DOCSLIB.ORG

Presynaptic Facilitation of Glutamatergic Synapses to Dopaminergic Neurons of the Rat Substantia Nigra by Endogenous Stimulation of Vanilloid Receptors

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Presynaptic Facilitation of Glutamatergic Synapses to Dopaminergic Neurons of the Rat Substantia Nigra by Endogenous Stimulation of Vanilloid Receptors 3136 • The Journal of Neuroscience, April 15, 2003 • 23(8):3136–3144 Presynaptic Facilitation of Glutamatergic Synapses to Dopaminergic Neurons of the Rat Substantia Nigra by Endogenous Stimulation of Vanilloid Receptors Silvia Marinelli,1 Vincenzo Di Marzo,4 Nicola Berretta,1 Isabel Matias,4 Mauro Maccarrone,3 Giorgio Bernardi,1,2 and Nicola B. Mercuri1,2 1Istituto di Ricovero e Cura a Carattere Scientifico Fondazione Santa Lucia and Departments of 2Neuroscience and 3Experimental Medicine and Biochemical Sciences, University of Tor Vergata, 00179 Rome, Italy, and 4Endocannabinoid Research Group, Istituto di Chimica Biomolecolare, Consiglio Nazionale delle Ricerche, 80078 Pozzuoli, Italy Growing evidence regarding the function of vanilloid receptor-1 (VR1) in the brain suggests potential central roles of this receptor, previously described to occur primarily in peripheral sensory neurons. In the present study, we used electrophysiological and biochem- ical techniques to investigate the function and the endogenous stimulation of VR1 in dopaminergic neurons of the substantia nigra pars compacta (SNc). The VR1 agonist capsaicin increased the frequency of both TTX-sensitive and -insensitive spontaneous EPSCs (sEPSCs) without affecting their amplitude, suggesting a presynaptic site of action. In contrast, no effect was detected with regard to GABAergic transmission. No increase in sEPSC frequency was observed in the presence of cadmium chloride, while the voltage-dependent calcium channel antagonist ␻-conotoxin MVIIC did not prevent capsaicin action. The VR1 antagonists capsazepine and iodoresiniferatoxin (IRTX) blocked the effects of capsaicin. Importantly, IRTX per se reduced sEPSC frequency, suggesting a tonic activity of VR1. The endogenous VR1 agonist anandamide (AEA) produced an IRTX-sensitive increase in the frequency of sEPSCs on dopaminergic neurons that was more pronounced when protein kinase A had been activated. Furthermore, mass spectrometric analyses and binding experi- ments revealed high levels of endogenous AEA and specific binding of AEA to VR1 receptors in the SNc. These data suggest a tonic facilitation of glutamate release exerted by VR1 in the SNc through a stimulation of VR1 by endovanilloids, including anandamide. The increase in sEPSC frequency by VR1 onto midbrain dopaminergic neurons suggests the involvement of these receptors in motor and cognitive functions involving the dopaminergic system. Key words: capsaicin; VR1; EPSCs; substantia nigra; anandamide; presynaptic mechanisms Introduction 12-hydroperoxyeicosatetraenoic acid, and leukotriene B4 (Shin et The recent demonstration of a widespread distribution of the al., 2002) and, more potently, N-arachidonoyl-dopamine (NADA) mRNA for vanilloid receptor subtype-1 [VR1, also known as (Huang et al., 2002) can act as endogenous VR1 agonists. transient receptor potential vanilloid 1 (TRPV1)] and of VR1- With regard to the role of VR1 in the CNS, little is known of its like immunoreactivity in the CNS (Sasamura et al., 1998; Mezey function in the brain. Recent evidence suggests distinct actions in et al., 2000; Schumacher et al., 2000; Szabo et al., 2002) strongly the hypothalamus, locus ceruleus, and hippocampus. In particu- suggests that these receptors are involved not only in peripheral lar, capsaicin has been reported to increase the firing rate of hy- functions such as perception of inflammatory and thermal pain pothalamic preoptic neurons recorded in vivo (Hori et al., 1988) (Caterina et al., 1997; Julius and Basbaum, 2001) but also in and the release of glutamate from hypothalamic slices (Sasamura central responses. It is known that the “hot” chili pepper constit- et al., 1998). In the locus ceruleus, capsaicin activated firing uent capsaicin (Caterina et al., 1997; Tominaga et al., 1998; Kress (Hajos et al., 1987) and increased the frequency of excitatory and Zeilhofer, 1999; Smart et al., 2000) and the irritant extract postsynaptic currents (Marinelli et al., 2002a). However, capsa- from the Euphorbia resinifera, resiniferatoxin (RTX) activate icin, anandamide, and NADA potentiate the GABA-dependent these receptors (Acs et al., 1994). In addition protons, heat, and paired-pulse depression in the CA1 region of the hippocampus endogenous fatty acid derivatives such as anandamide (AEA) (Al-Hayani et al., 2001; Huang et al., 2002). (Zygmunt et al., 1999; Smart et al., 2000; Di Marzo et al., 2001b), The basal ganglia is endowed with VR1-immunopositive cells, with the substantia nigra being an area with a strong signal (Mezey et al., 2000). Behavioral experiments have reported that Received Sept. 10, 2002; revised Jan. 13, 2003; accepted Jan. 13, 2003. We thank Dr. Marco Capogna for helpful comments on this manuscript, Drs. Monica Bari and Natalia Battista for an intranigral injection of capsaicin enhanced motor behavior their skillful assistance in the binding experiments, Dr. Luciano De Petrocellis for valuable assistance in the RT-PCR (Dawbarn et al., 1981; Hajos et al., 1988), suggesting a functional experiments, and the VolkswagenStiftung for partial support (V.D.M.). role of these receptors in this area, but no direct investigations Correspondence should be addressed to Dr. Silvia Marinelli, Fondazione Santa Lucia Istituto di Ricovero e have been performed so far to elucidate VR1 function in the Cura a Carattere Scientifico, Experimental Neurology Laboratory, Via Ardeatina 306, 00179 Rome, Italy. E-mail: [email protected]. ventral midbrain. Copyright © 2003 Society for Neuroscience 0270-6474/03/233136-09$15.00/0 We now present direct evidence of VR1 function in the sub- Marinelli et al. • Presynaptic Increase in sEPSCs by VR1 in the SNc J. Neurosci., April 15, 2003 • 23(8):3136–3144 • 3137 stantia nigra and demonstrate an excitatory role of these recep- vitrogen, San Diego, CA). After extraction, RNA was precipitated using tors, exerted through an increase in synaptic glutamate release ice-cold isopropanol and resuspended in diethyl pyrocarbonate (Sigma, onto the dopaminergic neurons. Moreover, we provide evidence St. Louis, MO)-treated water; its integrity was verified after separation by for an endogenous activation of VR1 that tonically stimulates electrophoresis into a 1% agarose gel containing ethidium bromide. glutamate release in the dopaminergic system. Part of this work RNA was further treated with RNase-free DNase I (DNA-free kit; Am- has been published previously in abstract form (Marinelli et al., bion, Austin, TX) to digest contaminating genomic DNA and to subse- quently remove the DNase and divalent cations. 2002b). The expression of mRNAs for glyceraldehyde-3-phosphate dehydro- genase (GAPDH) and VR1 receptors was examined by reverse transcrip- Materials and Methods tion (RT)-PCR. Total RNA was reverse-transcribed using oligo(dT) Slice preparation. Wistar rats (12–24 d of age) were anesthetized with halo- primers. DNA amplifications were performed in PCR buffer (Q-Biogen) ␮ ␮ ␮ thane and killed by decapitation. All experiments followed international containing 2 l of cDNA, 500 M deoxyNTP, 2 mM MgCl2, 0.8 M of each guidelines on the ethical use of animals from the European Communities primer, and 0.5 U of Taq polymerase (Q-Biogen). The thermal reaction Council (EEC) Directive of November 24, 1986 (86/609/EEC). The brain profile consisted of a denaturation step at 94°C for 1 min, annealing at was rapidly removed from the skull, and horizontal midbrain slices (300 60°C for 1 min, and an extension step at 72°C for 1 min. A final extension ␮m) were cut in cold artificial CSF (ACSF) using a vibratome and left to step of 10 min was performed at 72°C. The PCR cycles were 35 for VR1 recover at 33°C for at least 1 hr. Slices were placed in a recording chamber and GAPDH and were observed to be optimal and in the linear portion of and submerged in continuously flowing (2.5 ml/min, 33–33.5°C) ACSF. the amplification curve (data not shown). Reaction was performed in a ACSF composition was as follows (in mM): 126 NaCl, 2.5 KCl, 1.2 MgCl2, 2.4 PE Gene Amp PCR System 2400 (PerkinElmer Life Sciences, Emeryville, CaCl2, 1.2 NaH2PO4, 19 NaHCO3, and 10 glucose. In experiments using CA). After reaction, the PCR products were electrophoresed on a 2% cadmium, NaH2PO4 and CaCl2 were omitted from ACSF. agarose gel containing ethidium bromide for UV visualization. The spe- Neurons were visualized using infrared Nomarski optics on an upright cific oligonucleotides were synthesized on the basis of cloned human microscope (BX50WI; Olympus Optical, Hataguya, Shibuya-Ku, Japan). cDNA sequences of rat GAPDH and VR1. For GAPDH, the primer se- Patch-clamp recordings were obtained using glass electrodes (3–4M⍀) quences were CCCTTCATTGACCTCAACTACATGGT (sense) and filled with (in mM): 150 K-methylsulfate, 2 MgCl2, 0.1 EGTA, 10 HEPES, GAGGGGCCATCCACAGTCTTCTG (antisense). The VR1 sense and anti- 2 MgATP, and 0.3 Na3GTP, pH 7.4, with KOH. sense primers were TCTATGATCGCAGGAGCATCTTCG and TCTGT- Whole-cell voltage-clamp recordings (Ϫ60 mV holding potential) GTAGCTGGCATTGACAAAC, respectively. The expected sizes of the were obtained using an Axopatch 1D (Axon Instruments, Foster City, amplicons were 470 bp for GAPDH and 256 bp for VR1. CA). Spontaneous EPSCs (sEPSCs) and spontaneous IPSCs (sIPSCs) Binding of [3H]anandamide to rat midbrain slices. The binding of 200 3 were filtered at 1 kHz, digitized at 10 kHz, and recorded on computer nM [ H]AEA to substantia nigra membrane fractions (50 ␮g protein/ using pClamp8 software (Axon Instruments). Series resistances (8–15
Load more

Recommended publications
  • TRP Mediation
    molecules Review Remedia Sternutatoria over the Centuries: TRP Mediation Lujain Aloum 1 , Eman Alefishat 1,2,3 , Janah Shaya 4 and Georg A. Petroianu 1,* 1 Department of Pharmacology, College of Medicine and Health Sciences, Khalifa University of Science and Technology, Abu Dhabi 127788, United Arab Emirates; [email protected] (L.A.); Eman.alefi[email protected] (E.A.) 2 Center for Biotechnology, Khalifa University of Science and Technology, Abu Dhabi 127788, United Arab Emirates 3 Department of Biopharmaceutics and Clinical Pharmacy, Faculty of Pharmacy, The University of Jordan, Amman 11941, Jordan 4 Pre-Medicine Bridge Program, College of Medicine and Health Sciences, Khalifa University of Science and Technology, Abu Dhabi 127788, United Arab Emirates; [email protected] * Correspondence: [email protected]; Tel.: +971-50-413-4525 Abstract: Sneezing (sternutatio) is a poorly understood polysynaptic physiologic reflex phenomenon. Sneezing has exerted a strange fascination on humans throughout history, and induced sneezing was widely used by physicians for therapeutic purposes, on the assumption that sneezing eliminates noxious factors from the body, mainly from the head. The present contribution examines the various mixtures used for inducing sneezes (remedia sternutatoria) over the centuries. The majority of the constituents of the sneeze-inducing remedies are modulators of transient receptor potential (TRP) channels. The TRP channel superfamily consists of large heterogeneous groups of channels that play numerous physiological roles such as thermosensation, chemosensation, osmosensation and mechanosensation. Sneezing is associated with the activation of the wasabi receptor, (TRPA1), typical ligand is allyl isothiocyanate and the hot chili pepper receptor, (TRPV1), typical agonist is capsaicin, in the vagal sensory nerve terminals, activated by noxious stimulants.
    [Show full text]
  • 102 the Effects of Intravesical
    102 Harper M, Brady C. M, Scaravilli F, Fowler C. J. Institute of Neurology, London THE EFFECTS OF INTRAVESICAL RESINIFERATOXIN ON SUBUROTHELIAL NERVE DENSITY IN PATIENTS WITH NEUROGENIC DETRUSOR OVERACTIVITY Aims of Study Somatic and autonomic neural pathways integrated in the CNS regulate urine storage and voiding. When spinal cord lesions disrupt these pathways, an aberrant segmental sacral reflex emerges, the afferent limb of which is comprised of small unmyelinated C-fibres that originate in the suburothelium. This pathological reflex is thought to be the underlying cause of “spinal” neurogenic detrusor overactivity (NDO). We are currently evaluating the role of resiniferatoxin (RTX) in the treatment of refractory “spinal” NDO. RTX is an ultra-potent capsaicin analogue purified from the dried latex of the succulent plant Euphorbia Resinifera. The vanillyl group of RTX facilitates the action of the vanilloid receptor (VR-1), a non-selective cation channel expressed on suburothelial C-fibres. Intravesical therapy with a single dose of RTX results in early acute excitatory effects (“sensitisation”) followed by inhibition of neuropeptide release and neuronal terminal field degeneration (“desensitisation”) (Avelino et al., 2001). In patients with refractory NDO, it has been shown that intravesical therapy with vanilloid compounds such as RTX or capsaicin significantly decreases lower urinary tract symptoms for a period of weeks or months, depending on factors such as dose and disease progression. It is thought that the eventual recurrence of symptoms is related to C-fibre regeneration. We have previously shown that the mean suburothelial nerve density decreases in patients who respond to capsaicin. Our experimental aim is to measure suburothelial nerve density in flexible cystoscopic biopsies in controls and patients with NDO before and after intravesical RTX or placebo.
    [Show full text]
  • TRP CHANNELS AS THERAPEUTIC TARGETS TRP CHANNELS AS THERAPEUTIC TARGETS from Basic Science to Clinical Use
    TRP CHANNELS AS THERAPEUTIC TARGETS TRP CHANNELS AS THERAPEUTIC TARGETS From Basic Science to Clinical Use Edited by ARPAD SZALLASI MD, PHD Department of Pathology, Monmouth Medical Center, Long Branch, NJ, USA AMSTERDAM • BOSTON • HEIDELBERG • LONDON NEW YORK • OXFORD • PARIS • SAN DIEGO SAN FRANCISCO • SINGAPORE • SYDNEY • TOKYO Academic Press is an imprint of Elsevier Academic Press is an imprint of Elsevier 125 London Wall, London, EC2Y 5AS, UK 525 B Street, Suite 1800, San Diego, CA 92101-4495, USA 225 Wyman Street, Waltham, MA 02451, USA The Boulevard, Langford Lane, Kidlington, Oxford OX5 1GB, UK First published 2015 Copyright © 2015 Elsevier Inc. All rights reserved. No part of this publication may be reproduced or transmitted in any form or by any means, electronic or mechanical, including photocopying, recording, or any information storage and retrieval system, without permission in writing from the publisher. Details on how to seek permission, further information about the Publisher’s permissions policies and our arrangement with organizations such as the Copyright Clearance Center and the Copyright Licensing Agency, can be found at our website: www.elsevier.com/permissions This book and the individual contributions contained in it are protected under copyright by the Publisher (other than as may be noted herein). Notices Knowledge and best practice in this field are constantly changing. As new research and experience broaden our understanding, changes in research methods, professional practices, or medical treatment may become necessary. Practitioners and researchers must always rely on their own experience and knowledge in evaluating and using any information, methods, compounds, or experiments described herein.
    [Show full text]
  • The Role of Phytotoxic and Antimicrobial Compounds of Euphorbia Gummifera in the Cause and Maintenance of the Fairy Circles of Namibia
    The role of phytotoxic and antimicrobial compounds of Euphorbia gummifera in the cause and maintenance of the fairy circles of Namibia by Nicole Galt Submitted in partial fulfillment of the requirements for the degree Magister Scientiae Department of Plant and Soil Sciences Faculty of Natural and Agricultural Sciences University of Pretoria Pretoria Supervisor: Prof. J.J.M. Meyer March 2018 i The role of phytotoxic and antimicrobial compounds of Euphorbia gummifera in the cause and maintenance of the fairy circles of Namibia by Nicole Galt Department of Plant and Soil Sciences Faculty of Natural and Agricultural Sciences University of Pretoria Pretoria Supervisor: Prof. J.J.M. Meyer Degree: MSc Medicinal Plant Science Abstract Fairy circles (FC) are unexplained botanical phenomena of the pro-Namib desert and parts of the West Coast of South Africa. They are defined as circular to oval shaped anomalies of varying sizes that are left bereft of vegetation. Even though there are several distinctly different hypotheses that have aimed to explain the origin of fairy circles, none have done so to satisfaction of the scientific community. The aim of this study was to determine if phytotoxic and antibacterial properties of a co-occurring Euphorbia species, E. gummifera plays a role in the creation of fairy circles. Representative soil samples (from inside-, outside fairy circles and underneath dead E. gummifera plants) and plant samples (aerial ii parts of E. gummifera and intact grasses, Stipagrostis uniplumis) were collected from the area. The collected samples were used for a several biological assays. A soil bed bio-assay was done using the three collected soil types.
    [Show full text]
  • TRPV1 and Endocannabinoids: Emerging Molecular Signals That Modulate Mammalian Vision
    Cells 2014, 3, 914-938; doi:10.3390/cells3030914 OPEN ACCESS cells ISSN 2073-4409 www.mdpi.com/journal/cells Review TRPV1 and Endocannabinoids: Emerging Molecular Signals that Modulate Mammalian Vision 1,2,†, 1,2,† 1,† 1,2,3,4, Daniel A. Ryskamp *, Sarah Redmon , Andrew O. Jo and David Križaj * 1 Department of Ophthalmology & Visual Sciences, Moran Eye Institute, University of Utah School of Medicine, Salt Lake City, UT 84132, USA; E-Mails: [email protected] (S.R.); [email protected] (A.O.J.) 2 Interdepartmental Program in Neuroscience, University of Utah School of Medicine, Salt Lake City, UT 84132, USA 3 Department of Neurobiology & Anatomy, University of Utah School of Medicine, Salt Lake City, UT 84132, USA 4 Center for Translational Medicine, University of Utah School of Medicine, Salt Lake City, UT 84132, USA † Those authors contributed equally to this work. * Authors to whom correspondence should be addressed; E-Mails: [email protected] (D.A.R.); [email protected] (D.K.); Tel.: +1-801-213-2777 (D.K.); Fax: +1-801-587-8314 (D.K.). Received: 1 July 2014; in revised form: 27 August 2014 / Accepted: 5 September 2014 / Published: 12 September 2014 Abstract: Transient Receptor Potential Vanilloid 1 (TRPV1) subunits form a polymodal cation channel responsive to capsaicin, heat, acidity and endogenous metabolites of polyunsaturated fatty acids. While originally reported to serve as a pain and heat detector in the peripheral nervous system, TRPV1 has been implicated in the modulation of blood flow and osmoregulation but also neurotransmission, postsynaptic neuronal excitability and synaptic plasticity within the central nervous system.
    [Show full text]
  • Osher Mini Medical School Feb 10 2016 Schumacher HAND OUT.Pptx
    2/10/16! Back to the Future of Pain Medicine ! What is Pain?! ! Pain: “An unpleasant sensory and emotional Mark Schumacher Ph.D.,M.D.! experience associated with actual or potential Professor and Chief, Division of Pain Medicine! tissue damage, or described in terms of such Dept. of Anesthesia & Perioperative Care! damage (IASP).”! Medical Director, UCSF Pain Services! University of California, San Francisco! Plant derivatives imitate endogenous Have we made any progress in the analgesic systems pharmacologic treatment of pain?! ! Morphine! " 1805 - Primary therapy for severe pain is:! " Morphine! ! Endorphin! " 2016 - Primary therapy for severe pain is:! " Morphine! •" Sustained Release! Ideal analgesic ?! A revolution is underway in our understanding of the pain pathway! Acts selectively on the “pain-sensing” nerves! Does not depress CNS - respiration! .. and its origin began thousands of Use over time maintains analgesia! years ago with the physicians of ancient times! Easy to administer! Is not addictive! Affordable $$! ! 1! 2/10/16! # Anti-Atlas Mountains-Morocco! Capsaicin vs. Resiniferatoxin (RTX)! ! ! ! ! # Euphorbia Resinifera! Share a Common Modification ! Perception! Peppers Sail the Ocean Blue! Transmission! 2000 BC 63 BC 1428 1492 Euphobia Resinifera Transduction! Descartes 1644 ! Sherrington and the development ! of modern neurobiology - nociceptor! Primary Afferent Nociceptors! Sherrington (1906) ... Proposed: the experience of pain is based on nerves that responded to specific 2000 BC 63 BC 1428 1492 1906 noxious stimuli
    [Show full text]
  • THE VANILLOID RECEPTOR: a Molecular Gateway to the Pain
    P1: FMF December 11, 2000 14:7 Annual Reviews AR121-17 Annu. Rev. Neurosci. 2001. 24:487–517 Copyright c 2001 by Annual Reviews. All rights reserved THE VANILLOID RECEPTOR:AMolecular Gateway to the Pain Pathway Michael J Caterina1 and David Julius2 1Department of Biological Chemistry, Johns Hopkins University School of Medicine, Baltimore, Maryland 21205; e-mail: [email protected] 2Department of Cellular and Molecular Pharmacology, University of California at San Francisco, San Francisco, California 94143; e mail: [email protected] Key Words capsaicin, pain, nociceptor, ion channel, heat sensation, hyperalgesia ■ Abstract The detection of painful stimuli occurs primarily at the peripheral termi- nals of specialized sensory neurons called nociceptors. These small-diameter neurons transduce signals of a chemical, mechanical, or thermal nature into action potentials and transmit this information to the central nervous system, ultimately eliciting a perception of pain or discomfort. Little is known about the proteins that detect nox- ious stimuli, especially those of a physical nature. Here we review recent advances in the molecular characterization of the capsaicin (vanilloid) receptor, an excitatory ion channel expressed by nociceptors, which contributes to the detection and integration of pain-producing chemical and thermal stimuli. The analysis of vanilloid receptor gene knockout mice confirms the involvement of this channel in pain sensation, as well as in hypersensitivity to noxious stimuli following tissue injury. At the same time, these studies demonstrate the existence of redundant mechanisms for the sensation of heat-evoked pain. by SCELC Trial on 10/04/10. For personal use only. INTRODUCTION Annu. Rev. Neurosci. 2001.24:487-517.
    [Show full text]
  • Homeopathic Remedies
    HOMEOPATHIC REMEDIES ABIES CANADENSIS ABIES NIGRA ABROTANUM ABSINTHIUM ACALYPHA INDICA ACANTHIA LECTULARIUS ACARUS ACETANILIDE ACHYRANTHES ACIDUM ACETICUM ACIDUM BENZOICUM ACIDUM BORICUM ACIDUM BUTYRICUM ACIDUM CAMPHORICUM ACIDUM CARBOLICUM ACIDUM CHROMICUM ACIDUM CHRYSOPHANICUM ACIDUM CITRICUM ACIDUM TANNICUM ACIDUM FLOURICUM ACIDUM FORMICUM ACIDUM GALLICUM ACIDUM HIPPURICUM ACIDUM HYDROBROMICUM ACIDUM HYDROCYANICUM ACIDUM LACTICUM ACIDUM MURIATICUM ACIDUM NITRICUM ACIDUM NITRO-HYDROCHLORICUM ACIDUM NITRO-MURIATICUM ACIDUM OXALICUM ACIDUM PHOSPHORICUM ACIDUM PICRICUM ACIDUM SALICYLICUM ACIDUM SARCOLACTICUM ACIDUM SUCCINICUM ACIDUM SULPHURICUM ACIDUM SULFUROSUM ACIDUM TARTARICUM ACIDUM URICUM ACONITINE 3 ACONITUM CAMMARUM ACONITUM FEROX ACONITUM LYCOTONUM ACONITUM NAPELLUS ACTAEA RACEMOSA ACTAEA SPICATA ADEPS SUIS ADONIDINE ADONIS VERNALIS ADRENALINE AESCULUS GLABRA AESCULUS HYPOCASTANUM AETHER NITRE SPIRITUS AETHIOPS ANTIMONIALIS AETHIOPS MERCURIUS MINERALIS AETHUSA CYNAPIUM AGARICIN AGARICUS EMETICUS AGARICUS MUSCARIUS AGARICUS PHALLOID AGAVE AMERICANA AGNUS CASTUS AGRAPHIS NUTANS AGRIMONIA EUPATORIA AGROPYRON REPENS AGROSTEMA GITHAGO AILANTHUS GLANDULOSA ALCOHOL SULPHURIS ALETRIS FARINOSA ALFALFA ALKEKENGI OFFICINARUM ALLIUM CEPA ALLIUM SATIVUM ALNUS RUBRA ALOE SOCOTRINA ALSTONIA CONSTRICTA ALSTONIA SCHOLARIS ALTHAE OFFICINALIS ALUMEN ALUMINA ALUMINIUM ACETICUM ALUMINIUM CHLORIDE ALUMINIUM SILICATUM ALUMINIUM SILICO SULPHOCALCATE AMANITA MUSCARIUS 4 AMANITA PHALLOIDES AMANITA PHALLOIDES ALBA AMANITA VERNUS AMBER SUCCINUM AMBRA GRISEA
    [Show full text]
  • PC18 Inf. 6 (English Only / Únicamente En Inglés / Seulement En Anglais)
    PC18 Inf. 6 (English only / Únicamente en inglés / Seulement en anglais) CONVENTION ON INTERNATIONAL TRADE IN ENDANGERED SPECIES OF WILD FAUNA AND FLORA ____________ Eighteenth meeting of the Plants Committee Buenos Aires (Argentina), 17-21 March 2009 TRADE SURVEY STUDY ON SUCCULENT EUPHORBIA SPECIES PROTECTED BY CITES AND USED AS COSMETIC, FOOD AND MEDICINE, WITH SPECIAL FOCUS ON CANDELILLA WAX The attached document has been submitted by the Scientific Authority of Germany*. * The geographical designations employed in this document do not imply the expression of any opinion whatsoever on the part of the CITES Secretariat or the United Nations Environment Programme concerning the legal status of any country, territory, or area, or concerning the delimitation of its frontiers or boundaries. The responsibility for the contents of the document rests exclusively with its author. PC18 Inf. 6 – p. 1 Trade survey study on succulent Euphorbia species protected by CITES and used as cosmetic, food and medicine, with special focus on Candelilla wax Dr. Ernst Schneider PhytoConsulting, D-84163 Marklkofen Commissioned by Bundesamt für Naturschutz CITES Scientific Authority, Germany February 2009 Content SUMMARY ................................................................................................................. 4 OBJECTIVE................................................................................................................ 5 CANDELILLA WAX, ITS USE AND THE PLANT SOURCE ....................................... 6 Candelilla wax
    [Show full text]
  • Further Terpenoids from Euphorbia Tirucalli
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Archive Ouverte en Sciences de l'Information et de la Communication Further terpenoids from Euphorbia tirucalli Thuc-Huy Duong, Mehdi A Beniddir, Grégory Genta-Jouve, Huu-Hung Nguyen, Dinh-Phuoc Nguyen, Thi-Anh-Tuyet Nguyen, Dinh-Hung Mac, Joël Boustie, Kim-Phi-Phung Nguyen, Warinthorn Chavasiri, et al. To cite this version: Thuc-Huy Duong, Mehdi A Beniddir, Grégory Genta-Jouve, Huu-Hung Nguyen, Dinh-Phuoc Nguyen, et al.. Further terpenoids from Euphorbia tirucalli. Fitoterapia, Elsevier, 2019, 135, pp.44-51. 10.1016/j.fitote.2019.04.001. hal-02120745 HAL Id: hal-02120745 https://hal-univ-rennes1.archives-ouvertes.fr/hal-02120745 Submitted on 21 Jun 2019 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. ACCEPTED MANUSCRIPT Further Terpenoids from Euphorbia tirucalli Thuc-Huy Duong,a,b Mehdi A. Beniddir,c Grégory Genta-Jouve,d Huu-Hung Nguyen,e Dinh-Phuoc Nguyen,f Thi-Anh-Tuyet Nguyen,g Dinh-Hung Mac,h Joël Boustie,i Kim-Phi-Phung Nguyen,j Warinthorn Chavasiri,f*and Pierre Le Pogamc* aDepartment for Management of Science and Technology Development, Ton Duc Thang University, Ho Chi Minh City, Vietnam bFaculty of Applied Sciences, Ton Duc Thang University, Ho Chi Minh City, Vietnam cBioCIS, Université Paris-Sud, CNRS, Université Paris-Saclay, 5 Rue J.-B.
    [Show full text]
  • TRPV Channels and Their Pharmacological Modulation
    Cellular Physiology Cell Physiol Biochem 2021;55(S3):108-130 DOI: 10.33594/00000035810.33594/000000358 © 2021 The Author(s).© 2021 Published The Author(s) by and Biochemistry Published online: online: 28 28 May May 2021 2021 Cell Physiol BiochemPublished Press GmbH&Co. by Cell Physiol KG Biochem 108 Press GmbH&Co. KG, Duesseldorf SeebohmAccepted: 17et al.:May Molecular 2021 Pharmacology of TRPV Channelswww.cellphysiolbiochem.com This article is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 Interna- tional License (CC BY-NC-ND). Usage and distribution for commercial purposes as well as any distribution of modified material requires written permission. Review Beyond Hot and Spicy: TRPV Channels and their Pharmacological Modulation Guiscard Seebohma Julian A. Schreibera,b aInstitute for Genetics of Heart Diseases (IfGH), Department of Cardiovascular Medicine, University Hospital Münster, Münster, Germany, bInstitut für Pharmazeutische und Medizinische Chemie, Westfälische Wilhelms-Universität Münster, Münster, Germany Key Words TRPV • Molecular pharmacology • Capsaicin • Ion channel modulation • Medicinal chemistry Abstract Transient receptor potential vanilloid (TRPV) channels are part of the TRP channel superfamily and named after the first identified member TRPV1, that is sensitive to the vanillylamide capsaicin. Their overall structure is similar to the structure of voltage gated potassium channels (Kv) built up as homotetramers from subunits with six transmembrane helices (S1-S6). Six TRPV channel subtypes (TRPV1-6) are known, that can be subdivided into the thermoTRPV 2+ (TRPV1-4) and the Ca -selective TRPV channels (TRPV5, TRPV6). Contrary to Kv channels, TRPV channels are not primary voltage gated. All six channels have distinct properties and react to several endogenous ligands as well as different gating stimuli such as heat, pH, mechanical stress, or osmotic changes.
    [Show full text]
  • MURDOCH RESEARCH REPOSITORY This Is the Author's
    MURDOCH RESEARCH REPOSITORY http://researchrepository.murdoch.edu.au This is the author's final version of the work, as accepted for publication following peer review but without the publisher's layout or pagination. Finch, P.M. and Drummond, P.D. (2015) Topical treatment in pain medicine: From ancient remedies to modern usage. Pain Management, In Press . pp. 1-13. http://researchrepository.murdoch.edu.au/27842 Copyright © Future Medicine It is posted here for your personal use. No further distribution is permitted. Topical treatment in pain medicine: from ancient remedies to modern usage Philip M Finch*1 & Peter D Drummond2 1Perth Pain Management Centre, Perth, Western Australia, Australia 2Centre for Research on Chronic Pain & Inflammatory Diseases, Murdoch University, Perth, Western Australia, Australia *Author for correspondence: [email protected] Abstract: Over several millennia, substances have been applied to the skin for treatment of pain. Some ingredients are in current use; others have been discontinued. Mechanisms of action include interactions with nociceptive neural networks and inflammatory processes. Substances must penetrate the stratum corneum barrier and vehicles that enhance penetration have been developed. Topical drugs with links to the past include menthol, capsaicin, some opioids, local anaesthetic agents and non-steroidal anti-inflammatory drugs. Mandragora is also described as an example of a herbal remedy that has been discontinued due to its toxicity. The future for topical drugs is promising, with the advent of new drugs tailored for specific pain mechanisms and the development of both penetration enhancers and sterile preparation methods. Key Words: Topical drugs, mechanisms, stratum corneum, antiquity, vehicles, receptors, current agents Introduction Over several millennia, substances have been applied externally for painful conditions but with variable success.
    [Show full text]