ptac promoter. cat, lacIq, and tnp are genes for chloramphenicol acetyltransferase, the lactose operon repressor and the transposase, respectively. 140

Figure 3.5. Continued

B 141

pMac20 was performed by the removal of gusA from pMac14 as a XbaI-HindIII fragment that was then ligated into the XbaI-HindIII sites of pKV32 (532) (Fig.

3.5). The construction was verified by digestion with ClaI and EcoRI to produce fragments of 1.8 and 6.2 kb, and by PCR with the KS and GA primers as previously described.

3.3.11 Mobilisation and transposition

V. vulnificus C7184(T) and (O) were grown in brain heart infusion (BHI) broth containing 2% NaCl and E. coli BW20767 (pMac20) was grown in LB with the appropriate antibiotics for 16 - 18 hours at 37°C with shaking at 200 rpm. E. coli

BW20767 was washed once in prewarmed LB and allowed to remain stationary

30 min prior to mixing. V. vulnificus was heat shocked at 45°C for 15 min, washed in prewarmed LB and a 1.5 ml cell pellet was resuspended in 50 µl of prewarmed LB. Cell suspensions were mixed (50 µl donor: 150 µl recipient) on a filter (GS Millipore; 0.22 µm pore size) placed on the surface of an LB agar plate.

Control filters containing only donor or recipient cells were also prepared. After incubation at 37°C for 4 h, the filters were placed onto LB plates containing IPTG

(50 µM isopropyl-ß-D-thiogalactopyranoside) to induce transposition. After overnight incubation, the filters were resuspended in 2 ml of 10 mM MgSO4 and

200 µl aliquots plated onto LB agar supplemented with chloramphenicol (34 µg ml-1) or kanamycin (50 µg ml-1) and colistin (100 µg ml-1). To select for stable insertions, transconjugant colonies were transferred by replica plating onto 2M

(glucose concentration of 2 g l-1) and 2M-low glucose (0.4 g l-1) plates containing 142

X-GlcA. Colonies that were white on 2M during growth (before colonies stopped growing) and blue on 2M low-glucose plates, were picked and stored in LB plus

30% glycerol (vol/vol) until further analysis.

3.4 RESULTS

3.4.1 Nucleic acids in VBNC cells of Vibrio vulnificus

The presence of ribosomal RNA in cells of Vibrio vulnificus was monitored as an indicator of viability. Cell samples hybridised with a fluorescently labelled eubacterial 16S rRNA probe EUB338 showed that while growing cells gave strong signals, the signal intensity decreased with incubation time at 5°C. After

12 days, only 10 to 20% of the cells gave strong signals, and more than 50% of cells were not detected (data not shown); after 26 days at 5°C, less than 0.1% of cells could be detected by hybridisation. After 120 days at 5°C, no signal could be detected by microscopy of hybridised samples in any of the cells.

3.4.2 Staining with DAPI after differential digestion with DNase and RNase

Paraformaldehyde-fixed and permeabilised cells were subjected to DAPI staining after in situ digestion of DNA or RNA. After DNase treatment exponentially growing cells were clearly stained (Fig. 3.6B), reflecting the RNA content of the cells. Samples that had been digested with both DNase and RNase showed very little staining, indicating that the permeabilisation and digestion were efficient and that staining with DAPI was specific for nucleic acids (Fig 3.6C). 143

Cells that had been kept at 5°C for 15 - 33 days, at which time the CFU counts were less than 10-5% of the initial population, showed considerable heterogeneity in nucleic acids in fixed and permeabilised cells. After 33 days, about 50% of the population were stained to varying degrees, but the remaining 50% of the cells were unstained (Fig. 3.6D). After treatment with DNase, about 20% of the population were still stained by DAPI (Fig. 3.6E).

All cells in nonculturable populations kept at 5°C for 160 days ("old VBNC cells") were stained by DAPI after fixation with paraformaldehyde and treatment with NP40 as described in the Materials and Methods section (data not shown).

After permeabilisation with lysozyme, however, only a small fraction (about

0.5%) of cells were stained by DAPI (Fig. 3.6F). After DNase treatment of permeabilised cells, less than 0.05% of 160 day old VBNC cells retained DAPI- stainable material (Fig. 3.6G), and after DNase and RNase treatment no staining was observed (data not shown). These results indicate that nucleic acids, and in particular RNA, are degraded prior to fixation in the majority of old VBNC cells, and that only a very small proportion of the populations maintain DNA and RNA during long-term cold incubation.

3.4.3 Degradation of DNA during cold incubation

DNA extracted from samples that had been cold incubated for more than 25 days was compared to DNA extracted from logarithmic phase cells. Logarithmic cells maintained intact chromosomal DNA while the VBNC cells contained degraded 144

Figure 3.6. Epifluorescence microscopic images of DAPI-stained cells of V. vulnificus C7184(T).

Cells of V. vulnificus cells were DAPI-stained during exponential growth (A to

C), after 33 days at 5°C (D and E), and after 160 days at 5°C (F and G). The cells were subjected to fixation with paraformaldehyde and permeabilised with lysozyme as described in Materials and Methods and were subsequently treated with DNase (B, E and G) or with DNase and RNase (C) or left untreated (A, D and F) prior to staining with DAPI. Representative fluorescent (arrow) and nonfluorescent (box) cells are indicated. 145

Figure 3.6. Continued 146

Figure 3.6. Continued 147

1 2 3 4

Figure 3.7. Electrophoretic image of chromosomal DNA extracted from logarithmic-phase and nonculturable cells of V. vulnificus.

Lane 1, molecular weight marker; lane 2, logarithmic-phase cells; lane 3, 30-day- old nonculturable cells; lane 4, 30-day-old nonculturable cells spiked with logarithmic-phase cells prior to extraction. 148

DNA as shown in Fig. 3.7 suggesting loss of viability of a significant portion of the population.

3.4.4 Generation of stable insertion mutants

To further our understanding of the starvation-induced maintenance of culturability (SIMC) and the VBNC response in V. vulnificus, the identification of genes that are uniquely induced in response to carbon starvation and low temperature was initiated. Transconjugants were generated by filter matings as described in Materials and Methods. The E. coli strains SM10lpir (325) and S17-

1lpir (466) were tested for their effectiveness as donor strains as previous reports indicate differential results depending on the recipient strain used. Both of these strains gave similar results when utilised as donor strains in matings with V. vulnificus, however, the strain BW20767 (323) gave superior results (1/3 more transconjugants). This strain was therefore utilised as a donor in subsequent mating experiments. Different growth media were tested for the growth of the recipient strain, specifically LB, LB with 20 g l-1 NaCl, BHI and BHI with 20 g l-1

NaCl were tested. It was determined that either LB with 20 g l-1 NaCl or BHI with 20 g l-1 NaCl gave similar results which were better than LB or BHI alone

(30% more). The effect of growth phase on the ability of V. vulnificus to act as an efficient recipient was also tested. It was determined that there was very little difference between log and stationary phase cells, however when the recipient was subjected to heat shock prior to conjugation, stationary phase cells yielded twice as many transconjugants. Heat shock of the recipient at 45°C for 15 min prior to 149

conjugation greatly increased the number of transconjugants obtained, possibly due to the inactivation of restriction endonuclease systems or DNase activity (133,

451, 452).

The transposase, which is located outside of the transposon on the plasmid (Fig.

3.7B), is under the control of an inducible promoter (Ptac) and therefore, placing filters on plates containing IPTG (50 µM isopropyl-ß-D-thiogalactopyranoside) induces the transposition event. Filters were transferred to plates containing IPTG after 3-4 h incubation, as filters put on plates with IPTG immediately or after 4 h resulted in no transconjugants, no matter how long they were left on the plates with IPTG before resuspension. After resuspension and plating of the filters in 10 mM MgSO4, aliquots were plated onto LB plates containing colistin and chloramphenicol to select for recipient strains carrying the transposon. To verify loss of the delivery vector, transconjugants were tested for loss of the antibiotic resistance carried on the plasmid itself, and then were transferred by replica plating onto 2M (glucose concentration of 2 g l-1) and 2M-low glucose (0.4 g l-1) plates containing X-GlcA. Colonies (about 150 out of 1000) that were white on

2M and blue on 2M low-glucose plates (and were carbon-starvation specific), were picked and stored in LB plus 30% glycerol (vol/vol) until further analysis

(Fig. 3.8). In addition, colonies were plated onto 2M and allowed to incubate for

16 h. The plates were then shifted to 4°C and colonies that turned blue only after the shift were picked and stored (only about 15 colonies of the total tested). Thus, a bank of transposon mutants of V. vulnificus was generated and awaits further analysis for alterations in the VBNC response. 150

3.5 DISCUSSION

To further our understanding of the starvation-induced maintenance of culturability (SIMC) and the VBNC response in V. vulnificus, the identification of genes that are uniquely induced in response to carbon starvation and low temperature was initiated. The use of promoter-probe transposons allows us to identify genes whose promoter is responsive to the environmental conditions of interest, and thereby isolate mutations not otherwise detectable. At the initiation of this study, the molecular tools available for delivery of a suitable reporter gene by transposon mutagenesis in V. vulnificus was not available. We therefore, constructed a delivery vector with appropriate antibiotic resistances carrying a reporter gene that is quantitative and simple to assay, and for which there is no background activity in V. vulnificus.

The transposon used for insertion of the GUS reporter gene into the target cell is derived from the mini-Tn10 system described by de Lorenzo and coworkers (86,

87, 189). Transposition is mediated by the transposase encoded on the plasmid at a site external to the transposon. Since the transposase is not maintained in the target cells, cells are not immune to further transposition rounds and the stability of the insert is improved (37, 540). The suicide plasmids used for delivery vectors

of these transposons contain the vegetative origin of R6K (oriRR6Kg) but lacks the plamid's pir gene, whose product, p, is required for replication initiation (248).

Therefore, replication of the plasmid is only possible in strains that contain pir on a separate replicon. These plasmids also contain the origin of conjugal transfer of plasmid RP4 (oriTRP4), and therefore can be mobilised by the transfer system of 151

that plasmid (325). Escherichia coli strains that have a chromosomally integrated

RP4 are able to provide broad-host-range conjugal transfer functions for these plasmids. With the system described here, the reporter gene can be stably inserted into the chromosome of target Gram-negative bacteria provided the strain is sensitive to kanamycin or chloramphenicol, is able to act as a recipient of RP4- mediated conjugal transfer and can support Tn10 transposition.

Through the use of this system, we were able to generate gusA fusion strains in V. vulnificus. We have a bank of starvation-induced, as well as a few cold-induced insertions (15) in V. vulnificus that will be further characterised. Determination of the phenotypes of these insertion mutants in response to starvation and cold incubation, as well as the identification of those insertions which are also responsive to signals that are produced and released into the supernatant of stationary phase V. vulnificus cells will provide important information on the genetic regulation of the VBNC and SIMC responses. Strains that are identified as having interesting phenotypes will be characterised for their induction patterns in fluorescent assays under various conditions. These assays will be conducted in microtitre plates using the fluorescent substrate MUG (4-methyl umbelliferyl glucuronide).

In this chapter, a new method for the assessment of viability of nonculturable cells of Vibrio vulnificus using the presence of intact DNA and RNA as indicators of potential viability is presented. V. vulnificus serves as a useful model for study as it displays a starvation adaptation response at moderate temperatures, and also 152

Screen for transductants

Selective medium High nutrient Room temperature

Select colonies not Select colonies not induced under high C induced under high C and RT and RT X

Selective medium + substrate

Low nutrient induction Low temperture induction

Screen for loss Screen for of SIMC defective response VBNC response

SIMC VBNC

CFU CFU Mutant

Time Time

Figure 3.8. Isolation of transposon mutants of V. vulnificus.

This model indicates the plan for the isolation of VBNC mutants. Colonies that are white at room temperature and high carbon concentration are screened for induction of GUS activity upon incubation under low temperature or starvation conditions. Those colonies that are induced at low glucose concentration and low temperature will be assayed for changes in their VBNC or SIMC (starvation- induced maintenance of culturability) responses. 153

displays loss of culturability (VBNC response) following a shift to low temperature, thus allowing the study of both responses in the single organism.

Specific in situ staining, or lack of, before or after DNase or RNase treatment demonstrates that DAPI is a reliable stain for nucleic acids. Cold-induced VBNC cells of V. vulnificus retain cellular stability and significant amounts of DAPI- stainable material even after prolonged cold exposure (541). Several days after loss of more than 99.999% of culturability, a significant fraction of the nonculturable population displayed maintenance of DNA and RNA, as detected by DAPI staining and hybridisation with 16S rRNA probes. Both methods indicated considerable heterogeneity among these "young VBNC" cell populations regarding their nucleic acid content. DAPI staining was observed to be more sensitive than hybridisation: less than 0.1% of the cells could be detected by hybridisation after 26 days at 5°C, while 20% of the cells contained RNA detectable by DAPI staining after 33 days of cold incubation (Fig. 3.7E). DAPI readily penetrates fixed cells even without prior permeabilisation with lysozyme while hybridisation with 16S rRNA probes may be limited by the permeability of cells due to the size of the probes employed.

Permeabilisation of paraformaldehyde-fixed nonculturable cells which had been long-term incubated, induced rapid release of DAPI-stained nucleic acids by

99.5% of the population, indicating degradation of DNA and RNA in these cells.

The fraction of the population with detectable DNA and RNA after DAPI staining of fixed and permeabilised cells decreased with incubation time at 5˚C; after 150 154

days at 5˚C, less than 0.05% of the cells gave a signal. Further evidence for the loss of intact nucleic acids was obtained by the extraction and visualisation of nucleic acids by gel electrophoresis. These results indicate progressive, degradation of the chromosome and ribosomes in aged cold-incubated cells.

It has been reported that PCR amplification of species-specific DNA sequences in samples of VBNC cells of V. vulnificus requires more than 10,000 times more extracted DNA than the amplification of the same sequence in samples of growing cells (49). It appears that the degradation of DNA in aged VBNC cells is responsible for the lack of amplification of specific DNA sequences.

Alternatively, the DNA of these VBNC cells may be arranged in a way that precludes staining or detection by PCR amplification, such as the condensation of the nucleoid by DNA-binding proteins. Indeed, both H-NS (348) and Dps (6) have been shown to compact the nucleoid of starving cells.

Degradation of RNA and release of the degradation products has been reported to occur in populations of starved or stressed bacteria (84, 292, 420, 492). In contrast, Vibrio angustum and Pseudomonas putida maintain ribosomes during carbon starvation (127, 157). Furthermore, it is interesting to note that while survival (culturability) of V. angustum and P. putida during carbon starvation is not impaired (157, 199), the loss of ribosomes in these two strains coincides with a moderate or dramatic loss of viability.

In this chapter, it has been shown that DAPI staining of bacterial cells is a sensitive and reliable method for detecting RNA and DNA. Only 0.1% of VBNC 155

cells could be detected by hybridisation methods while more than 20% of cells could be shown to contain detectable amounts of RNA by DAPI staining. Using this technique, we have demonstrated that VBNC cells of V. vulnificus contain significant amounts of DAPI stainable material even after prolonged cold exposure, but that increased cold incubation results in progressive loss of RNA and DNA. Recently similar results have been reported with nonculturable populations of Legionella pneumophila (563). Nonculturable L. pneumophila cells retain intact RNA and DNA (as visualised by gel electrophoresis) which became degraded during long term incubation. The use of differential staining of

DNA and RNA in this study supports our results with V. vulnificus. We conclude that there are two phases of the VBNC state: (i) loss of culturability with maintenance of cellular integrity and intact RNA and DNA (and thus possible viability), and (ii) degradation of RNA and DNA resulting in loss of viability.

Thus, since the majority of long-term cold-incubated cells of V. vulnificus do not contain detectable amounts of intact ribosomes or chromosomes, they may not be viable. The integrity of ribosomes and nucleic acids, however, may be maintained in a small fraction of the population for much longer than would be anticipated based on the ability of the cells to grow and divide and may retain the ability to recover and infect a suitable host. The maintenance of DNA in a population of

VBNC cells indicates that the DNA is in a form capable of being transcribed. The identification of genes induced or repressed upon entry into or exit from the

VBNC state would give insight into regulation of adaptive states in V. vulnificus.

Development of a suitable system for the generation of mutants was thus undertaken. 156

This chapter describes a sensitive method for the evaluation of viability based on the retention of intact DNA and RNA in nonculturable cells, and describes a promoter-probe system that can be utilised to generate transposon mutants in

Gram-negative bacteria. We have determined that there are two phases of VBNC formation with a subpopulation retaining intact DNA and RNA. This subpopulation may therefore be capable of resuscitation and virulence. Analysis of the mutants generated here will make the identification of genes involved in this response possible.

3.6 ACKNOWLEDGMENTS

I would like to thank Daniel Tillett and Dieter Weichart for help with the nucleic acid analysis. I would like to thank the following people for the gifts of strains and plasmids: Barry Wanner for E. coli strain BW20767; Kate Wilson for pCAM140; Mikhail Alexeyev for pBSL180; and Karen Visick for pKV32. 157

4 THE MARINE PATHOGEN Vibrio vulnificus ENCODES A

PUTATIVE HOMOLOGUE OF THE Vibrio harveyi REGULATORY

GENE, luxR: A GENETIC AND PHYLOGENETIC COMPARISON

4.1 ABSTRACT

Vibrio vulnificus is an opportunistic pathogen that exhibits numerous virulence factors, including the secretion of a zinc metalloprotease and the production of a capsule. A homologue of the positive transcriptional regulator, luxR, of the lux operon in Vibrio harveyi, has been clone and sequenced from V. vulnificus. This gene encodes a putative, single complete open reading frame (ORF) designated smcR, which shares greater than 75% nucleotide identity with luxR of V. harveyi.

The deduced amino acid sequence of the putative SmcR protein is more than 90% identical and 95% similar to that of LuxR of V. harveyi, suggesting that V. vulnificus possesses a member of the family of signal-response genes recently described in Vibrio cholerae and in Vibrio parahaemolyticus. The data presented in this chapter demonstrate that, in addition to V. vulnificus, all six Vibrio spp. tested contained genes that hybridised with the luxR probe. Evidence is also presented that this regulatory protein was inherited from a common ancestor, and that the gene is ancient and widespread in marine Vibrio spp.

4.2 INTRODUCTION

It is becoming increasingly apparent that a large number of microorganisms regulate a wide variety of processes, including virulence traits through the use of 158

diffusible extracellular molecules, or signals. The expression of signal-related phenotypes is coordinated by a family of genes that are responsive to the presence and concentration of extracellular signals in the environment. Recently, these autoinduction circuit-regulated genes have been implicated to be important in the regulation of starvation and/or stationary phase gene expression. Vibrio vulnificus was examined for the occurrence of genes involved in signal generation and response because of the expression of numerous virulence factors, such as exoprotease, siderophore, and capsule production, which are known to be dependent on signal-related genes in other organisms. In addition, these phenotypes are induced in stationary phase or under starvation conditions in V. vulnificus, and are thus phenotypes that may be important in the starvation- stress adaptation of this organism.

Vibrio vulnificus is a normal inhabitant of estuarine waters whose numbers are especially high in filter-feeding molluscs. This bacterium is an opportunistic pathogen capable of causing septicemia following ingestion, with fatality rates above 60%, as well as localised infections following wound contamination (388).

Due to the extreme invasiveness of this organism, tissue debridement and/or amputation is often required for treatment of wound infections. Numerous studies have identified possible virulence factors (282, 283, 435) produced by V. vulnificus including a cytolysin (164, 557), siderophores (344, 467), and exoenzymes (335, 395). In addition, it has been determined that the production of capsular polysaccharide is essential for survival of the pathogen within the host

(256, 469), allowing encapsulated strains to resist phagocytosis by 159

polymorphonuclear leucocytes. Likewise, the ability of V. vulnificus to acquire iron from transferrin (467) has been correlated with pathogenicity.

It is now known that an extracellular, metalloprotease (VVP) produced by V. vulnificus facilitates growth of the organism during infection, by digestion of heme-protein complexes thereby allowing the liberation and uptake of heme

(365). In addition, VVP has been shown to enhance vascular permeability and oedematous skin lesions through the release of bradykinin (302) and histamine from mast cells (330). VVP can also specifically degrade type IV collagen (329), thereby disrupting the backbone structure of the basal membrane layer of capillary vessels. Due to its role in invasion and dissemination as well as iron utilisation, it is extremely likely that the V. vulnificus metalloprotease, in addition to capsular polysaccharide, is an important virulence factor.

The V. vulnificus metalloprotease belongs to a family of zinc metalloproteases which includes the Vibrio cholerae HA/protease (HA/P) (173). It has been recently demonstrated that HapR is required for the expression of V. cholerae

HA/P (219). This activator protein is homologous to the LuxR activator protein of Vibrio harveyi. The induction of gene transcription by LuxR depends on the activation of a phosphorelay cascade by a luxS-derived signal molecule.

Likewise, it has been shown that a LuxR homologue (OpaR) controls the production of capsular polysaccharide in Vibrio parahaemolyticus (312). These data suggest that metalloprotease and capsule production are regulated by external signals in V. cholerae and V. parahaemolyticus respectively. Due to the similarities between the V. cholerae HA/P and VVP and capsular polysaccharide 160

production in V. parahaemolyticus and V. vulnificus, the existence of a LuxR homologue in V. vulnificus was examined. This chapter describes the cloning and sequencing of a gene in V. vulnificus, smcR, which is a putative homologue of the positive transcriptional activator, luxR, originally identified in V. harveyi.

4.3 MATERIALS AND METHODS

4.3.1 Bacterial strains and growth conditions

The bacterial strains and plasmids used are listed in Table 4.1. Vibrio vulnificus

C7184(O) was originally isolated from the drainage of a hand wound from a patient in Texas, USA (394). Strains were generally grown in Luria-Bertani (LB) broth (10 g l-1 tryptone (Oxoid Australia Pty., Melbourne, Vic), 10 g l-1 NaCl

(Sigma Chemical Co., St. Louis, MO, USA), 5 g l-1 yeast extract (Oxoid)) or LB agar with 15 g l-1 agar (Research Organics Inc., Cleveland, OH, USA) added.

Strains were grown at 37°C in the case of Escherichia coli strains, V. vulnificus and Vibrio cholerae, or 30°C for other Vibrio strains. Liquid cultures were grown overnight with shaking on a rotary shaker (Thermoline Scientific Equipment Pty.

Ltd., Smithfield, NSW, Australia) at 200 rpm. Ampicillin (Boehringer

Mannheim, Germany) was added at a final concentration of 50 µg ml-1 when used. For the screening of fragments cloned into pUC19, 5-bromo-4-chloro-3- indolyl-ß-D-galactopyranoside (XGal) (AGP Trading TA Molecular Bioscience,

Upper Mount Gravatt, Queensland, Australia) was added to plates at a concentration of 50 µg ml-1. General chemicals were purchased from Sigma. 161

Table 4.1. Bacterial strains and plasmids

Strain or Plasmid Description Reference or source Strains E. coli DH5a supE44 DlacU169 (f80lacZ∆M15)hsdR17 (172) recA1 endA1 gyrA96 thi-1 relA1 XLI Blue recA1 endA1 gyrA96 thi-1 hsdR17 supE44 (53) relA1 lac [F proAB lacIqZDM15 Tn10(tetr)] V. alginolyticus Marine isolate ACMM1 AB V. anguillarum Laboratory 2129 stock V. angustum Marine isolate (206) S14 V. cholerae Laboratory 021001 stock V. fischeri (447) MJ-1 V. harveyi Prawn isolate ACMM 47-6661 V. harveyi Prawn isolate ACMM 642 V. vulnificus Human wound isolate (394) C7184 Plasmids r pUC19 Ap , multiple cloning site, plac promoter (566) fused to the a peptide of ¢LacZ pMacR Apr, pUC19 with ~1.5 kb insert containing This study the V. vulnificus smcR Table 4.1 cont. 162

pMacR1 Apr, pUC19 with ~2.0 kb insert containing This study the 5' end of V. vulnificus smcR pMacR2 Apr, pUC19 with ~2.2 kb insert containing This study the 3' end of V. vulnificus smcR

1ACMM, The Australian Collection of Marine Microorganisms, James Cook

University of North Queensland, Townsville, Australia 163

pMacR consists of a DNA fragment of approximately 1.5 kb containing the smcR gene of V. vulnificus cloned into the dephosphorylated SmaI site of pUC19. This plasmid was used for the sequencing of the smcR gene.

4.3.2 DNA techniques

Molecular biology techniques were performed as generally described by

Sambrook et al. (450). Restriction endonucleases, agarose, molecular weight markers, alkaline phosphatase and ligase were purchased from Boehringer

Mannheim. Plasmid DNA was isolated by the alkaline lysis method using the

QIAFILTER® Maxi Plasmid kit (QIAGEN, Pty. Ltd., Clifton Hills, Vic.,

Australia). Chromosomal DNA was isolated using a modified xanthogenate method of DNA extraction (516). Briefly, cells were lysed at 65°C in a buffer of potassium ethyl xanthogenate (Fluka Chemika) and phenol (1:1), followed by extraction with phenol:chloroform and ethanol precipitation of the DNA.

4.3.3 Southern hybridisation with a Vibrio cholerae hapR probe

A probe for the detection of Vibrio harveyi luxR homologues was generated by amplifying the hapR gene from V. cholerae using the following primers (luxRfor

5’ tggcattggccgtggtgg; luxRrev 5’ ggtcacacacttcaccac). PCR conditions were as follows: 97°C for 30 sec, 50°C 30 sec and 70°C for 30 sec for 25 cycles. The purified 370 bp PCR product was digoxigenin (DIG)-labelled (Boehringer

Mannheim) by PCR-labelling using the same primers and was subsequently used as a probe in Southern hybridisations. Chromosomal DNA was prepared from V. 164

vulnificus, V. harveyi, V. cholerae, Vibrio anguillarum, Vibrio alginolyticus,

Vibrio angustum and E. coli, digested with the enzyme EcoRI and electrophoresed on a 0.7% agarose gel in Tris-borate buffer. The DNA was transferred to Hybond N+ membranes (Amersham Life Science) using a Bio-Rad vacuum blotter (Model 785, Bio-Rad, Richmond, CA, USA). Hybridisation was performed at 50°C for 18 hours in a high SDS hybridisation buffer (7%

NaDodSO4; 1 mM EDTA; 0.5 M NaHPO4, pH 7.0) (74). After post-hybridisation washes, detection of the hybridised probe was carried out according to the manufacturers recommendations using an anti-DIG antibody conjugated to alkaline phosphatase and the chemiluminescent substrate, CSPD (Boehringer

Mannheim), and was visualised by autoradiography using X-Omat AR film

(Eastman Kodak Co., Rochester, NY).

4.3.4 Isolation of the Vibrio harveyi luxR homologue from Vibrio vulnificus

For the isolation of a luxR homologue from V. vulnificus, chromosomal preparations were digested with SalI and electrophoresed on a 0.7% agarose gel in

Tris-borate buffer. The gel containing the digested DNA was sliced into 15 fractions, the DNA electroeluted from the gel slices and concentrated by ethanol precipitation. The reconstituted DNA fractions were electrophoresed on a 0.7% agarose gel, transferred to a nylon membrane (Hybond N+, Amersham Life

Science) by vacuum blotting and hybridised as described above. The hybridisation-positive fraction was ligated into the dephosphorylated SalI site of pUC19 (566) and transformed into chemically competent E. coli DH5a cells.

Transformants were transferred to nylon membranes and prepared for colony 165

hybridisation using the hapR probe. Plasmids from positive colonies were collected, digested with SalI, and a Southern blot of the digested clones was performed to confirm the positive clones. The smcR gene was cloned by using primers based on luxR from V. harveyi (luxR2for 5’ gcgtagtgtatcattccgc; luxR2rev

5’ acgaagtggcgacattcc) to amplify an approximately 1.5 kb fragment from V. vulnificus genomic DNA (Fig. 4.3). This PCR fragment was blunt-end cloned into the dephosphorylated SmaI site of pUC19 to generate the plasmid pMacR.

4.3.5 DNA sequencing and analysis

Nucleotide sequencing was performed by dideoxynucleotide sequencing using the

ABI Big-Dye sequencing system and a fluorescent automated DNA sequencer

(model ABI 377, PE Applied Biosystems, Foster City, California, USA) by the

Automated DNA Analysis Facility at the University of New South Wales,

Sydney, Australia. The nucleotide sequence of both DNA strands was determined by primer-walking of the clone, pMacR, using synthetic primers

(Pacific Oligos, Lismore, New South Wales, Australia). Sequence assembly, analysis and alignments were performed with DNA Star® software (Lasergene,

LaJolle CA, USA). Synonymous and nonsynonymous site substitution analyses and the construction of phylogenetic trees was performed with MEGA software

(260). The Basic Local Alignment Search Tool (BLAST) (7) was used to search the nonredundant sequence database for homologous sequences. Aligned sequences were manipulated for presentation using SeqVu software (147). The nucleotide sequence of the V. vulnificus smcR gene has been deposited in

GenBank under accession no. AF204737. 166

4.4 RESULTS

4.4.1 Identification of luxR homologues in Vibrio species

Hybridisation results using the Vibrio cholerae hapR gene as a probe indicated that all seven of the Vibrio strains tested contain single, specific fragments that hybridised with the hapR probe (Fig. 4.1). This would suggest that these strains possess genes that are highly similar to luxR and that the luxR gene is widely dispersed in the marine Vibrios. This probe did not hybridise to DNA from

Escherichia coli DH5a. Because the EcoRI fragment from Vibrio vulnificus was too large for convenient cloning, further chromosomal digests were performed with a range of enzymes to identify luxR fragments of smaller sizes. Using

BamHI, PstI, and SalI, to digest chromosomal DNA for Southern hybridisations, it was determined that all three enzymes produced specific bands that hybridised with the hapR probe (data not shown). Of these, only the SalI gave fragments small enough for cloning. Two fragments of 2.0 and 2.2 kb were detected (data not shown) and subsequently cloned into pUC19. Colony hybridisations of V. vulnificus chromosomal DNA fragments cloned into pUC19 and transformed into

E. coli identified twenty possible clones. Subsequent Southern hybridisation of the extracted plasmids confirmed that five of the clones contained putative luxR homologues from V. vulnificus. Sequence analysis of those five clones indicated that the SalI had cut the gene near the middle of the coding sequence of the putative luxR homologue and that two of the clones, pMacR1 and pMacR2, contained either the 5' or 3' regions respectively of the gene. To generate a near 167

Figure 4.1. The identification of V. harveyi luxR homologues in Vibrio spp.

Using a DIG-labelled PCR fragment of the V. harveyi luxR homologue, hapR from V. cholerae, EcoRI digests of chromosomes were probed for the presence of luxR homologues. Lanes 1, V. cholerae; 2, V. harveyi 642; 3, V. harveyi 47-6661;

4, V. vulnificus C7184; 5, V. angustum S14; 6, V. anguillarum; 7, V. alginolyticus;

8, E. coli DH5a. The molecular weights of fragments are given at the left hand side and are based on the migration of fragments from a HindIII digest of Lambda

DNA. 168

full-length clone of the smcR gene, the smcR region was amplified using the luxR2 primers and then blunt-end cloned into the SmaI site of pUC19 to generate the plasmid pMacR.

4.4.2 Sequence analysis

Sequencing of the approximately 1.5 kb insert of pMacR revealed a gene that had a single open reading frame, capable of coding for a 205 amino acid protein (Fig. 4.2). Sequence alignments of the open reading frame (ORF) indicated that the cloned V. vulnificus gene shared 90, 80.3, and 70% nucleotide identity with the luxR homologues from Vibrio harveyi (accession no. M55260 / M37905) (464), Vibrio parahaemolyticus (accession no. AF035967) (312) and V. cholerae (accession no. AF00716) (219) respectively (Table 4.2). Approximately 10 bp upstream from the ATG codon, a consensus ribosome binding site, “aaggaa”, and potential –10 and –35 boxes which share strong homology to sigma 70 promoters were identified (Fig. 4.2). While the presence of these sites suggests a position for the initiation of transcription, the start site has not yet been identified experimentally. The position of these sites is also similar to that found in V. harveyi and V. parahaemolyticus. Sequence analysis of the 5 and 3 prime termini of the clone indicated similarity to the htp and the lpd genes (data not shown) from V. parahaemolyticus (312) suggesting that the organisation of the putative V. vulnificus luxR homologue is the same as that observed for V. parahaemolyticus (Fig. 4.3). A comparison with the genome of V. cholerae indicates that there is a copy of the htp gene that lies in close proximity to the hapR gene (data not shown), which suggests that the genetic organisation of the 169

Figure 4.2. DNA sequence of the V. vulnificus smcR gene.

The nucleotide sequence of smcR. The location of the open reading frame (ORF) is marked, and the amino acid sequence encoded by the smcR gene is shown above the DNA sequence. The direction of transcription is shown by an arrow.

The –35 and –10 of the putative smcR promoter are boxed and the putative Shine-

Dalgarno (SD) ribosome-binding site is in bold. Inverted repeats are indicated by horizontal arrows. The possible DNA-binding region is shaded. The stop codon is indicated by the asterisk. The smcR sequence has been deposited in GenBank under the accession no. AF204737. 170

GTGCCAGTGCAATACGCTATTTACTATCACACCAATAAACGAGATCTCGATGCCAATTTA

AATAAAAGTTGCTCAAGATAGATATCAATATTGACATTACTGTTCATTTATTCACCATAA -35 -10 GTTATTGACCCAATGCATATCGCACCATTACACTCATGGAGCTAAAAGCAATTATTAAAA SD CAATCAATAGGAACAGTTAAGCCGTTCCATTTTATATAAAAACAACTCATTGGTAAGGAA ORF

M D S I A K R P R T R L S P L K R K ACAACCTATGGACTCAATCGCAAAGAGACCGCGAACTCGCTTATCTCCGCTAAAACGTAA

Q Q L M E I A L E V F A R R G I G R G G ACAGCAGCTCATGGAAATTGCACTGGAAGTGTTTGCTCGTCGTGGCATTGGCCGTGGTGG

H A D I A E I A Q V S V A T V F N Y F P TCACGCAGACATCGCTGAAATTGCGCAAGTTTCTGTGGCGACCGTCTTCAACTACTTCCC

T R E D L V D E V L N H V V R Q F S N F AACTCGCGAAGATCTTGTAGACGAAGTGCTTAACCATGTCGTTCGTCAGTTTTCTAATTT

L S D N I D L D L H A K E N I A N I T N CCTATCTGACAACATCGATTTGGATCTTCACGCTAAAGAAAACATCGCCAACATCACCAA

A M I E L V V Q D N H W L K V W F E W S CGCAATGATTGAGCTTGTGGTGCAAGACAATCACTGGTTGAAAGTTTGGTTCGAGTGGAG

A S T R D E V W P L F V T T N R T N Q L TGCGTCGACGCGTGATGAAGTTTGGCCTCTGTTTGTCACCACCAACCGTACTAATCAATT

L V Q N M F I K A I E R G E V C D Q H N GCTGGTACAAAACATGTTCATCAAAGCCATTGAGCGTGGTGAAGTGTGTGACCAACACAA

P E D L A N L F H G I C Y S L F V Q A N CCCAGAAGATTTGGCGAACTTGTTCCACGGCATTTGTTACTCGCTGTTTGTTCAAGCAAA

R T N N T A E L S K L V S S Y L D M L C CCGTACCAACAATACCGCAGAGCTCAGCAAACTGGTCAGCAGCTACTTAGACATGCTATG

I Y K R E H E * CATCTATAAACGCGAGCACGAATAACACCAGTAACCTCATATCAAGGTTGGCTACGGCCA

ACCTTTTTTGTGTCAGCGCAAAACGTGGGGC 171

Table 4.2. Percent identities, similarities for DNA and protein

V. vulnificus V. harveyi V. parahaemolyticus V. cholerae V. vulnificus ___ a79 80.3 70

V. harveyi 92b (95)c ___ 84.5 72.1

V. parahaemolyticus 92 (94) 96 (97) ___ 71.5

V. cholerae 72 (85) 71 (85) 72 (86) ___

aPercent nucleotide identity bPercent amino acid identity is shown in bold cPercent amino acid similarity is shown in parentheses 172

luxR homologues is conserved in these species. Analysis of the putative protein encoded by the ORF indicated that the V. vulnificus homologue was 92, 92 and

72% identical and 95, 94, and 85% similar respectively to the LuxR proteins from

V. harveyi, V. parahaemolyticus and, V. cholerae (Table 4.2 and Fig. 4.4).

Alignment of the four homologues indicated that only the V. cholerae protein contains significant differences in amino acid sequence and these differences cluster around two regions at positions 90-110 and 155-185 (Fig. 4.4). Based on sequence identity and genetic organisation, it is believed that a gene cloned and sequenced from V. vulnificus, smcR, is a putative homologue of luxR, the positive transcriptional activator found in V. harveyi.

4.4.3 Phylogenetic analysis of smcR and other luxR homologues

Due to the high percentage of sequence similarity and the occurrence of a luxR gene in all Vibrio spp. tested, we were interested in investigating whether the genes were stably inherited from mother cell to daughter cell or if they were recently acquired through lateral transfer, for example as part of a mobile genetic element, such as the pathogenicity islands of V. cholerae. To investigate this hypothesis, synonymous and nonsynonymous site substitution analyses were performed on the available luxR homologues, rates of evolutionary change were calculated and phylogenetic trees were constructed based on these comparisons.

Nucleotide identity and amino acid identity and similarity (Table 4.2) indicate that smcR is most closely related to opaR and luxR and is most distantly related to the hapR of V. cholerae. The phylogenetic tree based on amino acid sequences 173

Sal I

ORF 1 smcR ORF 2

Figure 4.3. Genomic organisation of the smcR gene.

The solid line indicates the regions which were sequenced. Arrows point in the direction of transcription of the coding regions. ORF 1 shows similarity to hpt of

V. parahaemolyticus while ORF 2 shows similarity to lpd. Open arrows indicate the luxR2 primers used to clone the full-length gene. The hatched bar indicates theprobe used for Southern hybridisation. The SalI site is indicated on the figure. 174

(Fig. 4.5) shows a topography that is similar to trees based on 16 S rRNA analysis (521) where V. harveyi and V. parahaemolyticus cluster closely together, with V. vulnificus as the nearest neighbour and that V. cholerae is the most distantly related of the four bacteria. Thus the evolutionary distances between the luxR homologues are consistent with the vertical transmission of genetic elements. Similarly, the rates of change at synonymous sites (Table 4.3) do not support the hypothesis that the luxR homologues have been recently disseminated by horizontal transfer. In fact, the average rate of change for these luxR homologues is approximately 0.15 changes per synonymous site per million years which is close to the average rate of change for genes common to E. coli and

Salmonella typhimurium (461). It is interesting to note that the rate of change between luxR of V. harveyi and opaR of V. parahaemolyticus is much higher, 0.4-

0.6, although the significance of the high rate of change is unclear at this time.

This data, in conjunction with the similar organisation of the flanking regions in

V. vulnificus and V. parahaemolyticus would indicate that a luxR homologue was present before these species diverged, that luxR homologues are likely to be ubiquitous in Vibrio species and that those species lacking a homologue most likely have lost that gene since their divergence from a common ancestor. This hypothesis is further supported by the hybridisation of a DNA fragment from

Vibrio anguillarum, Vibrio angustum and Vibrio alginolyticus with the hapR probe. 175

SmcR 1 M D- S I A K R P R T R L S P L K R K Q Q L M E I A L E V F A R R LuxR 1 M D- S I A K R P R T R L S P L K R K Q Q L M E I A L E V F A R R OpaR 1 M D- S I A K R P R T R L S P L K R K Q Q L M E I A L E V F A R R HapR 1 M D A S I E K R P R T R L S P Q K R K L Q L M E I A L E V F A K R

SmcR 33 G I G R G G H A D I A E I A Q V S V A T V F N Y F P T R E D L V D LuxR 33 G I G R G G H A D I A E I A Q V S V A T V F N Y F P T R E D L V D OpaR 33 G I G R G G H A D I A E I A Q V S V A T V F N Y F P T R E D L V D HapR 34 G I G R G G H A D I A E I A Q V S V A T V F N Y F P T R E D L V D

SmcR 66 E V L N H V V R Q F S N F L S D N I D L D L H A K E N I A N I T N LuxR 66 E V L N H V V R Q F S N F L S D N I D L D I H AR E N I A N I T N OpaR 66 E V L N H V V R Q F S N F L S D N I D L D I H AR E N I A N I T N HapR 67 D V L N F V V R Q Y S N F L T D H I D L D LD V KT N LQT V CK

SmcR 99 AM I E L V V Q D N H W L K VW F E W S A S T R D E VW P L F V T LuxR 99 AM I E L VS Q D C H W L K VW F E W S A S T R D E VW P L F V T OpaR 99 AM I E L VS Q D C H W L K VW F E W S A S T R D E VW P L F V S HapR 100 E M V K L AMT D C H W L K VW F E W S A S T R D E VW P L F V S

SmcR 132 T N R T N Q L L V Q N M F I K A I E R G E V C D Q H N P ED L A N LuxR 132 T N R T N Q L L V Q N M F I K A I E R G E V C D Q H E P EH L A N OpaR 132 T N R T N Q L L V Q N M F I K A I E R G E V C D Q H D S EH L A N HapR 133 T N R T N Q L L IR N M F M K AM E R G E L C EK H DV DN M A S

SmcR 165 L F H G I C Y S L F V Q A N R TNNT A E L S K L V S S Y L D M L LuxR 165 L F H G I C Y S I F V Q A N R SKSE A E L TN L V S A Y L D M L OpaR 165 L F H G I C Y S L F V Q A N RFKGE A E LK E L V S A Y L D M L HapR 166 L F H G I F Y S I F L Q V N R LGEQEA V Y K L AD S Y L N M L

SmcR 198 C I Y K R E HE LuxR 198 C I YN R E HH OpaR 198 C I YN R E H HapR 199 C I Y K--N

Figure 4.4. Protein alignment of V. vulnificus SmcR with V. harveyi LuxR, V. parahaemolyticus OpaR and V. cholerae HapR.

Shaded regions indicate homology of 90% or greater, while the outlined regions

indicate 100% identity. 176

Table 4.3. Rates of change at synonymous sites (per million years) for luxR homologues

V. harveyi V. parahaemolyticus V. cholerae

V. vulnificus 0.1865 0.203 0.138

V. harveyi ___ 0.4 - 0.6* 0.1

V. parahaemolyticus ______0.099

*rate is based on an average time of divergence from Kita-Tsukamoto et al. (239) and Urakawa et al. (521). 177

Figure 4.5. Phylogenetic tree based on synonymous site substitutions of luxR homologues.

Evolutionary distances for luxR homologues were calculated based on synonymous site substitutions using the Jukes-Cantor calculation in the MEGA program (260). The phylogenetic tree was generated using the Neighbor-Joining method in the MEGA program. The distances for branch lengths are presented along each branch. 178

4.5 DISCUSSION

This chapter reports the identification and characterisation of smcR from Vibrio vulnificus, which is a putative homologue of the luxR gene from Vibrio harveyi.

Furthermore, it is reported that this gene may be widespread in marine Vibrio species, as positive hybridisation to a Vibrio cholerae probe was obtained with all

7 Vibrio spp. tested. The newly identified gene shares strong identities at both the nucleotide and amino acid levels to the V. harveyi luxR homologue, suggesting that the gene has either been functionally conserved or recently disseminated by horizontal transfer amongst the Vibrios. Phylogenetic analyses and rates of evolutionary change at synonymous sites of the open reading frames of the luxR homologues from V. harveyi, V. vulnificus, V. cholerae and Vibrio parahaemolyticus suggests that these genes were present prior to the divergence of this group of bacteria, thus it follows that the gene was present at least in the most recent common ancestor of these strains. The phylogenetic tree based on the amino acid sequences of the LuxR homologues closely resembles that based on the 16S rRNA tree, with V. harveyi and V. parahaemolyticus clustering closely together, V. vulnificus as the nearest neighbour and V. cholerae the most distantly related. The LuxR protein homologues show the least amount of divergence in an area containing a putative helix-turn-helix domain (positions 21 to 67) which is required for DNA-binding, suggesting that these proteins may bind to similar promoter sites in the genes that they regulate. Alignments indicate that amino acid residues in this helix-turn-helix region show homology to the tetR family of repressor proteins. This helix-turn-helix region is conserved in the tetR family of 179

bacterial regulatory proteins and crystallography data has demonstrated it to be a

DNA-binding domain (190). Interestingly, all other members of the tetR family act as repressor proteins, while the LuxR homologues appear to function as activators, although it has been shown that LuxR represses transcription from its own promoter (68). Whether LuxR is an exception within the TetR family, or whether it remains to be demonstrated that LuxR may function as a repressor as well, is still yet to be confirmed. Indeed, recent evidence indicates that the SmcR in V. vulnificus acts as both a repressor and activator (see Chapters 5 and 6).

Not only are the nucleotide sequences of these homologues very similar within the luxR ORFs, but the amino- and carboxy-terminal translated regions also share significant homology. All four of the luxR homologues reported thus far have a divergently transcribed homologue of hpt (hypoxanthine ribosyltransferase) located upstream of the ORF. The region downstream of the ORF shows more variation. In V. harveyi the ORF is followed by 20 repeats of a 7 bp sequence

(464), while in V. cholerae the ORF is followed by a single copy of a 128 bp enterobacterial repeat intergenic consensus (ERIC) sequence. However, sequence comparison with the genome of V. cholerae indicates that there is a putative homologue of the lpd gene although its position in relation to hapR is unknown

(data not shown). In V. vulnificus and V. parahaemolyticus (312), the ORFs are followed directly by a homologue of lpd (dihydrolipoamide dehydrogenase).

Each of the three previously identified homologues, LuxR, HapR, and OpaR, have been demonstrated to regulate different phenotypes. Jobling and Holmes

(219) noted that the promoter region for the metalloproteases found in V. 180

cholerae, hap, and V. vulnificus, vvp, are highly conserved. Interestingly,

Swartzman and Meighen (498) identified two DNA-binding regions in the promoter region of the lux genes of V. harveyi which they demonstrate are bound by LuxR. This conserved sequence was not found in the Lux boxes where LuxR has been shown to bind to its own promoter or in the promoter region of the hap gene of V. cholerae suggesting that the HapR is capable of binding to other promoter regions. Similarly, a search of the promoter region of vvp gene from V. vulnificus, did not identify a LuxR binding consensus sequence, suggesting that the identification of phenotypes regulated by these signal response regulators will require the use of mutants (see Chapters 5 and 6).

It is becoming increasingly clear that signal-mediated communication plays an important role in gene regulation in bacteria, where phenotypes ranging from fruiting body formation and sporulation to the expression of virulence traits have been demonstrated to be regulated by extracellular factors. While signalling molecules have long been recognized in some Gram-positive bacteria, the genes responsible for signal production and response were quite divergent and not ubiquitously spread. The identification of N-acyl-homoserine lactone (AHL) signals and the associated family of AHL genes in Gram-negative bacteria has led to a renaissance in the field of bacterial signalling. This was primarily due to the apparent widespread occurrence of the AHL signals that allowed information derived for one system to be applied to and compared with the data from another system. However, Bassler et al. (28) have demonstrated that a wide range of bacteria produce extracellular factors that modulate phenotypic expression via the 181

system 2 signalling pathway in V. harveyi. This data is in agreement with the suggestion by Surette et al. (496) who, based on database searches of partial and complete genome sequences, identified homologues of the signal synthase gene of V. harveyi, luxS, in bacteria including V. cholerae and in strains as distantly related as Enterococcus. Thus, the identification of luxR homologues in a range of marine bacteria [(219, 312, 464), this study] and the identification of putative luxS genes in marine bacteria and non-marine bacteria [(496) and this study], would support the notion that the non-AHL signalling system is one of the most widespread signalling systems identified to date.

This chapter reports the presence of signal system 2 genes in a number of marine

Vibrio spp. and suggest that this family of signal-dependent genes may in fact be even more highly conserved and widespread than the AHL class of signalling genes. Investigation of the regulatory role played by SmcR and extracellular factors in V. vulnificus and the identification of phenotypes regulated by them will provide insight into the population-regulated phenotypes of this marine organism.

4.6 ACKNOWLEDGMENTS

I would like to thank Scott Rice for help with all aspects of this chapter, especially with the phylogenetic analysis. I would also like to thank Sujatha

Srinivasan for help on the Southern hybridisations of Vibrio species. 182

5 GENERATION OF A SmcR MUTATION IN Vibrio vulnificus AND

ITS EFFECT ON VIRULENCE

5.1 ABSTRACT

Vibrio vulnificus produces an extracellular factor that stimulates luminescence in the Vibrio harveyi signal system 2 reporter strain, which suggests that V. vulnificus has an AI-2 signalling system. In order to examine the significance of the AI-2 signalling system in V. vulnificus, a smcR mutant, which is the homologue of the V. harveyi luxR, was generated. A null mutation in smcR resulted in hypermotility, increased fimbriation, increased biofilm formation, and early expression of alkaline phosphatase and protease as well as increased final amounts of activity of the enzymes in stationary phase. In addition, a signal antagonist was shown to inhibit protease production and but not production of the signal itself. These results demonstrate the occurrence of a signal system 2 in V. vulnificus that is involved in the regulation of certain virulence factors. The fact that the smcR mutant is impaired in the timing of stationary phase gene expression suggests that the AI-2 system may play an important role in the regulation of stationary phase phenotypes.

5.2 INTRODUCTION

Vibrio species are widely distributed in aquatic environments, especially in coastal, tropical or temperate waters. Vibrio vulnificus is ubiquitous in tropical 183

and temperate oceans and has been isolated from seawater, sediment, plankton, animals, intestines of fish and from bivalves in the U. S. (394) and from areas such as Brazil (435), the Netherlands (528), Denmark (193), India (510) and

Korea (463).

In many bacteria, the regulation of phenotypes is controlled via signalling pathways where the secretion and recognition of small extracellular factors is used to coordinate the expression of phenotypes at the population level. Many virulence factors are also induced during the stationary phase of growth, for example, the expression of the metalloprotease of V. vulnificus has been demonstrated to be maximal during late exponential phase and was stable during stationary phase (252). Interestingly, in a range of other organisms, signalling molecules have been demonstrated or suggested to regulate the expression of virulence factors (32, 366, 404, 478).

V. vulnificus has gained much attention in recent years due to its ability to cause three distinct disease syndromes involving rapid progression, making them distinct from most pathogenic Vibrios (43). First, wound infections occur in otherwise healthy persons upon exposure of a wound, such as an insect bite, to seawater, fish or shellfish. Second, primary septicemia is almost always preceded by consumption of raw shellfish (in some cases as few as 2 oysters) and in 97% of cases involves a patient with a pre-existing disease affecting either the liver or the immune system (493). The third syndrome, gastroenteritis, like primary septicemia, is usually preceded by consumption of shellfish, but involves abdominal cramps and vomiting or diarrhoea. While the number of people 184

infected worldwide with V. vulnificus is low when compared with infections by other Vibrios, the severity of disease and rapidity of progression makes it a leading cause of seafood-associated fatalities.

Numerous virulence factors have been proposed for this organism, such as the expression of an antiphagocytic capsular polysaccharide (CPS) (256, 469), type

IV fimbriae (145), and the production of siderophores (283, 468). In addition, this organism produces a number of extracellular proteins including a cytolysin

(164, 257), a novel hemolysin (67), a phospholipase and lysophospholipase (509), hyaluronidase, fibrinolysin and chondroitin sulfatase (395). Possibly one of the most important extracellular virulence factors is an elastolytic and collagenolytic metalloprotease (VVP) (253, 328) which has been shown to degrade albumin, immunoglobulin G and complement C3 and C4 (418). In its purified form, this protease has been shown to induce hemmorhagic damage, enhance vascular permeability and oedema, and is lethal to mice when administered intraperitoneally or intravascularly (329). In addition, the metalloprotease has been implicated in the release of iron bound to transferrin or lactoferrin (383) which makes the iron available to the siderophore and enhances growth of the bacterium under conditions of low iron.

The VVP of V. vulnificus has been shown to be homologous to the HA protease

(HA/P) of Vibrio cholerae (173) which is regulated by HapR (219). This activator protein is homologous to the LuxR protein of Vibrio harveyi. In addition, another luxR homologue, opaR, has been demonstrated to regulate capsule production in Vibrio parahaemolyticus (312). These regulatory proteins 185

are members of a signalling system that has been discovered in an ever increasing number of organisms (26), including both Gram-negative and Gram-positive bacteria. In most cases, the genes regulated by this signalling system are unknown, but the regulation of virulence is indicated in Escherichia coli,

Salmonella typhimurium (478, 496) and V. cholerae (219). It has also been demonstrated that the metalloprotease is expressed in stationary phase in V. cholerae and V. vulnificus, at a time when signalling processes have been shown to play key regulatory roles in in other bacteria. Due to the similarities in the metalloproteases of V. cholerae and V. vulnificus the search for a luxR homologue in V. vulnificus was initiated and the smcR gene, which is a homologue of the V. harveyi luxR gene and hapR of V. cholerae (315), was identified.

This chapter reports the generation of a smcR mutant constructed in V. vulnificus and examines its role in virulence factor expression. This regulatory protein appears to play an important role in the regulation of virulence factors such as the metalloprotease, alkaline phosphatase and pili production. This chapter also presents data that demonstrates that V. vulnificus produces extracellular signals, which are able to induce luminescence in the V. harveyi reporter strain. The role of signals in the expression of the metalloprotease is further confirmed by the inhibition of protease expression upon addition of furanone compound 2, a signal antagonist. Data in this chapter has been submitted to the Journal of

Bacteriology. 186

5.3 MATERIALS AND METHODS

5.3.1 Bacterial strains and growth conditions

The plasmids and bacterial strains used in this study and their genotypes are listed in Table 5.1. Vibrio vulnificus C7184(O) is a clinical isolate obtained from the drainage of a hand wound (394). V. vulnificus C7184(T) is a spontaneously derived non-encapsulated and thus non-virulent mutant of the opaque strain

C7184 (469). The designations (T) and (O) refer to translucent and opaque colony morphologies respectively, on agar plates which is related to capsular polysaccharide production. The Vibrio harveyi strains were a gift from Bonnie

- + Bassler. V. harveyi BB170 (30) (sensor 1 , sensor 2 ) has a null mutation in the gene for sensor 1 and thus is a reporter strain for autoinducer 2 (AI-2). V. harveyi

BB152 (30) (autoinducer 1-, autoinducer 2+) has a null mutation in the gene for autoinducer 1 synthase (AI-1) and produces only AI-2, and thus serves as a positive control for assays of AI-2 production.

Strains of Escherichia coli and V. vulnificus were stored at -70°C in Luria-Bertani

(LB) (324) broth (10 g tryptone (Oxoid), 5 g yeast extract (Oxoid) and 10 g NaCl per litre of distilled water) containing 15% (vol/vol) glycerol (Research

Organics), while other Vibrios were maintained in LB with 20 g NaCl per litre.

Prior to each experiment, cells were inoculated from frozen stocks into LB broth overnight and then plated onto LB agar (LB with 15 g agar (Research Organics) per litre distilled water) to check for purity. Where specified, glucose was added 187

Table 5.1. Bacterial strains and plasmids

Strain or Reference or Description Plasmid source Strains V. vulnificus C7184(O) Human wound isolate; encapsulated and (394) virulent C7184(T) Non-encapsulated spontaneous mutant of (469) C7814(O) DM7 smcR::Sm, derived from C7184(O) This study UTHS-1 Source of isolation unknown (554) V. harveyi

BB170 luxN::Tn5; sensor 1-, sensor 2+ (30)

BB152 luxL::Tn5; AI- 1-, AI- 2+ (30) E. coli BW20767 Smr, (RP4-2 tet : Mu-1kan::Tn7 integrant) tra+ leu-63::IS10 recA1 creC510 hsdR17 (323) endA1 zbf-5 uidA(Mlu1):pir+ thi DH5a supE44 DlacU169 (f80lacZ∆M15)hsdR17 (172) recA1 endA1 gyrA96 thi-1 relA1 XLI Blue recA1 endA1 gyrA96 thi-1 hsdR17 supE44 relA1 lac [F proAB lacIqZDM15 (53) Tn10(tetr)] Plasmids pBluescript® Apr, multiple cloning site flanked by T3

II SK+ and T7 promoters, plac promoter fused to Stratagene the a peptide of ¢LacZ, derived from pUC19 188

Table 5.1. Continued

pCAM140 Smr, Apr, mini-Tn5 gusA in pUT mini (550) Tn5 Sm/Sp pCVD442 Apr, positive selection vector, pGP704 with sacB inserted in multiple cloning (97) site pLG401 Lynn Gilson, Cmr, pACYC ori, mob, promoterless University of gfp with multiple cloning site Hawaii pMacSB Cmr, sacB from pCVD442 inserted as PstI-EcoRV fragment into cloning site This study of pLG401 pMacSmcRK pMacSB with disrupted smcR fragment from SprA.SM inserted into EcoRV site This study of pMacSB r pUC19 Ap , multiple cloning site, plac promoter (566) fused to the a peptide of ¢LacZ pSprA8 Apr, pUC19 with 720 bp insert This study containing the V. vulnificus smcR pSprA8.18 Apr, pBluescript with ~770 bp insert containing the EcoR1-HindIII smcR This study fragment from pSprA8 pSprA.SM Apr, Smr, pSprA8.18 with ~2.0 kb Sm fragment from pCAM140 inserted into This study the BglII site of the smcR insert 189

from a filter-sterilised 20% stock to a final concentration of 0.5% for LB and

0.4% for 2M minimal medium. Antibiotics were used at the following concentrations (µg ml-1) ampicillin 50, streptomycin 200, chloramphenicol 34 and colistin 100.

For starvation experiments, cells were grown in LB with 20 g l-1 NaCl overnight at room temperature, transferred to fresh medium at a dilution of 1:50 and grown overnight. Cells were then transferred to fresh medium again at a dilution of

1:100. The cells were grown to mid-exponential phase (optical density at OD610 nm = 0.2; 4.0 X 108 CFU ml-1) and harvested by centrifugation (10,000 X g, 10 min, 24°C, Beckman Avanti J-25 centrifuge, JA 25.50 rotor) and washed twice in

0.5 X NSS (402). Cells were resuspended in 2M medium lacking glucose (2M-C)

(402) at 1:100 dilution. Agar (Research Organics, Cleveland, OH, USA) was added to a concentration of 1.5% for solid media. General chemicals were purchased from Sigma (Sigma Chemical Co., St. Louis, MO, USA).

5.3.2 Preparation of cell-free supernatants

For the generation of cell-free supernatants, V. harveyi strains were grown in autoinducer bioassay (AB) medium (165) overnight at 30°C with shaking at 200 rpm. AB medium consists of 0.3 M NaCl, 0.05 M MgSO4, and 0.2% vitamin-free casamino acids (Difco), adjusted to pH 7.5 with KOH. The medium was sterilised, allowed to cool, and 10 ml of sterile 1 M potassium (pH 7.0), 10 ml of

0.1 M L-arginine, 20 ml of glycerol, 1 ml of 10 µg ml-1 of riboflavin, and 1 ml of

1 mg ml-1 of thiamine was added per litre. V. vulnificus strains were grown in 190

LB, LB + 0.5% glucose or 2M (402) medium at 24°C or 37°C overnight. The following morning, fresh medium was inoculated at a 1:100 dilution and the cultures were grown to late stationary phase. Growth was followed spectrophotometrically with a Pharmacia Biotech model Novaspec II spectrophotometer and aliquots removed at various time points for the preparation of cell-free supernatants. Supernatants for the V. harveyi bioluminescence bioassay were prepared by the removal of cells by centrifugation of cultures

(8,000 X g, 24°C for 10 min in a Beckman Avanti J-25 centrifuge, JA 25.50 rotor) (Beckman Coulter, Inc., Fullerton, Ca. USA) followed by filtration of the supernatant through 0.2 µm pore size filters (Supor Acrodisc, Pall-Gelman

Laboratories, Ann Arbor, MI USA). Supernatants were frozen at -20°C until used.

In experiments performed with the addition of signal antagonists, the furanone compound 2 was added to cultures at a concentration of 10 µg ml-1 during exponential phase (OD610 nm =0.4). Stock solutions of furanone compounds were prepared in EtOH at a concentration of 20 mg ml-1. EtOH was added to control samples to account for the solvent volume added and growth was followed spectrophometrically to ensure the concentrations of compound used were not growth inhibitory.

5.3.3 V. harveyi bioassay for the detection of AI-2 activity

Cell-free supernatants obtained from strains of V. vulnificus were tested for their ability to induce luminescence in the V. harveyi AI-2 reporter strain BB170. The 191

effect of growth phase and growth medium on the production of AI-2-like signals in different strains was examined. V. harveyi BB152 (AI-1-, AI-2+) supernatant was used as a positive control and E. coli DH5a supernatant or sterile media as a negative control. This strain of E. coli has previously been shown to harbour a mutation in the AI-2 synthase gene, ygaG, which results in a truncated protein with no AI-2 activity (496). The V. harveyi bioassay was performed as described previously (495). Briefly, 10 µl of the above-described supernatants were added to wells of 96-well microtiter plates. The V. harveyi reporter strain BB170 was grown for 16 hours at 30°C with shaking in AB medium. Cells were diluted

1:5,000 into 30°C prewarmed AB medium and 90 µl of the diluted suspension was added to wells containing supernatant. The microtiter plates were incubated at 30°C with shaking at 175 rpm. Hourly determinations of the total luminescence were quantified using the chemiluminescent setting on a Wallac

(Gaithersburg, MD) model 1450 Microbeta Plus liquid scintillation counter. The

V. harveyi cell density was monitored by the use of a microplate reader (Bio-Rad,

Hercules, CA, USA). Activity is reported as the percentage of activity obtained from V. harveyi BB152 cell-free supernatant. While the absolute values of luminescence varied considerably between experiments, the pattern of results obtained was reproducible.

5.3.4 Molecular biology techniques

Genomic DNA was isolated by the method of Tillett and Neilan (516). Plasmid

DNA was isolated by the alkaline lysis method using the QIAFILTER Maxi

Plasmid kit (QIAGEN, Pty. Ltd., Clifton Hills, Vic., Australia) for large scale 192

purification or by the use of Wizard® Plus Minipreps (Promega Corp., Madison,

Wisconsin, USA) for small scale purification. For the analysis of multiple clones, the lithium chloride miniprep method was used (16).

A probe for the identification of smcR containing the streptomycin insert was generated by PCR with the primers SmcR (5' GCGTAGTGTATCATTCCGC) and LuxR3r (GGTCACACACTTCACCACGC). The PCR product of 700-800 bp was gel purified, electroeluted and used as a template for digoxigenin (DIG) labelling (Boehringer Mannheim, Indianapolis, IN, USA) by PCR. For Southern hybridisations, chromosomal DNA was digested with SalI and electrophoresed on a 0.7% agarose gel in Tris-borate buffer. The digested DNA was transferred to

Hybond N+ membranes (Amersham Life Science, Buckinghamshire, England) using a Bio-Rad vacuum blotter (Model 785, Bio-Rad, Richmond, CA, USA).

Membranes were hybridised at 50°C for 18 hours in a high SDS buffer (74). Pre- hybridisation and hybridisation washes were performed at 50°C; post- hybridisation washes were: one rinse with 2 X SSC containing 0.1% SDS at room temperature and two rinses with 0.1 X SSC containing 0.1% SDS. Detection was carried out according to manufacturer recommendations using an anti-DIG antibody conjugated to alkaline phosphatase and the chemiluminescent substrate

CSPD® (Boehringer Mannheim), and was visualised by autoradiography using

X-Omat AR film (Eastman Kodak Co., Rochester, NY).

PCR amplifications were performed in an automatic thermal cycler (Hybaid PCR

Sprint, Hybaid Limited, Middlesex, UK) using standard conditions. Restriction 193

enzymes, molecular weight markers, shrimp alkaline phosphatase, ligase, Pwo and T4 DNA ligase were purchased from Boehringer Mannheim.

5.3.5 Generation of V. vulnificus smcR null mutants

A 720 bp fragment from V. vulnificus C7184(O) was amplified with Pwo polymerase (Boehringer Mannheim) using the LuxR2f (5’

GCACAATTACACTCATCAGTG) and LuxR2r (5’

GTTCACGGTTGTAGATGCATAGC) primers, which were derived from the sequence of V. vulnificus smcR (315) (accession no. AF204737). The PCR product was gel purified by excising the band from a 0.7% agarose gel in Tris- borate buffer and then electroeluting the fragment from the gel slice. The purified product was blunt-end cloned into the SmaI site of pUC19 (566). Positive clones were confirmed by sequencing and one clone, pSmcR8, was selected for subsequent work. The smcR gene was excised from pUC19 using the restriction endonucleases EcoRI and HindIII and the fragment was cloned into pBluescript®

II SK (Stratagene, La Jolle, CA, USA) which had been prepared by digestion using EcoRI and HindIII. This clone was designated pSmcR8.18. The smcR gene on plasmid pSmcR8.18 was disrupted by insertion of a selectable marker, streptomycin, into the BglII site 183 bp downstream from the ATG codon. The

2.0 kb streptomycin resistance cassette was removed from pCAM140 (550) with

BamHI and gel purified as described above. pSmcR8.18 was digested with BglII, dephosphorylated with shrimp alkaline phosphatase (Boehringer Mannheim) and the purified 2.0 kb streptomycin gene cassette was ligated into the BglII site.

Positive clones containing the smcR gene with the streptomycin disruption were 194

selected on LB plates supplemented with 200 µg ml-1 streptomycin and were confirmed by sequencing. The plasmid carrying the disrupted smcR gene has been designated pSmcR.Sm.

A vector was constructed for the delivery and homologous recombination of the disrupted smcR that would replicate in V. vulnificus, but that carries a counter- selectable marker, the sacB gene. The expression of sacB causes cell lysis when cells are grown in the presence of sucrose under low osmolarity and thus enables us to select for cells that have either lost the plasmid or in which a double cross- over event had occurred, leaving the disrupted smcR gene on the chromosome.

This plasmid was constructed by inserting the sacB gene as a PstI-EcoRV fragment from pCVD442 (97) into the PstI-EcoRV site of pLG401 (constructed by Lynn Gilson, University of Hawaii) and was denoted pMacSB. The disrupted smcR gene was then ligated into the EcoRV site of pMacSB.

This plasmid, pMacSmcRK, was then conjugated into V. vulnificus C7184(O) in the following manner. V. vulnificus was grown in brain heart infusion (BHI) broth (Oxoid) containing 2% NaCl and E. coli BW20767 in LB with antibiotics for 16 - 18 hours at 37°C with shaking at 200 rpm. E. coli was washed once in prewarmed LB and allowed to stand 30 min prior to conjugation. V. vulnificus was heat shocked at 45°C for 15 min, washed in LB and a 1.5 ml cell pellet was resuspended in 50 µl of prewarmed LB. Cell suspensions were mixed (50 µl donor: 150 µl recipient) on a filter (GS Millipore; 0.22 µm pore size) placed on the surface of an LB agar plate at 37°C for 16 hr. Following incubation, the 195

filters were resuspended in 2 ml of 10 mM MgSO4 and aliquots plated onto selective media. Transconjugants, carrying pMacSmcRK were selected on LB agar supplemented with streptomycin (200 µg ml-1) and colistin (100 µg ml-1).

To select for double crossover events, cells were grown at 30°C in LB supplemented with 0.05% NaCl (V. vulnificus requires NaCl) and 6% sucrose.

Cultures that grew under these conditions were then plated onto LB supplemented with streptomycin. The streptomycin resistant colonies were tested for sensitivity to the antibiotic carried on the plasmid, chloramphenicol, which indicated that the clones had the disrupted smcR gene, but did not carry the entire plasmid as an insert.

The disruption of the smcR gene in one of the clones, V. vulnificus DM7, was confirmed by Southern hybridisation using a probe that binds to the 5' half of the gene (see above). The V. vulnificus DM7 mutant had a chromosomal band shift when compared to the wild type. Further confirmation was obtained by PCR.

5.3.6 Electron microscopy

For viewing by electron microscopy, V. vulnificus cells were fixed in 1% glutaraldehyde. One drop of the cell suspension was placed onto a 200 mesh carbon-coated grid and left for 1-2 min. The drop was removed with filter paper and the grid washed 3 times with dH2O and then negatively stained with 2% uranyl acetate in water. The negative stains were examined and photographed with a Hitachi H-7000 transmission electron microscope operating at 75 kV. 196

5.3.7 Biofilm assays

The biofilm assays were performed in 96 well microtitre plates. Log phase cells were added to wells at an OD610 nm of 0.1 in 100 µl LB. Biofilm formation was allowed to proceed overnight, wells were washed twice with PBS to remove loosely attached cells and the attached cells stained with 100 µl of a 1% crystal violet solution for 15 min. After staining, the crystal violet solution was removed and the well washed three times with PBS (twice with 300 µl and once with 100

µl). The crystal violet that remained bound to cells was then extracted with 200

µl of 95% ethanol for at least 5 min. The ethanol solution was transferred to a cuvette and the absorbance at 540 nm was determined spectrophotometrically.

5.3.8 Motility assay

For the determination of the motility phenotype, soft agar LB plates with 0.3% agar (Difco) were used. Cells were grown overnight in LB medium. Fresh LB was inoculated at a 1:100 dilution and the cultures grown to mid exponential phase. Inoculations were made as stabs into the centre of motility agar plates and the plates were incubated overnight at either 30 or 37°C.

5.3.9 Capsule production

To demonstrate differences in capsule production, exponential phase cells which had been grown in LB with 20 g l-1 NaCl, were diluted in 0.5 X NSS and plated onto either LB or DVNSS agar by the drop plate method (191). 197

5.3.10 Exoenzyme assays

For studies on the regulation of exoprotease activity, cell-free supernatants were prepared as described above for bioluminescent assays. Samples were collected at various time points throughout the growth of the cultures in LB; cell-free supernatants were prepared and frozen at -20°C until analysis. For the determination of exoenzyme activity, several substrates were utilised. The Hyde powder azure (HPA) assay was performed by the addition of 1 mg ml-1 HPA to cell-free supernatants that were incubated at 37°C for 4 hours. The samples were centrifuged at 8,000 X g for 5 min to pellet cells and undegraded substrate and the supernatant collected by filtration through a 0.2 µm disposable filter (Supor

Acrodisc, Pall Gelman Laboratories, Ann Arbor, MI, USA). Protease activity per cell of the collected supernatant was determined as the absorbance at 595 nm divided by the OD610 nm of the culture. In the experiment with the addition of the signal antagonist (see above), furanone compound 2 (C2), the compound was added during exponential phase (OD610 nm = 0.4) and the culture grown in the presence of C2 until early stationary phase at which time cell-free supernatants were collected.

For the azocasein assay, samples were prepared as described for the HPA assay and 100 µl of supernatant was added to 900 µl of azocasein solution (1% in 0.1 M

Tris pH 8.0). The solution was incubated for 4 hours at 37°C and the reaction stopped with the addition of 2 ml of 10% trichloroacetic acid. The solution was centrifuged at 10,000 X g for 5 min to remove precipitated protein and the 198

supernatant collected and the absorbance at 440 nm assayed. The activity per cell is calculated by the division of the absorbance at 440 nm by the OD at 610 nm.

The elastase assay was performed with supernatants collected as described above and 50 µl added to 1 ml of buffer (0.1 M Tris pH 7.2; 1 mM CaCl2) containing 20 mg elastin-Congo red (Sigma Chemical Co., St. Louis, MO, USA). The mixture was incubated at 37°C for 6 hours and insoluble protein removed by centrifugation at 10,000 X g for 5 min. Elastase activity per cell is determined as the absorbance at 495 nm divided by the OD at 610 nm.

Alkaline phosphatase assays were performed in 96 well microtitre plates. Cell- free supernatants collected throughout the growth of the culture were prepared as described above. The alkaline phosphatase substrate was prepared according to the manufacturer instructions by adding one tablet of the Sigma 104 Phosphatase substrate tablet to 8 ml of diethanolamine buffer. Fifty µl of the reagent was added to 100 µl of bacterial supernatant in 96 well microtitre plates. The reaction was allowed to proceed at 37°C for 4 hours at which time, the absorbance was read at 450 nm.

5.3.11 Assay for siderophore production

For the determination of siderophore production by V. vulnificus, the CAS assay was performed as described by Schwyn and Neilands (456). V. vulnificus

C7184(O) and DM7 were grown overnight in LB and the cells collected by centrifugation (8,000 X g, 24°C for 10 min in a Beckman Avanti J-25 centrifuge, 199

JA 25.50 rotor) (Beckman Coulter, Inc., Fullerton, Ca. USA), washed in PBS and resuspended in deferrated M9. After 24 hours of incubation with shaking at

24°C, supernatants were collected as described above. Equal volumes of CAS scanning solution and supernatant (0.5 ml) were mixed and allowed to react for 2 hours. Absorbance at 630 nm was determined and sterile deferrated M9 + CAS solution served as a control.

5.4 RESULTS

5.4.1 Production and regulation of AI-2 activity in V. vulnificus

5.4.1.1 V. vulnificus produces a substance that induces luminescence in V.

harveyi

Numerous Vibrio species have been shown to possess signalling systems that can activate luminescence in Vibrio harveyi bioassays. The similarities between the metalloproteases of Vibrio cholerae and Vibrio vulnificus and the observation that the V. cholerae HA/P is regulated by such a system, prompted the investigation into the occurrence of signalling system 2 in V. vulnificus. The addition of cell- free supernatants to the V. harveyi BB170 reporter strain was used to demonstrate the production of a signalling molecule by V. vulnificus. Both V. vulnificus

C7814(T) and UTHS-1(O) induced bioluminescence in V. harveyi in Fig. 5.1. V. vulnificus cells were grown in LB with aeration at 37°C and supernatants were collected in late exponential phase (OD610 nm = 0.796). Cell-free supernatants were prepared and added to BB170 cells at a concentration of 10%. These 200

400

300

200

100

0 BB152 C7184(T) UTHS(O) Media DH5

Figure 5.1. Production of bioluminescence in V. harveyi by cell-free supernatants of V. vulnificus strains.

The response of V. harveyi BB170 to cell-free supernatants of V. vulnificus

C7184(T) and V. vulnificus UTHS-1(O) are shown. V. harveyi BB152 (AI-1-, AI-

2+) supernatant was used as a positive control and DH5a supernatants (collected from cells grown in LB + 0.5% glucose) and sterile media were used as negative controls. Cell-free supernatants were prepared from V. vulnificus strains grown with aeration in LB at 37°C to early stationary phase and were added at a final concentration of 10% (vol/vol) at the start of each experiment. The data for the 5 h time point are shown and presented as the percentage luminescence produced by V. harveyi BB170 with the BB152 supernatant normalised to 100% activity.

Results presented here are representative of results obtained in at least 3 independent experiments. 201

supernatant preparations were able to induce the reporter strain to at least 100% activity as determined by the addition of supernatant from the V. harveyi AI-2 positive strain, BB152. Specifically, the V. vulnificus strain C7184(T) induced

215% and UTHS-1 induced 350% of the BB152 activity. These results indicate that V. vulnificus produces a compound that induces luminescence via the signal system 2 pathway and that at least two strains possess this ability.

5.4.1.2 Effect of growth medium and temperature on the production of signal

molecules in V. vulnificus

It has been shown that glucose regulates the production of signal molecules in some bacterial strains. For example, Salmonella typhimurium and some strains of

Escherichia coli do not produce AI-2 activity without the addition of glucose to

LB (496). To determine the effect of growth medium and temperature on the production of signal molecules in V. vulnificus, cells were grown in either LB, LB

+ 0.5% glucose or the minimal medium, 2M, at either room temperature or at

37°C. The results of a typical experiment are shown in Fig. 5.2. Cell-free supernatants were collected from C7814(T) and added to the V. harveyi reporter strain BB170 at a final concentration of 10% (vol/vol). Supernatant collected from V. harveyi strain BB152 (AI-1-, AI-2+) grown in AB medium served as a positive control and sterile medium as negative control. V. vulnificus C7184(T) or UTHS-1(O) (data not shown) grown in either LB or 2M medium can produce a signal which induces luminescence in the reporter strain (Fig. 5.2), and the production of this factor is not temperature-dependent as production occurred at both room temperature (data not shown) and 37°C. However, supernatants 202

collected from cells grown in LB with the addition of 0.5% glucose do not induce luminescence of V. harveyi (Fig. 5.2). Supernatants collected from DM7

(smcR::Sm) were also able to induce luminescence in V. harveyi to similar levels as the wild type (data not shown), indicating that smcR is not required for signal production.

5.4.1.3 Production of signal molecules is growth phase dependent in V. vulnificus

To investigate the kinetics of signal production in V. vulnificus, cells were grown at 37°C in 2M medium with aeration and samples were removed throughout the growth curve for preparation of cell-free supernatants. A typical experiment is shown in Fig. 5.3 and the same trend was observed with cells grown in LB (data not shown). The production of AI-2 activity increased until late exponential to early stationary phase after which the activity of cell-free supernatants decreased.

Often, the 24 hour samples had reduced or no ability to induce the V. harveyi reporter strain. These results indicate that production of signalling activity is growth phase-dependent.

Maximal signal production in V. vulnificus occurs as cells enter the stationary phase of growth. This led us to speculate that nutrient and/or energy starvation may be involved in the induction of autoinducer production, as starvation is one of the cues that induces many stationary phase genes. In order to determine if the production of AI-2-like activity in V. vulnificus is induced under conditions of nutrient starvation, cells of C7184(T) or UTHS-1(O) were grown to mid- exponential phase in LB containing 20 g l-1 NaCl and collected by centrifugation 203

150

100

50

0

Figure 5.2. The effect of growth medium on the production of signal molecules in V. vulnificus.

The response of the V. harveyi reporter strain BB170 to cell-free supernatants of V. vulnificus C7184(T) is shown. V. harveyi was diluted 1:5000 in AB medium and 90µl was added to 10 µl cell-free supernatant at the beginning of each experiment. Bioluminescence of the reporter strain was monitored during growth. Cell-free supernatants were prepared from V. vulnificus grown at 37°C in LB, LB + 0.5% glucose or in 2M medium during late exponential to early stationary phase of growth. DH5a supernatants and sterile media were used as negative controls. Results are presented as percentage luminescence produced by V. harveyi BB170 with the BB152 supernatant normalised to 100% activity and are representative of results obtained in at least 3 independent experiments. 204

150 1.00

100

0.10

50

0 0.01 0 5 10 15 20 25 30 Time (Hours)

Figure 5.3. Effect of growth phase on the production of substances able to induce luminescence in V. harveyi BB170.

V. vulnificus C7184(T) was grown with aeration in 2M medium at 37°C. Growth was followed spectrophotometrically (optical density at 610 nm) and cell-free supernatants were prepared and assayed for signalling activity in the luminescence induction assay (bars). The activity of supernatants is presented as the percentage of activity obtained when V. harveyi BB152 cell-free spent supernatant is added to the reporter strain. Cell density is reported as optical density at 610 nm (squares). Results presented here are representative of results obtained in at least 3 independent experiments. 205

at 8,000 X g for 10 min at 24°C. Cells were washed once and resuspended in 0.5

X NSS. Supernatant samples were taken every hour and tested for AI-2 activity

(Fig. 5.4). Cell-free supernatants taken from the starving culture at time 0 induced luminescence in the V. harveyi reporter strain 0.4%. This induction increased to 849% for supernatants taken from cells starved for 4 h at which time their ability to induce luminescence began to decrease and by 9 h of starvation had dropped to 245%. These data indicate that starvation conditions are able to stimulate the production of AI-2 activity in V. vulnificus. The production of the luminescence inducing factors peaks between 4 - 6 hours of nutrient starvation and thereafter begins to decline. The cell numbers of the cultures did not increase during this time. These results indicate that cells that have been shifted from exponential growth to starvation conditions are able to produce signal molecules.

5.4.1.4 Addition of signal antagonists do not inhibit signal production

The red marine alga Delisea pulchra has been shown to produce a range of halogenated furanones that specifically inhibit signaling phenotypes regulated by the AHL and AI-2 systems in bacterial species (156, 161, 293, 294, 480). The furanone compound 2 (C2) was added to growing cultures of V. vulnificus

C7184(T) in order to assess whether signal transduction is required for the production of autoinducer activity. The response of V. harveyi BB170 to supernatants collected from V. vulnificus during growth with C2 is shown in Fig.

5.5. The addition of C2 did not inhibit signal production by this organism. 206

1000

750

500

250

0 BB152 0 hr 2 hr 4 hr 6 hr 9 hr DH5 Media

Figure 5.4. V. vulnificus produces a substance that induces luminescence in the V. harveyi reporter strain BB170 under starvation conditions.

The response of the V. harveyi reporter strain BB170 to cell-free supernatants of

V. vulnificus UTHS(O) during starvation is shown. V. harveyi was diluted 1:5000 in AB medium and supernatant was added at a final concentration of 10%

(vol/vol) at the beginning of each experiment. Bioluminescence of the reporter strain was monitored during growth. Cell-free supernatants were prepared from

V. vulnificus which had been grown with aeration in LB containing 20 g l-1 NaCl at 37°C to mid-exponential phase (OD610 nm = 0.4), washed and resuspended in

2M salts. DH5a supernatants and sterile media (0.5 X NSS) were used as negative controls. Results are presented as the percentage luminescence produced by V. harveyi BB170 with the BB152 supernatant normalised to 100% activity and are representative of at least three independent experiments. 207

1500

1000

500

0 BB152 C7184 C7184/C2 Media DH5

Figure 5.5. Signal antagonists do not inhibit production of the autoinducer activity in V. vulnificus.

V. vulnificus C7184(T) was grown in 2M with aeration at 37°C. Furanone compound 2 (C2) was added at mid-exponential phase and growth was allowed to proceed to early stationary phase at which time samples were collected for the preparation of cell-free supernatants. V. harveyi was diluted 1:5000 in AB medium and supernatant was added at a final concentration of 10% (vol/vol) at the beginning of each experiment. Bioluminescence of the reporter strain was monitored during growth. Results are presented as the percentage luminescence produced by V. harveyi BB170 with the BB152 supernatant normalised to 100% activity and are representative of at least three independent experiments. 208

5.4.1.5 Characteristics of the V. vulnificus signalling molecule

Attempts to extract the signal molecule from cell-free supernatant with dichloromethane (DCM) or ethyl acetate proved unsuccessful. While it was possible to extract some activity into the solvent phase, the majority of the activity always remained in the aqueous phase, which suggests the factor is a polar compound (data not shown). To investigate the heat stability of the signal produced by V. vulnificus, cell-free supernatants were prepared from cultures of

C7184(T) grown in 2M medium to early stationary phase (OD610 nm = 0.7). The autoinducer activity of cell-free supernatants heated to 80°C for 10 min was reduced by 52.7% while heat treatment at 100°C for 10 min completely abolished activity (Fig. 5.6). These results indicate that the AI-2 stimulating factor produced by V. vulnificus is a heat labile compound.

5.4.1.6 V. vulnificus possesses the AI-2 synthase gene, luxS

The discovery of the signal synthase gene required for the production of AI-2

(496) in V. harveyi, E. coli and S. typhimurium, the observation that numerous bacterial strains possess highly conserved luxS homologues, and the demonstration of AI-2 activity in V. vulnificus, prompted a search for a luxS homologue in V. vulnificus. The luxS in V. vulnificus was identified by PCR amplification of an approximately 320 base pair fragment genomic DNA from V. vulnificus C7184(O) using degenerate primers (LuxS.F 5’ cat (c/t)tg t(a/t)(c/t) gct ggc ttt atg and LuxSR 5’ (a/c)(c/t)t ct(c/g) gca g(c/t)g cca att c) based on the alignment of luxS sequences found in the GenBank database. The amplified 209

1000

750

500

250

0 BB152 C7184(T) 80°C 100°C Media DH5

Figure 5.6. The effect of heat treatment on signal activity.

The response of V. harveyi BB170 to cell-free supernatants of V. vulnificus

C7184(T) that have been heated to 80°C or 100°C are shown. V. harveyi BB152

(AI-1-, AI-2+) supernatant was used as a positive control and DH5a supernatants

(collected from cells grown in LB + 0.5% glucose) and sterile media are used as negative controls. Cell-free supernatants were prepared from V. vulnificus strains grown with aeration in 2M medium at 37°C to early stationary phase (OD610 nm =

0.7) and were added at a final concentration of 10% (vol/vol) at the start of each experiment. The data for the 5-hr time point are shown and presented as the percentage luminescence produced by V. harveyi BB170 with the BB152 supernatant normalised to 100% activity. 210

product was cloned and sequenced and it was determined that the cloned fragment shared >80%, 79%, and 68% nucleotide identities to the luxS gene from V. harveyi, an unidentified open reading frame in the V. cholerae genome database, and the ygaG gene of E. coli (Fig. 5.7). The amplified region lies within the open reading frame that encodes the LuxS protein. Based on the high degree of nucleotide identity and the presence of AI-2 activity in the supernatants of V. vulnificus, we believe that we have identified a putative luxS gene in V. vulnificus.

The full-length gene is currently being cloned to complete the sequence analysis and to generate a luxS mutant for analysis.

5.4.2 Characterisation of a mutant in V. vulnificus of the luxR

transcriptional regulator homologue

In V. harveyi, the LuxR regulatory protein is required for the expression of the lux operon. We have previously reported the cloning and sequencing of a homologue of the V. harveyi luxR gene from V. vulnificus (315). A potential rho-independent terminator lies nineteen nucleotides downstream of the smcR stop codon, and the smcR coding region is followed by a divergently transcribed homologue of lpd

(dihydrolipoamide dehydrogenase). In an attempt to determine the role of this regulator in the signalling pathway, we generated a null mutation in this gene, smcR (Fig. 8). Interruption of the smcR gene was achieved by the insertion of a selectable marker, streptomycin, 183 bp downstream from the ATG codon by 211

V.vulnificus 1 ------0 V.harveyi 1 A TGCCT T TATTAGAC A GCTTTACC G TA G AC C AC 33 V.cholerae 1 ATGCC ATTATTAGA C AG T TTTA CC GT C GA TCA T 33 E.coli 1 ATGCC G TT G TTAGA T AG CTT C A C AGT C GATCA T 33 S.typhi 1 ATGCC ATT ATTAGA T AGCTT C GC AGT C GATCA T 33 C.jejuni 1 ATGCCATTATTAGA C AGCTT TAA AGT T GA C CA T 33 H.influenza 1 ATGCCATTA C T T GA T AG T TTTA A AGT G GA TCA C 33 Y.pestis 1 ATGCCATTA TT G GA T AG CTTTA C CGT A GA C CA T 33 B.anthracis 1 ATGCCAT C A G T AGA A AGCTTT GA A T T A GA TCA T 33 E.faecalis 1 ------T AGA A A G T T TT GA A T T A G ATCA C 23

V.vulnificus 1 ------0 V.harveyi 34 A CGCGT A TGAAT G CACCA G CG G TT C GTG T G G CT 66 V.cholerae 34 AC TCGT ATGAA T GCACC G GC G GT G CG TG T T GC C 66 E.coli 34 AC CCGG ATG G A A GC G CC T GC A GT T CG GG T G GC G 66 S.typhi 34 AC CCGG ATG C A A GC G CC G GC G GT C CG GG GT GC A 66 C.jejuni 34 AC TAAA ATG C CA GC T CC T GC T GT G CG TT T A GC T 66 H.influenza 34 AC AAAA ATG AAC GC ACC T GC A GT A CG CA T T GC A 66 Y.pestis 34 AC CATT ATGAA A GCACC G GC A GT A CG TG T C GC T 66 B.anthracis 34 AC GATT GT A AA G GCACC T TAT GT A AG AC AT TGC 66 E.faecalis 24 A ACACAG T A A A A G CACC ATAT G T T C G CC T T G C T 56

V.vulnificus 1 ------0 V.harveyi 67 A AAACG A TGC A A A CT C CAA A A G GA G ACACC A TC 99 V.cholerae 67 AAAAC C ATG C A A AC C CC AA A A GG G GA TACG AT T 99 E.coli 67 AAAAC A ATG A A C AC C CC GC A T GG C GA CGCA AT C 99 S.typhi 67 AAAAC G ATG A A C AC C CC GC A T GG C GA CGCA AT C 99 C.jejuni 67 AAA G TT ATG A A A AC A CC TA A G GG T GA TGAT AT T 99 H.influenza 67 AAA ACG ATG C TC AC G CC AA A A GG C GA TAAT AT T 99 Y.pestis 67 AA G AC G ATG A A A AC T CC NN N------86 B.anthracis 67 GG A G TT CACA A T GTA GGTAGT G AC G GTATTG T A 99 E.faecalis 57 GG C A C AGAAC A A A ATGGTG A T G CG TTAGTCG AA 89

Figure 5.7. Nucleotide alignment of luxS homologues.

The nucleotide alignment of luxS homologues in V. vulnificus, V. harveyi, V. cholerae, E. coli, S. typhi, Campylobacter jejuni, Haemophilus influenza, Yersinia pestis, Bacillus anthracis and Enterococcus faecalis. Nucleotide sequences that are boxed have an identity of 55% or more. Sequences of strains other than V. vulnificus were obtained from GenBank (V. harveyi accession no., AF120098; E. coli accession no., AE000353) or from nucleotide sequencing databases. 212

Figure. 5.7. Continued

V.vulnificus 1 ------0 V.harveyi 100 A CG G TA T TC G ACC T A C GTTTCACTGCT C CA A AC 132 V.cholerae 100 A CC GT A TT T GA TT T G CGTTT TACTATG CC A AA C 132 E.coli 100 A CC GT G TT C GAT C T G CG C TT CTGCGTG CC G AA C 132 S.typhi 100 A CC GT G TT T GAT C T G CG TTT TTGCATT CC G AA C 132 C.jejuni 100 A GC GT A TT T GAT T T G CGTTT TTGCATA CC A AA T 132 H.influenza 100 A CT GT T TT T GAT T T A CGTTT TTGTATT CC A AA C 132 Y.pestis 87 ------86 B.anthracis 100 A ATAAA T TC G ATA T T C GTTTTTGCCAA C CG A AT 132 E.faecalis 90 A AATAT GAC TTAC GT TTC T T ACAACCA AAC A A A 122

V.vulnificus 1 ------0 V.harveyi 133 A AAGACA T CC T TT C T G AG A AAGGA A TT C ATACA 165 V.cholerae 133 AAAGA TA T CT T GT C T G AG CGCGG T AT C CATAC T 165 E.coli 133 AAAGA AG T GA T GC C A G A A AG AGG G AT C CATAC C 165 S.typhi 133 AAAGA AG T GA T GC C G G A AA AAGG G AT T CATAC G 165 C.jejuni 133 AAAGA CA T TA T GA GC G A AAAAGG T A CT CATAC C 165 H.influenza 133 AAAGA AA T TC T TT C C CC AAAAGG C A TT CATAC A 165 Y.pestis 87 ------GAG AAA G GG A TCC ATACGC 105 B.anthracis 133 A AAC A AGCAA T GAAACC A G A T G TT A TT C ATACG 165 E.faecalis 123 G A T G CCC T AC CAA C A G G CG C A TTA CAC ACGTTG 155

V.vulnificus 1 ------C ATC T G T AT G CT G GC T TTATGCGT A AG 27 V.harveyi 166 T T A G AG CAT TT G T AC GC A GG C TTTATGCG T AA T 198 V.cholerae 166 C T A GA G CAT C T C T AC GC G GG C TTTATGCG C AA T 198 E.coli 166 C T G GA G CA CC T G T TT GC T GG T TTTATGCG T AA C 198 S.typhi 166 C T T GA G CA TC T G T TT GC T GG C TTTATGCG C GA C 198 C.jejuni 166 T T A GA A CAT TT A T TC GC A GG A TTTATG A G AG A T 198 H.influenza 166 C T T GA A CATTT A T TT GC T GG A TTTATG CG CG A T 198 Y.pestis 106 T AG AGC ACTT AT T CG CTG GG T TT A TGCGG G A CC 138 B.anthracis 166 T T A G AA C ATT TA T TA G CA TTT AA T T T A CG T A AA 198 E.faecalis 156 G AA C A T TTA T T A GCA G TTAACA T GC GT GAT G A A 188

V.vulnificus 28 C AT C --- T T A ATGGCGCATCG G TT G - A G A TC A T 56 V.harveyi 199 CA C C --- T A AATGG TG A TAGC GT T G - A G AT C A T 227 V.cholerae 199 CA C C --- T T AA C GG CA GCCAA GT G G - A G AT C A T 227 E.coli 199 CA T C --- T T AA C GG TA A TGGT GT A G - A G AT T A T 227 S.typhi 199 CA C C ACA T G A GC CTGA TT GGC ACG CC GG A CG A G 231 C.jejuni 199 CA T C --- T T A ATTCAA AT TCA G TT G - A A A TT A T 227 H.influenza 199 CA T T--- T A AAT GGCG AT AGC AT A G - A A AT T A T 227 Y.pestis 139 ACCT--- -C AATGG TG AT GGT GT T G - A A AT T A T 166 B.anthracis 199 T A TATTGAT CGT T ATC CACAT T T T G - A T A T T A T 230 E.faecalis 189 T TAAAAGGA A T CATTG A CAT 208 213

Figure. 5.7. Continued

V.vulnificus 57 C G ATATC T CA C CG A TGGGT T GT C GT A CC G GTTT 89 V.harveyi 228 T GATAT C TC A CC A ATGGG G TG C CG T AC T GGTT T 260 V.cholerae 228 C GATAT T TC A CC A ATGGG T TG C CG T AC A GGTT T 260 E.coli 228 C GATAT C TC G CC A ATGGG C TG C CG C AC C GGTT T 260 S.typhi 232 C AGCGT G T TG CC G A C G C TT GG A AAG CGG CG A AC 264 C.jejuni 228 T G ATAT T T CA CC T A TG GGT TG T C GC A CG GG TTT 260 H.influenza 228 T GATAT T TC T CC G ATGGG A TG T CG C AC G GG A T T 260 Y.pestis 167 T GATAT C TC G CC G ATGGG A TG T CG C AC G GG TT T 199 B.anthracis 231 C G ATAT T T C A C C A A TGGG C T G C C AA A C A G G A T A 263

V.vulnificus 90 C T AC A TGAGC T TA A TTGGTG C G C CGAGT G AG C A 122 V.harveyi 261 C TA C ATGAG C TT G ATTGG TA C G CC TTCA GA G C A 293 V.cholerae 261 C TA C ATGAG C TT G ATTGG TG C G CC GACA GA A C A 293 E.coli 261 T TA T ATGAG T CT G ATTGG TA C G CC AGAT GA G C A 293 S.typhi 265 A T GA GCCTG A TT G GCACG CC GG AC GAGC AGC GT 297 C.jejuni 261 T T AT A TGAG T TT A A TTGG AA C A CC TGAT G AGA A 293 H.influenza 261 T TA T ATG T CT T T G A TTGG CA C A C C AAAT G A A C A 293 Y.pestis 200 C TA C ATG AG 208 B.anthracis 264 C T A C C T T GTAG T A A GC G G AA C A C C GACA G TT C G 296

V.vulnificus 123 AGACG T GG C ATCT G CG T GGACG G CTT C G A TGG A 155 V.harveyi 294 GCAAG T GG C TGAC GC T TGG ATT GC CG C G ATG G A 326 V.cholerae 294 GCAAG T GG C ACAA GC A TGG CTA GC CG C A ATG C A 326 E.coli 294 GCGTG T TG C TGAT GC C TGG AAA GC GG C A ATG G A 326 S.typhi 298 GTTGC CGA C GCTT G GA AAG CGG CGAT GG CGG A T 330 C.jejuni 294 AAGTA T TG C AAAA G CT T GG GAA G CAG C C A TG A A 326 H.influenza 294 GAAAG T GT C TGAG G C T T GG TTA G C TT C A A TG C A 326 B.anthracis 297 AGAAA 301

V.vulnificus 156 A GAT G TGT T GAAA G TGGAAAGC C AAAACAAG A T 188 V.harveyi 327 AGA C GT AC T AAAA GT AGAAAAC CA AAACAAG A T 359 V.cholerae 327 AGA T GT GT T GAAA GT TGAAAGC CA AGAGCAA A T 359 E.coli 327 AGA C GT GC T GAAA GT GCAGGAT CA GAATCAG A T 359 S.typhi 331 GTGC TGAA AGTGC AGGATCAAA ACCAGATCC CG 363 C.jejuni 327 A GAT G TTT T AAGC G TAAGCGAT C AAAGCAAA A T 359 H.influenza 327 A GA T G T TT T AGGT G T ACAAGAT C A AGCTTCT A T 359

V.vulnificus 189 C C CT G AGT T G A ACGAG T AT C AG T GT G GT A CCGC 221 V.harveyi 360 C CC T GA GT T G AA CGAA TA C CA A TG T GG T A CAGC 392 V.cholerae 360 T CC T GA GC T G AA TGAG TA C CA G TG C GG C A CTGC 392 E.coli 360 C CC G GA AC T G AA CGTC TA C CA G TG T GG C A CTTA 392 S.typhi 364 G AGC TGAA CG TTTACC AGT GCG GTA CG T A TCAG 396 C.jejuni 360 T C CT G AAC T T A ATATC T AC C AA T GC GG A A CTTG 392 H.influenza 360 T C C T G A AT T A A A TATC T A T C A A T G C G G A A GCTA 392 214

Figure 5.7. Continued

V.vulnificus 222 GGCC A CG C AC T CGC T AG A T G AA G CGNNCCAA A T 254 V.harveyi 393 AGCG A TG CA C TC TC T GG A T GA A GC GAAGCAA A T 425 V.cholerae 393 GGCG A TG CA C TC GC T CG A A GA A GC CAAAGCG A T 425 E.coli 393 CCAG A TG CA C TC GT T GC A G GA A GC GCAGGAT A T 425 S.typhi 397 ATGC A CT C GC TC AG T GA A G CGC AGGACATTG CC 429 C.jejuni 393 CGCA A TG C AT TC TT T AG A T G AA G CCAAACAA A T 425 H.influenza 393 TACG GAA C A T T C CT T AG A A G A T G C ACACGAA A T 425

V.vulnificus 255 C G CGCAG A ACA T TC T G G CAGCA G GAAANTCGG T 287 V.harveyi 426 C GC GAAG A ACA T TC T A G AAGTG GG TGTGGCGG T 458 V.cholerae 426 T GC GAAA A ACG T GA T T G CGGCA GG CATCTCGG T 458 E.coli 426 T GC GCGT A GCA T TC T G G AACGT G ACGTACGCA T 458 S.typhi 430 C G TCATA TTCT GGA GC G TGATG T G CGCGTGAA C 462 C.jejuni 426 T G CCCAA A AAG T TT T A AATCTA GG TATTAGCA T 458 H.influenza 426 T G C CAAA A ATG T TA T C G CACGC G G TATAGGTG T 458

V.vulnificus 288 G A AT A AA A ACG A T G AAT T GGCA C TGCNAG A A 318 V.harveyi 459 G A AT A AG AA TG A T GA AT T GGCA CT GCCAG A GTC 491 V.cholerae 459 T A AC CGT AA CG A T GA GT T GGCG CT GCCCG A ATC 491 E.coli 459 C A AC A GC AA CG A A GA AC T GGCA CT GCCGA A AGA 491 S.typhi 463 A GCA A TA AA GA GC TGGC GCTGC C GAAAGA A AAA 495 C.jejuni 459 A A TA A AT AA CA A A G AAT T AAAA C TCGAGA A TGC 491 H.influenza 459 A A AT A AA A A TG A A G A TT T GTCA C T CGATA A TTC 491

V.harveyi 492 AATGCTGAGAGAGCTACGCATCGACTAA 519 V.cholerae 492 TATGCTCAATGAGCTGAAGGTTCACTAA 519 E.coli 492 GAAGTTGCAGGAACTGCACATCTAG 516 S.typhi 496 CTG 498 C.jejuni 492 TTAAAAAG 499 H.influenza 492 CTTATTAAAATAGGAAGAC 510 215

Figure 5.8. Construction of the smcR mutant, Vibrio vulnificus DM7.

The following steps were performed to make a null mutation in the smcR gene.

The sacB gene from pCVD442 was excised as a EcoRV-PstI fragment and was inserted into the EcoRV-PstI site of pLG401 at the 5' position relative to the promoterless gfp gene to make the suicide delivery plasmid pMacSB (Step 1).

The smcR gene was PCR amplified, ligated into pUC19 and transferred into the

EcoRI-HindIII site of pBluescriptII SK to make the plasmid pSmcR8.18. The streptomycin resistance cassette from pCAM140 was excised as a BamHI fragment and inserted into the BglII site of pSmcR to generate the plasmid pSmcR.SM (Step 2). The disrupted smcR gene from pSmcR.SM was amplified by PCR and ligated into the EcoRV site of pMacSB to make pMacSmcRK (Step

3). The plasmid pMacSmcRK was conjugated into V. vulnificus C7184 (O) and colonies that were streptomycin resistant and chloramphenicol sensitive were isolated (Step 4). Confirmation of the mutant was made by Southern hybridisation and by PCR; one mutant, V. vulnificus DM7, was chosen for further characterisation. The orientation of the smcR gene with its streptomycin insertion as well as the orientation of the genes 5' and 3' of smcR is shown. Arrows above the genes indicate the direction of transcription for smcR, lpd (encoding dihydrolipoamide dehydrogenase in E. coli), hpt (encoding hypoxanthine ribosyltransferase in E. coli) and the gene for streptomycin resistance, Sm/Sp. mob, Cmr, ori, gfp, and sacB refer to genes that code for plasmid mobilisation, chloramphenicol resistance, green fluorescent protein, and sucrose sensitivity respectively. 216

EcoRV PstI pCVD442 sacB Step 1 + EcoRV PstI pLG401 mob Cmr ori gfp pMacSB

BamHI BamHI pCAM140 Sm/Sp Step 2 + EcoRI HindIII pSmcR8.18 smcR pSmcR.SM

BglII PCR amplification

smcR Sm/Sp smcR + Step 3 pMacSB mob Cmr ori sacB gfp pMacSmcRK

EcoRV

pMacSmcRK + V. vulnificus C7184 (O) Step 4

hpt smcR Sm/SP smcR lpd V. vulnificus DM7 217

homologous recombination. This disruption was confirmed in one of the clones,

V. vulnificus DM7, by Southern hybridisation using a probe that binds to the 5' half of the gene (see above). The V. vulnificus DM7 mutant had a chromosomal band shift when compared to the wild type band. Further confirmation was obtained by PCR.

5.4.2.1 Capsule production by V. vulnificus DM7

In Vibrio parahaemolyticus, mutation of the V. harveyi luxR homologue, opaR, results in the loss of capsule production (312). V. vulnificus produces an extracellular polysaccharide capsule that is regulated by growth phase and environmental conditions (558), and in addition, produces translucent mutants that synthesise reduced levels of capsular material (469). The smcR mutation was thus evaluated for its effect on capsule production in V. vulnificus. The appearance of colonies on LB agar plates of the wild type and mutant were similar (data not shown), indicating that V. vulnificus DM7 is able to produce capsule. However, colonies of DM7 on DVNSS (low nutrient plates) were extremely mucoid when compared with the wild type strain, C7184(O) (Fig. 5.9).

These results indicate that the decrease in capsule production that occurs when cells are plated on low-nutrient media is due, either directly or indirectly to a functional SmcR. 218

5.4.2.2 smcR affects motility, fimbriation and biofilm formation

During routine growth in LB broth, DM7 often appeared to clump. We therefore investigated the effect of the mutation on motility, fimbriae production and biofilm formation. In order to test the effect on motility, we inoculated C7184(O) and DM7 into LB and grew cultures at 37°C with aeration to exponential phase.

These cells were inoculated into motility agar (LB with 0.3% agar) (Bacto Difco agar, Difco Laboratories) as a stab in the centre of plates and incubated 16 hours at 37°C. The rate of motility of the mutant strain was significantly faster than the wild type, with the mutant covering the plate within 16 hours (Fig. 5.10). Similar results were obtained when motility agar plates were incubated at 30°C (data not shown).

In order to observe extracellular appendages on the wild type and mutant strain, electron microscopy was performed on stationary phase cells. Cells were grown overnight in LB at 37°C with aeration, washed in phosphate-buffered saline

(PBS) and fixed by the addition of 2% glutaraldehyde to a final concentration of

1% (w/v). Nearly all of the wild type cells observed lacked fimbriae and flagella while the mutant cells usually possessed both (Fig. 5.11). V. vulnificus has been reported to produce type IV pili (403) that are required for adherence to HEp-2 cells. The appearance of the surface appendages shown here is the same as that reported for the type IV pili. 219

Figure 5.9. smcR regulates capsule production in V. vulnificus.

A null mutation in smcR was demonstrated to increase capsule production under some growth conditions. Cells of V. vulnificus C7184 (O) and the smcR mutant

(DM7) were grown in LB with 20 g l-1 NaCl at 37°C with aeration to exponential phase. Cells were serially diluted in 0.5 X NSS salts, plated onto DVNSS agar plates and incubated at 37°C for 24 hours. 220

Figure 5.10. V. vulnificus lacking SmcR is hypermotile.

Cells of V. vulnificus C7184(O) and DM7 (smcR::Sm) were grown overnight in

LB medium. Fresh LB was inoculated at a 1:100 dilution and the cultures grown to mid exponential phase at 37°C. Cells were inoculated as a stab into LB motility agar containing 0.3% agar (Bacto Difco agar, Difco Laboratories) and incubated at 37°C for 16 hours. 221

Figure 5.11. SmcR affects fimbriation.

V. vulnificus C7184(O) and DM7 were grown in LB at 37°C overnight. Cells were washed in PBS and fixed by the addition of 2% glutaraldehyde to a final concentration of 1% (w/v). Fixed cells were allowed to adhere onto a 200 mesh carbon-coated grid and were negatively stained with 2% uranyl acetate in water.

Negatively-stained cells of V. vulnificus C7184(O) (A) and DM7 (smcR::Sm) (B and C) were examined and photographed with a Hitachi H-7000 transmission electron microscope operating at 75 kV. The cell shown in B has numerous fimbriae and the one shown in C has both fimbriae (black arrows) and a sheathed polar flagellum at the left lower corner. Bars represent 1 µm. 222

Figure 5.11. Continued 223

Because fimbriae have been demonstrated to play a role in attachment and biofilm formation, we tested the ability of the mutant to attach and form biofilms. The smcR mutant strain formed more biofilm (507% of the wild type biofilm) in the microtiter plates than the wild type, which formed very little biofilm (Fig. 5.12).

This increased biofilm formation by the mutant correlates with the electron microscopy data (Fig. 5.11) which demonstrates that the mutant has more fimbriae than the wild type.

5.4.2.3 Exoenzyme production

Various substrates were used to determine if the exoenzyme profile of the wild type is affected by the smcR null mutation. We observed no significant differences in haemolytic activity as assayed by overnight growth on blood agar as both the V. vulnificus C7184(O) and DM7 created similar zones of hemolysis

(data not shown). Similarly, no significant differences were seen in siderophore production as assayed by the CAS assay (456) (data not shown).

Alkaline phosphatase activity was determined as described by the manufacturer

(Sigma manual, Sigma Chemical Co., St. Louis MO, USA). The alkaline phosphatase activity of supernatants obtained from cells grown in LB at 37°C for

24 h is shown in Fig. 5.13. The results are presented as alkaline phosphatase activity per cell (OD540 nm/OD610 nm). The smcR mutant produces 2.5 fold more alkaline phosphatase activity in an overnight culture than the wild type. 224

750

500

250

0 C7184(O) DM7

Figure 5.12. Biofilm formation by smcR mutant cells.

The ability of V. vulnificus smcR mutant cells (DM7) to form biofilms was compared to that of the wild type (C7184(O)). Cells were grown in LB and added to microtiter plates at an OD610 = 0.1 nm. Six replicate wells were run for each strain and the average attachment of the wild type strain was set at 100%. Results presented here are representative of results obtained in at least 3 independent experiments. 225

1.5

1.0

0.5

0.0 C7184(O) DM7

Figure 5.13. The expression of alkaline phosphatase activity.

V. vulnificus C7184(O) and DM7 (smcR::Sm) were grown overnight at 37°C in

LB with shaking at 200 rpm. Cell-free supernatants were prepared by centrifugation of the culture at 10,000 X g for 10 min and filtration of the supernatant through 0.2 µm filter membranes. The phosphatase assay was performed according to manufactures recommendations. Alkaline phosphatase activity per cell was determined by absorbance at 450 nm / OD 610 nm. Bars indicate standard deviation. 226

When the smcR mutant was assayed for exoprotease production, it was discovered that there is an earlier expression of protease activity and the final amount of protease in the supernatant during late stationary phase growth was always higher.

Typical results for exoprotease expression by cells of V. vulnificus C7184(O) and

DM7 are represented in Fig. 5.14. Cells grown in LB at 24°C (A and C) and at

37°C (B and D) and exoprotease activity was determined by degradation of HPA

(A and B), azocasein (C and D) and elastin-Congo red (E) substrates. The results are presented as protease activity per cell. In all cases, the protease expression of the smcR mutant occurred earlier and the final activity was higher than for the wild type strain.

The ability of the signal antagonist, furanone compound 2 (C2), to inhibit protease production was tested due to the fact that signals were implicated in the regulation of proteases (Fig. 5.15). Growth of V. vulnificus C7184(O) in the presence of C2 inhibited protease production, indicating that the signal transduction pathway is important for protease activity. The concentration of C2 used was not growth inhibitory. In V. cholerae, a mutation in the luxR homologue, hapR resulted in a loss of HA/P expression (219). Our results indicate that, unlike hapR in V. cholerae, smcR is involved in the repression of protease expression during exponential growth rather than its induction. 227

A 10.00 0.2

1.00

0.1 0.10

0.0 0.01 0 10 20 30 40 Time (Hours)

Figure 5.14. Exoprotease activity of V. vulnificus C7814(O) and DM7 (smcR::Sm).

Cultures of V. vulnificus C7814(O) (, n) and DM7 (m, l) were grown in LB at

37°C with shaking at 200 rpm on a rotary shaker. At various time points, aliquots were removed and cell-free supernatants prepared by centrifugation (10,000 X g;

10 min) followed by filtration of the supernatant through 0.2 µm filters.

Exoprotease activity (closed symbols) was assayed by degradation of HPA (A and B), azocasein (C and D) and elastin-Congo red (E) at 37°C (A, C and E) or

24°C (B and D). Results are presented as the exoprotease activity per cell and are representative of at least three independent experiments. 228

Figure 5.14. Continued

B 10.00 0.2

1.00

0.1 0.10

0.0 0.01 0 10 20 30 40 Time (Hours) C

0.75 10.00

0.50 1.00

0.25

0.10 0.00

-0.25 0.01 0 10 20 30 40 Time (Hours) 229

Figure 5.14. Continued

D

0.75 10.00

0.50 1.00

0.25

0.10 0.00

-0.25 0.01 0 10 20 30 40 Time (Hours) E

0.3 10.00

0.2 1.00

0.1 0.10

0.0 0.01 0 10 20 30 Time (Hours) 230

0.3

0.2

0.1

0.0 C7184T C7184T + C2

Figure 5.15. Furanone compound 2 inhibits production of exoprotease in V. vulnificus.

V. vulnificus C7184(T) was grown in 2M with aeration at 37°C. Furanone compound 2 (C2) was added at mid-exponential phase and growth was allowed to proceed to early stationary phase at which time samples were collected for the preparation of cell-free supernatants. Protease activity was determined by the addition of 1 mg ml-1 HPA to 2 ml of supernatant. Triplicate samples were incubated at 37°C for 4 hours, at which time the supernatant was collected by centrifugation and the optical density at 595 nm was determined. Results are presented at protease activity per cell (OD595 nm / OD610 nm). 231

5.5 DISCUSSION

The majority of investigations of quorum-sensing systems endeavour to determine the mechanisms whereby bacteria are able to coordinate their phenotypic expression at the population level. In both the host - pathogen interaction, and in the external environment, sensing the quorum allows for coordination of gene expression at an appropriately high cell density. The ability of bacterial cells to delay expression of virulence factors until the cell population is large enough to overcome the host immune response allows the population to persist and cause infection.

Vibrio vulnificus produces an extracellular, polar molecule that induces luminescence in Vibrio harveyi BB170, which has the signal- sensing phenotype sensor 1-, sensor 2+ and is therefore only induced via the system 2 signalling pathway. Multiple strains of V. vulnificus were demonstrated to produce this signal. In addition, the molecule is produced at 37°C and 24°C as well as in complex and minimal media, while the addition of glucose to complex media results in inhibition of signal production. Maximal signal production occurs upon entry into the stationary phase of growth. The most interesting feature of signal production in V. vulnificus is its induction in cells, which have been shifted from exponential growth to starvation conditions.

Furthermore, genes were identified in V. vulnificus, smcR and luxS, that are apparent homologues of signal-related genes in V. harveyi (315). All six of the

Vibrio strains tested, Vibrio anguillarum, Vibrio angustum, Vibrio alginolyticus, 232

V. vulnificus, Vibrio cholerae, and V. harveyi, contained homologues of the smcR gene. The amino- and carboxy-terminal translated regions of the four reported luxR homologues are similar for V. harveyi, V. vulnificus, V. cholerae, and Vibrio parahaemolyticus. All four of the luxR ORFs described have a divergently transcribed homologue of hpt (hypoxanthine ribosyltransferase) located upstream.

In V. vulnificus and V. parahaemolyticus, the ORFs are followed by a homologue of lpd (dihydrolipoamide dehydrogenase). Coupled with the identification of an extra-cellular, polar factor that stimulates the V. harveyi AI-2 responder, it would appear that V. vulnificus has an AI-2 signalling pathway. The identification of

AI-2 signals and signal related genes in this organism and many others would suggest that the AI-2 pathway is widely dispersed amongst bacteria. For example, the induction of luminescence in V. harveyi BB170 has been reported for Yersinia (28) and highly conserved luxS homologues have been discovered in a wide range of Gram-negative and Gram-positive bacteria (496) including

Mycobacterium, Bacillus, Pasteurella and Borrelia. Similarly, phylogenetic analysis of these genes identified in organisms as widely dispersed as V. harveyi and Bacillus (315, 496), would suggest that the genes needed to accomplish the

AI-2-mediated signalling pathway, are an ancient system and may have been present since these organisms diverged. It should be noted however, that the number of organisms tested for AI-2 activity is still relative small, thus the significance of the large number of organisms containing identified luxS homologues awaits further clarification. 233

While the general features of the AI-2 systems appear to be highly conserved across a broad range of genera and species, some of the specific features of the system clearly differ and may reflect individual adaptation of the AI-2 system to the specific needs of particular bacteria. In Escherichia coli for example, it has been reported that at least one extracellular signal is resistant to pH 12 for 20 min,

100°C for 10 min and is produced in LB without glucose (553) during the entry into stationary phase. However, it has also been reported that an extracellular signal molecule produced by some strains of E. coli and Salmonella typhimurium and able to induce the V. harveyi AI-2 monitor strain is only produced in LB with the addition of glucose in exponential phase and is inactivated at 100°C (495).

The factor produced by V. vulnificus is heat labile at 100°C but is produced during late exponential and early stationary phase. Perhaps the most interesting feature of the signal produced by V. vulnificus is its repression by glucose addition, which clearly suggests that there are differences in the regulation of production of these molecules amongst different bacteria. These data indicate that there may be more than one AI-2 factor, where the AI-2 factors produced by different bacteria or strains of bacteria share a basic structure but also are slightly different. By analogy, there are a range of AHL molecules that vary by the length of the acyl chain (e.g. C6-HSL, and C4-HSL), substitution at the third carbon on the chain (e.g. C6-HSL and 3-oxo C6 HSL), or by the degree of saturation of the acyl chain (e.g. 3-OH, C14:1 HSL) and these modifications of the basic AHL structure may contribute to vastly different physical or chemical properties of the signal molecules. 234

A mutation in the smcR gene does not affect the ability of the cells to produce signal molecules. This would suggest that the production of the AI-2 signal is not regulated via an auto-induction circuit in V. vulnificus. Therefore, signal production may be controlled through other regulators, such as those that regulate entry into stationary phase or signal production may be constitutive and the response to the signal may be controlled in a growth phase dependent fashion.

Furanone compound 2 does, however, inhibit the expression of a major virulence factor in V. vulnificus, the signal-regulated metalloprotease. Therefore, the furanone appears to be a useful tool for exploring signal-regulated phenotypes as well as having potential application for the control of virulence in pathogens.

In V. parahaemolyticus, disruption of opaR, a homologue of the V. harveyi luxR, in an opaque genetic background results in transformation of the strain to the translucent morphotype (312). V. vulnificus also experiences the opaque to translucent conversion; in addition, the expression of capsular polysaccharide

(CPS) is environmentally regulated (558). Cell surface expression of CPS in wild types strain of V. vulnificus varies with growth phase, increasing during logarithmic growth and declining in stationary phase (558). The timing of CPS repression in those studies (558) correlates with the time where we observe increases in signal production. Unlike V. parahaemolyticus, however, a null mutation in smcR results in an increase in capsule production under some environmental conditions. It is therefore possible that smcR is responsible, either directly or indirectly, for the decrease in CPS production seen in stationary phase cells. In El Tor strains of V. cholerae, deletion of the luxR homologue, hapR, 235

leads to conversion of the translucent morphotype to the opaque or rugose morphotype (219). This data would suggest that hapR functions as a repressor of

CPS production, which appears to be similar to the effects observed for other phenotypes in V. vulnificus.

Indeed, it has been previously suggested that LuxR may function as a repressor.

For example, in V. harveyi LuxR binds independently to two sites upstream of its own open reading frame (68). Results from experiments using a cat transcriptional fusion to the luxR promoter reveal a repression of transcription from the luxR promoter as a result of possibly interfering with and displacing

RNA polymerase from the promoter (68). Furthermore, LuxR has not been shown to have an activator domain. Transcriptional run-off experiments have shown that luxR expression is required to alter the transcription start site of the lux operon from the -123 location to the -26 location by repressing transcription from

-123 but has not been shown to induce transcription from the -26 site (498). This would indicate that LuxR induces the lux operon by repressing one of the transcription start sites, thereby shifting RNA polymerase binding to the -26 site.

Furthermore, LuxR is a member of the TetR family of transcriptional regulators which act as repressors (190). Taken together, these data indicate that the primary function of the LuxR regulator, at least in some organisms, may in fact be repression of gene transcription rather than activation. It is clear, however, that in

V. cholerae and V. parahaemolyticus, LuxR acts as an activator of protease expression and capsule production respectively. SmcR in V. vulnificus appears to act both as an activator and repressor. 236

The possibility that LuxR can function as a repressor fits with the phenotypes we observe in the smcR mutant in V. vulnificus. For example, deletion of the gene leads to an up-regulation of protease production, alkaline phosphatase production, fimbriation, motility and biofilm formation. In the wild-type strain, these phenotypes are induced at the onset of or early in stationary phase. In support of our hypothesis that SmcR acts as a repressor, the mapping of the time of induction of enzyme activity also occurs earlier than in the wild type, suggesting that the mutant is impaired in the timing of stationary-phase gene expression. If the smcR is acting as a repressor, it may function to repress stationary phase phenotypes in exponential phase, and this repression may be relieved at the onset of stationary phase or upon nutrient deprivation. It seems likely that signal production and recognition, which occurs at the transition into stationary phase or shortly after entry into starvation, when these phenotypes are normally expressed, may be the mediator of this relief of repression.

Furanone compounds produced by the red marine alga Delisea pulchra, have the ability to act as signal antagonists, thereby inhibiting signal-dependent phenotypes (294, 480) (156, 161). This chapter presents data that demonstrates that the furanone compound 2 inhibits the expression of a major virulence factor in V. vulnificus, the signal-regulated metalloprotease, but does not inhibit the production of signal molecules. The observation that a signal antagonist has the ability to inhibit protease expression further supports the suggestion that this is a signal-related phenotype. Furanones may serve as useful tools for exploring 237

signal-regulated phenotypes as well as having potential application for the control of virulence in pathogens.

Due to the pleiotropic effects of the smcR mutation in V. vulnificus, it is tempting to speculate that SmcR acts either as a global regulator of stationary phase genes or that SmcR regulates other global regulators, such as the stationary phase regulator, RpoS. It is also possible that SmcR acts through pathways, such as the

ToxR signal transduction system. It has been shown that ToxR regulates expression of type IV fimbriae in V. cholerae and that ToxR mutants exhibit increases in swarming, protease production and attachment to HEp-2 cells (146).

Whatever the mechanism of control, it is apparent that the signalling system 2 investigated here is involved, either directly or indirectly, in the regulation of stationary phase regulated virulence factors in V. vulnificus.

5.6 ACKNOWLEDGMENTS

I would like to thank Bonnie Bassler for her gift of the V. harveyi reporter strains,

Evi Fuary for performing biofilm experiments and Scott Rice for assistance with sequencing and sequence analysis. 238

6 STARVATION ADAPTATION IN Vibrio vulnificus IS

REGULATED BY CELL TO CELL SIGNALLING

6.1 ABSTRACT

This chapter characterises the effect of the smcR null mutation in Vibrio vulnificus on starvation adaptation at room temperature and on the starvation-induced delay of VBNC formation at low temperature. The previous chapter reported that the smcR mutant is up-regulated in numerous phenotypes that are normally expressed in the stationary phase of growth. The earlier and increased final expression of those stationary phase-related phenotypes suggests that SmcR is a repressor of stationary genes in exponential phase. This chapter reports that the smcR mutation results in a defect in starvation survival as well as inhibition of the starvation-induced maintenance of culturability (SIMC) response. This response occurs when V. vulnificus is starved prior to low temperature incubation and results in a delay in the formation of nonculturable cells. In addition, a furanone signal antagonist that has been demonstrated to inhibit signalling systems (294), is shown to inhibit the SIMC response. The addition of supernatant extracts, which contain signals that activate the AI-2 system of Vibrio harveyi, from both V. vulnificus and Vibrio angustum inhibited the effect of the signal antagonist in a dose dependent manner. These results provide evidence for the involvement of signal system 2 in the regulation of starvation adaptation in V. vulnificus and indicate that signalling molecules may play a role in the regulation of starvation and stationary phase phenotypes in other organisms. 239

6.2 INTRODUCTION

Vibrio vulnificus has been isolated from temperate and tropical waters throughout the world (193, 394, 435, 556). At water temperatures below 10°C, the number of culturable cells of V. vulnificus drops below detection. It is now known that this organism survives low temperature by entering a viable but nonculturable

(VBNC) state (313, 387). It has been demonstrated that starvation of V. vulnificus prior to shifting cells to low temperatures induces the starvation-induced maintenance of culturability (SIMC) response which delays the induction of the

VBNC response (384, 402). This would suggest that starvation-induced or stationary phase genes are important for the adaptation of this organism to a variety of stress conditions.

Many bacteria utilise small extracellular molecules, which are secreted and can be perceived, in the regulation of gene expression in response to cell-density. Many of these signal-regulated phenotypes are induced during stationary phase. Thus, it is also possible that signal molecules may be used by some bacteria for the regulation of stationary phase or starvation phenotypes, rather than for cell- density regulation per se. For example, Rhizobium leguminosarum (162) and

Pseudomonas aeruginosa (569) use diffusible signal molecules to induce stationary phase; conditioned supernatants have been shown to induce carbon- starvation proteins in Vibrio angustum (480); and a dependence on the signal system has been demonstrated to control long-term survival of carbon and nitrogen starvation in R. leguminosarum (514). A mutation in smcR in V. vulnificus, a homologue of the Vibrio harveyi luxR, was previously demonstrated 240

to effect several phenotypes whose expression is normally induced in the stationary phase of growth (315) (Chapter 5). In addition, the production of an

AI-2 signal molecule, as determined by induction of the V. harveyi system 2 reporter strain, was induced upon starvation, which further suggested a role for the signal system 2 in starvation adaptation in V. vulnificus (315) (Chapter 5).

This chapter presents evidence that this signal system in involved in starvation adaptation in V. vulnificus.

6.3 MATERIALS AND METHODS

6.3.1 Bacterial strains and culture conditions

Vibrio vulnificus C7184 is a clinical isolate obtained from the drainage of a hand wound (394). The designation (T) refers to translucent and (O) to opaque colony morphologies on agar plates, which is related to capsular polysaccharide production. Vibrio angustum was isolated from surface marine water taken near

Botany Bay, Australia (206). Strains of V. vulnificus were maintained at -70°C in

Luria-Bertani (LB) (324) broth (10 g tryptone (Oxoid), 5 g yeast extract (Oxoid) and 10 g NaCl per litre of distilled water) containing 15% (vol/vol) glycerol

(Research Organics), while V. angustum was maintained in LB with 20 g NaCl per litre. Where specified, glucose was added from a filter-sterilised 20% stock to a final concentration of 0.4% for 2M and MMM.

For starvation and cold incubation experiments, cells were grown in LB with 20 g l-1 NaCl overnight at room temperature, transferred to fresh medium at a dilution 241

of 1:50 and grown overnight. Cells were then transferred to fresh medium at a dilution of 1:100. The cells were grown to mid-exponential phase and harvested by centrifugation (10,000 X g, 10 min, 24°C, Beckman Avanti J-25 I centrifuge,

JA 25.50 rotor) (Beckman Coulter, Inc., Fullerton, Ca. USA) and washed twice in

0.5 X NSS (402) for V. vulnificus and 1 X NSS in the case of V. angustum. Cells were resuspended in 2M medium lacking glucose (2M-C) (384, 402) or MMM

(397) in the case of V. angustum at 1:100 dilution. Agar (Research Organics) was added to a concentration of 1.5% for solid media.

For cold incubation experiments with V. vulnificus, cells that had been washed and resuspended in starvation medium as described above, were left to starve at room temperature for the time indicated before being shifted to 4°C. In experiments conducted with the addition of the signal antagonist, furanone compound 2 (91), the compound was dissolved in EtOH at a concentration of 20 mg ml-1 and added to cultures at a concentration of either 2 or 5 µg ml-1 at the indicated times. Control samples were amended with EtOH to account for the addition of solvent. Furanone compound 2 was synthesised and purified by Dr.

Roger Read and Dr. Naresh Kumar. The synthesis and structure of the furanone compound has been previously described (295).

6.3.2 Determination of colony forming units

To assess the culturability of V. vulnificus upon starvation and cold incubation, and the culturability of V. angustum upon starvation, samples were taken at the indicated times and diluted in the respective starvation medium. Drop plate 242

counts were performed as described by Hoben and Somasegaran (191) on VNSS agar plates (377) [V-medium modified from Väätänen (522)] or, in the case of V. vulnificus on DVNSS (402) containing 50% of the reported salt concentrations to equal the growth and starvation medium. Plates were dried and incubated for 24 h at 24°C before the assessment of colony forming units (CFU). Prolonged incubation of plates at room temperature for up to 7 days revealed no further colony development.

6.3.3 Preparation of supernatant extracts

For the generation of supernatant extracts, V. vulnificus and V. angustum strains were grown in either 2M or MMM with glucose. The following morning, fresh medium was inoculated at a 1:100 dilution and the cultures were grown to mid- exponential phase. Cells were collected and washed as described above and the cells resuspended in 0.5 or 1 X NSS. Cultures were allowed to starve for 4 hours at room temperature before collection of the supernatant. Cells were removed by centrifugation of cultures (15,000 X g, 4°C for 20 min in a Beckman Avanti J-25

I centrifuge, JLA 16.250 rotor) followed by filtration of the supernatant through

0.2 µm pore size filters (Supor Acrodisc, Pall Gelman Laboratories, Ann Arbor,

MI). Supernatants were frozen at -20°C until used.

For supernatant extractions, two volumes of the supernatants were extracted with one volume of dichloromethane (Omnisolv, HPLC grade) (DCM) three times.

The solvent was removed by rotary evaporation at 30°C and the dried extract was 243

dissolved in EtOH to a stock concentration of 5 mg ml-1. Media, either 2M or

MMM, was extracted as described above and used for control samples.

6.4 RESULTS

6.4.1 A null mutation in smcR affects starvation survival of V. vulnificus

The phenotypes so far examined in the smcR mutant all are stationary-phase regulated (Chapter 5). In order to determine whether smcR is involved in survival during starvation, cells of Vibrio vulnificus C7184(O) and DM7 were grown to

-1 early exponential phase in LB with 20 g l NaCl (OD610 nm = 0.22), washed in

0.5 X NSS and resuspended in 2M-C. The results for samples maintained under starvation conditions at room temperature are shown in Fig. 6.1. There was an initial decrease of 76% in the CFU for the mutant strain after one day and no decrease for the wild type strain before 6 days. After 14 days of incubation at room temperature, the smcR mutant strain exhibited a decrease of 91% of the

CFU while the wild type only exhibited a loss of 70% of CFU. The loss in CFU for the two strains was not significantly different after the first 20 days of incubation. These results indicate that smcR is important for starvation survival, especially in the early stages (first 2 weeks) of starvation. 244

1.0x1003

1.0x1002

1.0x1001

1.0x1000 0 10 20 30 40 50 Time (Days)

Figure 6.1. SmcR affects starvation survival at room temperature.

V. vulnificus C7184(O) (n) and DM7 (smcR::Sm) (l) were grown to mid- exponential phase in LB with 20 g l-1 NaCl, the cells collected by centrifugation

(10,000 X g; 10 min), washed in 0.5 X NSS and resuspended in 2M-C. Cultures were held statically at 24°C in the dark. Determinations of CFU were performed on DVNSS agar plates. Data are presented as percentages of the initial count (1.1

- 2.9 x 105 CFU ml-1) and are representative of three independent experiments.

Error bars represent the standard deviation. 245

6.4.2 A null mutation in smcR affects the culturability of V. vulnificus at

low temperatures in a starvation-dependent manner

The defect in starvation survival exhibited by the mutant prompted the investigation of its effect on the SIMC response. It has been previously demonstrated that starvation prior to low temperature incubation allows for the maintenance of culturability at low temperature in V. vulnificus (384, 402). This delay possibly allows cells to synthesise proteins which will be important in their survival and recovery when conditions are again favourable. The results in Fig.

6.2 indicate that the smcR mutant strain is defective in mounting this protective maintenance of culturability response. Cells of V. vulnificus C7184(O) and DM7

-1 were grown to early exponential phase in LB with 20 g l NaCl (OD610 nm =

0.22), washed in 0.5 X NSS, and resuspended in 2M-C. The cultures that were shifted to 4°C without pre-starvation showed very little differences in their loss of culturability. It should be pointed out that even the non-starved sample had been starved 30 minutes prior to shifting to 4°C owing to sample preparation times required for washing, pelleting and resuspending the cells. The cultures that were starved at room temperature before cold incubation exhibited a difference in the rate of loss of culturability (Fig. 6.2). By the third day of cold incubation, the mutant strain had lost 77% of the total CFU while the wild type strain only showed a decrease of 28%. This trend continued throughout the cold incubation. 246

1.0x1003 1.0x1002 1.0x1001 1.0x1000 1.0x10-01 1.0x10-02 1.0x10-03 1.0x10-04 1.0x10-05 1.0x10-06 0 10 20 30 40 50 Time (Days)

Figure 6.2. SmcR affects starvation-induced maintenance of culturability (SIMC) at low temperature.

V. vulnificus C7184(O) (, n) and DM7 (smcR::Sm) (m, l) were grown to mid- exponential phase in LB with 20 g l-1 NaCl, the cells collected by centrifugation

(10,000 X g; 10 min), washed in 0.5 X NSS and resuspended in 2M-C. Cultures were allowed to starve for 0 (open symbols) or 4 hours (closed symbols) before shifting to 4°C. Determinations of CFU were performed on DVNSS agar plates.

Data are presented as percentages of the initial count (1.1 - 2.9 x 105 CFU ml-1) and are representative of three independent experiments. Error bars represent the standard deviation. 247

6.4.3 Effect of a signal antagonist on the SIMC response in V. vulnificus

The data reported above indicate that SmcR either directly or indirectly affects the pre-starvation response. To further investigate the hypothesis that the starvation response is signal-regulated, we tested the ability of the signal antagonist, furanone compound 2, to inhibit the SIMC response. The marine red alga,

Delisea pulchra, produces furanone compounds that are secreted onto the surface of the plant, which prevent fouling by other organisms (308) [for a review, see

Rice et. al. (432)]. These compounds have been demonstrated to specifically interfere with intercellular signalling systems in bacteria (156, 161, 293, 294). In order to investigate the effect of furanone compound 2 on the SIMC response of

V. vulnificus C7184(T), cells were collected during early exponential phase, washed and resuspended in 2M-C with or without the addition of 2 µg ml-1 of furanone compound 2, and shifted to 4°C at time 0 or after 4 h starvation at room temperature. Results are shown in Fig. 6.3. Starvation of cells in the presence of compound 2 at room temperature prevents the SIMC response. These data further support the hypothesis that the signal system investigated here affects the starvation response.

6.4.4 Effect of supernatant extract from V. angustum on the SIMC response

of V. vulnificus

It has been previously reported that supernatants extracts from Vibrio angustum induced the up-regulation of a significant number of carbon starvation-induced proteins, as determined by 2D-PAGE analysis (480). It was therefore 248

A 1.0x1003

1.0x1000

1.0x10-03

1.0x10-06 0.0 2.5 5.0 7.5 Time (Days)

Figure 6.3. Furanone compound 2 can inhibit the starvation-induced maintenance of culturability (SIMC) at low temperature at concentrations that are not growth inhibitory.

V. vulnificus C7184(T) was grown to mid-exponential phase in LB with 20 g l-1

NaCl, the cells collected by centrifugation (10,000 X g; 10 min), washed in 0.5 X

NSS and resuspended in 2M-C (, n) or 2M-C with the addition of 2 µg ml-1 of compound 2 (m, l). Cultures were starved for 0 (open symbols) or 4 hours

(closed symbols) before shifting to 4°C. Determinations of CFU were performed on DVNSS agar plates. Data are presented as percentages of the initial count

(2.18 X 106 CFU ml-1) and are representative of three independent experiments

(A). To ensure that the concentrations of compound 2 used were not growth inhibitory, C7814(T) was grown in 2M in the presence of 2 µg ml-1 (B). Error bars represent the standard deviation. 249

Figure 6.3. Continued

B

1.0x1000

1.0x10-01 0 10 20 30 Time (Hours) 250

hypothesised that the addition of supernatant extracts from V. angustum to logarithmic cells of V. vulnificus may induce the up-regulation of starvation proteins, which we have demonstrated to be involved in the SIMC response (402).

If these carbon-starvation proteins were induced, then there may be an increase in culturability in cultures shifted to 4°C without prior starvation. While the signal molecule produced by V. angustum and V. vulnificus is a polar compound (see

Chapter 5), some of the signal activity can be extracted into the solvent phase.

Supernatant extracts were used in these experiments in an attempt to limit the addition of metabolic byproducts and excess media components.

In order to test whether supernatant extracts from V. angustum could induce the

SIMC response in V. vulnificus, cells of V. vulnificus C7184(T) were grown to early exponential phase at 24°C in 2M (OD at 610 nm = 0.15) at which time 50

µg ml-1 of supernatant extract from V. angustum or 50 µg ml-1 of media extract was added. Growth was allowed to continue until the optical density at 610 nm of the culture reached 0.4, at which time the cultures were shifted to 4°C. As can be seen in Fig. 6.4, the addition of supernatant extract from V. angustum allowed for an increase in culturability during low temperature incubation of V. vulnificus in the absence of starvation. After 1 day of incubation at 4°C, the samples with supernatant extract exhibited a culturability of 1.2% of the original sample, while the cultures with media extract added retained only 0.049% culturability. A difference of approximately 100-fold between the two conditions was maintained throughout the experiment. These data indicate that supernatant extracts from V. 251

1.0x1003

1.0x1000

1.0x10-03 0.0 2.5 5.0 7.5 Time (Days)

Figure 6.4. Effect of supernatant extract from V. angustum on SIMC in V. vulnificus.

Cells of V. vulnificus C7184(T) were grown to early exponential phase at 24°C in

2M (OD at 610 nm = 0.15) at which time 50 µg ml-1 of supernatant extract from

V. angustum (l) or 50 µg ml-1 of media extract (n) was added. Growth was allowed to continue until the optical density at 610 nm of the culture reached 0.4, at which time the cultures were shifted to 4°C. Determinations of CFU were performed on DVNSS agar plates. Data are presented as percentages of the initial count (5.53 - 9.3 X 108 CFU ml-1) and are representative of three independent experiments. 252

angustum were able to induce a SIMC response in V. vulnificus cells incubated at low temperature.

6.4.5 Supernatant extracts from V. angustum and V. vulnificus can provide

protection from the loss of culturability induced by compound 2

In addition to the induction of carbon starvation proteins by supernatant extracts in V. angustum, it was reported that these extracts could also rescue cells starved in the presence of compound 2 (480). V. angustum was shown to lose culturability when starved in the presence of compound 2 and simultaneous incubation with compound 2 and supernatant extracts resulted in a rescue effect; a significant increase in culturability during starvation was found. Since V. angustum supernatant extract was demonstrated to induce SIMC in V. vulnificus, as shown above, the ability of the supernatant extracts from these two marine

Vibrios was tested for their ability to rescue inhibitory effects exerted by furanone compound two in the non-native organism (Fig. 6.5 and 6.6).

The affect of the addition of V. vulnificus supernatant extracts to V. angustum cells starved in the presence of furanone compound 2 is shown in Fig. 6.5. Cells of V. angustum were collected during exponential phase by centrifugation and washed once in MMM without carbon. Cells were resuspended MMM-C in the presence of 5 µg ml-1 of furanone compound 2, MMM-C in the presence of 5 µg ml-1 of furanone compound 2 and 50 µg ml-1 of V. vulnificus supernatant extract or

MMM-C in the presence of 5 µg ml-1 of furanone compound 2 and 50 µg ml-1 of 253

1000

100

10

1 0 1 2 3 4 5 TIME (days)

Figure 6.5. Effect of the addition of V. vulnificus supernatant extracts to V. angustum cells starved in the presence of furanone compound 2.

Cells of V. angustum were collected during exponential phase by centrifugation and washed once in MMM-C. Cells were resuspended in MMM-C (n), MMM-C in the presence of 5 µg ml-1 of furanone compound 2 (s), MMM-C in the presence of 5 µg ml-1 of furanone compound 2 and 50 µg ml-1 of V. vulnificus supernatant extract (u) or 3M-C in the presence of 5 µg ml-1 of furanone compound 2 and 50 µg ml-1 of V. angustum supernatant extract (l). The supernatant extract and compound 2 were added to logarithmic cells at time 0 of carbon starvation. Determinations of CFU were performed on VNSS agar plates.

Data are presented as percentages of the initial count and are representative of three independent experiments. 254

100.000

10.000

1.000

0.100

0.010

0.001 0 2 4 6 8 TIME (Days)

Figure 6.6. Effect of the addition of V. angustum supernatant extract to V. vulnificus cells starved in the presence of furanone compound 2.

Cells of V. vulnificus were grown to exponential phase (OD at 610 nm = 0.2 to

0.3), collected by centrifugation (10,000 X g, 24°C, 10 min) and washed once in

2M-C. Cell were resuspended in 2M-C (n), 2M-C in the presence of 5µg ml-1 of compound 2 (s) or in the presence of 5µg ml-1 of compound 2 and 50 µg ml-1 of supernatant extract from V. angustum (l). Cells were incubated at room temperature for 4 h before being shifted to 4°C. Determinations of CFU were performed on DVNSS agar plates. Data are presented as percentages of the initial count and are representative of three independent experiments. 255

V. angustum supernatant extract. The supernatant extract and compound 2 were added to logarithmic cells at time 0 of carbon starvation. Results indicate that both supernatant extracts were able to counteract the loss of culturability of V. angustum that was induced by compound 2.

Fig. 6.6 shows the reciprocal effect of the ability of supernatant extracts from V. angustum to rescue cells of V. vulnificus that are starved in the presence of compound 2 prior to the shifting to low temperature. Cells of V. vulnificus were grown to exponential phase (OD at 610 nm = 0.2 to 0.3), collected by centrifugation (10,000 X g, 24°C, 10 min) and washed once in 2M-C. Cell were resuspended in 2M-C in the presence of 5µg ml-1 of compound 2 or in the presence of 5µg ml-1 of compound 2 and 50 µg ml-1 of supernatant extract from V. angustum. Cells were incubated at room temperature for 4 h before being shifted to 4°C and their culturability determined by plating of DVNSS agar plates. The addition of V. angustum supernatant extract was able to reduce the inhibitory effect seen in the presence of compound 2. Taken together, these results indicate that extracts of supernatants from starving Vibrio cells are able to counteract the inhibition of starvation adaptation experienced by cells starving in the presence of furanone compound 2.

6.5 DISCUSSION

Quorum sensing systems have been shown to regulate phenotypic expression in response to cell-density (141, 142, 225, 409). While this is the paradigm for some systems, such as the acylated homoserine lactone- (AHL) regulated signalling 256

system, recent discoveries suggest that signal molecules may regulate phenotypes that are not density-dependent. For example, signal molecules have been shown to regulate the induction of stationary phase in Rhizobium leguminosarum (514) and Pseudomonas aeruginosa (569) and to induce the carbon starvation response in Vibrio angustum (480). In addition, a quinolone signal discovered in P. aeruginosa has been shown to regulate one of the AHL systems in a density- independent manner during late stationary phase (30 - 42 hours post-inoculation)

(319). These reports suggest there is a density-independent system in some bacteria that regulates starvation and/or stationary phase phenotypes. The AI-2 system, first reported for Vibrio harveyi, investigated here may be one such density-independent regulatory system.

This chapter presents evidence that the signal system 2 in Vibrio vulnificus plays an important role in starvation adaptation and the viable but nonculturable

(VBNC) response. V. vulnificus enters a nonculturable state when exposed to low temperature (316, 384, 385). Entrance into the VBNC state is related to the physiological state of the cells as pre-starvation delays entrance into the VBNC state (402). This starvation-induced maintenance of culturability (SIMC) is dependent on the production of carbon starvation-induced proteins. It has been demonstrated in numerous species that starvation-induced protein synthesis prepares cells for survival during stress and may be important in the reactivation of cells when conditions are again favourable (151, 176, 221, 457) (215, 305). In the natural environment, it is likely that a proportion of V. vulnificus cells would encounter nutrient limitation prior to low temperature conditions. The production 257

of these starvation proteins may act to delay VBNC formation until the cells have become more stress-resistant, thereby providing the cells with a greater chance of survival during low temperature exposure and by increasing the chance of resuscitation upon an increase in temperature. The identification of the genetic determinants of this SIMC response could possibly help to determine if the

VBNC response is a genetically defined program.

Results presented here demonstrate that the loss of a functional smcR in V. vulnificus resulted in a defect in starvation survival at room temperature. In addition to the defect observed during room temperature starvation, the null mutation in smcR resulted in an inability of cells of V. vulnificus to induce the

SIMC response upon starvation prior to low temperature incubation. To our knowledge, this is the first report of the regulation of starvation adaptation by a luxR homologue. In addition to the defects in starvation adaptation that were demonstrated, the smcR mutant is also derepressed for numerous genes that are normally induced during the stationary phase of growth (Chapter 5) during exponential growth. The earlier and increased expression of stationary phase genes during exponential phase indicates that SmcR may act to repress expression of some stationary phase phenotypes during exponential growth. Therefore, while the specifics of the signal transduction pathway are currently unknown, it would appear that, based on analogies with other global regulators, SmcR is also a mediator of stationary phase physiology, including virulence factor production and starvation adaptation. 258

Furanone compounds produced by the red marine alga Delisea pulchra, have the ability to act as signal antagonists, thereby inhibiting signal-dependent phenotypes such as swarming in Serratia liquefaciens (156) and Proteus mirabilis

(161), and bioluminescence in Vibrio fischeri and V. harveyi (293). The data presented here demonstrates that the addition of furanone compound 2 blocks the starvation-mediated maintenance of culturability at low temperature in V. vulnificus. In addition, it is shown that addition of supernatant extracts from starving cultures of V. angustum have the ability to induce the SIMC response in exponentially growing cells of V. vulnificus, as determined by CFU during low temperature incubation. In fact, supernatant extracts from starving cells of either

V. vulnificus or V. angustum can rescue cells from the inhibitory effect that is induced by incubation in the presence of compound 2. This response was shown to be dose dependent (data not shown). Further support of the hypothesis that furanone 2 inhibits the signal transduction pathway in the signal system 2 has recently been obtained from the demonstration that compound 2 can inhibit the luminescence of V. harveyi BB170, the signal system 2 reporter strain (data not shown).

Data presented in this chapter shows that SmcR is important for starvation adaptation in V. vulnificus, as a null mutant was demonstrated to exhibit a loss of

76% of the initial CFU during the first 24 hours of carbon starvation at room temperature. It has also been demonstrated that a signal antagonist, which has been shown to specifically inhibit intercellular signalling pathways bacteria, can interfere with starvation adaptation responses in V. vulnificus and V. angustum at 259

concentrations that do not inhibit growth. Indeed, it has been previously demonstrated that furanone compound 2 inhibits the synthesis of carbon- starvation induced proteins in V. angustum and that supernatant extracts from starving cultures of V. angustum were able to counteract the inhibitory action of the furanone (480). Thus it is suggested that starvation adaptation is a signal- regulated response in these organisms, and that SmcR described in V. vulnificus is involved in the regulation of starvation adaptation. Future work in this area will undoubtedly provide us with a more detailed knowledge of the signal transduction pathway and its coordination with starvation and stress adaptation in marine bacteria.

6.6 ACKNOWLEDGMENTS

I would like to thank Sujatha Srinivasan for collaboration on the supernatant extract experiments. 260

7 DISCUSSION

This dissertation addresses the molecular mechanisms that control the processes by which the non-differentiating bacterium, Vibrio vulnificus, adapts to non- growth conditions and VBNC formation. By their very nature, cells that are in the VBNC state are difficult to study because they show reduced activity, therefore, this investigation of the genetic determinants of the VBNC state employed three indirect approaches; proteomics, intercellular signalling circuits and genetic analysis.

The first approach undertaken, proteomics, was aimed at the identification of protein responders that delayed the entry into the VBNC state. It was hypothesised that the identification of regulators that delay nonculturability would give insight into the mechanisms of the formation of VBNC cells and possibly the exit from the nonculturable state. It had been previously determined that starvation delayed VBNC formation in V. vulnificus (384) and it has been shown in numerous organisms that room temperature starvation allows for the development of stress-resistant cells (151, 176, 214, 215, 457, 524). Thus it is possible that transcripts synthesised during starvation protect V. vulnificus cells in the VBNC state by providing them with a mechanism to maintain culturability until such time that the factors needed for long-term persistence and possibly even for resuscitation, are synthesised. This response could involve such starvation- associated responders as RpoS and the DNA-binding proteins Dps and H-NS, all of which have been shown to protect cell populations under conditions of 261

environmental stress. The sequestering of nucleic acids by binding proteins may be one factor allowing for this maintenance of intact nucleic acids in VBNC cells.

For example, we have determined that within a VBNC population of V. vulnificus, heterogenous results were obtained as relating to the maintenance of intact DNA and RNA (Chapter 3). A subpopulation of cells was shown to maintain intact DNA and RNA for prolonged periods of time, while other cells within the population were shown to contain degraded nucleic acids (542).

In order to identify proteins involved in the starvation-induced maintenance of culturability (SIMC), the use of two-dimensional PAGE was employed. It was determined that carbon starvation or long-term phosphorus starvation (18 hours or more) were conditions that allowed for a delay in VBNC formation (402) (and

Chapter 2). Nitrogen starvation, even after 72 hours, did not allow for the development of SIMC. Upon analysis of approximately 100 proteins that were induced under all three conditions, it was determined that there were no protein responders that were unique to carbon and long-term phosphorus starvation, that were not also induced during nitrogen starvation. Interestingly, it has been shown that when V. vulnificus is incubated at temperatures between 10 and 15°C, the cells exhibit a cold adaptive response that delays their entry into the VBNC state upon subsequent low temperature incubation (51), similar to the response observed upon pre-starvation. In addition, 2D-PAGE has allowed for the identification of 40 proteins induced during cold adaptation (318). A comparison of the carbon and phosphorus-starvation induced proteins and the cold adaptation 262

proteins would be of great interest and may give clues to the mechanism of stress resistance in V. vulnificus.

The temporal pattern of the development of SIMC was such that an effect was seen immediately upon the induction of starvation, but was significant after four hours of starvation, resulting in a significant delay in VBNC formation.

Moreover, stationary phase cells, when incubated at low temperature were able to remain culturable much longer than exponential phase cells. Many stationary phase associated phenotypes are signal regulated in other organisms and other

Vibrio species have been shown to have signalling genes. Hence, we investigated the potential involvement of signals in the SIMC and VBNC phenotypes of V. vulnificus.

The second approach of this project was therefore, the investigation of the occurrence of an intercellular signalling pathway in V. vulnificus and its involvement in the adaptive responses exhibited by this organism. It was determined that supernatants from early stationary phase or starving cultures of V. vulnificus had the ability to induce luminescence in Vibrio harveyi, and that this signal was active through the system 2 pathway (28, 31). The timing of signal production coincided with the development of SIMC, i.e. after four hours of starvation or upon entry into the stationary phase of growth (315) (Chapter 5).

Furthermore, it was demonstrated that the addition of these supernatants, as well as supernatant extracts, could induce SIMC in exponentially growing, non-starved cells and that the addition of a signal antagonist, furanone compound 2, could inhibit the development of SIMC in starving cells (Chapter 6). Furthermore, the 263

signal molecule produced by V. vulnificus was demonstrated to inhibit the loss of culturability that was induced by the starvation of V. angustum in the presence of furanone 2. These data indicate that a signal molecule is produced by V. vulnificus and that this molecule is involved in the starvation adaptation program of this organism.

The third indirect approach employed the use of genetics to identify the determinants of nonculturability and the development of SIMC. Due to the lack of a suitable reporter gene for use in V. vulnificus, a promoterless gusA mini-Tn10 transposon was constructed and placed on a broad-host range suicide vector for delivery into Gram-negative bacteria. Two transposon constructs were generated; one containing a kanamycin marker and one containing a chloramphenicol marker. A bank of starvation- and cold- induced fusion mutants has been generated that will be screened for an altered VBNC and SIMC responses. In addition, the search for genes involved in the regulation of the signalling system was also initiated. We have demonstrated in V. vulnificus the existence of homologues of the luxR and luxS genes of V. harveyi, which encode the transcriptional regulator of the lux operons and a signal synthase respectively (27,

31, 464, 496). A null mutation in the gene encoding the response regulator called smcR, led to pleiotropic effects in V. vulnificus, including an up-regulation in numerous virulence factors that are usually expressed in stationary phase. It therefore appears that at least one function of SmcR may be to delay the expression of stationary phase phenotypes in exponentially growing cells. Others have proposed that the production of virulence factors is only beneficial when the 264

cell density is high enough that the population is able to overcome the host immune response and initiate a productive infection (143, 366, 404, 523, 552). A lack of sufficient nutrient and overcrowding may thus be cues used to signal a high population in a confined area, such as in a macrophage in the case of

Salmonella typhimurium (135).

Furthermore, the defect observed in starvation survival and the development of

SIMC in the smcR mutant of V. vulnificus, indicates a more general role for the signalling system in the regulation of adaptive responses of this organism. These results indicate that signalling systems may in fact have a role in the regulation of starvation and stationary phase phenotypes. The observation that a null mutation in smcR in V. vulnificus resulted in phenotypes similar to those seen in other organisms that were mutated in global regulatory genes is also intriguing. For example, a mutation in the stationary phase regulator rpoS in Vibrio cholerae resulted in a defect in starvation survival and a loss of HA/P expression (567), the metalloprotease of V. cholerae. This metalloprotease is also regulated by hapR

(219), a homologue of smcR. These data indicate that there is an association between RpoS and HapR in the regulation of genes in V. cholerae, possibly through the induction of hapR via RpoS. Unlike the HapR of V. cholerae, the

SmcR of V. vulnificus appears to repress expression of the metalloprotease rather than activate its transcription. The phenotypes exhibited by the SmcR mutant of

V. vulnificus indicates that SmcR may be responsible for the repression of RpoS- dependent genes during exponential phase, or may be involved in the regulation of RpoS expression or activity itself. 265

In addition to RpoS, it is possible that the alternative sigma factor RpoN (s54) is also important for the regulation of signal dependent phenotypes. For example, it has recently been demonstrated in V. harveyi that RpoN is an important regulator of luminescence. Furthermore, these investigators demonstrate that RpoN has multiple effects on the cells and is capable of mediating those effects either through interaction with LuxO, a homologue of the nitrogen regulator NtrC, or independent of LuxO, through other unidentified regulators. It has been demonstrated that other members of the NtrC family of proteins possess both activator and repressor functions. For example, FlbD together with s54, activates the transcription of flagellar genes in Caulobacter crescentus, but, FlbD alone, is able represses the fliF operon (36). Similarly, in S. typhimurium, NtrC along with s54 is able to activate transcription of glnA, but NtrC also represses the transcription of a s70 promoter that is upstream of the major glnA promoter without s54 (431). Based on the phenotypes observed here, it is possible that, at least for some genes, RpoN may mediate its effects through direct interaction with

SmcR. This would account for the fact that SmcR appears to act both as a repressor (e.g. of proteases and flagella) and as an activator (e.g. starvation adaptation). Thus SmcR may repress gene expression at some promoters and activate expression of others when bound to RpoN. In addition, RpoN-regulated genes have been shown to require the alarmone (p)ppGpp for induction, causing silencing of energetically less favourable specialised catabolic functions until needed (500). The alarmone binds to the RNA polymerase and recruits binding of the sigma factor (85). The production of (p)ppGpp is stimulated during the transition from growth into stationary phase, at a time when the maximal 266

induction of signal production was observed (Chapter 5). Thus, the (p)ppGpp could also serve as an internal signal of impending starvation/stress and induce

AI-2 signal production and could mediate its effects through the alternative sigma factor RpoN. It is therefore possible that SmcR may act in conjunction with

RpoN to regulate expression of log and stationary phase genes in V. vulnificus including capsule production, fimbriae formation, and protease expression. The potential role of RpoN and LuxO in the regulation of signal dependent phenotypes in V. vulnificus is an aspect of this project that will be exciting to investigate.

A mutation in vvpD of V. vulnificus, which encodes components of the type IV pilus biogenesis pathway, led to a decrease in fimbriae expression and secretion of protease, chitinase and hemolysin (403). In V. cholerae, the regulation of type

IV pilus, the toxin co-regulated pilus, is under regulation of ToxR (276, 413). A mutation in the toxR gene of V. cholerae resulted in increased motility, protease production and adherence to HEp-2 cells (146). The fact that the SmcR mutant shows alterations in the expression of fimbriae and protease secretion indicates that SmcR may have a role in activating expression of ToxR or, alternatively, may affect the ToxR regulon indirectly. Similarly, an H-NS-like gene, vicH, has been described in V. cholerae (508) and was shown to be induced upon cold shock. Production of a truncated form of VicH from a multicopy plasmid resulted mucoidy and a loss of motility. Thus, in V. cholerae, expression of flagella is under positive control of VicH as well as RpoN (232) and capsule production is 267

negatively regulated by H-NS. It is therefore possible that SmcR and H-NS may act to coordinate flagellar and capsular expression.

Phylogenetic studies of the luxR and luxS genes have enabled us to conclude, due to the widespread occurrence and relatively high conservation of these genes, that either this signal system is ancient or reflects a recent adaptation of some bacterial species for the development of signalling systems from ancient metabolic genes.

In either case, it is apparent that numerous species contain genes of this signalling system and the list of regulated phenotypes will undoubtedly continue to grow.

Intercellular signalling circuits are therefore implicated in increasingly diverse regulatory contexts and will probably constitute a global regulatory system.

The work presented in this dissertation includes novel approaches to the study of the VBNC response and has resulted in an improved understanding of the VBNC state in V. vulnificus by the demonstration of a genetic link between stationary phase/starvation phenotypes, VBNC formation and intercellular signalling.

Furthermore, genes involved in the regulation of the SIMC response have been identified. Through the analysis of transposon mutants, it is expected that specific responders will be identified that will be important for VBNC formation.

Advances in our understanding of the adaptive responses in this organism and the assessment of the VBNC state as an adaptive state that is regulated at the gene level, will require that we further address the genetic regulation and involvement of global regulatory systems in adaptive responses such as the VBNC and SIMC responses. 268

8 REFERENCES

1. Albertson, N. H., T. Nyström, and S. Kjelleberg. 1990. Functional mRNA half-lives in the marine Vibrio sp. S14 during starvation and recovery. J. Gen. Microbiol. 136:2195-2199.

2. Albertson, N. H., T. Nyström, and S. Kjelleberg. 1990. Macromolecular synthesis during recovery of the marine Vibrio sp. S14 from starvation. J. Gen. Microbiol. 136:2201-2207.

3. Albus, A. M., E. C. Pesci, L. J. Runyen-Janecky, S. E. H. West, and B. H. Iglewski. 1997. Vfr controls quorum sensing in Pseudomonas aeruginosa. J. Bacteriol. 179:3928-3935.

4. Alexeyev, M. F., and I. N. Shokolenko. 1995. Mini-Tn10 transposon derivatives for insertion mutagenesis and gene delivery into the chromosome of Gram-negative bacteria. Gene 160:59-62.

5. Allen-Austin, D., B. Austin, and R. R. Colwell. 1984. Survival of Aeromonas salmonicida in river water. FEMS Microbiol. Lett. 21:143-146.

6. Almirón, M., A. J. Link, D. Furlong, and R. Kolter. 1992. A novel DNA- binding protein with regulatory and protective roles in starved Escherichia coli. Genes & Dev. 6:2646-2654.

7. Altschul, S. F., W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. 1990. Basic local alignment search tool. J. Mol. Biol. 215:403-410.

8. Altuvia, S., M. Almirón, G. Huisman, R. Kolter, and G. Storz. 1994. The dps promoter is activated by OxyR during growth and by IHF and ss in stationary phase. Mol. Microbiol. 13:265-272. 269

9. Altuvia, S., D. Weinstein-Flischer, A. Zhang, L. Postow, and G. Storz. 1997. A small stable RNA induced by oxidative stress: role as a pleiotropic regulator and antiterminator. Cell 90:43-53.

10. Amann, R. I., W. Ludwig, and K. H. Schleifer. 1995. Phylogenetic identification and in situ detection of individual microbial cells without cultivation. Microbiol. Rev. 59:143-169.

11. Amy, P. S., and R. Y. Morita. 1983. Protein patterns of growing and starved cells of a marine Vibrio sp. Appl. Environ. Microbiol. 45:1748-1752.

12. Amy, P. S., C. Pauling, and R. Y. Morita. 1983. Starvation-survival processes of a marine Vibrio. Appl. Environ. Microbiol. 45:1041-1048.

13. Anderson, J. I. W., and W. P. Heffernan. 1965. Isolation and characterization of filterable marine bacteria. J. Bacteriol. 90:1713-1718.

14. Arana, I., A. Muela, J. Iriberri, L. Egea, and I. Baracina. 1992. Role of hydrogen peroxide in loss of culturability mediated by visible light in Escherichia coli in a freshwater system. Appl. Environ. Microbiol. 58:3903-3907.

15. Åslund, F., M. Zheng, J. Beckwith, and G. Storz. 1999. Regulation of the OxyR transcription factor by hydrogen peroxide and the cellular thiol-disulfide status. Proc. Natl. Acad. Sci., USA 96:6161-6165.

16. Ausbel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl (ed.). 1994. Current protocols in molecular biology. Wiley Interscience, New York, N. Y.

17. Baethge, B. A., and B. C. West. 1988. Vibrio vulnificus: Did Hippocrates describe a fatal case? Rev. Infect. Dis. 10:614-615. 270

18. Bainton, N. J., P. Stead, S. R. Chhabra, B. W. Bycroft, G. P. Salmond, G. S. Stewart, and P. Williams. 1992. N-(3-oxohexanoyl)-L-homoserine lactone regulates carbapenem antibiotic production in Erwinia carotovora. Biochem. J. 288:997-1004.

19. Bajaj, V., C. Hwang, and C. A. Lee. 1995. hilA is a novel ompR/toxR family member that activates the expression of Salmonella typhimurium invasion genes. Mol. Microbiol. 18:715-727.

20. Balke, V. L., and J. D. Gralla. 1987. Changes in the linking number of supercoiled DNA accompany growth transitions in Escherichia coli. J. Bacteriol. 169:4499-4506.

21. Barcina, I., J. M. González, J. Iriberri, and L. Egea. 1989. Effect of visible light on progressive dormancy of Escherichia coli cells during the survival process in natural fresh water. Appl. Environ. Microbiol. 55:246-251.

22. Barcina, I., J. M. González, J. Iriberri, and L. Egea. 1990. Survival strategy of Escherichia coli and Enterococcus faecalis in illuminated fresh and marine systems. J. Appl. Bacteriol. 68:189-198.

23. Barer, M. R. 1997. Viable but non-culturable and dormant bacteria: time to resolve an oxymoron and a misnomer? J. Med. Microbiol. 46:629-631.

24. Barer, M. R., and C. R. Harwood. 1999. Bacterial viability and culturability. Adv. Microbiol. Physiol. 41:93-137.

25. Barth, M., C. Marschall, A. Muffler, D. Fischer, and R. Hengge-Aronis. 1995. Role for the histone-like protein H-NS in growth phase-dependent and osmotic regulation of sS and many sS-dependent genes in Escherichia coli. J. Bacteriol. 177:3455-3464. 271

26. Bassler, B. L. 1999. How bacteria talk to each other: regulation of gene expression by quorum sensing. Curr. Opin. Microbiol. 2:582-587.

27. Bassler, B. L. 1999. A multichannel two-component signaling relay controls quorum sensing in Vibrio harveyi, p. 259-273. In G. M. Dunny and S. C. Winans (ed.), Cell-Cell Signaling in Bacteria. American Society for Microbiology Press, Washington, D. C.

28. Bassler, B. L., E. P. Greenberg, and A. M. Stevens. 1997. Cross-species induction of luminescence in the quorum-sensing bacterium Vibrio harveyi. J. Bacteriol. 179:4043-4045.

29. Bassler, B. L., and M. R. Silverman. 1995. Intercellular communication in marine Vibrio species: density-dependent regulation of the expression of bioluminescence, p. 431-445. In J. A. Hoch and T. J. Silhavey (ed.), Two- Component Signal Transduction. American Society for Microbiology Press, Washington, D. C.

30. Bassler, B. L., M. Wright, R. E. Showalter, and M. R. Silverman. 1993. Intercellular signalling in Vibrio harveyi : sequence and function of genes regulating expression of luminescence. Mol. Microbiol. 9:773-786.

31. Bassler, B. L., M. Wright, and M. R. Silverman. 1994. Multiple signalling systems controlling expression of luminescence in Vibrio harveyi : sequence and function of genes encoding a second sensory pathway. Mol. Microbiol. 13:273- 286.

32. Beck von Bodman, S., and S. K. Farrand. 1995. Capsular polysaccharide biosynthesis and pathogenicity in Erwinia stewartii require induction by an N- acylhomoserine lactone autoinducer. J. Bacteriol. 177:5000-5008.

33. Becker, G., E. Klauck, and R. Hengge-Aronis. 1999. Regulation of RpoS proteolysis in Escherichia coli: the response regulator RssB is a recognition factor 272

that interacts with the turnover element in RpoS. Proc. Natl. Acad. Sci., USA 96:6439-6444.

34. Becker, G., E. Klauck, and R. Hengge-Aronis. 2000. The response regulator RssB, a recognition factor for ss proteolysis in Escherichia coli, can act like an anti-ss factor. Mol. Microbiol. 35:657-666.

35. Bell, R., S. Carmeli, and N. Sar. 1994. Vibrindole A. A metabolite of the marine bacterium V. parahaemolyticus, isolated from the toxic mucus of the boxfish Ostracion cubicus. J. Nat. Prod. 57:1587-1590.

36. Benson, A. K., G. Ramakrishnan, N. Ohta, J. Feng, A. Ninfa, and A. Newton. 1994. The Caulobacter crescentus FlbD protein acts at ftr sequence elements both to activate and repress transcription of cell cycle regulated flagellar genes. Proc. Natl. Acad. Sci., USA 91:4989-4993.

37. Berg, C. M., D. E. Berg, and E. A. Groisman. 1989. Transposable elements and the genetic engineering of bacteria, p. 879-926. In D. E. Berg and M. M. Howe (ed.), Mobile DNA. American Society for Microbiology Press, Washington, D. C.

38. Berry, T. M., D. L. Park, and D. V. Lightner. 1994. Comparison of the microbial quality of raw shrimp from China, Ecuador, or Mexico at both wholesale and retail levels. J. Food Prot. 57:150-153.

39. Beumer, R. R., J. de Vries, and F. M. Rombouts. 1992. Campylobacter jejuni non-culturable coccoid cells. Int. J. Food Microbiol. 15:153-163.

40. Bhriain, N. N., C. J. Dorman, and C. F. Higgins. 1989. An overlap between osmotic and anaerobic stress responses: a potential role for DNA supercoiling in the coordinate regulation of gene expression. Mol. Microbiol. 3:933-942. 273

41. Binnerup, S. J., O. Hojberg, and D. Gerlif. 1995. Resuscitation demonstrated in a mixed batch of culturable and non-culturable Pseudomonas aeruginosa PAO303. Presented at the 7th International Symposium on Microbial Ecology, SanPaulo, Brazil.Location.

42. Binnerup, S. J., D. F. Jensen, H. Thordal-Christensen, and J. Sørensen. 1993. Detection of viable, but non-culturable Pseudomonas fluorescens DF57 in soil using a microcolony epifluorescence technique. FEMS Microbiol. Ecol. 12:97-105.

43. Blake, P. A., M. H. Merson, R. E. Weaver, D. G. Hollis, and P. C. Heublein. 1979. Disease caused by a marine vibrio - clinical characteristics and epidemiology. N. Engl. J. Med. 300:1-5.

44. Bode, G., F. Mauch, and P. Malfertheiner. 1993. The coccoid forms of Helicobacter pylori. Criteria for their viability. Epidemiol. Infect. 111:483-490.

45. Bogosian, G., L. E. Sammons, P. J. L. Morris, J. P. O'Neil, M. A. Heitkamp, and D. B. Weber. 1996. Death of the Escherichia coli K-12 strain W3110 in soil and water. Appl. Environ. Microbiol. 62:4114-4120.

46. Böhringer, J., D. Fischer, G. Mosler, and R. Hengge-Aronis. 1995. UDP- glucose is a potential intracellular signal molecule in the control of expression of ss-dependent genes in Escherichia coli. J. Bacteriol. 177:413-422.

47. Borowiec, J. A., and J. D. Gralla. 1987. All three elements of the lac ps promoter mediate its transcriptional response to DNA supercoiling. J. Mol. Biol. 1987:587-598.

48. Bovill, R. A., and B. M. Mackey. 1997. Resuscitation of "non-culturable" cells from aged cultures of Campylobacter jejuni. Microbiol. 143:1575-1581. 274

49. Brauns, L. A., M. C. Hudson, and J. D. Oliver. 1991. Use of the polymerase chain reaction in detection of culturable and nonculturable Vibrio vulnificus cells. Appl. Environ. Microbiol. 57:2651-2655.

50. Brewer, D. G., S. E. Martin, and Z. J. Ordal. 1977. Beneficial effects of catalase or pyruvate in a most-probable number technique for the detection of Staphylococcus aureus. Appl. Environ. Microbiol. 34:797-800.

51. Bryan, P. J., R. J. Steffan, A. DePaola, J. W. Foster, and A. K. Bej. 1999. Adaptive response to cold temperatures in Vibrio vulnificus. Curr. Microbiol. 38:168-175.

52. Buchrieser, C., V. V. Gangar, R. L. Murphree, M. L. Tamplin, and C. W. Kaspar. 1995. Multiple Vibrio vulnificus strains in oysters as demonstrated by clamped homogeneous electric field gel electrophoresis. Appl. Environ. Microbiol. 61:1163-1168.

53. Bullock, W. O., J. M. Fernandez, and J. M. Short. 1987. XL1-blue: A high efficiency plasmid transforming recA Escherichia coli strain with b-galactosidase selection. Biotechniques 5:376-379.

54. Buswell, C. M., Y. M. Herlihy, L. M. Lawrence, J. T. M. McGuiggan, P. D. Marsh, C. W. Keevil, and S. A. Leach. 1998. Extended survival and persistance of Campylobacter spp. in water and aquatic biofilms and their detection by immunofluorescent-antibody and rRNA staining. Appl. Environ. Microbiol. 64:733-741.

55. Button, D. K., F. Schut, P. Quang, R. Martin, and B. R. Robertson. 1993. Viability and isolation of marine bacteria by dilution culture. Theory, procedures, and inital results. Appl. Environ. Microbiol. 59:881-891. 275

56. Byrd, J. J., and R. R. Colwell. 1990. Maintenance of plasmids pBR322 and pUC18 in nonculturable Escherichia coli in the marine environment. Appl. Environ. Microbiol. 56:2104-2107.

57. Byrd, J. J., H. S. Xu, and R. R. Colwell. 1991. Viable but nonculturable bacteria in drinking water. Appl. Environ. Microbiol. 57:875-878.

58. Cao, J.-G., and E. A. Meighen. 1989. Purification and structural identification of an autoinducer for the luminescence system of Vibrio harveyi. J. Biol. Chem. 264:21670-21676.

59. Cappelier, J. M., C. Magras, J. L. Jouve, and M. Federighi. 1999. Recovery of viable but non-culturable Campylobacter jejuni cells in two animal models. Food Microbiol. 16:375-383.

60. Cappelier, J. M., J. Minet, C. Magras, R. R. Colwell, and M. Federighi. 1999. Recovery in embryonated eggs of viable but nonculturable Campylobacter jejuni cells and maintenance of ability to adhere to HeLa cells after resuscitation. Appl. Environ. Microbiol. 65:5154-5157.

61. Caro, A., P. Got, J. Lesne, S. Binard, and B. Baleux. 1999. Viability and virulence of experimentally stressed nonculturable Salmonella typhimurium. Appl. Environ. Microbiol. 65:3229-3232.

62. Cashel, M., and J. Gallant. 1969. Two compounds implicated in the function of the RC gene of Escherichia coli. Nature 221:838-841.

63. Cashel, M., D. R. Gentry, V. J. Hernandez, and D. Vinella. 1996. The stringent response, p. 1458-1496. In F. C. Neidhardt, R. Curtiss, C. A. Gross, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. Reznikoff, M. Riley, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella typhimurium: Cellular and Molecular Biology. American Society for Microbiology Press, Washington, D. C. 276

64. Cellini, L., I. Robuffo, E. Di Campli, S. Di Bbartolomeo, T. Taraborelli, and B. Dainelli. 1998. Recovery of Helicobacter pylori ATCC43504 from a viable but not culturable state - regrowth or resuscitation. Apmis 106:571-579.

65. Chancey, S. T., D. W. Wood, and L. S. Pierson III. 1999. Two-component transcriptional regulation of N-acyl-homoserine lactone production in Pseudomonas aureofaciens. Appl. Environ. Microbiol. 65:2294-2299.

66. Chandrasekaran, S., B. Venkatesh, and D. Lalithakumari. 1998. Transfer and expression of a multiple antibiotic resistance plasmid in marine bacteria. Curr. Microbiol. 37:347-351.

67. Chang, T. M., Y. C. Chuang, J. H. Su, and M. C. Chang. 1997. Cloning and sequence analysis of a novel hemolysin gene (vllY) from Vibrio vulnificus. Appl. Environ. Microbiol. 63:3851-3857.

68. Chatterjee, J., C. M. Miyamoto, and E. A. Meighen. 1996. Autoregulation of luxR: the Vibrio harveyi lux-operon activator functions as a repressor. Mol. Microbiol. 20:415-425.

69. Chmielewski, R. A. N., and J. F. Frank. 1995. Formation of viable but nonculturable Salmonella during starvation in chemically defined solutions. Lett. Appl. Microbiol. 20:380-384.

70. Cho, J.-C., and S.-J. Kim. 1999. Green fluorescent protein-based direct viable count to verify a viable but non-culturable state of Salmonella typhi in environmental samples. J. Microbiol. Methods 36:227-235.

71. Chomcyzynski, P., and N. Sacchi. 1987. Single-step method for RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162:156-159. 277

72. Christman, M. F., G. Storz, and B. N. Ames. 1989. OxyR, a positive regulator of hydrogen peroxide-inducible genes in Escherichia coli and Salmonella typhimurium, is homologous to a family of bacterial regulatory proteins. Proc. Natl. Acad. Sci., USA 86:3484-3488.

73. Chuang, Y.-C., C.-Y. Yuan, C.-Y. Liu, C.-K. Lan, and A. H.-M. Huang. 1992. Vibrio vulnificus infection in Taiwan: report of 28 cases and review of clinical manifestations and treatment. Clin. Infect. Dis. 15:271-276.

74. Church, G. W., and W. Gilbert. 1984. Genomic sequencing. Proc. Natl. Acad. Sci., USA 81:1991-1995.

75. Clewell, D. B. 1999. Sex pheromone systems in Enterococci, p. 47-65. In G. M. Dunny and S. C. Winans (ed.), Cell-Cell Signaling in Bacteria. American Society for Microbiology Press, Washington, D. C.

76. Coleman, S. S., and J. D. Oliver. 1996. Optimization of conditions for the polymerase chain reaction amplification of DNA from culturable and nonculturable cells of Vibrio vulnificus. FEMS Microbiol. Ecol. 19:127-132.

77. Colwell, R. R., P. Brayton, D. Herrington, B. Tall, A. Huq, and M. M. Levine. 1996. Viable but non-culturable Vibrio cholerae 01 revert to a culturable state in the human intestine. World J. Microbiol. Biotechnol. 12:28-31.

78. Colwell, R. R., P. R. Brayton, D. J. Grimes, D. B. Roszak, S. A. Huq, and L. M. Palmer. 1985. Viable but non-culturable Vibrio cholerae and related pathogens in the environment: Implications for release of genetically engineered microorganisms. Bio/Technol. 3:817-820.

79. Cui, Y., A. Chatterjee, Y. Liu, C. K. Dumenyo, and A. K. Chatterjee. 1995. Identification of a global repressor gene, rsmA, of Erwinia carotovora subsp. carotovora that controls extracellular enzymes, N-(3-oxohexanoyl)-L- 278

homoserine lactone, and pathogenicity in soft-rotting Erwinia spp. J. Bacteriol. 177:5108-5115.

80. Cui, Y., A. Mukherjee, C. K. Dumenyo, Y. Liu, and A. K. Chatterjee. 1999. rsmC of the soft-rotting bacterium Erwinia carotovora subsp. carotovora negatively controls extracellular enzyme and harpinEcc production and virulence by modulating levels of regulatory RNA (rsmB) and RNA-binding protein (RsmA). J. Bacteriol. 181:6042-6052.

81. Czyz, A., B. Wróbel, and G. Wegrzyn. 2000. Vibrio harveyi bioluminescence plays a role in stimulation of DNA repair. Microbiol. 146:283- 288.

82. Davey, H. M., and D. B. Kell. 1996. Flow cytometry and cell sorting of heterogeneous microbial populations: the importance of single-cell analyses. Microbiol. Rev. 60:641-696.

83. Davies, C. M., S. C. Apte, and S. M. Peterson. 1995. b-D-galactosidase activity of viable, non-culturable coliform bacteria in marine waters. Lett. Appl. Microbiol. 21:99-102.

84. Davis, B. D., S. M. Luger, and P. C. Tai. 1986. Role of ribosome degradation in the death of starved Escherichia coli cells. J. Bacteriol. 166:439- 445.

85. de Lorenzo, V., I. Cases, M. Carmona, M. Rodriguez, S. van Dien, and F. Velazquez. 2000. How the Sigma 54 promoter Pu of Pseudomonas putida of the TOL plasmid works in vivo: coupling transcription to lifestyle. Presented at the Pseudomonas '99: Biotechnology and Pathogenesis, Maui, Hawaii.Location.

86. de Lorenzo, V., I. Cases, M. Herrero, and K. N. Timmis. 1993. Early and late responses of TOL promoters to pathway inducers: identification of 279

postexponential promoters in Pseudomonas putida with lacZ-tet bicistronic reporters. J. Bacteriol. 175:6902-6907.

87. de Lorenzo, V., M. Herrero, U. Jakubzik, and K. N. Timmis. 1990. Mini- Tn5 transposon derivatives for insertion mutagenesis, promoter probing, and chromosomal insertion of cloned DNA in Gram-negative eubacteria. J. Bacteriol. 172:6568-6572.

88. Decamp, O., N. Rajendran, H. Nakano, and G. B. Nair. 1997. Estimation of the viability of Vibrio cholerae 0139 by assessing cell membrane integrity. Microbios. 92:83-89.

89. del Giorgio, P. A., and J. J. Cole. 2000. Bacterial energetics and growth efficiency, p. 289-325. In D. L. Kirchman (ed.), Microbial ecology of the oceans. Wiley-Liss, Inc., New York, NY.

90. Demple, B. 1996. Redox signaling and gene control in the Escherichia coli soxRS oxidative stress regulon - a review. Gene 179:53-57.

91. DeNys, R., A. D. Wright, G. M. Konig, and O. Sticher. 1993. New halogenated furanones from the marine alga Delisea pulchra (cf fimbriata). Tetrahedron 49:11213-11220.

92. DePaola, A., G. M. Capers, and D. Alexander. 1994. Densities of Vibrio vulnificus in the intestines of fish from the U. S. Gulf Coast. Appl. Environ. Microbiol. 60:984-988.

93. DiGaetano, M., S. F. Ball, and J. G. Straus. 1989. Vibrio vulnificus corneal ulcer. Case reports. Arch. Ophthalmol. 107:323-324.

94. Diggle, P., K. Winzer, M. Camara, and P. Williams. 2000. Growth phase dependency of the Pseudomonas aeruginosa quorum sensing cascade. Presented at the Abstr. Annu. Meet. Am. Soc. Microbiol., Los Angeles, CA.Location. 280

95. DiRita, V. J., C. Parsot, G. Jander, and J. J. Mekalanos. 1991. Regulatory cascade controls virulence in Vibrio cholerae. Proc. Natl. Acad. Sci., USA 88:5403-5407.

96. DiRusso, C. C., and T. Nyström. 1998. The fats of Escherichia coli during infancy and old age: regulation by global regulators, alarmones and lipid intermediates. Mol. Microbiol. 27:1-8.

97. Donnenberg, M. S., and J. B. Kaper. 1991. Construction of an eae deletion mutant of enteropathogenic Escherichia coli by using a positive-selection suicide vector. Infect. Immun. 59:4310-4317.

98. Dorman, C. J., G. C. Barr, N. N. Bhriain, and C. F. Higgins. 1988. DNA supercoiling and the anaerobic and growth phase regulation of tonB gene expression. J. Bacteriol. 170:2816-2826.

99. Dorman, C. J., N. N. Bhriain, and C. F. Higgins. 1990. DNA supercoiling and environmental regulation of virulence gene expression in Shigella flexneri. Nature 344:789-792.

100. Dove, S. L., and C. J. Dorman. 1994. The site-specific recombination system regulating expression of the Type 1 fimbral subunit gene of Escherichia coli is sensitive to changes in DNA supercoiling. Mol. Microbiol. 14:975-988.

101. Dri, A.-M., and P. L. Moreau. 1993. Phosphate starvation and low temperature as well as ultraviolet irradiation transcriptionally induce the Escherichia coli LexA-controlled gene sfiA. Mol. Microbiol. 8:697-706.

102. Dukan, S., Y. Lévi, and D. Touati. 1997. Recovery of culturability of an HOCl-stressed population of Escherichia coli after incubation in phosphate buffer: resuscitation or regrowth? Appl. Environ. Microbiol. 63:4204-4209. 281

103. Dukan, S., and T. Nystrom. 1998. Bacterial senescence: stasis results in increased and differential oxidation of cytoplasmic proteins leading to developmental induction of the heat shock regulon. Genes & Dev. 12:3431-3441.

104. Dukan, S., and T. Nyström. 1999. Oxidative stress defense and deterioration of growth-arrested Escherichia coli cells. J. Biol. Chem. 274:26027- 26032.

105. Duncan, S., L. A. Glover, K. Killham, and J. I. Prosser. 1994. Luminescence-based detection of activity of starved and viable but nonculturable bacteria. Appl. Environ. Microbiol. 60:1308-1316.

106. Dunlap, P. V. 1989. Regulation of luminescence by cyclic AMP in cya-like and crp-like mutants of Vibrio fischeri. J. Bacteriol. 171:1199-1202.

107. Dunlap, P. V., and E. P. Greenberg. 1988. Control of Vibrio fischeri lux gene transcription by a cyclic AMP receptor protein-LuxR protein regulatory circuit. J. Bacteriol. 170:4040-4046.

108. Dunlap, P. V., and A. Kuo. 1992. Cell density-dependent modulation of the Vibrio fischeri luminescence system in the absence of autoinducer and LuxR protein. J. Bacteriol. 174:2440-2448.

109. Eberhard, A., A. L. Burlingame, C. Eberhard, G. L. Kenyon, K. H. Nealson, and N. J. Oppneheimer. 1981. Structural identification of autoinducer of Photobacterium fischeri luciferase. Biochem. 28:2444-2449.

110. Eberl, L., M. Givskov, C. Sternberg, S. Møller, G. Christiansen, and S. Mlin. 1996. Physiological responses of Pseudomonas putida KT2442 to phosphate starvation. Microbiol. 142:155-163.

111. Eberl, L., M. K. Winson, C. Sternberg, G. S. A. B. Stewart, G. Christiansen, S. R. Chhabra, B. Bycroft, P. Williams, S. Molin, and M. 282

Givskov. 1996. Involvement of N-acyl-L-homoserine lactone autoinducers in controlling the multicellular behaviour of Serratia liquefaciens. Mol. Microbiol. 20:127-136.

112. Effendi, I., and B. Austin. 1995. Dormant/unculturable cells of fish pathogen Aeromonas salmonicida. Mol. Ecol. 30:183-192.

113. Effendi, I., and B. Austin. 1991. Survival of the fish pathogen Aeromonas salmonicida in seawater. FEMS Microbiol. Lett. 84:103-106.

114. Eguchi, M., T. Nishikawa, K. MacDonald, R. Cavicchioli, J. C. Gottschal, and S. Kjelleberg. 1996. Responses to stress and nutrient availability by the marine ultramicrobacterium Sphingomonas sp. strain RB2256. Appl. Environ. Microbiol. 62:1287-1294.

115. Ekweozor, C. C., C. E. Nwoguh, and M. R. Barer. 1998. Transient increases in colony counts observed in declining populations of Campylobacter jejuni held at low temperature. FEMS Microbiol. Lett. 158:267-272.

116. Engebrecht, J., K. Nealson, and M. Silverman. 1983. Bacterial bioluminescence: isolation and genetic analysis of functions from Vibrio fischeri. Cell 32:773-781.

117. Engebrecht, J., and M. Silverman. 1984. Identification of genes and gene products necessary for bacterial bioluminescence. Proc. Natl. Acad. Sci., USA 81:4154-4158.

118. Evdokimova, N. V., A. G. Dorofeev, and N. S. Panikov. 1994. Dynamics of survival and transition to dormant state of nitrogen-starving bacteria Pseudomonas fluorescens. Mikrobiologiya 63:99-104. 283

119. Fang, F. C., S. J. Libby, N. A. Buchmeirer, P. C. Loewen, J. Switala, J. Harwood, and D. G. Guiney. 1992. The alternative s factor KatF (RpoS) regulates Salmonella virulence. Proc. Natl. Acad. Sci., USA 89:11978-11982.

120. Farmer, J. I. 1979. Vibrio ('Beneckea') vulnificus, the bacterium associated with sepsis, septicemia, and the sea. Lancet 2:903.

121. Federighi, M., J. L. Tholozan, J. M. Cappelier, J. P. Tissier, and J. L. Jouve. 1998. Evidence of non-coccoid viable but non-culturable Campylobacter jejuni cells in microcosm water by direct viable count, CTC-Dapi double staining, and scanning electron microscopy. Food Microbiol. 15:539-550.

122. Fegatella, F., J. Lim, S. Kjelleberg, and R. Cavicchioli. 1998. Implications of rRNA operon copy number and ribosome content in the marine oliotrophic ultramicrobacterium Sphingomonas sp. strain RB2256. Appl. Environ. Microbiol. 64:4433-4438.

123. Felter, R. A., R. R. Colwell, and G. B. Chapman. 1969. Morphology and round body formation in Vibrio marinus. J. Bacteriol. 99:326-335.

124. Ferguson, Y., A. Glover, D. M. McGillivray, and J. I. Prosser. 1995. Survival and activity of lux-marked Aeromonas salmonicida in seawater. Appl. Environ. Microbiol. 61:3494-3498.

125. Finkel, S. E., and R. Kolter. 1999. Evolution of microbial diversity during prolonged starvation. Proc. Natl. Acad. Sci., USA 96:4023-4027.

126. Flärdh, K. 1993. Physiology of carbon starvation and recovery of a marine Vibrio sp. PhD Thesis. University of Göteborg, Göteborg, Sweden.

127. Flärdh, K., P. S. Cohen, and S. Kjelleberg. 1992. Ribosomes exist in large excess over the apparent demand for protein synthesis during carbon starvation in marine Vibrio sp. strain CCUG 15956. J. Bacteriol. 174:6780-6788. 284

128. Flavier, A. B., S. J. Clough, M. A. Schell, and T. P. Denny. 1997. Identification of 3-hydoxypalmitic acid methyl ester as a novel autoregulator controlling virulence in Ralstonia solanacearum. Mol. Microbiol. 26:251-259.

129. Flavier, A. B., L. M. Ganova-Raeva, M. A. Schell, and T. P. Denny. 1997. Hierarchical autoinduction in Ralstonia solanacearum: control of acyl- homoserine lactone production by a novel autoregulatory system responsive to 3- hydoxypalmitic acid methyl ester. J. Bacteriol. 179:7089-7097.

130. Flavier, A. B., M. A. Schell, and T. P. Denny. 1998. An Rpos (ss) homologue regulates acylhomoserine lactone-dependent autoinduction in Ralstonia solanacearum. Mol. Microbiol. 28:475-486.

131. Flint, K. P. 1987. The long-term survival of Escherichia coli in river water. J. Appl. Bacteriol. 63:261-270.

132. Flowers, R. S., S. E. Martin, D. G. Brewer, and Z. J. Ordal. 1977. Catalase and enumeration of stressed Staphylococcus aureus cells. Appl. Environ. Microbiol. 33:1112-1117.

133. Focareta, T., and P. A. Manning. 1991. Distinguishing between the extracellular DNases of Vibrio cholerae and development of a transformation system. Mol. Microbiol. 5:2547-2555.

134. Forsman, M., E. W. Henningson, E. Larsson, T. Johansson, and G. Sandström. 2000. Francisella tularensis does not manifest virulence in viable but non-culturable state. FEMS Microbiol. Ecol. 31:217-224.

135. Foster, J. W., and M. P. Spector. 1995. How Salmonella survive against the odds. Annu. Rev. Microbiol. 49:145-174. 285

136. Fouz, B., A. E. Toranzo, E. Marco-Noales, and C. Amaro. 1998. Survival of fish-virulent strains of Photobacterium damselae subsp. damselae in seawater under starvation conditions. FEMS Microbiol. Lett. 168:181-186.

137. Freeman, J. A., and B. L. Bassler. 1999. A genetic analysis of the function of LuxO, a two-component response regulator involved in quorum sensing in Vibrio harveyi. Mol. Microbiol. 31:665-677.

138. Freeman, J. A., and B. L. Bassler. 1999. Sequence and function of LuxU: a two-component phosphorelay protein that regulates quorum sensing in Vibrio harveyi. J. Bacteriol. 181:899-906.

139. Friesen, J. D., N. P. Fiil, J. M. Parker, and W. A. Haseltine. 1974. A new relaxed mutant of Escherichia coli with an altered 50S ribosomal subunit. Proc. Natl. Acad. Sci., USA 71:3465-3469.

140. Fry, J. C. 1990. Oligotrophs, p. 93-116. In C. Edwards (ed.), Microbiology of Extreme Environments. McGraw-Hill, New York.

141. Fuqua, C., and E. P. Greenberg. 1998. Self perception in bacteria - quorum sensing with acylated homoserine lactones. Curr. Opin. Microbiol. 1:183- 189.

142. Fuqua, C., S. C. Winans, and E. P. Greenberg. 1996. Census and consensus in bacterial ecosystems: the LuxR-LuxI family of quorum sensing transcriptional regulators. Annu. Rev. Microbiol. 50:727-751.

143. Fuqua, W. C., S. C. Winans, and P. E. Greenberg. 1994. Quorum sensing in bacteria: the LuxR-LuxI family of cell density-responsive transcriptional regulators. J. Bacteriol. 176:269-275. 286

144. Gambello, M. J., and B. H. Iglewski. 1991. Cloning and characterization of the Pseudomonas aeruginosa lasR gene, a transcriptional activator of elastase expression. J. Bacteriol. 173:3000-3009.

145. Gander, R. M., and M. T. Larocco. 1989. Detection of pilus-like structures on clinical and environmental isolates of Vibrio vulnificus. J. Clin. Microbiol. 27:1015.

146. Gardel, C. L., and J. J. Mekalanos. 1996. Alterations in Vibrio cholerae motility phenotypes correlate with changes in virulence factor expression. Infect. Immun. 64:2246-2255.

147. Gardner, J., P. Schofield, T. Iismaa, and A. Nicholson. 1992. SeqVu, 1.0.1 ed. The Garvan Institute of Medical Research, Sydney, NSW, Australia.

148. Gentry, D. R., V. J. Hernandez, L. H. Nguyen, D. B. Jensen, and M. Cashel. 1993. Synthesis of the stationary-phase sigma factor sS is positively regulated by ppGpp. J. Bacteriol. 175:7982-7989.

149. Gérard, F., A.-M. Dri, and P. L. Moreau. 1999. Role of Escherichia coli RpoS, LexA and H-NS global regulators in metabolism and survival under aerobic, phosphate-starvation conditions. Microbiol. 145:1547-1562.

150. Ghinsberg, R. C., R. Dror, and Y. Nitzan. 1999. Isolation of Vibrio vulnificus from sea water and sand along the Dan region coast of the Mediterranean. Microbios 97:7-17.

151. Giard, J.-C., A. Hartke, S. Flahaut, A. Benachour, P. Boutibonnes, and Y. Auffray. 1996. Starvation-induced multiresistance in Enterococcus faecalis JH2-2. Curr. Microbiol. 32:264-271. 287

152. Giard, J.-C., A. Hartke, S. Flahaut, P. Boutibonnes, and Y. Auffray. 1997. Glucose starvation response in Enterococcus faecalis JH2-2: survival and protein analysis. Res. Microbiol. 148:27-35.

153. Gilson, L., A. Kuo, and P. V. Dunlap. 1995. AinS and a new family of autoinducer synthesis proteins. J. Bacteriol. 177:6946-6951.

154. Giovannoni, S., and M. Rappé. 2000. Evolution, diversity, and molecular ecology of marine prokaryotes, p. 47-84. In D. L. Kirchman (ed.), Microbial ecology of the oceans. Wiley-Liss, Inc., New York, NY.

155. Giovannoni, S. J., E. F. DeLong, G. J. Olsen, and N. R. Pace. 1988. Phylogenetic group-specific oligodeoxynucleotide probes for identification of single microbial cells. J. Bacteriol. 170:720-726.

156. Givskov, M., R. deNys, M. Manefield, L. Gram, R. Maximilien, L. Eberl, S. Molin, P. D. Steinberg, and S. Kjelleberg. 1996. Eukaryotic interference with homoserine lactone-mediated prokaryotic signalling. J. Bacteriol. 178:6618-6622.

157. Givskov, M., L. Eberl, and S. Molin. 1994. Responses to nutrient starvation in Pseudomonas putida KT2442: two-dimensional electrophoretic analysis of starvation- and stress-induced proteins. J. Bacteriol. 176:4816-4824.

158. Gonzalez, J. M., J. Iriberri, L. Egea, and I. Barcina. 1992. Characterization of culturability, protistan grazing, and death of enteric bacteria in aquatic ecosystems. Appl. Environ. Microbiol. 58:998-1004.

159. González, J. M., E. B. Sherr, and B. F. Sherr. 1993. Differential feeding by marine flagellates on growing versus nonmotile, bacterial prey. Mar. Ecol. Prog. Ser. 102:257-267. 288

160. González-Flecha, B., and B. Demple. 1997. Transcriptional regulation of the Escherichia coli oxyR gene as a function of cell growth. J. Bacteriol. 179:6181-6186.

161. Gram, L., R. deNys, R. Maximilien, M. Givskov, P. Steinberg, and S. Kjelleberg. 1996. Inhibitory effects of secondary metabolites from the red alga Delisea pulchra on swarming motility of Proteus mirabilis. Appl. Environ. Microbiol. 62:4284-4287.

162. Gray, K. M., J. P. Pearson, J. A. Downie, B. E. A. Boboye, and E. P. Greenberg. 1996. Cell-to-cell signaling in the symbiotic nitrogen-fixing bacterium Rhizobium leguminosarum: autoinduction of a stationary phase and rhizosphere-expressed genes. J. Bacteriol. 178:372-376.

163. Gray, L. D., and A. S. Kreger. 1987. Mouse skin damage caused by cytolysin from Vibrio vulnificus and by V. vulnificus infection. J. Infect. Dis. 155:236.

164. Gray, L. D., and A. S. Kreger. 1985. Purification and characterization of an extracellular cytolysin produced by Vibrio vulnificus. Infect. Immun. 48:62-72.

165. Greenberg, E. P., J. W. Hastings, and S. Ulitzer. 1979. Induction of luciferase synthesis in Beneckea harveyi by other marine bacteria. Arch. Microbiol. 120:87-91.

166. Greenberg, J. T., P. Monach, J. H. Chou, P. D. Josephy, and B. Demple. 1990. Positive control of a global antioxidant defense regulon activated by superoxide-generating agents in Escherichia coli. Proc. Natl. Acad. Sci., USA 87:6181-6185.

167. Gribbon, L. T., and M. R. Barer. 1995. Oxidative metabolism in nonculturable Helicobacter pylori and Vibrio vulnificus cells studied by substrate- 289

enhanced tetrazolium reduction and digital image processing. Appl. Environ. Microbiol. 61:3379-3384.

168. Grimes, D. J., and R. R. Colwell. 1986. Viability and virulence of Escherichia coli suspended by membrane chamber in semitropical ocean water. FEMS Microbiol. Lett. 34:161-165.

169. Groat, R. G., J. E. Schultz, E. Zychlinsky, A. Bockman, and A. Matin. 1986. Starvation proteins in Escherichia coli: kinetics of synthesis and role in starvation survival. J. Bacteriol. 168:486-493.

170. Grogan, D. W., and J. E. J. Cronan. 1997. Cyclopropane ring formation in membrane lipids of bacteria. Microbiol. Mol. Biol. Rev. 61:429-441.

171. Haller, C. M., S. Rölleke, D. Vybiral, A. Witte, and B. Velimirov. 2000. Investigation of 0.2 µm filterable bacteria from the Western Mediterranean Sea using a molecular approach: dominance of potential starvation forms. FEMS Microbiol. Ecol. 31:153-161.

172. Hanahan, D. 1983. Studies on transformation of Escherichia coli with plasmids. J. Mol. Biol. 166:557-580.

173. Hanne, L. F., and R. A. Finkelstein. 1982. Characterization and distribution of the hemagglutinins produced by Vibrio cholerae. Infect. Immun. 36:209-214.

174. Harder, W., and L. Dijkhuizen. 1983. Physiological responses to nutrient limitation. Annu. Rev. Microbiol. 37:1-23.

175. Harris-Young, L., M. L. Tamplin, J. W. Mason, H. C. Aldrich, and J. K. Jackson. 1995. Viability of Vibrio vulnificus in association with hemocytes of the American oyster (Crassostrea virginica ). Appl. Environ. Microbiol. 61:52- 57. 290

176. Hartke, A., S. Bouche, X. Gansel, P. Boutibonnes, and Y. Auffray. 1994. Starvation-induced stress resistance in Lactococcus lactis subsp. lactis IL1403. Appl. Environ. Microbiol. 60:3474-3478.

177. Hartmann, A., and W. Boos. 1993. Mutations in phoB, the positive gene activator of the pho regulon in Escherichia coli, affect the carbohydrate phenotype on MacConkey indicator plates. Res. Microbiol. 144:285-293.

178. Harvey, P., and S. Leach. 1998. Analysis of coccal cell formation by Campylobacter jejuni using continuous culture techniques, and the importance of oxidative stress. J. Appl. Microbiol. 85:398-404.

179. Hasan, J. A. K., M. A. R. Chowdhury, M. Shahabuddin, A. Huq, L. Loomis, and R. R. Colwell. 1994. Cholera toxin gene polymerase chain reaction for detection of non-culturable Vibrio cholerae 01. World J. Microbiol. Biotechnol. 10:568-571.

180. Haseltine, W. A., and R. Block. 1973. Synthesis of guanosine tetra- and pentaphosphate requires the presence of a codon-specific, uncharged transfer ribonucleic acid in the acceptor site of ribosomes. Proc. Natl. Acad. Sci., USA 70:1564-1568.

181. Håvarstein, L. S., G. Coomaraswamy, and D. A. Morrison. 1996. An unmodified heptadecapeptide pheromone induces competence for genetic transformation in Streptococcus pneumoniae. Proc. Natl. Acad. Sci., USA 92:11140-11144.

182. Håvarstein, L. S., and D. A. Morrison. 1999. Quorum sensing and peptide pheromones in Streptococcal competence for genetic transformation, p. 9-26. In G. M. Dunny and S. C. Winans (ed.), Cell-Cell Signaling in Bacteria. American Society for Microbiology Press, Washington, D. C. 291

183. Hazeleger, W. C., J. D. Janse, P. M. F. J. Koenraad, R. R. Beumer, F. M. Rombouts, and T. Abee. 1995. Temperature-dependent membrane fatty acid and cell physiology changes in coccoid forms of Campylobacter jejuni. Appl. Environ. Microbiol. 61:2713-2719.

184. Hecker, M., and U. Völker. 1990. General stress proteins in Bacillus subtilis. FEMS Microbiol. Ecol. 74:197-213.

185. Heidelberg, J. F., M. Shahamat, M. Levin, I. Rahman, G. Stelma, C. Grim, and R. R. Colwell. 1997. Effect of aerosolization of culturability and viability of Gram-negative bacteria. Appl. Environ. Microbiol. 63:3585-3588.

186. Helms, S. D., J. D. Oliver, and J. C. Travis. 1984. Role of heme compounds and haptoglobin in Vibrio vulnificus pathogenicity. Infect. Immun. 45:345-349.

187. Hengge-Aronis, R. 1996. Regulation of gene expression during entry into stationary phase, p. 1497-1512. In F. C. Neidhardt, R. Curtiss, C. A. Gross, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. Reznikoff, M. Riley, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella typhimurium: Cellular and Molecular Biology. American Society for Microbiology Press, Washington, D. C.

188. Hengge-Aronis, R. 1993. Survival of hunger and stress: The role of rpoS in early stationary phase gene regulation in E. coli. Cell 72:165-168.

189. Herrero, M., V. deLorenzo, and K. N. Timmis. 1990. Transposon vectors containing non-antibiotic resistance selection markers for cloning and stable chromosomal insertion of foreign genes in Gram-negative bacteria. J. Bacteriol. 172:6557-6567. 292

190. Hinrichs, W., C. Kiser, M. Düvel, A. Müller, K. Tovar, W. Hillen, and W. Saenger. 1994. Structure of the Tet repressor-tetracycline complex and regulation of antibiotic resistance. Science 264:418-420.

191. Hoben, H. J., and P. Somasegaran. 1982. Comparison of the pour, spread, and drop plate methods for enumeration of Rhizobium spp. in inoculants made from presterilized peat. Appl. Environ. Microbiol. 44:1246-1247.

192. Hoff, K. A. 198. Survival of Vibrio anguillarum and Vibrio salmonicida at different salinities. Appl. Environ. Microbiol. 55:1775-1786.

193. Høi, L., J. L. Larsen, I. Dalsgaard, and A. Dalsgaard. 1998. Occurrence of Vibrio vulnificus biotypes in Danish marine environements. Appl. Environ. Microbiol. 64:7-13.

194. Holden, M., S. Swift, and P. Williams. 2000. New signal molecules on the quorum-sensing block. Trends Microbiol. 8:101-103.

195. Holden, M. T. G., S. R. Chhabra, R. de Nys, P. Stead, N. J. Bainton, P. J. Hill, M. Manefield, N. Kumar, M. Labatte, D. England, S. A. Rice, M. Givskov, G. P. C. Salmond, G. S. A. B. Stewart, B. W. Bycroft, S. Kjelleberg, and P. Williams. 1999. Quorum-sensing cross talk: isolation and chemical characterization of cyclic dipeptides from Pseudomonas aeruginosa and other Gram-negative bacteria. Mol. Microbiol. 33:1254-1266.

196. Höller, C., and W. Martin. 1998. Evaluation of the direct viable count method for temperature-stressed Campylobacter coli. J. Microbiol. Methods 33:157-162.

197. Höller, C., D. Witthuhn, and B. Janzen-Blunck. 1998. Effect of low temperatures on growth, structure, and metabolism of Campylobacter coli SP10. Appl. Environ. Microbiol. 64:581-587. 293

198. Holmquist, L., Å. Jouper-Jaan, D. Weichart, D. R. Nelson, and S. Kjelleberg. 1993. The induction of stress proteins in three marine Vibrios during carbon starvation. FEMS Microbiol. Ecol. 12:185-194.

199. Holmquist, L., and S. Kjelleberg. 1993. Changes in viability, respiratory activity and morphology of the marine Vibrio sp. strain S14 during starvation of individual nutrients and subsequent recovery. FEMS Microbiol. Ecol. 12:215- 224.

200. Hood, M. A., J. B. Guckert, D. C. White, and F. Deck. 1986. Effect of nutrient deprivation on lipid, carbohydrate, DNA, RNA and protein levels in Vibrio cholerae. Appl. Environ. Microbiol. 52:788-793.

201. Hoppe, H. G. 1976. Determination and properties of actively metabolizing heterotrophic bacteria in the sea, investigated by means of micro-autoradiography. Mar. Biol. 36:291-302.

202. Horinouchi, S., and T. Beppu. 1994. A-factor as a microbial hormone that controls cellular differentiation and secondary metabolism in Streptomyces griseus. Mol. Microbiol. 12:859-864.

203. Howard, R. J., and N. T. Bennett. 1993. Infections caused by halophilic marine Vibrio bacteria. Ann. Surg. 217:525-531.

204. Huisman, G. W., and R. Kolter. 1994. Sensing starvation: a homoserine lactone-dependent signaling pathway in Escherichia coli. Science 265:537-539.

205. Hulton, C. S. J., A. Seirafi, J. C. D. Hinton, J. M. Sidebotham, L. Waddell, G. D. Pavitt, T. Owen-Hughes, A. Spassky, H. Buc, and C. F. Higgins. 1990. Histone-like protein H1 (H-NS), DNA supercoiling, and gene expression in bacteria. Cell 63:631-642. 294

206. Humphrey, B., S. Kjelleberg, and K. C. Marshall. 1983. Responses of marine bacteria under starvation conditions at a solid-water interface. Appl. Environ. Microbiol. 45:43-47.

207. Husevåg, B. 1995. Starvation survival of the fish pathogen Aeromonas salmonicida in seawater. FEMS Microbiol. Ecol. 16:25-32.

208. Hussong, D., R. R. Colwell, M. O'Brien, E. Weiss, A. D. Pearson, R. M. Weiner, and W. D. Burge. 1987. Viable Legionella pneumophila not detectable by culture on agar media. Bio/Technol. 5:947-950.

209. Islam, M. S., M. K. Hasan, M. A. Miah, G. C. Sur, A. Felsenstein, M. Venkatesan, R. B. Sack, and M. J. Albert. 1993. Use of the polymerase chain reaction and fluorescent-antibody methods for detecting viable but nonculturable Shigella dysenteriae type 1 in laboratory microcosms. Appl. Environ. Microbiol. 59:536-540.

210. Jackson, J. K., R. L. Murphree, and M. L. Tamplin. 1997. Evidence that mortality from Vibrio vulnificus infection results from single strains among heterogeneous populations in shellfish. J. Clin. Microbiol. 35:2098-2101.

211. Jannasch, H. W. 1967. Growth of marine bacteria at limiting concentrations of organic carbon in seawater. Limnol. Oceanogr. 12:264-271.

212. Jannasch, H. W., and G. E. Jones. 1959. Bacterial populations in sea water as determined by different methods of enumeration. 4:128-139.

213. Jefferson, R. A., S. M. Burgess, and D. Hirsh. 1986. b-glucuronidase from Escherichia coli as a gene-fusion marker. Proc. Natl. Acad. Sci., USA 83:8447-8451. 295

214. Jenkins, D. E., S. A. Chaisson, and A. Matin. 1990. Starvation-induced cross protection against osmotic challenge in Escherichia coli. J. Bacteriol. 172:2779-2781.

215. Jenkins, D. E., J. E. Schultz, and A. Matin. 1988. Starvation-induced cross protection against heat or H2O2 challange in Escherichia coli. J. Bacteriol. 170:3910-3914.

216. Jepras, R. I., J. Carter, S. C. Pearson, F. E. Paul, and M. J. Wilkinson. 1995. Development of a robust flow cytometric assay for determining numbers of viable bacteria. Appl. Environ. Microbiol. 61:2696-2701.

217. Jiang, X., and T.-J. Chai. 1996. Survival of Vibrio parahaemolyticus at low temperature under starvation conditions and subsequent resuscitation of viable, nonculturable cells. Appl. Environ. Microbiol. 62:1300-1305.

218. Jishage, M., and A. Ishihama. 1998. A stationary phase protein in Escherichia coli with binding activity to the major s subunit of RNA polymerase. Proc. Natl. Acad. Sci., USA 95:4953-4958.

219. Jobling, M. G., and R. K. Holmes. 1997. Characterization of hapR, a positive regulator of the Vibrio cholerae HA/protease gene hap, and its identification as a functional homologue of the Vibrio harveyi luxR gene. Mol. Microbiol. 26:1023-1034.

220. Jones, D. M., E. M. Sutcliffe, and A. Curry. 1991. Recovery of viable but non-culturable Campylobacter jejuni. J. Gen. Microbiol. 137:2477-2482.

221. Jørgensen, F., O. Nybroe, and S. Knøchel. 1994. Effects of starvation and osmotic stress on viability and heat resistance of Pseudomonas flourescens AH9. J. Appl. Bacteriol. 77:340-347. 296

222. Jouper-Jaan, Å., A. E. Goodman, and S. Kjelleberg. 1992. Bacteria starved for prolonged periods develop increased protection against lethal temperatures. FEMS Microbiol. Ecol. 101:229-236.

223. Joux, F., P. Lebaron, and M. Troussellier. 1997. Succession of cellular states in Salmonella typhimurium population during starvation in artificial seawater microcosms. FEMS Microbiol. Ecol. 22:65-76.

224. Jovanovich, S. G., and J. Lebowitz. 1987. Estimation of the effect of coumermycin A1 on Salmonella typhimurium promoters by using random operon fusions. J. Bacteriol. 169:4431-4435.

225. Kaiser, D., and R. Losick. 1993. How and why bacteria talk to each other. Cell 73:873-885.

226. Kaprelyants, A. S., J. C. Gottschal, and D. B. Kell. 1993. Dormancy in non-sporulating bacteria. FEMS Microbiol. Rev. 104:271-286.

227. Kaprelyants, A. S., G. V. Mukamolova, H. M. Davey, and D. B. Kell. 1996. Quantitative analysis of the physiological heterogeneity within starved cultures of Micrococcus luteus by flow cytometry and cell sorting. Appl. Environ. Microbiol. 62:1311-1316.

228. Kaprelyants, A. S., G. V. Mukamolova, H. M. Davey, and D. B. Kell. 1996. The resuscitation of dormant cells of Micrococcus luteus. Presented at the Society for General Microbiology, 135th Meeting, University of Essex, UK.Location.

229. Kaprelyants, A. S., G. V. Mukamolova, and D. B. Kell. 1994. Estimation of dormant Micrococcus luteus cells by penicillin lysis and by resuscitation in cell-free spent culture medium at high dilution. FEMS Microbiol. Lett. 115:347- 352. 297

230. Kaspar, C. W., and M. L. Tamplin. 1993. Effects of temperature and salinity on the survival of Vibrio vulnificus in seawater and shellfish. Appl. Environ. Microbiol. 59:2425-2429.

231. Katz, B. Z. 1988. Vibrio vulnificus meningitis in a boy with thalassemia after eating raw oysters. Pediatrics 82:784-786.

232. Kawagishi, I., M. Nakada, N. Nishioka, and M. Homma. 1997. Cloning of a Vibrio alginolyticus rpoN gene that is required for polar flagellar formation. J. Bacteriol. 179:6851-6854.

233. Kell, D. B., A. S. Kaprelyants, D. H. Weichart, C. R. Harwood, and M. R. Barer. 1998. Viability and activity in readily culturable bacteria: a review and discussion of the practical issues. Anton. Leeuw. Int. J. 73:169-187.

234. Kelly, M. T. 1983. Effect of temperature and salinity on Vibrio vulnificus occurrence in a Gulf Coast environment. Appl. Environ. Microbiol. 44:820-824.

235. Kelly, M. T., and D. M. Avery. 1980. Lactose-postitive Vibrio in seawater: a cause of pneumonia and septicemia in a drowning victim. J. Clin. Microbiol. 11:278-280.

236. Kelly, M. T., and W. F. McCormick. 1981. Acute bacterial myositis caused by Vibrio vulnificus. J. Am. Med. Assoc. 246:72-73.

237. Kim, S. K., and D. Kaiser. 1990. C-factor: a cell-cell signaling protein required for fruiting body morphogenesis of Myxococcus xanthus. Cell 61:19-26.

238. Kim, Y., L. S. Watrud, and A. Matin. 1995. A carbon starvation survival gene of Pseudomonas putida is regulated by s54. J. Bacteriol. 177:1850-1859.

239. Kita-Tsukamoto, K., H. Oyaizu, K. Nanba, and U. Simidu. 1993. Phylogenetic relationships of marine bacteria, mainly members of the family 298

Vibrionaceae, determined on the basis of 16S rRNA sequences. Int. J. Syst. Bacteriol. 43:8-19.

240. Kjelleberg, S., N. Albertson, K. Flärdh, L. Holmquist, Å. Jouper-Jaan, R. Marouga, J. Östling, B. Svenblad, and D. Weichart. 1993. How do non- differentiating bacteria adapt to starvation? Anton. Leeuw. Int. J. 63:333-341.

241. Kjelleberg, S., M. Hermansson, and P. Mårdén. 1987. The transient phase between growth and nongrowth of heterotrophic bacteria, with emphasis on the marine environment. Annu. Rev. Microbiol. 41:25-49.

242. Kjelleberg, S., J. Östling, L. Holmquist, K. Flärdh, B. Svenblad, Å. Jouper-Jaan, D. Weichart, and N. Albertson. 1993. Starvation and recovery of Vibrio, p. 169-174. In R. G. C. Pedrós-Alió (ed.), Trends in Microbial Ecology. Spanish Society for Microbiology.

243. Kjelleberg, S., P. Steinberg, M. Givskov, L. Gram, M. Manefield, and R. deNys. 1997. Do marine natural products interfere with prokaryotic AHL regulatory systems. Aq. Microb. Ecol. 13.

244. Klein, C., C. Kaletta, and K. D. Entian. 1993. Biosynthesis of the lantibiotic subtilin is regulated by a histidine kinase/response regulator system. Appl. Environ. Microbiol. 59:296-303.

245. Klontz, K. C., S. Lieb, M. Schreiker, H. T. Janowski, L. M. Baldy, and R. A. Gunn. 1988. Syndromes of Vibrio vulnificus infections: clinical and epidemiologic features in Florida cases, 1981-1987. Ann. Intern. Med. 109:318- 323.

246. Kogure, K., U. Simidu, and N. Taga. 1979. A tentative direct microscopic method for counting living marine bacteria. Can. J. Microbiol. 25:415-420. 299

247. Kogure, K., U. Simidu, N. Taga, and R. R. Colwell. 1987. Correlation of direct viable counts with heterotrophic activity for marine bacteria. Appl. Environ. Microbiol. 53:2332-2337.

248. Kolter, R., M. Inuzuka, and D. R. Helinski. 1978. Trans-complementation dependent replication of a low molecular weight origin fragment from plasmid R6K. Cell 15:1199-1208.

249. Kolter, R., D. A. Siegele, and A. Tormo. 1993. The stationary phase of the bacterial life cycle. Annu. Rev. Microbiol. 47:855-874.

250. Kondo, K., A. Takade, and K. Amako. 1994. Morphology of the viable but nonculturable Vibrio cholerae as determined by the freeze fixation technique. FEMS Microbiol. Lett. 123:179-184.

251. Korgaonkar, K. S., and S. S. Ranade. 1966. Evaluation of acridine orange fluorescence test in viability studies of Escherichia coli. Can. J. Microbiol. 12:185-190.

252. Kothary, M. H., and A. S. Kreger. 1985. Production and partial characterization of an elastolytic protease of Vibrio vulnificus. Infect. Immun. 50:534-540.

253. Kothary, M. H., and A. S. Kreger. 1987. Purification and characterization of an elastolytic protease of Vibrio vulnificus. J. Gen. Microbiol. 133:1783-1791.

254. Kowarz, L., C. Coynault, V. Robbe-saule, and F. Norel. 1994. The Salmonella typhimurium katF (rpoS ) gene: Cloning, nucleotide sequence, and regulation of spvR and spvABCD virulence plasmid genes. J. Bacteriol. 176:6852-6860.

255. Kragelund, L., and O. Nybroe. 1994. Culturability and expression of outer membrane proteins during carbon, nitrogen, or phosphorous starvation of 300

Pseudomonas fluorescens DF57 and Pseudomonas putida DF14. Appl. Environ. Microbiol. 60:2944-2948.

256. Kreger, A., L. DeChatelet, and P. Shirley. 1981. Interaction of Vibrio vulnificus with human polymorphonuclear leukocytes: association of virulence with resistance to phagocytosis. J. Infect. Dis. 144:244-248.

257. Kreger, A., and D. Lockwood. 1981. Detection of extracellular toxin(s) produced by Vibrio vulnificus. Infect. Immun. 33:583-590.

258. Krovacek, K., S. B. Baloda, S. Dumontet, and I. Mansson. 1994. Detection of potential virulence markers of Vibrio vulnificus strains isolated from fish in Sweden. Comp. Immunol. Microbiol. Infect. Dis. 17:63-70.

259. Kumamoto, K. S., and D. J. Vukich. 1998. Clinical infections of Vibrio vulnificus: a case report and review of the literature. J. Emerg. Med. 16:61-66.

260. Kumar, S., K. Tamura, and M. Nei. 1993. MEGA: Molecuar Evolutionary Genetics Analysis, 1.01 ed. The Pennsylvania State University, University Park, PA, 16802.

261. Kuo, A., N. V. Blough, and P. V. Dunlap. 1994. Multiple N -acyl-L- homoserine lactone autoinducers of luminescence in the marine symbiotic bacterium Vibrio fischeri. J. Bacteriol. 176:7558-7565.

262. Kuo, A., S. M. Callahan, and P. V. Dunlap. 1996. Modulation of luminescence operon expression by N-octanoyl-L-homoserine lactone in ainS mutants of Vibrio fischeri. J. Bacteriol. 178:971-976.

263. Kuspa, A., L. Plamann, and D. Kaiser. 1992. A-signalling and the cell density requirement fo Myxococcus xanthus development. J. Bacteriol. 174:7360- 7369. 301

264. Kuzj, A. E. S., P. S. Medberry, and J. L. Schottel. 1998. Stationary phase, amino acid limitation and recovery from stationary phase modulate the stability and translation of chloramphenicol acetyltransferase mRNA and total mRNA in Escherichia coli. Microbiol. 144:739-750.

265. Lange, R., D. Fischer, and R. Hengge-Aronis. 1995. Identification of transcriptional start sites and the role of ppGpp in the expression of rpoS, the structural gene for the ss subunit of RNA polymerase in Escherichia coli. J. Bacteriol. 177:4676-4680.

266. Lange, R., and R. Hengge-Aronis. 1994. The cellular concentration of the ss subunit of RNA-polymerase in Escherichia coli is controlled at the levels of transcription, translation and protein stability. Genes & Dev. 8:1600-1612.

267. Lange, R., and R. Hengge-Aronis. 1991. Identification of a central regulator of stationary-phase gene expression in Escherichia coli. Mol. Microbiol. 5:49-59.

268. Latifi, A., M. Foglino, and A. Lazdunski. 1997. The chain of command in Pseudomonas quorum sensing: response. Trends Microbiol. 5:134-135.

269. Latifi, A., M. Foglino, K. Tanaka, P. Williams, and A. Lazdunski. 1996. A hierarchial quorum-sensing cascade in Pseudomonas aeruginosa links the transcriptional activators LasR and RhlR (VsmR) to expression of the stationary- phase sigma factor RpoS. Mol. Microbiol. 21:1137-1146.

270. Latifi, A., M. K. Winson, M. Foglino, B. W. Bycroft, G. S. A. B. Stewart, A. Lazdunski, and P. Williams. 1995. Multiple homolgues of LuxR and LuxI control expression of virulence determinants and secondary metabolites through quorum sensing in Pseudomonas aeruginosa PAO1. Mol. Microbiol. 17:333-343. 302

271. Lázaro, B., J. Cárcamo, A. Audícana, I. Perales, and A. Fernández- Astorga. 1999. Viability and DNA maintenance in nonculturable spiral Campylobacter jejuni cells after long-term exposure to low temperatures. Appl. Environ. Microbiol. 65:4677-4681.

272. Lazazzera, B. A. 2000. Quorum sensing and starvation: signals for entry into stationary phase. Curr. Opin. Microbiol. 3:177-182.

273. Lazazzera, B. A., T. Palmer, J. Quisel, and A. D. Grossman. 1999. Cell density control of gene expression and development in Bacillus subtiliu, p. 27-46. In G. M. Dunny and S. C. Winans (ed.), Cell-Cell Signaling in Bacteria. American Society for Microbiology Press, Washington, D. C.

274. Lease, R. A., M. E. Cusick, and M. Belfort. 1998. Riboregulation in Escherichia coli: DsrA RNA acts by RNA:RNA interactions at multiple loci. Proc. Natl. Acad. Sci., USA 95:12456-12461.

275. Lee, K.-H., and E. G. Ruby. 1995. Symbiotic role of the viable but nonculturable state of Vibrio fischeri in Hawaiian coastal seawater. Appl. Environ. Microbiol. 61:278-283.

276. Lee, S. H., D. L. Hava, M. K. Waldor, and A. Camilli. 1999. Regulation and temporal expression patterns of Vibrio cholerae virulence genes during infection. Cell 99:625-634.

277. Leonard, B. A. B., and G. M. Dunny. 1996. Enterococcus faecalis pheromone binding protein, PrgZ, recruits a chromosomal oligopeptide permease system to import sex pheromone cCF10 for induction of conjugation. Proc. Natl. Acad. Sci., USA 93:260-264.

278. Leser, T. D., M. Boye, and N. B. Hendriksen. 1995. Survival and activity of Pseudomonas sp. strain B13 (FR1) in a marine microcosm determined by 303

quantitative PCR and an rRNA-targeting probe and its effect on the indigenous bacterioplankton. Appl. Environ. Microbiol. 61:1201-1207.

279. Lilley, B. N., and B. L. Bassler. 2000. Regulation of quorum sensing in Vibrio harveyi by LuxO and Sigma 54. Molecular Microbiology 36:940-954.

280. Lin, Z., K. Kumagai, K. Baba, J. J. Mekalanos, and M. Nishibuchi. 1993. Vibrio parahaemolyticus has a homolog of the Vibrio cholerae toxRS operon that mediates environmentally induced regulation of the thermostable direct hemolysis gene. J. Bacteriol. 175:3844-3855.

281. Linder, K., and J. D. Oliver. 1989. Membrane fatty acid and virulence changes in the viable but nonculturable state of Vibrio vulnificus. Appl. Environ. Microbiol. 55:2837-2842.

282. Linkous, D. A., and J. D. Oliver. 1999. Pathogenesis of Vibrio vulnificus. FEMS Microbiol. Lett. 174:207-214.

283. Litwin, C. M., T. W. Rayback, and J. Skinner. 1996. Role of catechol siderophore synthesis in Vibrio vulnificus virulence. Infect. Immun. 64:2834- 2838.

284. Liu, M. Y., G. Gui, B. Wei, J. F. I. Preston, L. Oakford, Ü. Yüksel, D. P. Giedroc, and T. Romeo. 1997. The RNA molecule CsrB binds to the global regulatory protein CsrA and antagonizes its activity in Escherichia coli. J. Biol. Chem. 272:17502-17510.

285. Lleo, M. d. m., M. C. Tafi, and P. Canepari. 1998. Nonculturable Enterococcus faecalis cells are metabolically active and capable of resuming active growth. System. Appl. Microbiol. 21:333-339. 304

286. Lleo, M. d. M., M. C. Tafi, C. Signoretto, C. Dal Cero, and P. Canepari. 1999. Competitive polymerase chain reaction for quantification of nonculturable Enterococcus faecalis cells in lake water. FEMS Microbiol. Ecol. 30:345-353.

287. Loewen, P. C., I. von Ossowski, J. Switala, and M. R. Mulvey. 1993. KatF (sS) synthesis in Escherichia coli is subject to posttranscriptional regulation. J. Bacteriol. 175:2150-2153.

288. Loyd, R. G., and K. B. Low. 1996. Homologous recombination, p. 2236- 2255. In F. C. Neidhardt, R. Curtiss, C. A. Gross, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. Reznikoff, M. Riley, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella typhimurium: Cellular and Molecular Biology. American Society for Microbiology Press, Washington, D. C.

289. MacDonell, M. T., and M. A. Hood. 1982. Isolation and characterization of ultramicrobacteria from a gulf coast estuary. Appl. Environ. Microbiol. 43:566-571.

290. Malmcrona-Friberg, K., A. Tunlid, P. Mårdén, S. Kjelleberg, and G. Odham. 1986. Chemical changes in cell envelope and poly-b-hydroxybutyrate during short term starvation of a marine bacterial isolate. Arch. Microbiol. 144:340-345.

291. Manahan, S. H., and T. R. Steck. 1997. The viable but nonculturable state in Agrobacterium tumefaciens and Rhizobium meliloti. FEMS Microbiol. Ecol. 22:29-37.

292. Mandelstam, J., and H. Halvorson. 1960. Turnover of protein and nucleic acid in soluble and ribosome fractions of non-growing Escherichia coli. Biochim. Biophys. Acta 40:43-49.

293. Manefield, M., R. deNys, N. Kumar, R. Read, M. Givskov, P. Steinberg, and S. Kjelleberg. 1999. Evidence that halogenated furanones from Delisea 305

pulchra inhibit acylated homoserine lactone (AHL)-mediated gene expression by displacing the AHL signal from its receptor protein. Microbiol. 145:283-291.

294. Manefield, M., L. Harris, S. A. Rice, R. deNys, and S. Kjelleberg. 2000. Halogenated furanones from Delisea pulchra inhibit bioluminescence and virulence in the Paneus monodon pathogen Vibrio harveyi. Appl. Environ. Microbiol. 66:2079-2084.

295. Manny, A., S. Kjelleberg, N. Kumar, R. deNys, R. Read, and P. Steinberg. 1997. Reinvestigation of the sulfuric acid-catalysed cyclisation of brominated 2-alkyllevulinic acids to 3-alkyl-5-methylene-2(5H)-furanones. Tetrahedron 53:15813-15826.

296. Mårdén, P., A. Tunlid, K. Malmcrona-Friberg, G. Odham, and S. Kjelleberg. 1985. Physiological and morphological changes during short term starvation of marine bacterial isolates. Arch. Microbiol. 142:326-332.

297. Margarinos, B., J. L. Romalde, J. L. Barja, and A. E. Toranzo. 1994. Evidence of a dormant but infective state of the fish pathogen Pasteurella piscicida in seawater and sediment. Appl. Environ. Microbiol. 60:180-186.

298. Margariños, B., J. L. Romalde, A. Cid, and A. E. Toranzo. 1997. Viability of starved Pasteurella piscicida in seawater monitored by flow cytometry and the effect of antibiotics on its resuscitation. Lett. Appl. Microbiol. 24:122-126.

299. Martin, P., and R. A. MacLeod. 1984. Observations on the distinction between oligotrophic and eutrophic marine bacteria. Appl. Environ. Microbiol. 47:1017-1022.

300. Martin, S. E., R. S. Flowers, and Z. J. Ordal. 1976. Catalase: Its effect on microbial enumeration. Appl. Environ. Microbiol. 32:731-734. 306

301. Martinez, A., and R. Kolter. 1997. Protection of DNA during oxidative stress by the nonspecific DNA-binding protein Dps. J. Bacteriol. 179:5188-5194.

302. Maruo, K., T. Akaike, T. Ono, and H. Maeda. 1998. Involvement of bradykinin generation in intravascular dissemination of Vibrio vulnificus and prevention of invasion by a bradykinin antagonist. Infect. Immun. 66:866-869.

303. Mason, C. A., and T. Egli. 1993. Dynamics of microbial growth in the decelerating and stationary phase of batch culture, p. 81-102. In S. Kjelleberg (ed.), Starvation in Bacteria. Plenum Press, New York.

304. Matin, A. 1990. Molecular analysis of the starvation stress in Escherichia coli. FEMS Microbiol. Ecol. 74:185-196.

305. Matin, A. 1991. The molecular basis of carbon-starvation-induced general resistance in Escherichia coli. Mol. Microbiol. 5:3-10.

306. Matin, A., E. A. Auger, P. H. Blum, and J. E. Schultz. 1989. Genetic basis of starvation survival in nondifferentiating bacteria. Annu. Rev. Microbiol. 43:293-316.

307. Matté, G. R., M. H. Matté, M. I. Z. Sato, P. S. Sanchez, I. G. Rivera, and M. T. Martins. 1994. Potentially pathogenic vibrios associated with mussels from a tropical region on the Atlantic coast of Brazil. J. Appl. Bacteriol. 77:281- 281.

308. Maximilien, R., R. DeNys, C. Holmström, L. Gram, M. Givskov, K. Crass, S. Kjelleberg, and P. Steinberg. 1998. Chemical mediation of bacterial surface colonization by secondary metabolites from the red alga Delisea pulchra. Aquatic Microb. Ecol. 15:233-246. 307

309. Maxwell, E. L., B. C. Mayall, S. R. Pearson, and P. A. Stanley. 1991. A case of Vibrio vulnificus septicemia acquired in Victoria. Med. J. Aust. 154:214- 215.

310. McCann, M. P., C. D. Fraley, and A. Matin. 1993. The putative s factor KatF is regulated posttranscritionally during carbon starvation. J. Bacteriol. 175:2143-2149.

311. McCann, M. P., J. P. Kidwell, and A. Matin. 1991. The putative s factor KatF has a central role in development of starvation-mediated general resistance in Escherichia coli. J. Bacteriol. 173:4188-4194.

312. McCarter, L. L. 1998. OpaR, a homolog of Vibrio harveyi LuxR, controls opacity of Vibrio parahaemolyticus. J. Bacteriol. 180:3166-3173.

313. McDougald, D., S. A. Rice, and S. Kjelleberg. 1999. New perspectives on the viable but nonculturable response. Biologia 54:617-623.

314. McDougald, D., S. A. Rice, and S. Kjelleberg. 2000. SmcR-dependent regulation of adaptive phenotypes in Vibrio vulnificus. J. Bacteriol. submitted.

315. McDougald, D., S. A. Rice, and S. Kjelleberg. 2000. Vibrio vulnificus encodes a putative homologue of the Vibrio harveyi regulatory gene, luxR: a genetic and phylogenetic comparison. Gene 248:213-221.

316. McDougald, D., S. A. Rice, D. Weichart, and S. Kjelleberg. 1998. Nonculturability: adaptation or debilitation? FEMS Microbiol. Ecol. 25:1-9.

317. McGovern, V., N. P. Higgins, R. S. Chiz, and A. Jaworski. 1994. H-NS over-expression induces an artificial stationary phase by silencing global transcription. Biochimie 76:1019-1029. 308

318. McGovern, V., and J. D. Oliver. 1995. Induction of cold-responsive proteins in Vibrio vulnificus. J. Bacteriol. 177:4131-4133.

319. McKnight, S. L., B. H. Iglewski, and E. C. Pesci. 2000. The Pseudomonas quinolone signal regulates rhl quorum sensing in Pseudomonas aeruginosa. J. Bacteriol. 182:2702-2708.

320. Medema, G. J., F. M. Schets, A. W. van de Giessen, and A. H. Havelaar. 1992. Lack of colonization of 1 day old chicks by viable, non-culturable Campylobacter jejuni. J. Appl. Bacteriol. 72:512-516.

321. Mehtar, S., L. Bangham, D. Kalmanovitch, and M. Wren. 1988. Adult epiglottitis due to Vibrio vulnificus. Br. Med. J. Clin. Res. 296:827-828.

322. Melhus, A., T. Homldahl, and I. Thernderg. 1995. First documented case of bacteremia with Vibrio vulnificus in Sweden. Scand. J. Infect. Dis. 28:81-82.

323. Metcalf, W. W., W. Jiang, L. L. Daniels, S.-K. Kim, A. Haldimann, and B. L. Wanner. 1996. Conditionally replicative and conjugative plasmids carrying lacZa for cloning, mutagenesis, and allele replacement in bacteria. Plasmid 35:1- 13.

324. Miller, J. H. 1972. Experiments in Molecular Genetics. Cold Springs Harbor Laboratory Press, Cold Spring Harbor, NY.

325. Miller, V. L., and J. J. Mekalanos. 1988. A novel suicide vector and its use in construction of insertion mutations: osmoregulation of outer membrane proteins and virulence determinants in Vibrio cholerae requires toxR. J. Bacteriol. 170:2575-2583.

326. Minnikin, D. E., and H. Abdoltrahimzadeh. 1974. The replacement of phosphatidylethanolamine and acid phospholipids by an ornithine-amine lipid and 309

a minor phosphorus-free lipid in Pseudomonas fluorescens NCMB 129. FEBS Lett. 43:257-259.

327. Miyamoto, C. M., Y. H. Lin, and E. A. Meighen. 2000. Control of bioluminescence in Vibrio fischeri by the LuxO signal response regulator. Mol. Microbiol. 36:594-607.

328. Miyoshi, S., Y. Hirata, K. Tomochika, and S. Shinoda. 1994. Vibrio vulnificus may produce a metalloprotease causing an edematous skin lesion in vivo. FEMS Microbiol. Lett. 121:321-326.

329. Miyoshi, S., H. Nakazawa, K. Kawata, K. Tomochika, K. Tobe, and S. Shinoda. 1998. Characterization of the hemorrhagic reaction caused by Vibrio vulnificus metalloprotease, a member of the thermolysin family. Infect. Immun. 66:4851-4855.

330. Miyoshi, S., K. Sugiyama, H. Furuta, N. Miyoshi, and S. Shinoda. 1989. Histamine release from rat mast cells by Vibrio vulnificus protease. FEMS Microbiol. Lett. 34:301-304.

331. Mizunoe, Y., S. N. Wai, T. Ishikawa, A. Takade, and S. Yoshida. 2000. Resuscitation of viable but nonculturable cells of Vibrio parahaemolyticus induced at low temperature under starvation. FEMS Microbiol. Lett. 186:115- 120.

332. Mizunoe, Y., S. N. Wai, A. Takade, and S. Yoshida. 1999. Restoration of culturability of starvation-stressed and low-temperature-stressed Escherichia coli

O157 cells by using H2O2-degrading compounds. Arch. Microbiol. 172:63-67.

333. Mizushima, T., K. Kataoka, Y. Ogata, R. Inoue, and K. Sekimizu. 1997. Increase in negative supercoiling of plasmid DNA in Escherichia coli exposed to cold shock. Mol. Microbiol. 23:381-386. 310

334. Moran, M. A., and R. G. Zepp. 2000. UV radiation effects on microbes and microbial processes, p. 201-228. In D. L. Kirchman (ed.), Microbial ecology of the oceans. Wiley-Liss, Inc., New York, NY.

335. Moreno, M. L. G., and M. Landgraf. 1998. Virulence factors and pathogenicity of Vibrio vulnificus strains isolated from seafood. J. Appl. Microbiol. 84:747-751.

336. Morgan, J. A. W., P. A. Cranwell, and R. W. Pickup. 1991. Survival of Aeromonas salmonicida in lake water. Appl. Environ. Microbiol. 57:1777-1782.

337. Morgan, J. A. W., V. Kuntzelmann, S. Tavernor, M. A. Ousley, and C. Winstanley. 1997. Survival of Xenorhabdus nematophilus and Photorhabdus luminescens in water and soil. J. Appl. Microbiol. 83:665-670.

338. Morgan, J. A. W., G. Rhodes, and R. W. Pickup. 1993. Survival of nonculturable Aeromonas salmonicida in lake water. Appl. Environ. Microbiol. 59:874-880.

339. Morgan, J. A. W., E. Winstanley, R. W. Pickup, J. G. Jones, and J. R. Saunders. 1989. Direct phenotypic and genotypic detection of a recombinant pseudomonad population released into lake water. Appl. Environ. Microbiol. 55:2537-2544.

340. Moriarty, D. J. W., and R. T. Bell. 1993. Bacterial growth and starvation in aquatic environments, p. 25-53. In S. Kjelleberg (ed.), Starvation in Bacteria. Plenum Press, New York.

341. Morita, R. Y. 1997. Bacteria in Oligotrophic Environments. Chapman & Hall, New York.

342. Morita, R. Y. 1988. Bioavailability of energy and its relationship to growth and starvation survival in nature. Can. J. Microbiol. 34:436-441. 311

343. Morita, R. Y. 1993. Bioavailability of energy and the starvation state, p. 1- 23. In S. Kjelleberg (ed.), Starvation in Bacteria. Plenum Press, New York.

344. Morris, J. G. J., A. C. Wright, L. M. Simpson, P. K. Wood, D. E. Johnson, and J. D. Oliver. 1987. Virulence of Vibrio vulnificus: association with utilization of transferrin-bound iron, and lack of correlation with levels of cytotoxin or protease production. FEMS Microbiol. Lett. 40:55-59.

345. Morton, D., M. El-Janne, and J. D. Oliver. 1992. Macromolecular synthesis in Vibrio vulnificus during starvation and entry into the viable but nonculturable state. Presented at the American Society for Microbiology, New Orleans, LA.Location.

346. Morton, D. S., and J. D. Oliver. 1994. Induction of carbon-starvation- induced proteins in Vibrio vulnificus. Appl. Environ. Microbiol. 60:3656-3659.

347. Motes, M. L., A. DePaola, D. W. Cook, J. E. Veazey, J. C. Hunsucker, W. E. Garthright, R. J. Blodgett, and S. J. Chirtel. 1998. Influence of water temperature and salinity on Vibrio vulnificus in northern Gulf and Atlantic coast oysters (Crassostrea virginica). Appl. Environ. Microbiol. 64:1459-1465.

348. Moyer, C. L., and R. Y. Morita. 1989. Effect of growth rate and starvation-survival on the viability and stability of a psychrophilic marine bacterium. Appl. Environ. Microbiol. 55:1122-1127.

349. Muffler, A., M. Barth, C. Marschall, and R. Hengge-Aronis. 1997. Heat shock regulation of ss turnover: a role for DnaK and relationship between stress responses mediated by sS and s32 in Escherichia coli. J. Bacteriol. 179:445-452.

350. Muffler, A., D. Fischer, S. Altuvia, G. Storz, and R. Hengge-Aronis. 1996. The response regulator RssB controls stability of the sS subunit of RNA polymerase in Escherichia coli. EMBO J. 15:1333-1339. 312

351. Muffler, A., D. Fischer, and R. Hengge-Aronis. 1996. The RNA-binding protein HF-I, known as a host factor for phage Qb RNA replication, is essential for rpoS translation in Escherichia coli. Genes & Dev. 10:1143-1151.

352. Mukamolova, G. V., A. S. Kaprelyants, D. I. Young, M. Young, and D. B. Kell. 1998. A bacterial cytokine. Proc. Natl. Acad. Sci., USA 95:8916-8921.

353. Mukamolova, G. V., N. D. Yanopolskaya, D. B. Kell, and A. S. Kaprelyants. 1998. On resuscitation from the dormant state of Micrococcus luteus. Anton. Leeuw. Int. J. 73:237-243.

354. Mukherjee, A., Y. Cui, Y. Liu, C. K. Dumenyo, and A. K. Chatterjee. 1996. Global regulation in Erwinia species by Erwinia carotovora rsmA, a homologue of Escherichia coli csrA - repression of secondary metabolites, pathogenicity and hypersensitive reaction. Microbiol. 142:427-434.

355. Mukherjee, A., Y. Cui, W. Ma, Y. Liu, A. Ishihama, A. Eisenstark, and A. K. Chatterjee. 1998. RpoS (Sigma-S) controls expression of rsmA, a global regulator of secondary metabolites, harpin, and extracellular proteins in Erwinia carotovora. J. Bacteriol. 180:3629-3634.

356. Munro, P. M., G. N. Flatau, R. L. Clément, and M. J. Gauthier. 1995. Influence of the RpoS (KatF) sigma factor on maintenance of viability and culturability of Escherichia coli and Salmonella typhimurium in seawater. Appl. Environ. Microbiol. 61:1853-1858.

357. Murley, Y. M., P. A. Carroll, K. Skorupski, R. K. Taylor, and S. B. Calderwood. 1999. Differential transcription of the tcpPH operon confers biotype-specific control of the Vibrio cholerae ToxR virulence regulon. Infect. Immun. 67:5117-5123.

358. Naleway, J. J. 1992. Histochemical, spectrophotometric, and fluorometric GUS substrates, p. 61-76. In S. R. Gallagher (ed.), GUS Protocols: Using the 313

GUS Gene as a Reporter of Gene Expression. Harcourt Brace Jovanovich, San Diego, New York, Boston, London, Sydney, Tokyo, Toronto.

359. Nealson, K. H., and J. W. Hastings. 1979. Bacterial bioluminescence: its control and ecological significance. Microbiol. Rev. 43:496-518.

360. Neidhardt, F. C., P. L. Bloch, and D. F. Smith. 1974. Culture medium for Enterobacteria. J. Bacteriol. 119:736-747.

361. Nelson, D. R., Y. Sadlowski, M. Eguchi, and S. Kjelleberg. 1997. The starvation-stress response of Vibrio (Listonella) anguillarum. Microbiol. 143:2305-2312.

362. Nelson, S. M., R. W. Attwell, M. M. Dawson, and C. A. Smith. 1996. The effect of temperature on viability of carbon- and nitrogen-starved Escherichia coli. Microb. Ecol. 32:11-21.

363. Nes, I. F., L. S. Håvarstein, and H. Holo. 1995. Genetics of non-lantibiotic bacteriocins. Dev. Biol. Stand. 85:645-651.

364. Nilsson, L., J. D. Oliver, and S. Kjelleberg. 1991. Resuscitation of Vibrio vulnificus from the viable by nonculturable state. J. Bacteriol. 173:5054-5059.

365. Nishina, Y., S.-I. Miyoshi, A. Nagase, and S. Shinoda. 1992. Significant role of an extracellular protease in utilization of heme by Vibrio vulnificus. Infect. Immun. 60:2128-2132.

366. Novick, R. P. 1999. Regulation of pathogenicity in Staphylococcus aureus by a peptide-based density-sensing system, p. 129-146. In G. M. Dunny and S. C. Winans (ed.), Cell-Cell Signaling in Bacteria. American Society for Microbiology Press, Washington, D. C. 314

367. Novitsky, J. A., and R. Y. Morita. 1976. Morphological characterization of small cells resulting from nutrient starvation of a psychrophilic marine Vibrio. Appl. Environ. Microbiol. 32:617-622.

368. Novitsky, J. A., and R. Y. Morita. 1978. Possible strategy for the survival of marine bacteria under starvation conditions. Mar. Biol. 48:289-295.

369. Novitsky, J. A., and R. Y. Morita. 1977. Survival of a psychrophilic marine vibrio under long-term nutrient starvation. Appl. Environ. Microbiol. 33:635-641.

370. Nwoguh, C. E., C. R. Harwood, and M. R. Barer. 1995. Detection of induced b-galactosidase activity in individual non-culturable cells of pathogenic bacteria by quantitative cytological assay. Mol. Microbiol. 17:545-554.

371. Nyström, T. 1994. The glucose-starvation stimulon of Escherichia coli : induced and repressed synthesis of enzymes of central metabolic pathways and role of acetyl phosphate in gene expression and starvation survival. Mol. Microbiol. 12.

372. Nyström, T. 1994. Role of guanosine tetraphosphate in gene expression and the survival of glucose or seryl-tRNA starved cells of Escherichia coli K12. Mol. Gen. Genet. 245:355-362.

373. Nyström, T. 1999. Starvation, cessation of growth and bacterial aging. Curr. Opin. Microbiol. 2:214-219.

374. Nyström, T., N. Albertson, and S. Kjelleberg. 1988. Synthesis of membrane and periplasmic proteins during starvation of a marine Vibrio sp. J. Gen. Microbiol. 134:1645-1651. 315

375. Nyström, T., K. Flärdh, and S. Kjelleberg. 1990. Responses to multiple- nutrient starvation in marine Vibrio sp. strain CCUG 15956. J. Bacteriol. 172:7085-7097.

376. Nyström, T., C. Larsson, and L. Gustafsson. 1996. Bacterial defense against aging - Role of the Escherichia coli ArcA regulator in gene expression, readjusted energy flux and survival during stasis. EMBO J. 15:3219-3228.

377. Nyström, T., P. Mårdén, and S. Kjelleberg. 1986. Relative changes in incorporation rates of leucine and methionine during starvation survival of two bacteria isolated from marine waters. FEMS Microbiol. Ecol. 38:285-292.

378. Nyström, T., R. M. Olsson, and S. Kjelleberg. 1992. Survival, stress resistance, and alteration in protein expression in the marine Vibrio sp. strain S14 during starvation for different individual nutrients. Appl. Environ. Microbiol. 58:55-65.

379. O'Farrell, P. H. 1975. High resolution two-dimensional electrophoresis of proteins. J. Biol. Chem. 250:4007-4021.

380. O'Neill, K., S. H. Jones, and J. Grimes. 1992. Seasonal incidence of Vibrio vulnificus in the Great Bay estuary of New Hampshire and Maine. Appl. Environ. Microbiol. 58:3257-3262.

381. O'Neill, K. R., S. H. Jones, and D. J. Grimes. 1990. Incidence of Vibrio vulnificus in northern New England water and shellfish. FEMS Microbiol. Lett. 72:163-168.

382. Ohlsen, K. L., and J. D. Gralla. 1992. Interrelated effects of DNA supercoiling, ppGpp, and low salt on melting within the Escherichia coli ribosomal RNA rrnB P1 promoter. Mol. Microbiol. 6:2243-2251. 316

383. Okujo, N., T. Akiyama, S. Miyoshi, S. Shinoda, and S. Yamamoto. 1996. Involvement of vulnibactin and exocellular protease in utilization of transferrin- and lactoferrin-bound iron by Vibrio vulnficus. Microbiol. Immunol. 40:595-598.

384. Oliver, J. D. 1991. Formation of nonculturable Vibrio vulnificus cells and its relationship to the starvation state. Appl. Environ. Microbiol. 57:2640-2644.

385. Oliver, J. D. 1993. Formation of viable but nonculturable cells, p. 239-272. In S. Kjelleberg (ed.), Starvation in Bacteria. Plenum Press, New York.

386. Oliver, J. D. 1993. Nonculturability and resuscitation of Vibrio vulnificus, p. 187-191. In R. G. C. Pedrós-Alió (ed.), Trends in Microbial Ecology. Spanish Society for Microbiology.

387. Oliver, J. D. 1995. The viable but non-culturable state in the human pathogen Vibrio vulnificus. FEMS Microbiol. Lett. 133:203-208.

388. Oliver, J. D. 1989. Vibrio vulnificus, p. 569-600. In M. Doyle (ed.), Foodborne Bacterial Pathogens. Marcel-Dekker, Inc., New York.

389. Oliver, J. D., and R. Bockian. 1995. In vivo resuscitation, and virulence towards mice, of viable but nonculturable cells of Vibrio vulnificus. Appl. Environ. Microbiol. 61:2620-2623.

390. Oliver, J. D., F. Hite, D. McDougald, N. L. Andon, and L. M. Simpson. 1995. Entry into, and resuscitation from, the viable but nonculturable state by Vibrio vulnificus in an estuarine environment. Appl. Environ. Microbiol. 61:2624-2630.

391. Oliver, J. D., D. McDougald, T. Barrett, L. A. Glover, and J. I. Prosser. 1995. Effect of temperature and plasmid carriage on nonculturability in organisms targeted for release. FEMS Microbiol. Ecol. 17:229-237. 317

392. Oliver, J. D., and W. F. Stringer. 1984. Lipid composition of a psychrophilic marine Vibrio sp. during starvation-induced morphogenesis. Appl. Environ. Microbiol. 47:461-466.

393. Oliver, J. D., and D. Wanucha. 1989. Survival of Vibrio vulnificus at reduced temperatures and elevated nutrient. J. Food Safety 10:79-86.

394. Oliver, J. D., R. A. Warner, and D. R. Cleland. 1982. Distribution and ecology of Vibrio vulnificus and other lactose-fermenting marine vibrios in coastal waters of the southeastern United States. Appl. Environ. Microbiol. 44:1404-1414.

395. Oliver, J. D., J. E. Wear, M. B. Thomas, M. Warner, and K. Linder. 1986. Production of extracellular enzymes and cytotoxicity by Vibrio vulnificus. Diagn. Microbiol. Infect. Dis. 5:99-111.

396. Oppenheimer, D. H. 1952. The membrane filter in marine microbiology. J. Bacteriol. 64:783-786.

397. Östling, J., A. Goodman, and S. Kjelleberg. 1991. Behavior of Inc-P1 plasmids and a miniMu transposon in a marine Vibrio sp.: isolation of starvation inducible lac operon fusions. FEMS Microbiol. Ecol. 86:83-94.

398. Östling, J., L. Holmquist, K. Flärdh, B. Svenblad, Å. Jouper-Jaan, and S. Kjelleberg. 1993. Starvation and recovery of Vibrio, p. 103-127. In S. Kjelleberg (ed.), Starvation in Bacteria. Plenum Press, New York.

399. Östling, J., L. Holmquist, and S. Kjelleberg. 1996. Global analysis of the carbon starvation response of a marine Vibrio species with disruptions in genes homologous to relA and SpoT. J. Bacteriol. 178:4901-4908. 318

400. Östling, J., D. McDougald, R. Marouga, and S. Kjelleberg. 1997. Global analysis of physiological responses in marine bacteria. Electrophoresis 18:1441- 1450.

401. Ozaki, M., A. Wada, N. Fujita, and A. Ishihama. 1991. Growth phase- dependent modification of RNA polymerase in Escherichia coli. Mol. Gen. Genet. 230:17-23.

402. Paludan-Müller, C., D. Weichart, D. McDougald, and S. Kjelleberg. 1996. Analysis of starvation conditions that allow for prolonged culturability of Vibrio vulnificus at low temperature. Microbiol. 142:1675-1684.

403. Paranjpye, R. N., J. C. Lara, J. C. Pepe, C. M. Pepe, and M. S. Strom. 1998. The type IV leader peptidase/N-methyltransferase of Vibrio vulnificus controls factors required for adherence to HEp-2 cells and virulence in iron- overloaded mice. Infect. Immun. 66:5659-5668.

404. Passador, L., J. M. Cook, M. J. Gambello, L. Rust, and B. H. Iglewski. 1993. Expression of Pseudomonas aeruginosa virulence genes requires cell-to- cell communication. Science 260:1127-1130.

405. Paszko-Kolva, C., M. Shahamat, H. Yamamoto, T. Sawyer, J. Vives- Rego, and R. R. Colwell. 1991. Survival of Legionella pneumophila in the aquatic environment. Microb. Ecol. 22:75-83.

406. Pearson, J. P., L. Passador, B. H. Iglewski, and E. P. Greenberg. 1995. A second N-acylhomoserine lactone signal produced by Pseudomonas aeruginosa. Proc. Natl. Acad. Sci. USA. 92:1490-1494.

407. Pedersen, J. C., and C. S. Jacobsen. 1993. Fate of Enterobacter cloacae JP120 and Alcaligenes eutrophus AEO106(pRO101) in soil during water stress: effects on culturability and viability. Appl. Environ. Microbiol. 59:1560-1564. 319

408. Perego, M. 1999. Self-signaling by Phr peptides modulates Bacillus subtilis development, p. 243-258. In G. M. Dunny and S. C. Winans (ed.), Cell-Cell Signaling in Bacteria. American Society for Microbiology Press, Washington, D. C.

409. Pesci, E., C., and B. H. Iglewski. 1999. Quorum sensing in Pseudomonas aeruginosa, p. 147-155. In G. M. Dunny and S. C. Winans (ed.), Cell-Cell Signaling in Bacteria. American Society for Microbiology Press, Washington, D. C.

410. Pesci, E. C., and B. H. Iglewski. 1997. The chain of command in Pseudomonas quorum sensing. Trends Microbiol. 5:132-135.

411. Pesci, E. C., J. B. J. Milbank, J. P. Pearson, S. McKnight, A. S. Kende, E. P. Greenberg, and B. H. Iglewski. 1999. Quinolone signaling in the cell-to- cell communication system of Pseudomonas aeruginosa. Proc. Natl. Acad. Sci., USA 96:11229-11234.

412. Pesci, E. C., J. P. Pearson, P. C. Seed, and B. H. Iglewski. 1997. Regulation of las and rhl quorum sensing in Pseudomonas aeruginosa. J. Bacteriol. 179:3127-3132.

413. Peterson, K. M., and J. J. Mekalanos. 1988. Characterization of the Vibrio cholerae ToxR regulon: identification of novel genes involved in intestinal colonization. Infect. Immun. 56:2822-2829.

414. Piper, K. R., S. B. von Bodman, and S. K. Farrand. 1993. Conjugation factor of Agrobacterium tumefaciens regulates Ti plasmid transfer by autoinduction. Nature 362:448-450.

415. Plaga, W., I. Stamm, and H. U. Shairer. 1998. Intercellular signaling in Stigmatella aurantiaca: purification and characterization of stigmolone, a myxobacterial pheromone. Proc. Natl. Acad. Sci., USA 95:11263-11267. 320

416. Pommepuy, M., M. Butin, A. Derrien, M. Gourmelon, R. R. Colwell, and M. Cormier. 1996. Retention of enteropathogenicity by viable but nonculturable Escherichia coli exposed to seawater and sunlight. Appl. Environ. Microbiol. 62:4621-4626.

417. Pommepuy, M., L. Fiksdal, M. Gourmelon, H. Melikechi, M. P. Caprais, M. Cormier, and R. R. Colwell. 1996. Effect of seawater on Escherichia coli b-galactosidase activity. J. Appl. Bacteriol. 81:174-180.

418. Poole, M. D., J. H. Bowdre, and D. Klapper. 1982. Abstract B155. Presented at the Annual Meeting of the American Society for Microbiology.Location.

419. Porter, K. G., and Y. S. Feig. 1980. The use of DAPI for for identifying and counting aquatic microflora. Limnol. Oceanog. 25:943-948.

420. Postgate, J. R., and J. R. Hunter. 1962. The survival of starved bacteria. J. Gen. Microbiol. 29:233-263.

421. Powell, B. S., D. L. Court, T. Inada, Y. Nakmura, V. Michotey, X. Cui, M. Reizer, H. J. Saier, and J. Reizer. 1995. Novel proteins of the phosphotransferase system encoded within the rpoN operon of Escherichia coli.

Enzyme IIANtr affects growth on organic nitrogen and the conditionaly lethality of an erats mutant. J. Biol. Chem. 270:4822-4839.

422. Radu, S., N. Elhadi, Z. Hassan, G. Rusul, S. Lihan, N. Fifadara, Yuherman, and E. Purwati. 1998. Characterization of Vibrio vulnificus isolated from cockles (Anadara Granosa) : Antimicrobial resistance, plasmid profiles and random amplification of polymorphic DNA analysis. FEMS Microbiol. Lett. 165:139-143. 321

423. Rahman, I., M. Shahamat, M. A. R. Chowdhury, and R. R. Colwell. 1996. Potential virulence of viable but nonculturable Shigella dysenteriae type 1. Appl. Environ. Microbiol. 62:115-120.

424. Rahman, I., M. Shahamat, P. A. Kirchman, E. Russek-Cohen, and R. R. Colwell. 1994. Methionine uptake and cytopathogenicity of viable but nonculturable Shigella dysenteriae type 1. Appl. Environ. Microbiol. 60:3573- 3578.

425. Rao, N. N., and A. Kornberg. 1996. Inorganic phosphate supports resistance and survival of stationary-phase Escherichia coli. J. Bacteriol. 178:1394-1400.

426. Rao, N. N., S. J. Liu, and A. Kornberg. 1998. Inorganic polyphosphate in Escherichia coli - the phosphate regulon and the stringent response. J. Bacteriol. 180:2186-2193.

427. Ravel, J., I. T. Knight, C. E. Monahan, R. T. Hill, and R. R. Colwell. 1995. Temperature induced recovery of Vibrio cholerae from the viable but nonculturable state: growth or resuscitation? Microbiol. 141:377-383.

428. Reeve, C. A., P. S. Amy, and A. Matin. 1984. Role of protein synthesis in the survival of carbon-starved Escherichia coli K-12. J. Bacteriol. 160:1041- 1046.

429. Reeve, C. A., A. T. Bockman, and A. Matin. 1984. Role of protein degradation in the survival of carbon-starved Escherichia coli and Salmonella typhimurium. J. Bacteriol. 157:758-763.

430. Reimmann, C., M. Beyeler, A. Latifi, H. Winteler, M. Foglino, A. Lazdunski, and D. Haas. 1997. The global activator GacA of Pseudomonas aeruginosa PAO positively controls the production of the autoinducer N-butyryl- 322

homoserine lactone and the formation of the virulence factors pyocyanin, cyanide and lipase. Mol. Microbiol. 24:309-319.

431. Reitzer, L. J., and B. Magasanik. 1985. Expression of glnA in Escherichia coli is regulated at tandem promoters. Proc. Natl. Acad. Sci., USA 82:1979-1983.

432. Rice, S. A., M. Givskov, P. Steinberg, and S. Kjelleberg. 1999. Bacterial signals and antagonists: The interaction between bacteria and higher organisms. J. Mol. Microbiol. Biotechnol. 1:23-31.

433. Rice, S. A., D. McDougald, and S. Kjelleberg. 2000. Vibrio vulnificus: a physiological and genetic approach to the viable but nonculturable response. J. Infect. Chemother. In press.

434. Rigsbee, W., L. M. Simpson, and J. D. Oliver. 1997. Detection of the viable but nonculturable state in Escherichia coli 0157:H7. J. Food Safety 16:255-262.

435. Rodrigues, D. P., R. V. Ribeiro, and E. Hofer. 1992. Analysis of some virulence factors of Vibrio vulnificus isolated from Rio de Janeiro, Brazil. Epidemiol. Infect. 108:463-467.

436. Rodriguez, G. G., D. Phipps, K. Ishiguro, and H. F. Ridgeway. 1992. Use of a fluorescent redox probe for direct visualization of actively respiring bacteria. Appl. Environ. Microbiol. 58:1801-1808.

437. Rollins, D. M., and R. R. Colwell. 1986. Viable but nonculturable stage of Campylobacter jejuni and its role in survival in the natural aquatic environment. Appl. Environ. Microbiol. 52:531.

438. Romalde, J. L., J. L. Barja, B. Magarinos, and A. E. Toranzo. 1994. Starvation-survival processes of the bacterial fish pathogen Yersinia ruckeri. System. Appl. Microbiol. 17:161-168. 323

439. Romeo, T. 1998. Global regulation by the small RNA-binding protein CsrA and the non-coding RNA molecule CsrB. Mol. Microbiol. 29:1321-1330.

440. Romeo, T., M. Gong, M. Y. Liu, and A.-M. Brun-Zinkernagel. 1993. Identification and molecular characterization of csrA, a pleiotropic gene from Escherichia coli that affects glycogen biosynthesis, gluconeogenesis, cell size, and surface properties. J. Bacteriol. 175:4744-4755.

441. Rose, A. S., A. E. Ellis, and A. L. S. Munro. 1990. Evidence against dormancy in the bacterial fish pathogen Aeromonas salmonicida subsp. salmonicida. FEMS Microbiol. Lett. 68:105-108.

442. Roszak, D. B., and R. R. Colwell. 1987. Metabolic activity of bacterial cells enumerated by direct viable count. Appl. Environ. Microbiol. 53:2889-2893.

443. Roszak, D. B., D. J. Grimes, and R. R. Colwell. 1984. Viable but nonrecoverable stage of Salmonella enteritidis in aquatic systems. Can. J. Microbiol. 30:334-338.

444. Roth, B. L., M. Poot, S. T. Yue, and P. J. Millard. 1997. Bacterial viability and antibiotic susceptibility testing with SYTOX green nucleic acid stain. Appl. Environ. Microbiol. 63:2421-2431.

445. Roth, W. G., M. P. Leckie, and D. N. Dietzler. 1988. Restoration of colony-forming activity in osmotically stressed Escherichia coli by betaine. Appl. Environ. Microbiol. 54:3142-3146.

446. Ruby, E. G., and K. Lee. 1998. The Vibrio fischeri-Euphrymna scolopes light organ association: current ecological paradigms. Appl. Environ. Microbiol. 64:805-812. 324

447. Ruby, E. G., and K. H. Nealson. 1976. Symbiotic association of Photobacterium fischeri with the luminous fish Monocentris japonica: a model of symbiosis based on bacterial studies. Biol. Bull. (Woods Hole) 141:574-586.

448. Saha, S. K., S. Saha, and S. C. Sanyal. 1991. Recovery of injured Campylobacter jejuni cells after animal passage. Appl. Environ. Microbiol. 57:3388-3399.

449. Sak, B. D., A. Eisenstark, and D. Touati. 1989. Exonuclease III and the catalase hydroperoxidase II in Escherichia coli are both regulated by the katF gene product. Proc. Natl. Acad. Sci., USA 86:3271-3275.

450. Sambrook, J., E. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

451. Schäfer, A., J. Kalinowski, and A. Pühler. 1994. Increased fertility of Corynebacterium glutamicum recipients in intergeneric matings with Eschericha coli after stress exposure. Appl. Environ. Microbiol. 60:756-759.

452. Schäfer, A., A. Schwarzer, J. Kalinowski, and A. Pühler. 1994. Cloning and characterization of a DNA region encoding a stress-sensitive restriction system from Corynebacterium glutamicum ATCC 13032 and analysis of its role in intergeneric conjugation with Escherichia coli. J. Bacteriol. 176:7309-7319.

453. Schultz, J. E., and A. Matin. 1991. Molecular and functional characterization of a carbon starvation gene of Escherichia coli. J. Mol. Biol. 218:129-140.

454. Schut, F., E. J. de Vries, J. C. Gossschal, B. R. Robertson, W. Harder, R. A. Prins, and D. K. Button. 1993. Isolation of typical marine bacteria by dilution culture: Growth, maintenance, and characteristics of isolates under laboratory conditions. Appl. Environ. Microbiol. 59:2150-2161. 325

455. Schweder, T., K.-H. Lee, O. Lomovskaya, and A. Matin. 1996.

Regulation of Escherichia coli starvation sigma factor (ss) by ClpXP protease. J. Bacteriol. 178:470-476.

456. Schwyn, B., and J. B. Neilands. 1986. Universal chemical assay for the detection and determination of siderophores. Anal. Biochem. 160:47-56.

457. Seymour, R. L., P. V. Mishra, M. A. Khan, and M. P. Spector. 1996. Essential roles of core starvation-stress response loci in carbon-starvation- inducible cross-resistance and hydrogen peroxide-inducible adaptive resistance to oxidative challenge in Salmonella typhimurium. Mol. Microbiol. 20:497-505.

458. Shahamat, M., U. Mai, C. Paszko-Kolva, M. Kessel, and R. R. Colwell. 1993. Use of autoradiography to assess viability of Helicobacter pylori in water. Appl. Environ. Microbiol. 59:1231-1235.

459. Shapiro, R. L., S. Altekruse, L. Hutwagner, R. Bishop, R. Hammond, S. Wilson, B. Ray, S. Thompson, R. V. Tauxe, P. M. Griffin, and t. V. W. Group. 1998. The role of Gulf Coast oysters harvested in warmer months in Vibrio vulnificus infections in the United States, 1988-1996. J. Infect. Dis. 178:752-759.

460. Sharp, J. H., R. Benner, L. Bennett, C. A. Carlson, S. Fitzwater, E., E. T. Peltzer, and L. M. Tupas. 1995. Analysis of dissolved organic carbon in seawater: The JGOF Eq Pac methods comparison. Mar. Chem. 48:91-108.

461. Sharp, P. M. 1991. Determinants of DNA sequence divergence between Escherichia coli and Salmonella typhimurium: codon usage, map position, and concerted evolution. J. Mol. Evol. 33:23-33.

462. Shiba, T., K. Tsutsumi, H. Yano, Y. Ihara, A. Kameda, K. Tanaka, H. Takahashi, M. Munekata, N. N. Rao, and A. Kornberg. 1997. Inorganic 326

polyphosphate and the induction of rpoS expression. Proc. Natl. Acad. Sci., USA 94:11210-11215.

463. Shin, M. G., J. H. Shin, S. P. Suh, D. W. Ryang, and K. S. Bae. 1997. Cellular fatty acid profiles of ninety-five strains of Vibrio vulnificus isolated from clinical specimens in Korea. J. Gen. Appl. Microbiol. 43:317-324.

464. Showalter, R. E., M. O. Martin, and M. R. Silverman. 1990. Cloning and nucleotide sequence of luxR, a regulatory gene controlling bioluminescence in Vibrio harveyi. J. Bacteriol. 172:2946-2954.

465. Siegele, D., A., and R. Kolter. 1992. Life after log. J. Bacteriol. 174:345- 348.

466. Simon, R., U. Priefer, and A. Pühler. 1983. A broad host range mobilization system for in vivo genetic engineering: transposon mutagenesis in Gram negative bacteria. Bio/Technol. 1:784-791.

467. Simpson, L. M., and J. D. Oliver. 1987. Ability of Vibrio vulnificus to obtain iron from transferrin and other iron-binding proteins. Curr. Microbiol. 15:155-157.

468. Simpson, L. M., and J. D. Oliver. 1983. Siderophore production by Vibrio vulnificus. Infect. Immun. 41:644-649.

469. Simpson, L. M., V. K. White, S. F. Zane, and J. D. Oliver. 1987. Correlation between virulence and colony morphology in Vibrio vulnificus. Infect. Immun. 55:269-272.

470. Sledjeski, D., and S. Gottesman. 1995. A small RNA acts as an antisilencer of the H-NS-silenced rscA gene of Escherichia coli. Proc. Natl. Acad. Sci. USA. 92:2003-2007. 327

471. Sledjeski, D. D., A. Gupta, and S. Gottesman. 1996. The small RNA, DsrA, is essential for the low temperature expression of RpoS during exponential growth in Escherichia coli. EMBO J. 15:3993-4000.

472. Smith, J. J., J. P. Howington, and G. A. McFeters. 1994. Survival, physiological response, and recovery of enteric bacteria exposed to a polar marine environment. Appl. Environ. Microbiol. 60:2977-2984.

473. Solomon, J., B. Lazazzera, and A. Grossman. 1996. Purification and characterization of an extracellular peptide factor that affects two different developmental pathways in Bacillus subtilis. Genes Dev. 10:2014-2024.

474. Spassky, A., S. Rimsky, H. Garreau, and H. Buc. 1984. H1a, an E. coli DNA-binding protein which accumulates in stationary phase, strongly compacts DNA in vitro. Nucleic Acids Res. 12:5321-5340.

475. Spector, M. P. 1990. Gene expression in response to multiple nutrient- starvation conditions in Salmonella typhimurium. FEMS Microbiol. Ecol. 74:175- 184.

476. Spector, M. P., Z. Aliabadi, T. Gonzalez, and J. W. Foster. 1986. Global control in Salmonella typhimurium: Two-dimensional electrophoretic analysis of starvation-, anaerobiosis-, and heat shock-inducible proteins. J. Bacteriol. 168:420-424.

477. Spector, M. P., and C. L. Cubitt. 1992. Starvation-inducible loci of Salmonella typhimurium: regulation and roles in starvation-survival. Mol. Microbiol. 6:1467-1476.

478. Sperandio, V., J. L. Mellies, W. Nguyen, S. Shin, and J. B. Kaper. 1999. Quorum sensing controls expression of the type III secretion gene transcription and protein secretion in enterohemorrhagic and enteropathogenic Escherichia coli. Proc. Natl. Acad. Sci., USA 96:15196-15201. 328

479. Spira, B., N. Silberstein, and E. Yagil. 1995. Guanosine 3',5'- bispyrophosphate (ppGpp) synthesis in cells of Escherichia coli starved for Pi. J. Bacteriol. 177:4053-4058.

480. Srinivasan, S., J. Ostling, T. Charlton, R. deNys, K. Takayama, and S. Kjelleberg. 1998. Extracellular signal molecule(s) involved in the carbon starvation response of marine Vibrio sp. strain S14. J. Bacteriol. 180:201-209.

481. Steinert, M., L. Emödy, R. Amann, and J. Hacker. 1997. Resuscitation of viable but nonculturable Legionella pneumophila philadelphia jr32 by Acanthamoeba castellanii. Appl. Environ. Microbiol. 63:2047-2053.

482. Steinhaus, E. A., and J. M. Birkeland. 1938. Studies on the life and death of bacteria. I. The senescent phase in aging cultures and the probable mechanisms involved. J. Bacteriol. 38:249-261.

483. Stelma, G. N. J., A. L. Reyes, J. T. Peeler, C. H. Johnson, and P. L. Spaulding. 1992. Virulence characteristics of clinical and environmental isolates of Vibrio vulnificus. Appl. Environ. Microbiol. 58:2776-2782.

484. Stephens, K. 1986. Pheromones among the prokaryotes. Crit. Rev. Microbiol. 13:309-334.

485. Stern, N. J., D. M. Jones, I. V. Wesley, and D. M. Rollins. 1994. Colonization of chicks by non-culturable Campylobacter spp. Lett. Appl. Microbiol. 18:333-336.

486. Stevens, A. M., K. M. Dolan, and E. P. Greenberg. 1994. Synergistic binding of the Vibrio fischeri LuxR transcriptional activator domain and RNA polymerase to the lux promoter region. Proc. Natl. Acad. Sci. USA. 91:12619- 12623. 329

487. Stevens, A. M., and E. P. Greenberg. 1997. Quorum sensing in Vibrio fischeri: Essential elements for activation of the luminescence genes. J. Bacteriol. 179:557-562.

488. Stevenson, H. 1978. A case for bacterial dormancy in aquatic systems. Microb. Ecol. 4:127-133.

489. Stierle, A. C., J. H. Cardellina, and F. L. Singleton. 1988. A marine Micrococcus produces metabolites ascribed to the sponge Tedania ignis. Experimentia 44:1021.

490. Stock, J. B., A. J. Ninfa, and A. M. Stock. 1989. Protein phophorylation and regulation of adaptive responses in bacteria. Microbiol. Rev. 53:450-490.

491. Strange, R. E. 1961. Induced enzyme synthesis in aqueous suspensions of starved stationary phase Aerobacter aerogenes. Nature 191:1272-1273.

492. Strange, R. E., and M. Shon. 1964. Effects of thermal stress on viability and ribonucleic acid of Aerobacter aerogenes in aqueous suspension. J. Gen. Microbiol. 34:99-114.

493. Strom, M. S., and R. N. Paranjpye. 2000. Epidemiology and pathogenesis of Vibrio vulnificus. 2:177-188.

494. Stuart, M. R., L. S. Chou, and B. C. Weimer. 1999. Influence of carbohydrate starvation and arginine on culturability and amino acid utilization of Lactococcus lactis subsp. lactis. Appl. Environ. Microbiol. 65:665-673.

495. Surette, M. G., and B. L. Bassler. 1998. Quorum sensing in Escherichia coli and Salmonella typhimurium. Proc. Natl. Acad. Sci., USA 95:7046-7050.

496. Surette, M. G., M. B. Miller, and B. L. Bassler. 1999. Quorum sensing in Escherichia coli, Salmonella typhimurium, and Vibrio harveyi: a new family of 330

genes responsible for autoinducer production. Proc. Natl. Acad. Sci., USA 96:1639-1644.

497. Suzuki, T., C. Ueguchi, and T. Mizuno. 1996. H-NS regulates OmpF expression through micF antisense RNA in Escherichia coli. J. Bacteriol. 178:3650-3653.

498. Swartzman, E., and E. A. Meighen. 1993. Purification and characterization of a poly(dA-dT) lux-specific DNA-binding protein from Vibrio harveyi and identification as LuxR. J. Biol. Chem. 268:16706-16716.

499. Swift, S., J. P. Throup, P. Williams, G. P. C. Salmond, and G. S. A. B. Stewart. 1996. Quorum sensing: a population-density component in the determination of bacterial phenotype. Trends Biochem. Sci. 21:214-219.

500. Sze, C. C., and V. Shingler. 1999. The alarmone (p)ppGpp mediates physiological-responsive control at the s(54)-dependent Po promoter. Mol. Microbiol. 31:1217-1228.

501. Tabor, P. S., and R. Neihof. 1983. Improved microautoradiographic method to determine individual microorganisms active in substrate uptake in natural waters. Appl. Environ. Microbiol. 44:945-953.

502. Tabor, P. S., K. Ohwada, and R. R. Colwell. 1981. Filterable marine bacteria found in the deep sea: distribution, taxonomy, and response to starvation. Microb. Ecol. 7:67-83.

503. Tacket, C. O., T. J. Barrett, J. M. Mann, M. A. Roberts, and P. A. Blake. 1984. Wound infections caused by Vibrio vulnificus, a marine Vibrio, in inland areas of the United States. J. Clin. Microbiol. 19:197-199.

504. Tacket, C. O., F. Brenner, and P. A. Blake. 1984. Clinical features and an epidemiological study of Vibrio vulnificus infections. J. Infect. Dis. 149:558-561. 331

505. Tamplin, M. L., J. K. Jackson, C. Buchrieser, R. L. Murphree, K. M. Portier, V. Gangar, L. G. Miller, and C. W. Kaspar. 1996. Pulse-field gel electroporesis and ribotype profiles of clinical and environmental Vibrio vulnificus isolates. Appl. Environ. Microbiol. 62:3572-3580.

506. Tanaka, K., Y. Takayanagi, N. Fujita, A. Ishihama, and H. Takahashi. 1993. Heterogeneity of the principal s factor in Escherichia coli : The rpoS gene product, s38, is a second prinicple s factor of RNA polymerase in stationary- phase Escherichia coli. Proc. Natl. Acad. Sci., USA 90:3511-3515.

507. Tao, H., C. h. Bausch, C. Richmond, F. R. Blattner, and T. Conway. 1999. Functional genomics: Expression analysis of Escherichia coli growing on minimal and rich media. J. Bacteriol. 181:6425-6440.

508. Tendeng, C., C. Badaut, E. Krin, P. Gounon, S. Ngo, A. Danchin, S. Rimske, and P. Bertin. 2000. Isolation and characterization of vicH, encoding a new pleiotropic regulator in Vibrio cholerae. J. Bacteriol. 182:2026-2032.

509. Testa, J., L. W. Daniel, and A. S. Kreger. 1984. Extracellular phospholipase A2 and lysophospholipase produced by Vibrio vulnificus. Infect. Immun. 45:458-463.

510. Thampuran, N., and P. K. Surendran. 1998. Occurrence and distribution of Vibrio vulnificus in tropical fish and shellfish from Cochin (India). Lett. Appl. Microbiol. 26:110-112.

511. Tholozan, J. L., J. M. Cappelier, J. P. Tissier, G. Delattre, and M. Federighi. 1999. Physiological characterization of viable-but-nonculturable Campylobacter jejuni cells. Appl. Environ. Microbiol. 65:1110-1116.

512. Thom, S. M., R. W. Horobin, E. Seidler, and M. R. Barer. 1993. Factors affecting the selection and use of tetrazolium salts as cytochemical indicators of microbial viability and activity. J. Appl. Bacteriol. 74:433-443. 332

513. Thomson, N. R., M. A. Crow, S. J. McGowan, A. Cox, and G. P. C. Salmond. 2000. Biosynthesis of carbapenem antibiotic and prodigiosin pigment in Serratia is under quorum sensing control. Mol. Microbiol. 36:539-556.

514. Thorne, S. H., and H. D. Williams. 1999. Cell density-dependent starvation survival of Rhizobium leguminosarum bv. phaseoli: identification of the role of an N-acyl homoserine lactone in adaptation to stationary-phase survival. J. Bacteriol. 181:981-990.

515. Throup, J. P., M. Camara, G. S. Briggs, M. K. Winson, S. R. Chhabra, B. W. Bycroft, P. Williams, and G. S. A. B. Stewart. 1995. Characterisation of the yenl/yenR locus from Yersinia enterocolitica mediating the synthesis of two N -acylhomoserine lactone signal molecules. Mol. Microbiol. 17:345-356.

516. Tillett, D., and B. A. Neilan. 2000. Xanthogenate nucleic acid isolation from cultured and environmental cyanobacteria. J. Phycol. 36:1-8.

517. Tison, D. L., and M. T. Kelly. 1984. Vibrio vulnificus endometritis. J. Clin. Microbiol. 20:185-186.

518. Tison, D. L., and M. T. Kelly. 1986. Virulence of Vibrio vulnificus strains from marine enviroments. Appl. Environ. Microbiol. 51:1004-1006.

519. Troxler, J., M. Zala, Y. Moënne-Loccoz, C. Keel, and G. Défago. 1997. Predominance of nonculturable cells of the biocontrol strain Pseudomonas flourescens CHAO in the surface horizon of large outdoor lysimeters. Appl. Environ. Microbiol. 63:3776-3782.

520. Ullrich, S., B. Karrasch, H.-G. Hoppe, K. Jeskulke, and M. Mehrens. 1996. Toxic effects on bacterial metabolism of the redox dye 5-cyano-2,3-ditolyl tetrazolium chloride. Appl. Environ. Microbiol. 62:4587-4593. 333

521. Urakawa, H., K. Kita-Tsukamoto, and K. Ohwada. 1997. 16S rDNA genotyping using PCR/RFLP (restriction fragment length polymorphism) analysis among the family Vibrionaceae. FEMS Microbiol. Lett. 152:125-132.

522. Väätänen, P. 1976. Microbiological studies in coastal waters of the Northern Baltic sea, I. Distribution and abundance of bacteria and yeasts in the Tvärminne area. Walter and Andre de Nottbeck Found, Sci. Rep. 1:1-58.

523. Van Delden, C., and B. H. Iglewski. 1998. Cell-to-cell signaling and Pseudomonas aeruginosa infections. Emerg. Infect. Dis. 4:551-560.

524. van Overbeek, L. S., L. Eberl, M. Givskov, S. Molin, and J. D. van Elsas. 1995. Survival of, and induced stress resistance in, carbon-starved Pseudomonas fluorescens cells residing in soil. Appl. Environ. Microbiol. 61:4202-4208.

525. VanBogelen, R. A., and F. C. Neidhart. 1990. Global systems approach to bacterial physiology: protein responders to stress and starvation. FEMS Microbiol. Ecol. 74:121-128.

526. VanBogelen, R. A., E. R. Olson, B. L. Wanner, and F. C. Neidhardt. 1996. Global analysis of proteins synthesized during phosphorus restriction in Escherichia coli. J. Bacteriol. 178:4344-4366.

527. Vartian, C. V., and E. J. Septimus. 1990. Osteomyelitis caused by Vibrio vulnificus. J. Infect. Dis. 161:363.

528. Veenstra, J., P. J. G. M. Rietra, J. M. Coster, E. Slaats, and S. Dirks- Go. 1994. Seasonal variations in the occurrence of Vibrio vulnificus along the Dutch coast. Epidemiol. Infect. 112:285-290.

529. Vickery, M. C. L., N. Harold, and A. K. Bej. 2000. Cluster analysis of AP-PCR generated DNA fingerprints of Vibrio vulnificus isolates from patients 334

fatally infected after consumption of raw oysters. Lett. Appl. Microbiol. 30:258- 262.

530. Visick, K. L., and M. McFall-Ngai. 2000. An exclusive contract: specificity in the Vibrio fischeri-Euprymna scolopes partnership. J. Bacteriol. 182:1779-1787.

531. Visick, K. L., and E. G. Ruby. 1999. The emergent properties of quorum sensing: consequences to bacteria of autoinducer signaling in their natural environment, p. 333-352. In G. M. Dunny and S. C. Winans (ed.), Cell-Cell Signaling in Bacteria. American Society for Microbiology Press, Washington, D. C.

532. Visick, K. L., and E. G. Ruby. 1997. New genetic tools for use in the marine biolumiescent bacterium Vibrio fischeri, p. 119-122. In J. W. Hastings, L. J. Kricka, and P. E. Stanley (ed.), Bioluminescence and Chemiluminescence. John Wiley & Sons, Ltd., West Sussex, England.

533. von Kruger, W. M. A., S. Humphreys, and J. M. Ketley. 1999. A role for the PhoBR regulatory system homologue in the Vibrio cholerae phosphate limitation response and intestinal colonization. Microbiol. 145:2463-2475.

534. Votyakova, T. V., A. S. Kaprelyants, and D. B. Kell. 1994. Influence of viable cells on the resuscitation of dormant cells in Micrococcus luteus cultures held in an extended stationary phase. The population effect. Appl. Environ. Microbiol. 60:3284-3291.

535. Wada, A., Y. Yamazaki, N. Fujita, and A. Ishihama. 1990. Structure and probable genetic location of a "ribosome modulation factor" associated with 100S ribosomes in stationary-phase Escherichia coli cells. Proc. Natl. Acad. Sci., USA 87:2657-2661. 335

536. Wai, S. N., T. Moriya, K. Kondo, H. Misumi, and K. Amako. 1996. Resuscitation of Vibrio cholerae 01 strain TSI-4 from a viable but nonculturable state by heat shock. FEMS Microbiol. Lett. 136:187-191.

537. Wang, A.-Y., and J. E. J. Cronan. 1994. The growth phase-dependent sythesis of cylcopropane fatty acids in Escherichia coli is the result of an RpoS (KatF)-dependent promoter plus enzyme stability. Mol. Microbiol. 11:1009-1017.

538. Wanner, U., and T. Egli. 1990. Dynamics of microbial growth and cell composition in batch culture. FEMS Microbiol. Rev. 75:19-44.

539. Warner, J. M., and J. D. Oliver. 1998. Randomly amplified polymorphic DNA analysis of starved and viable nonculturable Vibrio vulnificus cells. Appl. Environ. Microbiol. 64:3025-3028.

540. Way, J. C., M. A. Davis, D. Morisato, D. E. Roberts, and N. Kleckner. 1984. New Tn10 derivatives for transposon mutagenesis and for construction of lacZ operon fusions by transposition. Gene 32:369-379.

541. Weichart, D., and S. Kjelleberg. 1996. Stress resistance and recovery potential of culturable and viable but nonculturable cells of Vibrio vulnificus. Microbiol. 142:845-853.

542. Weichart, D., D. McDougald, D. Jacobs, and S. Kjelleberg. 1997. In situ analysis of nucleic acids in cold-induced nonculturable Vibrio vulnificus. Appl. Environ. Microbiol. 63:2754-2758.

543. Weichart, D., J. D. Oliver, and S. Kjelleberg. 1992. Low temperature induced non-culturability and killing of Vibrio vulnificus. FEMS Microbiol. Lett. 100:205-210.

544. White, D., M. E. Hart, and T. Romeo. 1996. Phylogenetic distribution of the global regulatory gene csrA among eubacteria. Gene 182:221-223. 336

545. Whiteley, M., M. R. Parsek, and E. P. Greenberg. 2000. Regulation of quorum sensing by RpoS in Pseudomonas aeruginosa. Presented at the Abstr. Annu. Meet. Am. Soc. Microbiol., Los Angeles, California.Location.

546. Whitesides, M. D., and J. D. Oliver. 1997. Resuscitation of Vibrio vulnificus from the viable but nonculturable state. Appl. Environ. Microbiol. 63:1002-1115.

547. Willey, J. W., J. Santamaria, J. Guijarro, M. Geislich, and R. Losick. 1991. Extracellular complementation of a developmental mutation implicates a small sporulation protein in aerial mycelium formation by S. coelicolor. Cell 65:641-650.

548. Williams, P. J. l. B. 2000. Heterotrophic bacteria and the dynamics of dissolved organic material, p. 153-200. In D. L. Kirchman (ed.), Microbial ecology of the oceans. Wiley-Liss, Inc., New York, NY.

549. Wilson, K. J., R. A. Jefferson, and S. G. Hughes. 1992. The Escherichia coli gus operon: induction and expression of the gus operon in E. coli and the occurance and use of GUS in other bacteria, p. 7-22. In S. R. Gallagher (ed.), GUS Protocols: Using the GUS Gene as a Reporter of Gene Expression. Harcourt Brace Jovanovich, San Diego, New York, Boston, London, Sydney, Tokyo, Toronto.

550. Wilson, K. J., A. Sessitsch, J. C. Corbo, K. E. Giller, A. D. L. Akkermans, and R. A. Jefferson. 1995. b-glucuronidase (GUS) transposons for ecological and genetic studies of rhizobia and other Gram-negative bacteria. Microbiol. 141:1691-1705.

551. Wilson, M., and S. E. Lindow. 1992. Relationship of total viable and culturable cells in epiphytic population of Pseudomonas syringae. Appl. Environ. Microbiol. 58:3908-3913. 337

552. Winans, S. C., J. Zhu, and M. I. Moré. 1999. Cell density-dependent gene expression by Agrobacterium tumefaciens during colonization of crown gall tumors, p. 117-128. In G. M. Dunny and S. C. Winans (ed.), Cell-Cell Signaling in Bacteria. American Society for Microbiology Press, Washington, D. C.

553. Withers, H. L., and K. Nordström. 1998. Quorum-sensing acts at initiation of chromosomal replication in Escherichia coli. Proc. Natl. Acad. Sci., USA 95:15694-15699.

554. Wolf, P. W., and J. D. Oliver. 1992. Temperature effects on the viable but nonculturable state of Vibrio vulnificus. FEMS Microbiol. Ecol. 101:33-39.

555. Wongpaitoon, V., B. Sathaptayayongs, R. Prachaktam, S. Bunyaratvej, and S. Kurathong. 1985. Spontaneous Vibrio vulnificus peritonitis and primary sepsis in two patients with alcoholic cirrhosis. Am. J. Gastroenterol. 80:706-708.

556. Wright, A. C., R. T. Hill, J. A. Johnson, M.-C. Roghman, R. R. Colwell, and G. J. Morris. 1996. Distribution of Vibrio vulnificus in the Chesapeake Bay. Appl. Environ. Microbiol. 62:717-724.

557. Wright, A. C., J. G. J. Morris, D. R. J. Maneval, K. Richardson, and J. B. Kaper. 1985. Cloning of the cytotoxin-hemolysin gene of Vibrio vulnificus. Infect. Immun. 50:922-924.

558. Wright, A. C., J. L. Powell, M. K. Tanner, L. A. Ensor, A. B. Karpas, J. G. J. Morris, and M. B. Sztein. 1999. Differential expression of Vibrio vulnificus capsular polysaccharide. Infect. Immun. 67:2250-2257.

559. Wright, A. C., L. M. Simpson, J. D. Oliver, and J. G. Morris, Jr. 1990. Phenotypic evaluation of acapsular transposon mutants of Vibrio vulnificus. Infect. Immun. 58:1769-1773. 338

560. Xiao, H., M. Kalman, K. Ikehara, S. Zemel, G. Glaser, and M. Cashel. 1991. Residual guanosine 3',5'-bispyrophosphate synthetic activity of relA null mutants can be eliminated by spoT null mutations. J. Biol. Chem. 266:5980-5990.

561. Xu, H.-S., N. Roberts, F. L. Singleton, R. W. Attwell, D. J. Grimes, and R. R. Colwell. 1982. Survival and viability of nonculturable Escherichia coli and Vibrio cholerae in the estuarine and marine environment. Microb. Ecol. 8:313- 323.

562. Yamaguchi, N., and M. Nasu. 1997. Flow cytometric analysis of bacterial respiratory and enzymatic activity in the natural aquatic environment. J. Appl. Microbiol. 83:43-52.

563. Yamamoto, H., Y. Hashimoto, and T. Ezaki. 1996. Study of nonculturable Legionella pneumophila cells during multiple-nutrient starvation. FEMS Microbiol. Ecol. 20:149-154.

564. Yamamoto, K., A. C. Wright, J. B. Kaper, and J. G. Morris, Jr. 1990. The cytolysin gene of Vibrio vulnificus: sequence and relationship to the Vibrio cholerae El Tor hemolysin gene. Infect. Immun. 58:2706-2709.

565. Yamashino, T., C. Ueguchi, and T. Mizuno. 1995. Quantitative control of the stationary phase-specific sigma factor, ss, in Escherichia coli: involvement of the nucleoid protein H-NS. EMBO J. 14:594-602.

566. Yanisch-Perron, C., J. Vieria, and J. Messing. 1985. Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors. Gene 33:103-119.

567. Yildiz, F. H., and G. K. Schoolnik. 1998. Role of rpoS in stress survival and virulence of Vibrio cholerae. J. Bacteriol. 180:773-784. 339

568. Yoshida, S. I., M. Ogawa, and Y. Mizuguchi. 1985. Relation of capsular materials and colony opacity to virulence of Vibrio vulnificus. Infect. Immun. 47:446-451.

569. You, Z., J. Fukushima, K. Tanaka, S. Kawamoto, and K. Okuda. 1998. Induction of entry into stationary growth phase in Pseudomonas aeruginosa by N- acylhomoserine lactone. FEMS Microbiol. Lett. 164:99-106.

570. Zambrano, M. M., and R. Kolter. 1996. GASPing for life in stationary phase. Cell 86:181-184.

571. Zhang, A., S. Altuvia, A. Tiwari, L. Argaman, R. Hengge-Aronis, and G. Storz. 1998. The OxyS regulatory RNA represses rpoS translation and binds the Hfq (HF-I) protein. EMBO J. 17:6061-6068.

572. Zhang, L., P. J. Murphy, A. Kerr, and M. E. Tate. 1993. Agrobacterium conjugation and gene regulation by N-acyl-L-homoserine lactones. Nature 362:446-448.

573. Zheng, M., F. Åslund, and G. Storz. 1998. Activation of the OxyR transcription factor by reversible disulfide bond formation. Science 279:1718- 1721.

574. Zimmerman, R., R. Iturriaga, and J. Becker-Birck. 1978. Simultaneous determinations of the total number of aquatic bacteria and the number thereof involved in respiration. Appl. Environ. Microbiol. 36:926-935.