DOCSLIB.ORG

Supplemental Table 1

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Supplemental Table 1 Carlisle et al. 1 Supplementary Table 1. Primers for PCR amplification of bacterial 16S rRNA. Primers for Group A TA-27FMID1 CGTATCGCCTCCCTCGCGCCATCAGACGAGTGCGTAGAGTTTGATCCTGGCTCAG TA-27FMID2 CGTATCGCCTCCCTCGCGCCATCAGACGCTCGACAAGAGTTTGATCCTGGCTCAG TA-27FMID3 CGTATCGCCTCCCTCGCGCCATCAGAGACGCACTCAGAGTTTGATCCTGGCTCAG TA-27FMID4 CGTATCGCCTCCCTCGCGCCATCAGAGCACTGTAGAGAGTTTGATCCTGGCTCAG TA-27FMID5 CGTATCGCCTCCCTCGCGCCATCAGATCAGACACGAGAGTTTGATCCTGGCTCAG TA-27FMID6 CGTATCGCCTCCCTCGCGCCATCAGATATCGCGAGAGAGTTTGATCCTGGCTCAG TA-27FMID7 CGTATCGCCTCCCTCGCGCCATCAGCGTGTCTCTAAGAGTTTGATCCTGGCTCAG TA-27FMID8 CGTATCGCCTCCCTCGCGCCATCAGCTCGCGTGTCAGAGTTTGATCCTGGCTCAG TA-27FMID9 CGTATCGCCTCCCTCGCGCCATCAGTAGTATCAGCAGAGTTTGATCCTGGCTCAG TA-27FMID10 CGTATCGCCTCCCTCGCGCCATCAGTCTCTATGCGAGAGTTTGATCCTGGCTCAG TA-27FMID11 CGTATCGCCTCCCTCGCGCCATCAGTGATACGTCTAGAGTTTGATCCTGGCTCAG TA-27FMID13 CGTATCGCCTCCCTCGCGCCATCAGCATAGTAGTGAGAGTTTGATCCTGGCTCAG TA-27FMID14 CGTATCGCCTCCCTCGCGCCATCAGCGAGAGATACAGAGTTTGATCCTGGCTCAG TB-338R CTATGCGCCTTGCCAGCCCGCTCAGTGCTGCCTCCCGTAGGAGT Primers for Group B TB-27FMID1 CTATGCGCCTTGCCAGCCCGCTCAGACGAGTGCGTAGAGTTTGATCCTGGCTCAG TB-27FMID2 CTATGCGCCTTGCCAGCCCGCTCAGACGCTCGACAAGAGTTTGATCCTGGCTCAG TB-27FMID3 CTATGCGCCTTGCCAGCCCGCTCAGAGACGCACTCAGAGTTTGATCCTGGCTCAG TB-27FMID4 CTATGCGCCTTGCCAGCCCGCTCAGAGCACTGTAGAGAGTTTGATCCTGGCTCAG TB-27FMID5 CTATGCGCCTTGCCAGCCCGCTCAGATCAGACACGAGAGTTTGATCCTGGCTCAG TB-27FMID6 CTATGCGCCTTGCCAGCCCGCTCAGATATCGCGAGAGAGTTTGATCCTGGCTCAG TB-27FMID7 CTATGCGCCTTGCCAGCCCGCTCAGCGTGTCTCTAAGAGTTTGATCCTGGCTCAG TB-27FMID8 CTATGCGCCTTGCCAGCCCGCTCAGCTCGCGTGTCAGAGTTTGATCCTGGCTCAG TB-27FMID9 CTATGCGCCTTGCCAGCCCGCTCAGTAGTATCAGCAGAGTTTGATCCTGGCTCAG TB-27FMID10 CTATGCGCCTTGCCAGCCCGCTCAGTCTCTATGCGAGAGTTTGATCCTGGCTCAG TB-27FMID11 CTATGCGCCTTGCCAGCCCGCTCAGTGATACGTCTAGAGTTTGATCCTGGCTCAG TB-27FMID12 CTATGCGCCTTGCCAGCCCGCTCAGTACTGAGCTAAGAGTTTGATCCTGGCTCAG TB-27FMID13 CTATGCGCCTTGCCAGCCCGCTCAGCATAGTAGTGAGAGTTTGATCCTGGCTCAG TB-27FMID14 CTATGCGCCTTGCCAGCCCGCTCAGCGAGAGATACAGAGTTTGATCCTGGCTCAG TTA-338R CGTATCGCCTCCCTCGCGCCATCAGTGCTGCCTCCCGTAGGAGT Supplemental Table 2. Microbiota mRNA sequencing coverage. Coverage ranged from 92.8%- 100% (average 98.6%). Sample Diet Number of sequences after quality Percent Coverage trimming 1a FF 323 93 1b FF 833 98 1c FF 816 99 2a FF 662 98 2b FF 888 98 2c FF 884 99 3a FF 564 97 3b FF 966 99 4a FF 723 98 4b FF 1103 99 5a FF 746 97 10a MF 852 100 3c MF 699 100 4c MF 1154 100 5b MF 1144 100 6a MF 963 100 6b MF 919 100 7a MF 888 99 7b MF 1096 100 8a MF 834 100 9a MF 961 99 Carlisle et al. 2 Supplemental Table 3. Library characteristics for 8 cDNA libraries. Average read length was 100bp. BLAST search against the mouse RNA database yielded 18,014,657 hits (~2,251,000/library) to 19,703 mouse mRNAs. FF1 FF2 FF3 FF4 MF1 MF2 MF3 MF4 Total reads before quality trim 4,096,796 6,609,830 3,579,743 3,452,378 2,580,264 3,781,577 3,320,574 2,075,326 %GC 62 62 62 62 63 61 62 61 Reads for annotation 3,902,252 6,304,521 3,523,485 3,397,021 2,460,776 3,601,183 3,269,729 2,042,846 Total Reads Annotated 1,801,239 5,309,548 2,558,030 2,038,522 785,627 2,087,931 2,384,179 1,049,581 Mouse Genes Detected 11,695 16,273 13,166 13,261 9,943 13,191 13,141 11,921 Carlisle et al. 3 Supplemental Table 4. The 50 genes with the highest mRNA transcript levels. mRNA transcript level of each gene was calculated for FF and MF mice. p<0.01 indicated a statistically significant difference. Gene p-value Gene p-value 28S rRNA (LOC236598) Rn28s 0.10 Keratin 8 Krt8 0.58 18S rRNA Rn18s 0.19 RNA component of mitochondrial RNAse P RMrp 0.43 Leucyl-tRNA synthetase Lars2 0.89 Small praline-rich protein 2A2 Sprr2a 0.47 mitocohondrial nuclear gene 2 encoding mitochondrial protein microRNA 689-2 Mir689-2 0.04 Ribosomal protein, large P0 Rplp0 0.89 Ac1147 (LOC672857) Ac1147 0.73 7SK nuclear Rn7sk 0.07 MicroRNA mir-2135-3 Mir 21353 0.89 Metallothionein 2 Mt2 0.01 Transmembrane protein 170 Tmem170 0.82 Lectin, galactose binding, soulable 4 Lgals4 0.74 LOC627695 0.90 Actin, alpha 2, smooth muscle Acta2 0.30 Ribonuclease P RNA component Rpph1 0.81 Actin, gamma, cytoplasmic 1 Actg1 0.30 H1 microRNA mir 2133-2 Mir2133- 0.30 Tumor protein, translationally-controlled 1 Tpt1 0.81 2 Histone 3 (LOC677333) H3 0.32 Collagen, type 1, alpha 2 Col1a2 0.11 Eukaryotic translation elongation Eef1a1 0.50 Keratin 19 Krt19 0.82 factor 1 alpha 1 Collagen type III alpha 1 Col3a1 0.14 Filamin, alpha Flna 0.15 Mtrnr2-like Mtrnr2l 0.76 Actin, gamma 2, smooth muscle, enteric Actg2 0.04 Actin, beta Actb 0.06 Ferritin heavy chain 1 Fth1 0.05 Metallothionein 1 Mt1 0.003 Glyceraldehyde-3-phosphate dehydrogenase Gapdh 0.58 Collagen, type 1, alpha 1 Col1a1 0.09 Heat shock protein 8 Hspa8 0.53 Proline/histidine/glycine-rich 1 Phgr1 0.69 microRNA mir-2134-4 Mir213 0.11 4-4 Deleted in malignant brain tumors Dmbt1 0.800 Transgelin Tagln 0.45 1 Mucin 2 Muc2 0.975 Ribosomal protein SA Rpsa 0.75 Fc fragment of IgG binding protein Fcgbp 0.802 Serine protease inhibitor, Kunitz type 2 Spint2 0.91 5.8S ribosomal RNA 5.8S 0.009 Myosin, heavy polypeptide 11, smooth muscle Myh11 0.36 rRNA RIKEN cDNA 2210415F13 0.347 ATPase, Na/K transporting, alpha 1 Atp1a1 0.36 polypeptide Ferritin light chain 1 Flt1 0.180 ATP synthase, H+transporting mitochondrial Atp5b 0.36 F1 complex, beta subunit Eukaryotic translation elongation Eef2 0.944 Ubiquitin B Ubb 0.64 factor 2 Carlisle et al. 4 Supplemental Table 5. Host transcriptome analysis. mRNA transcript levels differed between MF and FF mice for 148 genes. p<0.01 was considered statistically significant. Fold change in FF mice relative to MF mice was calculated for each gene. Literature search for each gene was conducted, and genes were grouped based on published function: C/G-Cell Cycle/Gene Expression (n=32), SI-Structural Integrity (n=6), SR-Stress Response (n=18), NU-Nutrient Utilization (n=6), IR-Immune Regulation (n=14), CM-Cell Motility (n=6), VF-Vascular Function (n=3)). Gene Fold p-value Function Gene Fold p-value Function Change Change Methallothionein 1 Mt1 5.40↑ 0.0030 Autophagy-related 4B Atg4b 0.37↓ 0.0028 SR25, 26 5.8S ribosomal RNA 5.8S rRNA 1.7↑ 0.0095 Pirin Pir FF only 0.0022 C/G46 Desmin Des 0.56↓ 0.0016 SI32 Engulfment and cell motility 2, ced- Elmo2 FF only 0.0038 SR47 12 homolog Cysteine and glycine-rich Csrp1 0.66↓ 0.0065 Sestrin 3 Sesn3 0.41↓ 0.0040 SR27 protein 1 Tropomyosin 2 beta Tpm2 0.63↓ 0.0068 Regulator of G-protein signaling 3 Rgs3 0.43↓ 0.0097 IR48 Heme Oxygenase 1 Hmox1 25.4↑ 0.0066 SR 17, 18 Protein inhibitor of activated STAT2 Pias2 FF only 0.0048 C/G49 Serine pepditase inhibitor Serpinh1 0.49↓ 0.0074 SI31 Autophagy-related 5 Atg5 0.33↓ 0.0052 SR25 Cladue H member 1 ATP-binding cassette, sub- Abcbia 2.68↑ 0.0075 SR23 Kinesin family member 22 Kif22 9.46↑ 0.0064 family B, member 1A Supression of turmoigenicity St14 1.94↑ 0.0003 SR50 RIKEN 9030625A04 4.86↑ 0.0072 14 Vinculin Vcl 0.47↓ 0.0061 SI29 RIKEN 9130024F11 0.37↓ 0.0082 Protein Phosphatase 1, Ppp1cb 0.55↓ 0.0057 RAN binding protein 6 RANbp FF only 0.0015 CM51 catalytic subunit, beta isoform 6 Protein tyrosine phosphatase Ptp4a1 0.67↓ 0.0083 RIKEN 9530082P21 0.32↓ 0.0046 4a1 Ribophorin 1 Rpn1 0.70↓ 0.0069 RNA binding motif protein 12 Rbm12 0.33↓ 0.0032 C/G52 Glutamate-cysteine ligase, Gclc 5.66↑ 0.0051 SR18 bolA-like 2 Bola2 FF only 0.0060 SR53 catalytic subunit Transmembrane protein 30A Tmem30a 0.58↓ 0.0019 Testis-specific kinase 2 Tesk2 ↓0.42 0.0016 Aldehyde dehydrogenase 9, Aldh9a1 1.67↑ 0.0039 ERGIC and golgi 2 Ergic2 ↓0.36 0.0029 CM54 subfamily A1 Melanoma inhibitory activity 3 Mia3 2.66↑ 0.0062 DnaJ (Hsp40) homolog, subfamily C, Dnajc21 8.61↑ 0.0057 SR21 member 21 Vacuolar protein sorting 13B Vps13b 2.97↑ 0.0036 Carbohydrate sulfotransferase 3 Chst3 FF only 0.0010 3’-phosphoadenosine 5’- Papss1 0.61↓ 0.0050 JNK1/MAPK8-associated membrane Jkamp 8.2↑ 0.0025 SR24 phosphosulfate synthase 1 protein High mobility group Hmgn2 0.39↓ 0.0073 Hypothetical protein LOC100233175 7.18↑ 0.0036 nucleosomal binding domain 2 Integrin alpha 5 Itga5 0.34↓ 0.0094 SI55, 56 COX11 homolog, cytochrome c Cox11 0.38↓ 0.0069 SR57 oxidase assembly protein Proliferating cell nuclear PCNA 0.43↓ 0.0003 C/G58 H1 histone family, member X H1fx 0.38↓ 0.0059 antigen Family with sequence Fam109a 2.82↑ 0.0073 Actin, alpha 1, skeletal muscle Acta1 0.16↓ 0.0026 similarity 109, member A Cathepsin L Ctsl 0.40↓ 0.0075 IR59 Mitochondrial translational release Mtrf1 FF only 0.0044 factor 1 Cytochrome P450, family 4, Cyp4f16 0.47↓ 0.0061 IR60 Similar to Ornithine decarboxylase ODC FF only 0.0070 subunit f, polypeptiede 16 Ribosomal protein L3 0.61↓ 0.0044 Secretogranin III Scg3 FF only 0.0021 Lymphocyte specific 1, Lsp1 0.38↓ 0.0044 IR34 SRY-box containing gene 17 Sox17 FF only 0.0074 VF61 transcript variant 2 Solute carrier family 38, Slc38a10 0.60↓ 0.0029 CM62 Phosphodiesterase 6D, cGMP- Pde6d 0.30↓ 0.0034 member 10 specific, rod, delta Metastasis suppressor 1-like Mtss1l 0.48↓ 0.0040 Hexosaminidase Hexdc FF only 0.0006 Regulation of nuclear pre- Rprd2 0.60↓ 0.0083 Similar to Chlorine interacellular FF only 0.0040 mRNA domain containing 2 channel 4 Zinc finger, CCHC domain Zcchc2 2.69↑ 0.0069 Hemopexin Hpx FF only 0.0040 SR63, IR64, containing 2 65 GTPase activating protein and Gapvd1 0.38↓ 0.0028 Cyclin T1 Ccnt1 0.25↓ 0.0094 IR66, C/G67 VPS9 domain 1 Eph receptor A2 Epha2 2.60↑ 0.0052 CM68 Mab-21 like 1 Mab21l FF only 0.0054 1 Similar to mKIAA1397 protein 3.49↑ 0.0078 Adenylosuccinate synthetase like 1 Adssl1 FF only 0.0054 NU69 Solute carrier family 35, Scl35e3 3.41↑ 0.0022 BC068157 5.00↑ 0.0090 member E3 SYF2 homolog,
Load more

Recommended publications
  • Bioinformatics Approach for Pattern of Myelin-Specific Proteins And
    CORE Metadata, citation and similar papers at core.ac.uk Provided by Qazvin University of Medical Sciences Repository Biotech Health Sci. 2016 November; 3(4):e38278. doi: 10.17795/bhs-38278. Published online 2016 August 16. Research Article Bioinformatics Approach for Pattern of Myelin-Specific Proteins and Related Human Disorders Samiie Pouragahi,1,2,3 Mohammad Hossein Sanati,4 Mehdi Sadeghi,2 and Marjan Nassiri-Asl3,* 1Department of Molecular Medicine, School of Medicine, Qazvin university of Medical Sciences, Qazvin, IR Iran 2Department of Bioinformatics, National Institute of Genetic Engineering and Biotechnology (NIGEB), Tehran, IR Iran 3Department of Pharmacology, Cellular and Molecular Research Center, School of Medicine, Qazvin university of Medical Sciences, Qazvin, IR Iran 4Department of Molecular Genetics, National Institute of Genetic Engineering and Biotechnology (NIGEB), Tehran, IR Iran *Corresponding author: Marjan Nassiri-Asl, School of Medicine, Qazvin University of Medical Sciences, Qazvin, IR Iran. Tel: +98-2833336001, Fax: +98-2833324971, E-mail: [email protected] Received 2016 April 06; Revised 2016 May 30; Accepted 2016 June 22. Abstract Background: Recent neuroinformatic studies, on the structure-function interaction of proteins, causative agents basis of human disease have implied that dysfunction or defect of different protein classes could be associated with several related diseases. Objectives: The aim of this study was the use of bioinformatics approaches for understanding the structure, function and relation- ship of myelin protein 2 (PMP2), a myelin-basic protein in the basis of neuronal disorders. Methods: A collection of databases for exploiting classification information systematically, including, protein structure, protein family and classification of human disease, based on a new approach was used.
    [Show full text]
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Oral Absorption of Peptides and Nanoparticles Across the Human Intestine: Opportunities, Limitations and Studies in Human Tissues☆
    Advanced Drug Delivery Reviews 106 (2016) 256–276 Contents lists available at ScienceDirect Advanced Drug Delivery Reviews journal homepage: www.elsevier.com/locate/addr Oral absorption of peptides and nanoparticles across the human intestine: Opportunities, limitations and studies in human tissues☆ P. Lundquist, P. Artursson ⁎ Department of Pharmacy, Uppsala University, Box 580, SE-752 37 Uppsala, Sweden article info abstract Article history: In this contribution, we review the molecular and physiological barriers to oral delivery of peptides and nanopar- Received 2 May 2016 ticles. We discuss the opportunities and predictivity of various in vitro systems with special emphasis on human Received in revised form 2 July 2016 intestine in Ussing chambers. First, the molecular constraints to peptide absorption are discussed. Then the phys- Accepted 8 July 2016 iological barriers to peptide delivery are examined. These include the gastric and intestinal environment, the Available online 3 August 2016 mucus barrier, tight junctions between epithelial cells, the enterocytes of the intestinal epithelium, and the Keywords: subepithelial tissue. Recent data from human proteome studies are used to provide information about the protein fi Oral drug delivery expression pro les of the different physiological barriers to peptide and nanoparticle absorption. Strategies that Peptide drugs have been employed to increase peptide absorption across each of the barriers are discussed. Special consider- Nanoparticles ation is given to attempts at utilizing endogenous transcytotic pathways. To reliably translate in vitro data on Ussing chamber peptide or nanoparticle permeability to the in vivo situation in a human subject, the in vitro experimental system Peptide permeability needs to realistically capture the central aspects of the mentioned barriers.
    [Show full text]
  • Propranolol-Mediated Attenuation of MMP-9 Excretion in Infants with Hemangiomas
    Supplementary Online Content Thaivalappil S, Bauman N, Saieg A, Movius E, Brown KJ, Preciado D. Propranolol-mediated attenuation of MMP-9 excretion in infants with hemangiomas. JAMA Otolaryngol Head Neck Surg. doi:10.1001/jamaoto.2013.4773 eTable. List of All of the Proteins Identified by Proteomics This supplementary material has been provided by the authors to give readers additional information about their work. © 2013 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 10/01/2021 eTable. List of All of the Proteins Identified by Proteomics Protein Name Prop 12 mo/4 Pred 12 mo/4 Δ Prop to Pred mo mo Myeloperoxidase OS=Homo sapiens GN=MPO 26.00 143.00 ‐117.00 Lactotransferrin OS=Homo sapiens GN=LTF 114.00 205.50 ‐91.50 Matrix metalloproteinase‐9 OS=Homo sapiens GN=MMP9 5.00 36.00 ‐31.00 Neutrophil elastase OS=Homo sapiens GN=ELANE 24.00 48.00 ‐24.00 Bleomycin hydrolase OS=Homo sapiens GN=BLMH 3.00 25.00 ‐22.00 CAP7_HUMAN Azurocidin OS=Homo sapiens GN=AZU1 PE=1 SV=3 4.00 26.00 ‐22.00 S10A8_HUMAN Protein S100‐A8 OS=Homo sapiens GN=S100A8 PE=1 14.67 30.50 ‐15.83 SV=1 IL1F9_HUMAN Interleukin‐1 family member 9 OS=Homo sapiens 1.00 15.00 ‐14.00 GN=IL1F9 PE=1 SV=1 MUC5B_HUMAN Mucin‐5B OS=Homo sapiens GN=MUC5B PE=1 SV=3 2.00 14.00 ‐12.00 MUC4_HUMAN Mucin‐4 OS=Homo sapiens GN=MUC4 PE=1 SV=3 1.00 12.00 ‐11.00 HRG_HUMAN Histidine‐rich glycoprotein OS=Homo sapiens GN=HRG 1.00 12.00 ‐11.00 PE=1 SV=1 TKT_HUMAN Transketolase OS=Homo sapiens GN=TKT PE=1 SV=3 17.00 28.00 ‐11.00 CATG_HUMAN Cathepsin G OS=Homo
    [Show full text]
  • Supplementary Table 1: Adhesion Genes Data Set
    Supplementary Table 1: Adhesion genes data set PROBE Entrez Gene ID Celera Gene ID Gene_Symbol Gene_Name 160832 1 hCG201364.3 A1BG alpha-1-B glycoprotein 223658 1 hCG201364.3 A1BG alpha-1-B glycoprotein 212988 102 hCG40040.3 ADAM10 ADAM metallopeptidase domain 10 133411 4185 hCG28232.2 ADAM11 ADAM metallopeptidase domain 11 110695 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 195222 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 165344 8751 hCG20021.3 ADAM15 ADAM metallopeptidase domain 15 (metargidin) 189065 6868 null ADAM17 ADAM metallopeptidase domain 17 (tumor necrosis factor, alpha, converting enzyme) 108119 8728 hCG15398.4 ADAM19 ADAM metallopeptidase domain 19 (meltrin beta) 117763 8748 hCG20675.3 ADAM20 ADAM metallopeptidase domain 20 126448 8747 hCG1785634.2 ADAM21 ADAM metallopeptidase domain 21 208981 8747 hCG1785634.2|hCG2042897 ADAM21 ADAM metallopeptidase domain 21 180903 53616 hCG17212.4 ADAM22 ADAM metallopeptidase domain 22 177272 8745 hCG1811623.1 ADAM23 ADAM metallopeptidase domain 23 102384 10863 hCG1818505.1 ADAM28 ADAM metallopeptidase domain 28 119968 11086 hCG1786734.2 ADAM29 ADAM metallopeptidase domain 29 205542 11085 hCG1997196.1 ADAM30 ADAM metallopeptidase domain 30 148417 80332 hCG39255.4 ADAM33 ADAM metallopeptidase domain 33 140492 8756 hCG1789002.2 ADAM7 ADAM metallopeptidase domain 7 122603 101 hCG1816947.1 ADAM8 ADAM metallopeptidase domain 8 183965 8754 hCG1996391 ADAM9 ADAM metallopeptidase domain 9 (meltrin gamma) 129974 27299 hCG15447.3 ADAMDEC1 ADAM-like,
    [Show full text]
  • Mucin Family Genes Are Downregulated in Colorectal
    ooggeenneessii iinn ss && rrcc aa MM CC uu tt ff aa Journal ofJournal of oo gg Aziz et al., J Carcinogene Mutagene 2014, S10 ll ee ee aa aa nn nn nn nn ee ee rr rr ss ss uu uu ii ii ss ss oo oo DOI: 4172/2157-2518.S10-009 JJ JJ ISSN: 2157-2518 CarCarcinogenesiscinogenesis & Mutagenesis Research Article Article OpenOpen Access Access Mucin Family Genes are Downregulated in Colorectal Cancer Patients Mohammad Azhar Aziz*, Majed AlOtaibi, Abdulkareem AlAbdulrahman, Mohammed AlDrees and Ibrahim AlAbdulkarim Department of Medical Genomics, KIng Abdullah Intl. Med. Res. Ctr., King Saud Bin Abdul Aziz University for Health Sciences, Riyadh, Saudi Arabia Abstract Mucins are very well known to be associated with different types of cancer. Their role in colorectal cancer has been extensively studied without direct correlation with their change in expression levels. In the present study we employed the human exon array from Affymetrix to provide evidence that mucin family genes are downregulated in colorectal cancer tumor samples. We analyzed 92 samples taken from normal and tumor tissues. All mucin family genes except MUCL1 were downregulated with the fold change value ranging from -3.53 to 1.78 as calculated using AltAnalyze software. Maximum drop in RNA transcripts were observed for MUC2 with a fold change of -3.53. Further, we carried out Integromics analysis to analyze mucin genes using hierarchical clustering. MUC1 and MUC4 were found to be potential biomarkers for human colorectal cancer. Top upstream regulators were identified for mucin genes. Network analyses were carried out to further our understanding about potential mechanisms by which mucins can be involved in causing colorectal cancer.
    [Show full text]
  • Investigation of the Underlying Hub Genes and Molexular Pathogensis in Gastric Cancer by Integrated Bioinformatic Analyses
    bioRxiv preprint doi: https://doi.org/10.1101/2020.12.20.423656; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Investigation of the underlying hub genes and molexular pathogensis in gastric cancer by integrated bioinformatic analyses Basavaraj Vastrad1, Chanabasayya Vastrad*2 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karanataka, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India bioRxiv preprint doi: https://doi.org/10.1101/2020.12.20.423656; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract The high mortality rate of gastric cancer (GC) is in part due to the absence of initial disclosure of its biomarkers. The recognition of important genes associated in GC is therefore recommended to advance clinical prognosis, diagnosis and and treatment outcomes. The current investigation used the microarray dataset GSE113255 RNA seq data from the Gene Expression Omnibus database to diagnose differentially expressed genes (DEGs). Pathway and gene ontology enrichment analyses were performed, and a proteinprotein interaction network, modules, target genes - miRNA regulatory network and target genes - TF regulatory network were constructed and analyzed. Finally, validation of hub genes was performed. The 1008 DEGs identified consisted of 505 up regulated genes and 503 down regulated genes.
    [Show full text]
  • 140503 IPF Signatures Supplement Withfigs Thorax
    Supplementary material for Heterogeneous gene expression signatures correspond to distinct lung pathologies and biomarkers of disease severity in idiopathic pulmonary fibrosis Daryle J. DePianto1*, Sanjay Chandriani1⌘*, Alexander R. Abbas1, Guiquan Jia1, Elsa N. N’Diaye1, Patrick Caplazi1, Steven E. Kauder1, Sabyasachi Biswas1, Satyajit K. Karnik1#, Connie Ha1, Zora Modrusan1, Michael A. Matthay2, Jasleen Kukreja3, Harold R. Collard2, Jackson G. Egen1, Paul J. Wolters2§, and Joseph R. Arron1§ 1Genentech Research and Early Development, South San Francisco, CA 2Department of Medicine, University of California, San Francisco, CA 3Department of Surgery, University of California, San Francisco, CA ⌘Current address: Novartis Institutes for Biomedical Research, Emeryville, CA. #Current address: Gilead Sciences, Foster City, CA. *DJD and SC contributed equally to this manuscript §PJW and JRA co-directed this project Address correspondence to Paul J. Wolters, MD University of California, San Francisco Department of Medicine Box 0111 San Francisco, CA 94143-0111 [email protected] or Joseph R. Arron, MD, PhD Genentech, Inc. MS 231C 1 DNA Way South San Francisco, CA 94080 [email protected] 1 METHODS Human lung tissue samples Tissues were obtained at UCSF from clinical samples from IPF patients at the time of biopsy or lung transplantation. All patients were seen at UCSF and the diagnosis of IPF was established through multidisciplinary review of clinical, radiological, and pathological data according to criteria established by the consensus classification of the American Thoracic Society (ATS) and European Respiratory Society (ERS), Japanese Respiratory Society (JRS), and the Latin American Thoracic Association (ALAT) (ref. 5 in main text). Non-diseased normal lung tissues were procured from lungs not used by the Northern California Transplant Donor Network.
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Cloud-Clone 16-17
    Cloud-Clone - 2016-17 Catalog Description Pack Size Supplier Rupee(RS) ACB028Hu CLIA Kit for Anti-Albumin Antibody (AAA) 96T Cloud-Clone 74750 AEA044Hu ELISA Kit for Anti-Growth Hormone Antibody (Anti-GHAb) 96T Cloud-Clone 74750 AEA255Hu ELISA Kit for Anti-Apolipoprotein Antibodies (AAHA) 96T Cloud-Clone 74750 AEA417Hu ELISA Kit for Anti-Proteolipid Protein 1, Myelin Antibody (Anti-PLP1) 96T Cloud-Clone 74750 AEA421Hu ELISA Kit for Anti-Myelin Oligodendrocyte Glycoprotein Antibody (Anti- 96T Cloud-Clone 74750 MOG) AEA465Hu ELISA Kit for Anti-Sperm Antibody (AsAb) 96T Cloud-Clone 74750 AEA539Hu ELISA Kit for Anti-Myelin Basic Protein Antibody (Anti-MBP) 96T Cloud-Clone 71250 AEA546Hu ELISA Kit for Anti-IgA Antibody 96T Cloud-Clone 71250 AEA601Hu ELISA Kit for Anti-Myeloperoxidase Antibody (Anti-MPO) 96T Cloud-Clone 71250 AEA747Hu ELISA Kit for Anti-Complement 1q Antibody (Anti-C1q) 96T Cloud-Clone 74750 AEA821Hu ELISA Kit for Anti-C Reactive Protein Antibody (Anti-CRP) 96T Cloud-Clone 74750 AEA895Hu ELISA Kit for Anti-Insulin Receptor Antibody (AIRA) 96T Cloud-Clone 74750 AEB028Hu ELISA Kit for Anti-Albumin Antibody (AAA) 96T Cloud-Clone 71250 AEB264Hu ELISA Kit for Insulin Autoantibody (IAA) 96T Cloud-Clone 74750 AEB480Hu ELISA Kit for Anti-Mannose Binding Lectin Antibody (Anti-MBL) 96T Cloud-Clone 88575 AED245Hu ELISA Kit for Anti-Glutamic Acid Decarboxylase Antibodies (Anti-GAD) 96T Cloud-Clone 71250 AEK505Hu ELISA Kit for Anti-Heparin/Platelet Factor 4 Antibodies (Anti-HPF4) 96T Cloud-Clone 71250 CCA005Hu CLIA Kit for Angiotensin II
    [Show full text]
  • Appendix 2. Significantly Differentially Regulated Genes in Term Compared with Second Trimester Amniotic Fluid Supernatant
    Appendix 2. Significantly Differentially Regulated Genes in Term Compared With Second Trimester Amniotic Fluid Supernatant Fold Change in term vs second trimester Amniotic Affymetrix Duplicate Fluid Probe ID probes Symbol Entrez Gene Name 1019.9 217059_at D MUC7 mucin 7, secreted 424.5 211735_x_at D SFTPC surfactant protein C 416.2 206835_at STATH statherin 363.4 214387_x_at D SFTPC surfactant protein C 295.5 205982_x_at D SFTPC surfactant protein C 288.7 1553454_at RPTN repetin solute carrier family 34 (sodium 251.3 204124_at SLC34A2 phosphate), member 2 238.9 206786_at HTN3 histatin 3 161.5 220191_at GKN1 gastrokine 1 152.7 223678_s_at D SFTPA2 surfactant protein A2 130.9 207430_s_at D MSMB microseminoprotein, beta- 99.0 214199_at SFTPD surfactant protein D major histocompatibility complex, class II, 96.5 210982_s_at D HLA-DRA DR alpha 96.5 221133_s_at D CLDN18 claudin 18 94.4 238222_at GKN2 gastrokine 2 93.7 1557961_s_at D LOC100127983 uncharacterized LOC100127983 93.1 229584_at LRRK2 leucine-rich repeat kinase 2 HOXD cluster antisense RNA 1 (non- 88.6 242042_s_at D HOXD-AS1 protein coding) 86.0 205569_at LAMP3 lysosomal-associated membrane protein 3 85.4 232698_at BPIFB2 BPI fold containing family B, member 2 84.4 205979_at SCGB2A1 secretoglobin, family 2A, member 1 84.3 230469_at RTKN2 rhotekin 2 82.2 204130_at HSD11B2 hydroxysteroid (11-beta) dehydrogenase 2 81.9 222242_s_at KLK5 kallikrein-related peptidase 5 77.0 237281_at AKAP14 A kinase (PRKA) anchor protein 14 76.7 1553602_at MUCL1 mucin-like 1 76.3 216359_at D MUC7 mucin 7,
    [Show full text]
  • MUC6 (Mucin 6 / Gastric Mucin) Antibody - with BSA and Azide Mouse Monoclonal Antibody [Clone MUC6/916 ] Catalog # AH11929
    10320 Camino Santa Fe, Suite G San Diego, CA 92121 Tel: 858.875.1900 Fax: 858.622.0609 MUC6 (Mucin 6 / Gastric Mucin) Antibody - With BSA and Azide Mouse Monoclonal Antibody [Clone MUC6/916 ] Catalog # AH11929 Specification MUC6 (Mucin 6 / Gastric Mucin) Antibody - With BSA and Azide - Product Information Application ,1,2,3,4, Primary Accession Q6W4X9 Other Accession 4588, 528432 Reactivity Human Host Mouse Clonality Monoclonal Isotype Mouse / IgG1, kappa Calculated MW 252kDa KDa MUC6 (Mucin 6 / Gastric Mucin) Antibody - With BSA and Azide - Additional Information Formalin-fixed, paraffin-embedded human Gastric Carcinoma stained with MUC6 Monoclonal Antibody (MUC6/916). Gene ID 4588 Other Names Mucin-6, MUC-6, Gastric mucin-6, MUC6 Storage Store at 2 to 8°C.Antibody is stable for 24 months. Precautions MUC6 (Mucin 6 / Gastric Mucin) Antibody - With BSA and Azide is for research use only and not for use in diagnostic or therapeutic procedures. Formalin-fixed, paraffin-embedded human Gastric Carcinoma stained with MUC6 MUC6 (Mucin 6 / Gastric Mucin) Antibody - With Monoclonal Antibody (MUC6/916). BSA and Azide - Protein Information Name MUC6 MUC6 (Mucin 6 / Gastric Mucin) Antibody - With BSA and Azide - Background Function May provide a mechanism for modulation of The MUC6 gastric mucin is a secreted the composition of the protective mucus glycoprotein that plays an essential role in layer related to acid secretion or the epithelial cyto-protection from acid, proteases, presence of bacteria and noxious agents in pathogenic microorganisms, and mechanical the lumen. Plays an important role in the trauma in the gastrointestinal tract. Mucin 6 cytoprotection of epithelial surfaces and are expression is highest in the stomach and gall used as tumor markers in a variety of bladder, with lower expression in the terminal cancers.
    [Show full text]