Dual Role of the Mitochondrial Protein Frataxin in Astrocytic Tumors

Total Page:16

File Type:pdf, Size:1020Kb

Dual Role of the Mitochondrial Protein Frataxin in Astrocytic Tumors Laboratory Investigation (2011) 91, 1766–1776 & 2011 USCAP, Inc All rights reserved 0023-6837/11 $32.00 Dual role of the mitochondrial protein frataxin in astrocytic tumors Elmar Kirches1, Nadine Andrae1, Aline Hoefer2, Barbara Kehler1,3, Kim Zarse4, Martin Leverkus3, Gerburg Keilhoff5, Peter Schonfeld5, Thomas Schneider6, Annette Wilisch-Neumann1 and Christian Mawrin1 The mitochondrial protein frataxin (FXN) is known to be involved in mitochondrial iron homeostasis and iron–sulfur cluster biogenesis. It is discussed to modulate function of the electron transport chain and production of reactive oxygen species (ROS). FXN loss in neurons and heart muscle cells causes an autosomal-dominant mitochondrial disorder, Friedreich’s ataxia. Recently, tumor induction after targeted FXN deletion in liver and reversal of the tumorigenic phenotype of colonic carcinoma cells following FXN overexpression were described in the literature, suggesting a tumor suppressor function. We hypothesized that a partial reversal of the malignant phenotype of glioma cells should occur after FXN transfection, if the mitochondrial protein has tumor suppressor functions in these brain tumors. In astrocytic brain tumors and tumor cell lines, we observed reduced FXN levels compared with non-neoplastic astrocytes. Mitochondrial content (citrate synthase activity) was not significantly altered in U87MG glioblastoma cells stably overexpressing FXN (U87-FXN). Surprisingly, U87-FXN cells exhibited increased cytoplasmic ROS levels, although mitochondrial ROS release was attenuated by FXN, as expected. Higher cytoplasmic ROS levels corresponded to reduced activities of glutathione peroxidase and catalase, and lower glutathione content. The defect of antioxidative capacity resulted in increased susceptibility of U87-FXN cells against oxidative stress induced by H2O2 or buthionine sulfoximine. These characteristics may explain a higher sensitivity toward staurosporine and alkylating drugs, at least in part. On the other hand, U87-FXN cells exhibited enhanced growth rates in vitro under growth factor-restricted and hypoxic conditions and in vivo using tumor xenografts in nude mice. These data contrast to a general tumor suppressor function of FXN but suggest a dual, pro-proliferative but chemosensitizing role in astrocytic tumors. Laboratory Investigation (2011) 91, 1766–1776; doi:10.1038/labinvest.2011.130; published online 22 August 2011 KEYWORDS: chemotherapy; frataxin; glioma; oxidative stress A GAA repeat expansion in the frataxin gene causes the lethal biogenesis,6 the central steps of which take place in the disorder Friedreich’s ataxia (FRDA), which is characterized mitochondrial matrix. FXN oligomers exhibit large capacity by degeneration of spinocerebellar tracts, dorsal columns and for binding ferrous iron. After binding of FXN to the ISC- pyramidal tracts, as well as heart failure. The mutation scaffold protein, iron may be directly handed over to the abolishes gene transcription, leading to a loss of the metal-free ISCs, which are then transferred to their final mitochondrial protein frataxin (FXN), mitochondrial iron targets.7 ISC proteins include complexes of the electron accumulation and oxidative stress.1,2 Knockout of the FXN transport chain (ETC) or ferrochelatase, an enzyme of heme homolog Yfh1p in yeasts impairs respiration and causes biogenesis.8 FXN is thus essential for the function of ISC- mitochondrial DNA depletion and iron accumulation.3,4 and heme-containing ETC complexes and of cytochrome c. Defects of iron–sulfur proteins in myocardial biopsies of In tumor cells, FXN has been discussed as a modulator of FRDA patients confirmed a defective iron–sulfur cluster energy metabolism, with an impact on growth characteristics. (ISC) biogenesis in the Yfh1p knockout model.5 According to FXN-transformed colon cancer cell lines exhibited enhanced the current view, mammalian FXN is directly involved in ISC respiration and were characterized by decreased growth rates 1Department of Neuropathology, Otto-von-Guericke University, Magdeburg, Germany; 2Department of Neuropathology, Friedrich-Schiller University, Jena, Germany; 3Department of Experimental Dermatology, Otto-von-Guericke University, Magdeburg, Germany; 4Department of Human Nutrition, Friedrich-Schiller University, Jena, Germany; 5Department of Biochemistry and Cell Biology, Otto-von-Guericke University, Magdeburg, Germany and 6Department of Neurosurgery, Otto-von-Guericke University, Magdeburg, Germany Correspondence: Dr C Mawrin, MD, Department of Neuropathology, Otto-von-Guericke-University, Leipziger Strasse 44, D-39120 Magdeburg, Germany. E-mail: [email protected] Received 27 January 2011; revised 04 July 2011; accepted 13 July 2011 1766 Laboratory Investigation | Volume 91 December 2011 | www.laboratoryinvestigation.org Frataxin in astrocytomas E Kirches et al in soft agar assays and nude mice.9 These results were ATCC. Three of these markers, amelogenin (X), vWA (alleles interpreted in terms of cancer growth inhibition by 15, 17) and THO1 (allele 9.3) are published for the parental antioxidative properties of FXN, leading to an enhancement line U87MG in the ATCC database (http://www.ATCC.org). of oxidative phosphorylation (OXPHOS). The reciprocal OLN-93 was originally derived from a primary rat brain glial experiment was a hepatocyte-specific FXN knockout in mice. culture and resembles primary oligodendrocytes. It was a The induction of multiple hepatic tumors with decreased kind gift of Professor Richter-Landsberg (Department mitochondrial metabolism and iron–sulfur proteins sug- of Biology, University of Oldenburg, Germany), who first gested a tumor suppressor function for FXN.10 described the line. Malignant astrocytic tumors are among the most frequent intracranial neoplasms. Despite recent advances of chemo- Human Tumor Tissues therapy, the improvement of median overall survival of The frozen samples were taken from the files of the patients with glioblastoma (GBM) remains a major chal- Department of Neuropathology of the Otto-von-Guericke 11 lenge. In this report, we investigated the role of FXN in University. The samples had been obtained during routine astrocytic tumors and GBM cell lines. We hypothesized that neurosurgical excision of samples for diagnostic purposes. the malignant biological behavior of astrocytic tumor cells, Diagnosis had been performed by an experienced neuro- especially regarding tumor growth, should be attenuated by pathologist (CM). FXN transfection in vitro and in vivo, if the protein has tumor suppressor properties in these cells. If these biological Mixed Rat Brain Cell Cultures effects were connected with the suggested antioxidative and Neuronal/glial mixed cultures were prepared from cerebellum OXPHOS-protecting properties of FXN, transfected cells of 4-day-old rats in DMEM with 10% FCS and 1% (v/v) should exert lower reactive oxygen species (ROS) generation penicillin/streptomycin. After mechanical dispersion, ali- and higher aconitase activity. In addition, it is likely that quots of the suspension were plated in poly-D-lysine coated the transfected cells are less sensitive to externally applied dishes at a final density of 2 Â 106 cells per 8 cm2. After 48 h, oxidative stress. non-adherent cells were removed by medium change. After 10 days, the cells were used for experiments. For serum/glu- MATERIALS AND METHODS cose deprivation (SGD), growth medium was replaced by Vector Construction serum- and glucose-free DMEM for 24 h. pCl-neo-FXN was generated by cloning a hemagglutin- tagged human frataxin cDNA into pCl-neo (Promega, Mannheim, Germany). Qualitative and Real-Time PCR RNA was isolated using the RNeasy-mini-kits from Qiagen Cell Culture (Hilden, Germany). FXN-PCR from cDNA was performed The GBM cell lines U87MG, U118MG, U138MG and LN405 with the primers TAAGCGTTATGACTGGACTGG and GAA b were purchased from the American Type Culture Collection TAGGCCAAGGAAGACAAG, -actin (ACC ACC CCA GCC (ATCC) or the German Collection of Microorganisms and ATG TAC G and ATG TCA CGC ACG ATT TCC C) serving Cell Cultures, respectively. Transformed cell lines U87-FXN as a reference. For SYBR-green-based Real-Time PCR on an and U87-Neo were generated by lipofectamine-2000 trans- ABI-7000-SDS (Applied Biosystems, CA), the same primers 1 fection of the plasmids into U87MG cells and culturing were used with identical annealing temperature (57 C). under 0.2 mg/ml G418. This concentration had been determined as the minimal concentration, which kills Western Blotting parental cells within 2 weeks. Developing colonies of resistant Cells were washed twice with ice-cold PBS and harvested by cells were selectively transferred to new flask and maintained scraping in RIPA buffer (10 mM Tris-HCl, pH 7.4; 150 mM under G418. The cell lines used in the present study thus NaCl; 50 mM NaF; 1 mM EDTA; 1% Triton X-100; 0.1% represent cell clones. Human cortical astrocytes were SDS; 0.5% deoxycholate) with DTT, Na-vanadate and pro- purchased from ScienCell Research Laboratories (Carlsbad, tease inhibitors. In all, 40 mg protein was separated by SDS- CA) and embryonal rat astrocytes prepared in our labora- PAGE and transferred onto nitrocellulose membranes. After tory.12 All cells were cultured in DMEM with 10% FCS. The blocking, membranes were incubated with primary anti- identity of the cell lines was analyzed using the AmpFSTR kit bodies in TBST overnight at 4 1C, followed by chemilumi- and the software GeneMapper ID v3.2 (Applied Biosystems), nescence (Millipore, Schwalbach,
Recommended publications
  • The Pathogenetic Role of Β-Cell Mitochondria in Type 2 Diabetes
    236 3 Journal of M Fex et al. Mitochondria in β-cells 236:3 R145–R159 Endocrinology REVIEW The pathogenetic role of β-cell mitochondria in type 2 diabetes Malin Fex1, Lisa M Nicholas1, Neelanjan Vishnu1, Anya Medina1, Vladimir V Sharoyko1, David G Nicholls1, Peter Spégel1,2 and Hindrik Mulder1 1Department of Clinical Sciences in Malmö, Unit of Molecular Metabolism, Lund University Diabetes Centre, Clinical Research Center, Malmö University Hospital, Lund University, Malmö, Sweden 2Department of Chemistry, Center for Analysis and Synthesis, Lund University, Sweden Correspondence should be addressed to H Mulder: [email protected] Abstract Mitochondrial metabolism is a major determinant of insulin secretion from pancreatic Key Words β-cells. Type 2 diabetes evolves when β-cells fail to release appropriate amounts f TCA cycle of insulin in response to glucose. This results in hyperglycemia and metabolic f coupling signal dysregulation. Evidence has recently been mounting that mitochondrial dysfunction f oxidative phosphorylation plays an important role in these processes. Monogenic dysfunction of mitochondria is a f mitochondrial transcription rare condition but causes a type 2 diabetes-like syndrome owing to β-cell failure. Here, f genetic variation we describe novel advances in research on mitochondrial dysfunction in the β-cell in type 2 diabetes, with a focus on human studies. Relevant studies in animal and cell models of the disease are described. Transcriptional and translational regulation in mitochondria are particularly emphasized. The role of metabolic enzymes and pathways and their impact on β-cell function in type 2 diabetes pathophysiology are discussed. The role of genetic variation in mitochondrial function leading to type 2 diabetes is highlighted.
    [Show full text]
  • Src Inhibitors Modulate Frataxin Protein Levels
    Human Molecular Genetics, 2015, Vol. 24, No. 15 4296–4305 doi: 10.1093/hmg/ddv162 Advance Access Publication Date: 6 May 2015 Original Article ORIGINAL ARTICLE Src inhibitors modulate frataxin protein levels Downloaded from https://academic.oup.com/hmg/article/24/15/4296/2453025 by guest on 28 September 2021 Fabio Cherubini1, Dario Serio1, Ilaria Guccini1, Silvia Fortuni1,2, Gaetano Arcuri1, Ivano Condò1, Alessandra Rufini1,2, Shadman Moiz1, Serena Camerini3, Marco Crescenzi3, Roberto Testi1,2 and Florence Malisan1,* 1Laboratory of Signal Transduction, Department of Biomedicine and Prevention, University of Rome ‘Tor Vergata’, Via Montpellier 1, 00133 Rome, Italy, 2Fratagene Therapeutics Ltd, 22 Northumberland Rd, Dublin, Ireland and 3Department of Cell Biology and Neurosciences, Italian National Institute of Health, Viale Regina Elena, 299, 00161 Rome, Italy *To whom correspondence should be addressed at: Laboratory of Signal Transduction, Department of Biomedicine and Prevention, University of Rome ‘Tor Vergata’, Via Montpellier 1, 00133 Rome, Italy. Tel: +39 0672596501; Fax: +39 0672596505; Email: [email protected] Abstract Defective expression of frataxin is responsible for the inherited, progressive degenerative disease Friedreich’s Ataxia (FRDA). There is currently no effective approved treatment for FRDA and patients die prematurely. Defective frataxin expression causes critical metabolic changes, including redox imbalance and ATP deficiency. As these alterations are known to regulate the tyrosine kinase Src, we investigated whether Src might in turn affect frataxin expression. We found that frataxin can be phosphorylated by Src. Phosphorylation occurs primarily on Y118 and promotes frataxin ubiquitination, a signal for degradation. Accordingly, Src inhibitors induce accumulation of frataxin but are ineffective on a non-phosphorylatable frataxin- Y118F mutant.
    [Show full text]
  • Grantsummaries 2014-2017 Jf
    2015 FARA Awarded Grants Principal Investigator/Organization Grant Description Type of Research Co-funding Drug Discovery 2014 Keith Michael Andrus Cardiac Research Award: Veronique Monnier - Université Identification of therapeutic compounds on a cardiac Drosophila model of Friedreich’s Translational FARA Ireland Paris Diderot ataxia Andrew Dancis - University of A therapeutic strategy for Friedreich's ataxia: Frataxin bypass by enhancing the Translational Pennsylvania mitochondrial cysteine desulfurase activity Edward L. Grabczyk - Louisiana Small molecule induced exon skipping of MLH3 to slow repeat expansion in an FRDA Translational State University mousel model High throughput screen of Pfizer small molecule chemical library in FRDA patient- Pfizer Basic/Translational derived cells to look for regulators of frataxin protein Robert Wilson - University of (1) Center of Excellence: Drug Discovery Basic/Translational Hamilton & Finneran Family Pennsylvania (2) Drug testing and development for FA Omar Khdour - Arizona State Approaches to correct mitochondrial abnormalities and synaptic pathology in frataxin- Basic/Translational University deficient sensory neurons Gene & Stem Cell Therapy Helene Puccio - INSERM, IGBMC, Development of neuronal gene therapy for the treatment of FRDA Translational FARA Ireland France Ricardo Pinto Mouro - Harvard FARA Ireland & The National CRISPR/Cas9-based Therapeutics for Friedreich's ataxia Basic/Translational University Ataxia Foundation Joel Gottesfeld - The Scripps Stem Cell Therapeutics for Friedreich's
    [Show full text]
  • Oxidative Stress, Mitochondrial Dysfunction, and Neuroprotection of Polyphenols with Respect to Resveratrol in Parkinson’S Disease
    biomedicines Review Oxidative Stress, Mitochondrial Dysfunction, and Neuroprotection of Polyphenols with Respect to Resveratrol in Parkinson’s Disease Heng-Chung Kung 1,2 , Kai-Jung Lin 1,3 , Chia-Te Kung 4,* and Tsu-Kung Lin 1,5,6,* 1 Center for Mitochondrial Research and Medicine, Kaohsiung Chang Gung Memorial Hospital and Chang Gung University College of Medicine, Kaohsiung 83301, Taiwan; [email protected] (H.-C.K.); [email protected] (K.-J.L.) 2 Department of Biology, Krieger School of Arts and Sciences, Johns Hopkins University, Baltimore, MD 21218, USA 3 Department of Family Medicine, National Taiwan University Hospital, Taipei 100225, Taiwan 4 Department of Emergency Medicine, Kaohsiung Chang Gung Memorial Hospital and Chang Gung University College of Medicine, Kaohsiung 83301, Taiwan 5 Department of Neurology, Kaohsiung Chang Gung Memorial Hospital and Chang Gung University College of Medicine, Kaohsiung 83301, Taiwan 6 Center of Parkinson’s Disease, Kaohsiung Chang Gung Memorial Hospital and Chang Gung University College of Medicine, Kaohsiung 83301, Taiwan * Correspondence: [email protected] (C.-T.K.); [email protected] (T.-K.L.) Abstract: Parkinson’s disease (PD) is the second most common neurodegenerative disease and is characterized by dopaminergic neuronal loss. The exact pathogenesis of PD is complex and not yet completely understood, but research has established the critical role mitochondrial dysfunction plays in the development of PD. As the main producer of cytosolic reactive oxygen species (ROS), mito- chondria are particularly susceptible to oxidative stress once an imbalance between ROS generation and the organelle’s antioxidative system occurs. An overabundance of ROS in the mitochondria can Citation: Kung, H.-C.; Lin, K.-J.; lead to mitochondrial dysfunction and further vicious cycles.
    [Show full text]
  • Strand Breaks for P53 Exon 6 and 8 Among Different Time Course of Folate Depletion Or Repletion in the Rectosigmoid Mucosa
    SUPPLEMENTAL FIGURE COLON p53 EXONIC STRAND BREAKS DURING FOLATE DEPLETION-REPLETION INTERVENTION Supplemental Figure Legend Strand breaks for p53 exon 6 and 8 among different time course of folate depletion or repletion in the rectosigmoid mucosa. The input of DNA was controlled by GAPDH. The data is shown as ΔCt after normalized to GAPDH. The higher ΔCt the more strand breaks. The P value is shown in the figure. SUPPLEMENT S1 Genes that were significantly UPREGULATED after folate intervention (by unadjusted paired t-test), list is sorted by P value Gene Symbol Nucleotide P VALUE Description OLFM4 NM_006418 0.0000 Homo sapiens differentially expressed in hematopoietic lineages (GW112) mRNA. FMR1NB NM_152578 0.0000 Homo sapiens hypothetical protein FLJ25736 (FLJ25736) mRNA. IFI6 NM_002038 0.0001 Homo sapiens interferon alpha-inducible protein (clone IFI-6-16) (G1P3) transcript variant 1 mRNA. Homo sapiens UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 15 GALNTL5 NM_145292 0.0001 (GALNT15) mRNA. STIM2 NM_020860 0.0001 Homo sapiens stromal interaction molecule 2 (STIM2) mRNA. ZNF645 NM_152577 0.0002 Homo sapiens hypothetical protein FLJ25735 (FLJ25735) mRNA. ATP12A NM_001676 0.0002 Homo sapiens ATPase H+/K+ transporting nongastric alpha polypeptide (ATP12A) mRNA. U1SNRNPBP NM_007020 0.0003 Homo sapiens U1-snRNP binding protein homolog (U1SNRNPBP) transcript variant 1 mRNA. RNF125 NM_017831 0.0004 Homo sapiens ring finger protein 125 (RNF125) mRNA. FMNL1 NM_005892 0.0004 Homo sapiens formin-like (FMNL) mRNA. ISG15 NM_005101 0.0005 Homo sapiens interferon alpha-inducible protein (clone IFI-15K) (G1P2) mRNA. SLC6A14 NM_007231 0.0005 Homo sapiens solute carrier family 6 (neurotransmitter transporter) member 14 (SLC6A14) mRNA.
    [Show full text]
  • Stríbrná and Julius Lukes Hassan Hashimi, Lindsay Mcdonald, Eva
    Bioenergetics: Trypanosome Letm1 Protein Is Essential for Mitochondrial Potassium Homeostasis Hassan Hashimi, Lindsay McDonald, Eva Stríbrná and Julius Lukes J. Biol. Chem. 2013, 288:26914-26925. doi: 10.1074/jbc.M113.495119 originally published online July 26, 2013 Access the most updated version of this article at doi: 10.1074/jbc.M113.495119 Find articles, minireviews, Reflections and Classics on similar topics on the JBC Affinity Sites. Alerts: • When this article is cited • When a correction for this article is posted Click here to choose from all of JBC's e-mail alerts Supplemental material: http://www.jbc.org/content/suppl/2013/07/26/M113.495119.DC1.html This article cites 60 references, 26 of which can be accessed free at http://www.jbc.org/content/288/37/26914.full.html#ref-list-1 Downloaded from http://www.jbc.org/ at Edinburgh University Library on September 13, 2013 THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 288, NO. 37, pp. 26914–26925, September 13, 2013 © 2013 by The American Society for Biochemistry and Molecular Biology, Inc. Published in the U.S.A. Trypanosome Letm1 Protein Is Essential for Mitochondrial Potassium Homeostasis*□S Received for publication, June 19, 2013, and in revised form, July 23, 2013 Published, JBC Papers in Press, July 26, 2013, DOI 10.1074/jbc.M113.495119 Hassan Hashimi‡§1, Lindsay McDonald‡2, Eva Strˇíbrná‡, and Julius Lukesˇ‡§3 From the ‡Institute of Parasitology, Biology Centre, Czech Academy of Sciences and the §Faculty of Science, University of South Bohemia, 370 05 Cˇeské Budeˇjovice (Budweis), Czech Republic Background: Letm1 is a mitochondrial protein attributed disparate roles, including cation/proton antiport and translation.
    [Show full text]
  • Loss of Frataxin Induces Iron Toxicity, Sphingolipid Synthesis, and Pdk1
    1 Loss of Frataxin induces iron toxicity, sphingolipid synthesis, and 2 Pdk1/Mef2 activation, leading to neurodegeneration 3 4 Kuchuan Chen1, Guang Lin2, Nele A. Haelterman1, Tammy Szu-Yu Ho3, Tongchao Li1, Zhihong 5 Li2, Lita Duraine4, Brett H. Graham1, 2, Manish Jaiswal2, 4, Shinya Yamamoto1, 2, 5, Matthew N. 6 Rasband1, 3, and Hugo J. Bellen1, 2, 3, 4, 5, * 7 1Program in Developmental Biology, Baylor College of Medicine, Houston, TX 77030, USA 8 2Department of Molecular and Human Genetics, Baylor College of Medicine, Houston, TX 77030, USA 9 3Department of Neuroscience, Baylor College of Medicine, Houston, TX 77030, USA 10 4Howard Hughes Medical Institute, Baylor College of Medicine, Houston, TX 77030, USA 11 5Jan and Dan Duncan Neurological Research Institute, Texas Children’s Hospital, Houston, TX 77030, 12 USA 13 14 Keywords: Friedreich ataxia; Frataxin; iron; mitochondria; sphingolipid; Pdk1; Mef2; lipid 15 droplets; photoreceptors; Drosophila 16 17 *Corresponding author: [email protected] 18 19 20 21 1 22 Abstract 23 Mutations in Frataxin (FXN) cause Friedreich’s ataxia (FRDA), a recessive 24 neurodegenerative disorder. Previous studies have proposed that loss of FXN causes 25 mitochondrial dysfunction, which triggers elevated reactive oxygen species (ROS) and leads to 26 the demise of neurons. Here we describe a ROS independent mechanism that contributes to 27 neurodegeneration in fly FXN mutants. We show that loss of frataxin homolog (fh) in Drosophila 28 leads to iron toxicity, which in turn induces sphingolipid synthesis and ectopically activates 3- 29 phosphoinositide dependent protein kinase-1 (Pdk1) and myocyte enhancer factor-2 (Mef2). 30 Dampening iron toxicity, inhibiting sphingolipid synthesis by Myriocin, or reducing Pdk1 or 31 Mef2 levels, all effectively suppress neurodegeneration in fh mutants.
    [Show full text]
  • Functional Reconstitution of Mitochondrial Fe/S Cluster Synthesis on Isu1 Reveals the Involvement of Ferredoxin
    ARTICLE Received 18 May 2014 | Accepted 19 Aug 2014 | Published 31 Oct 2014 DOI: 10.1038/ncomms6013 Functional reconstitution of mitochondrial Fe/S cluster synthesis on Isu1 reveals the involvement of ferredoxin Holger Webert1, Sven-Andreas Freibert1, Angelo Gallo2, Torsten Heidenreich1, Uwe Linne3, Stefan Amlacher4, Ed Hurt4, Ulrich Mu¨hlenhoff1, Lucia Banci2,5 & Roland Lill1,6,7 Maturation of iron–sulphur (Fe/S) proteins involves complex biosynthetic machinery. In vivo synthesis of [2Fe–2S] clusters on the mitochondrial scaffold protein Isu1 requires the cysteine desulphurase complex Nfs1-Isd11, frataxin, ferredoxin Yah1 and its reductase Arh1. The roles of Yah1–Arh1 have remained enigmatic, because they are not required for in vitro Fe/S cluster assembly. Here, we reconstitute [2Fe–2S] cluster synthesis on Isu1 in a reaction depending on Nfs1-Isd11, frataxin, Yah1, Arh1 and NADPH. Unlike in the bacterial system, frataxin is an essential part of Fe/S cluster biosynthesis and is required simultaneously and stoichiome- trically to Yah1. Reduced but not oxidized Yah1 tightly interacts with apo-Isu1 indicating a dynamic interaction between Yah1–apo-Isu1. Nuclear magnetic resonance structural studies identify the Yah1–apo-Isu1 interaction surface and suggest a pathway for electron flow from reduced ferredoxin to Isu1. Together, our study defines the molecular function of the ferre- doxin Yah1 and its human orthologue FDX2 in mitochondrial Fe/S cluster synthesis. 1 Institut fu¨r Zytobiologie und Zytopathologie, Philipps-Universita¨t Marburg, Robert-Koch-Strasse 6, 35032 Marburg, Germany. 2 CERM, Magnetic Resonance Center, University of Florence, Sesto Fiorentino, 50019 Florence, Italy. 3 Fachbereich Chemie, Philipps-Universita¨t Marburg, Hans-Meerwein-Street, 35043 Marburg, Germany.
    [Show full text]
  • Diverse Entry Gates to Mitochondria Provide Insights Into the Evolution of Eukaryotes
    1 Review Peeping at TOMs - Diverse entry gates to mitochondria provide insights into the evolution of eukaryotes Jan Mania, Chris Meisingerb and André Schneidera, 1 aDepartment of Chemistry and Biochemistry, University of Bern, Freiestrasse 3, CH- 3012 Bern, Switzerland bInstitut für Biochemie und Molekularbiologie, ZBMZ and BIOSS Centre for Biological Signalling Studies, Universität Freiburg, 79104 Freiburg, Germany 1 Correspondence to: [email protected] | downloaded: 13.3.2017 http://boris.unibe.ch/92438/ source: 2 Mitochondria are essential for eukaryotic life and more than 95% of their proteins are imported as precursors from the cytosol. The targeting signals for this post-translational import are conserved in all eukaryotes. However, this conservation does not hold true for the protein translocase of the mitochondrial outer membrane that serves as entry gate for essentially all precursor proteins. Only two of its subunits, Tom40 and Tom22, are conserved and thus likely were present in the last eukaryotic common ancestor. Tom7 is found in representatives of all supergroups except the Excavates. This suggests that it was added to the core of the translocase after the Excavates segregated from all other eukaryotes. A comparative analysis of the biochemically and functionally characterized outer membrane translocases of yeast, plants and trypanosomes, which represent three eukaryotic supergroups, shows that the receptors that recognize the conserved import signals differ strongly between the different systems. They present a remarkable example of convergent evolution at the molecular level. The structural diversity of the functionally conserved import receptors therefore provides insight into the early evolutionary history of mitochondria. Protein import distinguishes mitochondria from its endosymbiontic ancestor The origin of eukaryotic cells arguably is the most important transition in evolution besides the origin of life itself.
    [Show full text]
  • 030626 Mitochondrial Respiratory-Chain Diseases
    The new england journal of medicine review article mechanisms of disease Mitochondrial Respiratory-Chain Diseases Salvatore DiMauro, M.D., and Eric A. Schon, Ph.D. From the Departments of Neurology (S.D., ore than a billion years ago, aerobic bacteria colonized E.A.S.) and Genetics and Development primordial eukaryotic cells that lacked the ability to use oxygen metabolical- (E.A.S.), Columbia University College of m Physicians and Surgeons, New York. Ad- ly. A symbiotic relationship developed and became permanent. The bacteria dress reprint requests to Dr. DiMauro at evolved into mitochondria, thus endowing the host cells with aerobic metabolism, a 4-420 College of Physicians and Surgeons, much more efficient way to produce energy than anaerobic glycolysis. Structurally, mito- 630 W. 168th St., New York, NY 10032, or at [email protected]. chondria have four compartments: the outer membrane, the inner membrane, the inter- membrane space, and the matrix (the region inside the inner membrane). They perform N Engl J Med 2003;348:2656-68. numerous tasks, such as pyruvate oxidation, the Krebs cycle, and metabolism of amino Copyright © 2003 Massachusetts Medical Society. acids, fatty acids, and steroids, but the most crucial is probably the generation of energy as adenosine triphosphate (ATP), by means of the electron-transport chain and the ox- idative-phosphorylation system (the “respiratory chain”) (Fig. 1). The respiratory chain, located in the inner mitochondrial membrane, consists of five multimeric protein complexes (Fig. 2B): reduced nicotinamide adenine dinucleotide (NADH) dehydrogenase–ubiquinone oxidoreductase (complex I, approximately 46 sub- units), succinate dehydrogenase–ubiquinone oxidoreductase (complex II, 4 subunits), ubiquinone–cytochrome c oxidoreductase (complex III, 11 subunits), cytochrome c oxi- dase (complex IV, 13 subunits), and ATP synthase (complex V, approximately 16 sub- units).
    [Show full text]
  • Mitochondrial Structure and Bioenergetics in Normal and Disease Conditions
    International Journal of Molecular Sciences Review Mitochondrial Structure and Bioenergetics in Normal and Disease Conditions Margherita Protasoni 1 and Massimo Zeviani 1,2,* 1 Mitochondrial Biology Unit, The MRC and University of Cambridge, Cambridge CB2 0XY, UK; [email protected] 2 Department of Neurosciences, University of Padova, 35128 Padova, Italy * Correspondence: [email protected] Abstract: Mitochondria are ubiquitous intracellular organelles found in almost all eukaryotes and involved in various aspects of cellular life, with a primary role in energy production. The interest in this organelle has grown stronger with the discovery of their link to various pathologies, including cancer, aging and neurodegenerative diseases. Indeed, dysfunctional mitochondria cannot provide the required energy to tissues with a high-energy demand, such as heart, brain and muscles, leading to a large spectrum of clinical phenotypes. Mitochondrial defects are at the origin of a group of clinically heterogeneous pathologies, called mitochondrial diseases, with an incidence of 1 in 5000 live births. Primary mitochondrial diseases are associated with genetic mutations both in nuclear and mitochondrial DNA (mtDNA), affecting genes involved in every aspect of the organelle function. As a consequence, it is difficult to find a common cause for mitochondrial diseases and, subsequently, to offer a precise clinical definition of the pathology. Moreover, the complexity of this condition makes it challenging to identify possible therapies or drug targets. Keywords: ATP production; biogenesis of the respiratory chain; mitochondrial disease; mi-tochondrial electrochemical gradient; mitochondrial potential; mitochondrial proton pumping; mitochondrial respiratory chain; oxidative phosphorylation; respiratory complex; respiratory supercomplex Citation: Protasoni, M.; Zeviani, M.
    [Show full text]
  • Substrate-Dependent Suppression of Oxidative Phosphorylation in the Frataxin-Depleted Heart
    bioRxiv preprint doi: https://doi.org/10.1101/2020.06.12.148361; this version posted September 1, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Substrate-dependent suppression of oxidative phosphorylation in the Frataxin-depleted heart César Vásquez-Trincado1, Monika Patel1, Aishwarya Sivaramakrishnan1, Carmen Bekeová1, Lauren Anderson-Pullinger1, Nadan Wang2, Erin L. Seifert1,*. 1 MitoCare Center for Mitochondrial Imaging Research and Diagnostics, Department of Pathology, Anatomy and Cell Biology, Thomas Jefferson University, Philadelphia, PA, USA 2 Center for Translational Medicine, Department of Pathology, Anatomy and Cell Biology, Thomas Jefferson University, Philadelphia, PA, USA * Correspondence: [email protected] Running Title: Frataxin loss and selective oxphos suppression 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.06.12.148361; this version posted September 1, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. ABSTRACT Friedreich’s ataxia is an inherited disorder caused by depletion of frataxin (FXN), a mitochondrial protein involved in iron-sulfur cluster biogenesis. Cardiac dysfunction is the main cause of death; pathogenesis remains poorly understood but is expected to be linked to an energy deficit. In mice with adult-onset FXN loss, bioenergetics analysis of heart mitochondria revealed a time- and substrate-dependent decrease in oxidative phosphorylation (oxphos). Oxphos was lower with substrates that depend on Complex I and II, but preserved for lipid substrates. This differential substrate vulnerability is consistent with the half-lives for mitochondrial proteins, and with the abundance of Fe-S clusters in proteins of different substrate oxidation pathways.
    [Show full text]