Carlisle et al. 1

Supplementary Table 1. Primers for PCR amplification of bacterial 16S rRNA.

Primers for Group A TA-27FMID1 CGTATCGCCTCCCTCGCGCCATCAGACGAGTGCGTAGAGTTTGATCCTGGCTCAG TA-27FMID2 CGTATCGCCTCCCTCGCGCCATCAGACGCTCGACAAGAGTTTGATCCTGGCTCAG TA-27FMID3 CGTATCGCCTCCCTCGCGCCATCAGAGACGCACTCAGAGTTTGATCCTGGCTCAG TA-27FMID4 CGTATCGCCTCCCTCGCGCCATCAGAGCACTGTAGAGAGTTTGATCCTGGCTCAG TA-27FMID5 CGTATCGCCTCCCTCGCGCCATCAGATCAGACACGAGAGTTTGATCCTGGCTCAG TA-27FMID6 CGTATCGCCTCCCTCGCGCCATCAGATATCGCGAGAGAGTTTGATCCTGGCTCAG TA-27FMID7 CGTATCGCCTCCCTCGCGCCATCAGCGTGTCTCTAAGAGTTTGATCCTGGCTCAG TA-27FMID8 CGTATCGCCTCCCTCGCGCCATCAGCTCGCGTGTCAGAGTTTGATCCTGGCTCAG TA-27FMID9 CGTATCGCCTCCCTCGCGCCATCAGTAGTATCAGCAGAGTTTGATCCTGGCTCAG TA-27FMID10 CGTATCGCCTCCCTCGCGCCATCAGTCTCTATGCGAGAGTTTGATCCTGGCTCAG TA-27FMID11 CGTATCGCCTCCCTCGCGCCATCAGTGATACGTCTAGAGTTTGATCCTGGCTCAG TA-27FMID13 CGTATCGCCTCCCTCGCGCCATCAGCATAGTAGTGAGAGTTTGATCCTGGCTCAG TA-27FMID14 CGTATCGCCTCCCTCGCGCCATCAGCGAGAGATACAGAGTTTGATCCTGGCTCAG TB-338R CTATGCGCCTTGCCAGCCCGCTCAGTGCTGCCTCCCGTAGGAGT

Primers for Group B TB-27FMID1 CTATGCGCCTTGCCAGCCCGCTCAGACGAGTGCGTAGAGTTTGATCCTGGCTCAG TB-27FMID2 CTATGCGCCTTGCCAGCCCGCTCAGACGCTCGACAAGAGTTTGATCCTGGCTCAG TB-27FMID3 CTATGCGCCTTGCCAGCCCGCTCAGAGACGCACTCAGAGTTTGATCCTGGCTCAG TB-27FMID4 CTATGCGCCTTGCCAGCCCGCTCAGAGCACTGTAGAGAGTTTGATCCTGGCTCAG TB-27FMID5 CTATGCGCCTTGCCAGCCCGCTCAGATCAGACACGAGAGTTTGATCCTGGCTCAG TB-27FMID6 CTATGCGCCTTGCCAGCCCGCTCAGATATCGCGAGAGAGTTTGATCCTGGCTCAG TB-27FMID7 CTATGCGCCTTGCCAGCCCGCTCAGCGTGTCTCTAAGAGTTTGATCCTGGCTCAG TB-27FMID8 CTATGCGCCTTGCCAGCCCGCTCAGCTCGCGTGTCAGAGTTTGATCCTGGCTCAG TB-27FMID9 CTATGCGCCTTGCCAGCCCGCTCAGTAGTATCAGCAGAGTTTGATCCTGGCTCAG TB-27FMID10 CTATGCGCCTTGCCAGCCCGCTCAGTCTCTATGCGAGAGTTTGATCCTGGCTCAG TB-27FMID11 CTATGCGCCTTGCCAGCCCGCTCAGTGATACGTCTAGAGTTTGATCCTGGCTCAG TB-27FMID12 CTATGCGCCTTGCCAGCCCGCTCAGTACTGAGCTAAGAGTTTGATCCTGGCTCAG TB-27FMID13 CTATGCGCCTTGCCAGCCCGCTCAGCATAGTAGTGAGAGTTTGATCCTGGCTCAG TB-27FMID14 CTATGCGCCTTGCCAGCCCGCTCAGCGAGAGATACAGAGTTTGATCCTGGCTCAG TTA-338R CGTATCGCCTCCCTCGCGCCATCAGTGCTGCCTCCCGTAGGAGT

Supplemental Table 2. Microbiota mRNA sequencing coverage. Coverage ranged from 92.8%- 100% (average 98.6%).

Sample Diet Number of sequences after quality Percent Coverage trimming 1a FF 323 93 1b FF 833 98 1c FF 816 99 2a FF 662 98 2b FF 888 98 2c FF 884 99 3a FF 564 97 3b FF 966 99 4a FF 723 98 4b FF 1103 99 5a FF 746 97 10a MF 852 100 3c MF 699 100 4c MF 1154 100 5b MF 1144 100 6a MF 963 100 6b MF 919 100 7a MF 888 99 7b MF 1096 100 8a MF 834 100 9a MF 961 99 Carlisle et al. 2

Supplemental Table 3. Library characteristics for 8 cDNA libraries. Average read length was 100bp. BLAST search against the mouse RNA database yielded 18,014,657 hits (~2,251,000/library) to 19,703 mouse mRNAs. FF1 FF2 FF3 FF4 MF1 MF2 MF3 MF4

Total reads before quality trim

4,096,796 6,609,830 3,579,743 3,452,378 2,580,264 3,781,577 3,320,574 2,075,326

%GC 62 62 62 62 63 61 62 61

Reads for annotation 3,902,252 6,304,521 3,523,485 3,397,021 2,460,776 3,601,183 3,269,729 2,042,846

Total Reads Annotated 1,801,239 5,309,548 2,558,030 2,038,522 785,627 2,087,931 2,384,179 1,049,581

Mouse Genes Detected 11,695 16,273 13,166 13,261 9,943 13,191 13,141 11,921

Carlisle et al. 3

Supplemental Table 4. The 50 genes with the highest mRNA transcript levels. mRNA transcript level of each gene was calculated for FF and MF mice. p<0.01 indicated a statistically significant difference.

Gene p-value Gene p-value 28S rRNA (LOC236598) Rn28s 0.10 Keratin 8 Krt8 0.58 18S rRNA Rn18s 0.19 RNA component of mitochondrial RNAse P RMrp 0.43 Leucyl-tRNA synthetase Lars2 0.89 Small praline-rich protein 2A2 Sprr2a 0.47 mitocohondrial nuclear gene 2 encoding mitochondrial protein microRNA 689-2 Mir689-2 0.04 Ribosomal protein, large P0 Rplp0 0.89 Ac1147 (LOC672857) Ac1147 0.73 7SK nuclear Rn7sk 0.07 MicroRNA mir-2135-3 Mir 21353 0.89 Metallothionein 2 Mt2 0.01 Transmembrane protein 170 Tmem170 0.82 Lectin, galactose binding, soulable 4 Lgals4 0.74 LOC627695 0.90 Actin, alpha 2, smooth muscle Acta2 0.30 Ribonuclease P RNA component Rpph1 0.81 Actin, gamma, cytoplasmic 1 Actg1 0.30 H1 microRNA mir 2133-2 Mir2133- 0.30 Tumor protein, translationally-controlled 1 Tpt1 0.81 2 Histone 3 (LOC677333) H3 0.32 Collagen, type 1, alpha 2 Col1a2 0.11 Eukaryotic translation elongation Eef1a1 0.50 Keratin 19 Krt19 0.82 factor 1 alpha 1 Collagen type III alpha 1 Col3a1 0.14 Filamin, alpha Flna 0.15 Mtrnr2-like Mtrnr2l 0.76 Actin, gamma 2, smooth muscle, enteric Actg2 0.04 Actin, beta Actb 0.06 Ferritin heavy chain 1 Fth1 0.05 Metallothionein 1 Mt1 0.003 Glyceraldehyde-3-phosphate dehydrogenase Gapdh 0.58 Collagen, type 1, alpha 1 Col1a1 0.09 Heat shock protein 8 Hspa8 0.53 Proline/histidine/glycine-rich 1 Phgr1 0.69 microRNA mir-2134-4 Mir213 0.11 4-4 Deleted in malignant brain tumors Dmbt1 0.800 Transgelin Tagln 0.45 1 Mucin 2 Muc2 0.975 Ribosomal protein SA Rpsa 0.75 Fc fragment of IgG binding protein Fcgbp 0.802 Serine protease inhibitor, Kunitz type 2 Spint2 0.91 5.8S ribosomal RNA 5.8S 0.009 Myosin, heavy polypeptide 11, smooth muscle Myh11 0.36 rRNA RIKEN cDNA 2210415F13 0.347 ATPase, Na/K transporting, alpha 1 Atp1a1 0.36 polypeptide Ferritin light chain 1 Flt1 0.180 ATP synthase, H+transporting mitochondrial Atp5b 0.36 F1 complex, beta subunit Eukaryotic translation elongation Eef2 0.944 Ubiquitin B Ubb 0.64 factor 2

Carlisle et al. 4

Supplemental Table 5. Host transcriptome analysis. mRNA transcript levels differed between MF and FF mice for 148 genes. p<0.01 was considered statistically significant. Fold change in FF mice relative to MF mice was calculated for each gene. Literature search for each gene was conducted, and genes were grouped based on published function: C/G-Cell Cycle/Gene Expression (n=32), SI-Structural Integrity (n=6), SR-Stress Response (n=18), NU-Nutrient Utilization (n=6), IR-Immune Regulation (n=14), CM-Cell Motility (n=6), VF-Vascular Function (n=3)).

Gene Fold p-value Function Gene Fold p-value Function Change Change Methallothionein 1 Mt1 5.40↑ 0.0030 Autophagy-related 4B Atg4b 0.37↓ 0.0028 SR25, 26 5.8S ribosomal RNA 5.8S rRNA 1.7↑ 0.0095 Pirin Pir FF only 0.0022 C/G46 Desmin Des 0.56↓ 0.0016 SI32 Engulfment and cell motility 2, ced- Elmo2 FF only 0.0038 SR47 12 homolog Cysteine and glycine-rich Csrp1 0.66↓ 0.0065 Sestrin 3 Sesn3 0.41↓ 0.0040 SR27 protein 1 Tropomyosin 2 beta Tpm2 0.63↓ 0.0068 Regulator of G-protein signaling 3 Rgs3 0.43↓ 0.0097 IR48 Heme Oxygenase 1 Hmox1 25.4↑ 0.0066 SR 17, 18 Protein inhibitor of activated STAT2 Pias2 FF only 0.0048 C/G49 Serine pepditase inhibitor Serpinh1 0.49↓ 0.0074 SI31 Autophagy-related 5 Atg5 0.33↓ 0.0052 SR25 Cladue H member 1 ATP-binding cassette, sub- Abcbia 2.68↑ 0.0075 SR23 Kinesin family member 22 Kif22 9.46↑ 0.0064 family B, member 1A Supression of turmoigenicity St14 1.94↑ 0.0003 SR50 RIKEN 9030625A04 4.86↑ 0.0072 14 Vinculin Vcl 0.47↓ 0.0061 SI29 RIKEN 9130024F11 0.37↓ 0.0082 Protein Phosphatase 1, Ppp1cb 0.55↓ 0.0057 RAN binding protein 6 RANbp FF only 0.0015 CM51 catalytic subunit, beta isoform 6 Protein tyrosine phosphatase Ptp4a1 0.67↓ 0.0083 RIKEN 9530082P21 0.32↓ 0.0046 4a1 Ribophorin 1 Rpn1 0.70↓ 0.0069 RNA binding motif protein 12 Rbm12 0.33↓ 0.0032 C/G52 Glutamate-cysteine ligase, Gclc 5.66↑ 0.0051 SR18 bolA-like 2 Bola2 FF only 0.0060 SR53 catalytic subunit Transmembrane protein 30A Tmem30a 0.58↓ 0.0019 Testis-specific kinase 2 Tesk2 ↓0.42 0.0016 Aldehyde dehydrogenase 9, Aldh9a1 1.67↑ 0.0039 ERGIC and golgi 2 Ergic2 ↓0.36 0.0029 CM54 subfamily A1 Melanoma inhibitory activity 3 Mia3 2.66↑ 0.0062 DnaJ (Hsp40) homolog, subfamily C, Dnajc21 8.61↑ 0.0057 SR21 member 21 Vacuolar protein sorting 13B Vps13b 2.97↑ 0.0036 Carbohydrate sulfotransferase 3 Chst3 FF only 0.0010 3’-phosphoadenosine 5’- Papss1 0.61↓ 0.0050 JNK1/MAPK8-associated membrane Jkamp 8.2↑ 0.0025 SR24 phosphosulfate synthase 1 protein High mobility group Hmgn2 0.39↓ 0.0073 Hypothetical protein LOC100233175 7.18↑ 0.0036 nucleosomal binding domain 2 Integrin alpha 5 Itga5 0.34↓ 0.0094 SI55, 56 COX11 homolog, cytochrome c Cox11 0.38↓ 0.0069 SR57 oxidase assembly protein Proliferating cell nuclear PCNA 0.43↓ 0.0003 C/G58 H1 histone family, member X H1fx 0.38↓ 0.0059 antigen Family with sequence Fam109a 2.82↑ 0.0073 Actin, alpha 1, skeletal muscle Acta1 0.16↓ 0.0026 similarity 109, member A Cathepsin L Ctsl 0.40↓ 0.0075 IR59 Mitochondrial translational release Mtrf1 FF only 0.0044 factor 1 Cytochrome P450, family 4, Cyp4f16 0.47↓ 0.0061 IR60 Similar to Ornithine decarboxylase ODC FF only 0.0070 subunit f, polypeptiede 16 Ribosomal protein L3 0.61↓ 0.0044 Secretogranin III Scg3 FF only 0.0021 Lymphocyte specific 1, Lsp1 0.38↓ 0.0044 IR34 SRY-box containing gene 17 Sox17 FF only 0.0074 VF61 transcript variant 2 Solute carrier family 38, Slc38a10 0.60↓ 0.0029 CM62 Phosphodiesterase 6D, cGMP- Pde6d 0.30↓ 0.0034 member 10 specific, rod, delta Metastasis suppressor 1-like Mtss1l 0.48↓ 0.0040 Hexosaminidase Hexdc FF only 0.0006 Regulation of nuclear pre- Rprd2 0.60↓ 0.0083 Similar to Chlorine interacellular FF only 0.0040 mRNA domain containing 2 channel 4 Zinc finger, CCHC domain Zcchc2 2.69↑ 0.0069 Hemopexin Hpx FF only 0.0040 SR63, IR64, containing 2 65 GTPase activating protein and Gapvd1 0.38↓ 0.0028 Cyclin T1 Ccnt1 0.25↓ 0.0094 IR66, C/G67 VPS9 domain 1 Eph receptor A2 Epha2 2.60↑ 0.0052 CM68 Mab-21 like 1 Mab21l FF only 0.0054 1 Similar to mKIAA1397 protein 3.49↑ 0.0078 Adenylosuccinate synthetase like 1 Adssl1 FF only 0.0054 NU69 Solute carrier family 35, Scl35e3 3.41↑ 0.0022 BC068157 5.00↑ 0.0090 member E3 SYF2 homolog, RNA splicing Syf2 3.40↑ 0.0094 C/G70 Dynactin 3 Dctn3 5.00↑ 0.0090 CM71 factor Carlisle et al. 5

RIKEN 1810013D10 3.48↑ 0.0041 Werner syndrome homolog Wrn FF only 0.0021 SR72 Sterol-C4-methyl oxidase-like Sc4mol 0.33↓ 0.0025 NU73 Caprin family member 2 Caprin2 FF only 0.0048 Coatomer protein complex, Copz2 29.6↑ 0.0051 CM74 Suppressor of Ty 7-like Supt7l 0.40↓ 0.0098 C/G75 subunit zeta2 Calcium/calmodulin- Camk1 0.53↓ 0.0088 ATP/GTP binding protein 1 Agtpbp1 FF only 0.0040 dependent protein kinase 1 Headcase homolog Heca 6.29↑ 0.0061 C/G76 Carbamoyl-phosphate synthetase 1 Cps1 0.14↓ 0.0040 Josephin domain containing 1 Josd1 0.36↓ 0.0001 C/G77 Glycerol kinase 5 Gk5 FF only 0.00001 Tet oncogene 1 Tet1 5.10↑ 0.0051 C/G78 Similar to leucine-rich repeat kinase FF only 0.0001 1 NLR family, apoptosis Naip5 0.35↓ 0.0055 IR33, C/G79 Chemokine receptor 9 Ccr9 FF only 0.0001 IR30, 37 inhibitory protein 5 Testis expressed gene 10 Tex10 2.94↑ 0.0065 Ring finger protein 150 Rnf150 0.15↓ 0.0001 PRP40 pre-mRNA processing Prpf40a 0.40↓ 0.0077 C/G80 ADP-ribosylation factor-like 6 Arl6ip6 0.21↓ 0.0054 factor 40 homolog A interacting protein 6 Transmembrane protein 106A Tmem106a 0.49↓ 0.0094 Asporin Aspn 0.26↓ 0.0086 SI81 ARP8 actin-related protein 8 Actr8 6.73↑ 0.0039 SR82 TRM5 tRNA methyltransferase 5 Trmt5 FF only 0.0001 C/G83 homolog homolog Unc-51 like kinase 2 Ulk2 0.35↓ 0.0063 SR25 Y3 small cytoplasmic (associated Rny3 FF only 0.0001 with Ro protein) Translocase of inner Timm8b 0.50↓ 0.0033 Non-coding sequence BC039771 FF only 0.0001 mitochondrial membrane 8 homolog b Amyloid beta precurson Appbp2 0.34↓ 0.0032 C/G84 Similar to baculoviral IAP repeat- 0.41↓ 0.0006 protein binding protein 2 containing 1a Heterogenous nuclear Hnrnpul1 0.34↓ 0.0025 C/G85 Similar to sprouty 1 0.33↓ 0.0050 VF86, IR87 ribonucleoprotein U-like 1 Methionyl aminopeptidase 1 Metap1 0.42↓ 0.0097 Adhesion moleculre with Ig like Amigo1 FF only 0.0019 domain 1 Tubulin, gamma complex Tubgcp5 9.90↑ 0.0005 Mannoside Mgat5b FF only 0.0019 associated protein acetylglucosaminyltransferase 5, isoenzyme B Period homolog 3 Per3 9.40↑ 0.0018 IR88 LON peptidase N-terminal domain Lonrf3 0.20↓ 0.0021 and ring finger 3 Apoptotic peptidase activating Apaf1 0.35↓ 0.0070 C/G89 Histocompatibility 2, blastocyst H2-Bl 0.29↓ 0.0014 IR32 factor 1 Homeobox B5 Hoxb5 2.51↑ 0.0062 C/G73 RIKEN 9030224M15 0.25↓ 0.0091 Riken 6430548M08 0.41↓ 0.0078 Ribosomal protein L38 Rpl38 0.35↓ 0.0043 RIKEN 3110021N24 8.37↑ 0.0093 N-6 adenine-specific DNA N6amt1 0.17↓ 0.0070 C/G90 methyltrnasferase 1 Leiomodin 1 (smooth muscle) Lmod1 0.32↓ 0.0004 E74-like factor 3 Elf3 0.23↓ 0.0031 SI25 Cell death-inducing DFFA-like Cidec 2.35↑ 0.0064 NU91, BCL6 interacting corepressor Bcor 0.17↓ 0.0091 C/G93 effector c C/G92 Family with sequence Fam136A 0.33↓ 0.0026 Histochompatability 2, K region H2-K2 0.19↓ 0.0074 similarity 136, member A locus 2 Ubi prenyltransferase domain Ubiad1 0.40↓ 0.0050 NU94 Leo1, Paf1/RNA polymerase II Leo1 0.11↓ 0.0091 C/G95 containing 1 complex component homolog ArfGAP with coiled-coil, Acap3 4.04↑ 0.0042 Cancer susceptibility candidate 5 Casc5 0.21↓ 0.0098 C/G96 ankyrin repeat and PH domain 3 DDBI and CUL4 assoicated Dcaf15 0.50↓ 0.0053 C/G97 Limb region 1 Lmbr1 0.13↓ 0.0024 factor 15 High mobility group Box 3 Hmgb3 0.51↓ 0.0026 IR98, C/G98 Ubiquitously transcribed Uty 0.07↓ 0.0084 tetratricopeptide repeat gene, Y chromosome Round spermatid basic protein Rsbn1l 4.97↑ 0.0058 4.5S RNA Rn4.5s 0.04↓ 0.0002 C/G99 1-like Tumor-supressing Tssc4 15.9↑ 0.0012 C/G100 Protein kinase, AMP-activated, Prkag2 0.14↓ 0.0080 NU101 subchromosomal transferable gamma 2 non catalytic subunit fragment 4 Target of EGR1, member one Toe1 3.61↑ 0.0067 C/G102 Origin recognition complex, subunit Orc2l 0.07↓ 0.0083 C/G103 2-like Activin A receptor, type II-like Acvrl1 0.40↓ 0.0030 VF104 GTP-binding protein 10 Gtpbp10 0.03↓ 0.0033 1 MOB1, Mps One Binder Mobkl2c 4.61↑ 0.0057 C/G105 Trans-acting transcription factor 4 Sp4 0.05↓ 0.0041 kinase activator-like 2C Ubiquitin specific peptidase 32 Usp32 0.35↓ 0.0064 C/G106 G two S phase expressed protein 1 Gtse1 0.06↓ 0.0091 C/G107 Lysosomal-associated protein Laptm6 0.33↓ 0.0085 Tyrosine aminotransferase Tat 0.06↓ 0.0091 transmembrane 5 GRB10 interacting GYF Gigyf1 6.81↑ 0.0043 SR20, 21 Transmembrane protein 59-like Tmem5 MF only 0.0031 protein 1 91 Lysosomal acid lipase A Lipa MF only 0.0062 NU108

Carlisle et al. 6

Supplemental Table 6. Mucous related genes. mRNA transcript level of each gene was calculated for FF and MF mice. p<0.01 indicated a statistically significant difference.

Gene p-value Mucin 2 Muc2 0.975 Mucin 13, epithelial transmembrane Muc13 0.566 Mucin 3, intestinal Muc3 0.776 Prostate androgen-regulated mucin-like Parm1 0.623 protein1 Glucosaminyl (N-acetyl) transferace 3, mucin Gcnt3 0.295 type Biphenyl hydrolase-like (serine hydrolase, Bphl 0.519 breast epithelial mucin-associated antigen Intestinal mucin LOC6400 0.242 20 Mucin 4 Muc4 0.539 Mucin 1, transmembrane Muc1 0.662 Endomucin (Emcn), transcript variant 1 0.420 Peritrophic matrix insect intestinal mucin LOC1000 0.742 44913 EGR-like module containing, mucin-like, Emr1 0.350 hormone receptor-like sequence 1 CD164 sialomucin-like 2 Cd164l2 0.153 Mucin 16 Muc16 0.556 Mucin 20 Muc20 0.556 Mucin 6, gastric Muc6 1.000 Mucin 5, subtype B, traceobronchial Muc5b 0.350 EGF-like module containing, mucin-like Emr4 0.350 hormone receptor-like sequence 4

Supplemental Table 7. Micro RNA (miRNA) genes. mRNA transcript level of each gene was calculated for FF and MF mice. p<0.01 indicated a statistically significant difference.

Gene p-value microRNA 689-2 Mir689-2 0.037 microRNA mir-2135-3 Mir2135-3 0.887 microRNA mir-2133-2 Mir2133-2 0.301 microRNA mir-2134-4 Mir2134-4 0.110 microRNA 715 Mir715 0.867 microRNA mir-2138 Mir2138 0.146 microRNA mir-2132 Mir2132 0.215 microRNA 689-1 Mir689-1 0.826 microRNA mir2134-3 Mir2134-3 0.912 microRNA mir2134-2 Mir2134-2 0.278 microRNA mir-2135-4 Mir2135-4 0.897 microRNA mir-2140 Mir2140 0.144 Micro RNA mir-2134-1 Mir2134-1 0.829 microRNA mir-2133-1 Mir2133-1 0.643 microRNA 703 Mir703 0.556 microRNA 546 Mir546 0.545 microRNA 215 Mir215 0.545 microRNA196a-1 Mir196a-1 1.000 microRNA mir-1901 Mir1901 1.000 microRNA mir-1946b Mir1946b 1.000 microRNA mir-2141 Mir2141 0.545 microRNA let7c-2 Mirlet7c-2 1.000 microRNA 331 Mir331 1.000 microRNA mir-1932 Mir1932 1.000 microRNA 147 Mir147 0.123 microRNA 425 Mir425 0.350 microRNA mir-2146 Mir2146 0.350

Carlisle et al. 7

References for supplementary information.

17. Petrache I, Otterbein LE, Alam J, et al. Heme oxygenase-1 inhibits TNF-alpha-induced apoptosis in cultured fibroblasts. Am J Physiol Lung Cell Mol Physiol 2000; 278(2):L312-9.

18. Dalton TP, Dieter MZ, Yang Y, et al. Knockout of the mouse glutamate cysteine ligase catalytic subunit (Gclc) gene: embryonic lethal when homozygous, and proposed model for moderate glutathione deficiency when heterozygous. Biochem Biophys Res Commun 2000; 279(2):324-9.

19. Giovannone B, Lee E, Laviola L, et al. Two novel proteins that are linked to insulin-like growth factor (IGF-I) receptors by the Grb10 adapter and modulate IGF-I signaling. J Biol Chem 2003; 278(34):31564- 73.

20. Baregamian N, Song J, Jeschke MG, et al. IGF-1 protects intestinal epithelial cells from oxidative stress- induced apoptosis. J Surg Res 2006; 136(1):31-7.

21. Pedersen CB, Gregersen N. Stress response profiles in human fibroblasts exposed to heat shock or oxidative stress. Methods Mol Biol 2010; 648:161-73.

22. Kalabis GM, Kostaki A, Andrews MH, et al. Multidrug resistance phosphoglycoprotein (ABCB1) in the mouse placenta: fetal protection. Biol Reprod 2005; 73(4):591-7.

23. Kadoya T, Khurana A, Tcherpakov M, et al. JAMP, a Jun N-terminal kinase 1 (JNK1)-associated membrane protein, regulates duration of JNK activity. Mol Cell Biol 2005; 25(19):8619-30.

24. Egan DF, Shackelford DB, Mihaylova MM, et al. Phosphorylation of ULK1 (hATG1) by AMP-activated protein kinase connects energy sensing to mitophagy. Science; 331(6016):456-61.

25. Behrends C, Sowa ME, Gygi SP, Harper JW. Network organization of the human autophagy system. Nature 2010; 466(7302):68-76.

26. Huett A, Xavier RJ. Autophagy at the gut interface: mucosal responses to stress and the consequences for inflammatory bowel diseases. Inflamm Bowel Dis 2010; 16(1):152-74.

27. Budanov AV, Lee JH, Karin M. Stressin' Sestrins take an aging fight. EMBO Mol Med 2010; 2(10):388- 400.

28. Peng X, Cuff LE, Lawton CD, DeMali KA. Vinculin regulates cell-surface E-cadherin expression by binding to beta-catenin. J Cell Sci 2010; 123(Pt 4):567-77.

29. Ng AY, Waring P, Ristevski S, et al. Inactivation of the transcription factor Elf3 in mice results in dysmorphogenesis and altered differentiation of intestinal epithelium. Gastroenterology 2002; 122(5):1455- 66.

30. Wang H, Parry S, Macones G, et al. A functional SNP in the promoter of the SERPINH1 gene increases risk of preterm premature rupture of membranes in African Americans. Proc Natl Acad Sci U S A 2006; 103(36):13463-7.

31. Paulin D, Li Z. Desmin: a major intermediate filament protein essential for the structural integrity and function of muscle. Exp Cell Res 2004; 301(1):1-7.

32. Guidry PA, Stroynowski I. The murine family of gut-restricted class Ib MHC includes alternatively spliced isoforms of the proposed HLA-G homolog, "blastocyst MHC". J Immunol 2005; 175(8):5248-59. Carlisle et al. 8

33. Wright EK, Goodart SA, Growney JD, et al. Naip5 affects host susceptibility to the intracellular pathogen Legionella pneumophila. Curr Biol 2003; 13(1):27-36.

34. Jongstra-Bilen J, Jongstra J. Leukocyte-specific protein 1 (LSP1): a regulator of leukocyte emigration in inflammation. Immunol Res 2006; 35(1-2):65-74.

35. Wermers JD, McNamee EN, Wurbel MA, et al. The chemokine receptor CCR9 is required for the T cell- mediated regulation of chronic ileitis in mice. Gastroenterology 2011.

36. Pietzak M. Bacterial colonization of the neonatal gut. J Pediatr Gastroenterol Nutr 2004; 38(4):389-91.

37. Caplan MS. Probiotic and prebiotic supplementation for the prevention of neonatal necrotizing enterocolitis. J Perinatol 2009; 29 Suppl 2:S2-6.

38. Lin HC, Hsu CH, Chen HL, et al. Oral probiotics prevent necrotizing enterocolitis in very low birth weight preterm infants: a multicenter, randomized, controlled trial. Pediatrics 2008; 122(4):693-700.

39. Voelz A, Muller A, Gillen J, et al. Outbreaks of Serratia marcescens in neonatal and pediatric intensive care units: clinical aspects, risk factors and management. Int J Hyg Environ Health 2010; 213(2):79-87.

40. Dessi A, Puddu M, Testa M, et al. Serratia marcescens infections and outbreaks in neonatal intensive care units. J Chemother 2009; 21(5):493-9.

41. Graham PL, 3rd, Begg MD, Larson E, et al. Risk factors for late onset gram-negative sepsis in low birth weight infants hospitalized in the neonatal intensive care unit. Pediatr Infect Dis J 2006; 25(2):113-7.

42. Glikman D, Sprecher H, Chernokozinsky A, Weintraub Z. Lactococcus lactis catheter-related bacteremia in an infant. Infection 2010; 38(2):145-6.

43. Maynard AA, Dvorak K, Khailova L, et al. Epidermal growth factor reduces autophagy in intestinal epithelium and in the rat model of necrotizing enterocolitis. Am J Physiol Gastrointest Liver Physiol 2010; 299(3):G614-22.

44. Wurbel MA, McIntire MG, Dwyer P, Fiebiger E. CCL25/CCR9 interactions regulate large intestinal inflammation in a murine model of acute colitis. PLoS One 2010; 6(1):e16442.

45. Tian R, Liu SX, Williams C, et al. Characterization of a necrotizing enterocolitis model in newborn mice. Int J Clin Exp Med 2010; 3(4):293-302.

46. Miyazaki I,Simizu S,Okumura H,et al.A small-molecule inhibitor shows that pirin regulates migration of melanoma cells.Nat Chem Biol2010;6:667-73.

47. Ho E,Irvine T,Vilk GJ,et al.Integrin-linked kinase interactions with ELMO2 modulate cell polarity.Mol Biol Cell2009;20:3033-43.

48. Yau DM,Sethakorn N,Taurin S,et al.Regulation of Smad-mediated gene transcription by RGS3.Mol Pharmacol2008;73:1356-61.

49. Arora T,Liu B,He H,et al.PIASx is a transcriptional co-repressor of signal transducer and activator of transcription 4.J Biol Chem2003;278:21327-30.

50. List K,Kosa P,Szabo R,et al.Epithelial integrity is maintained by a matriptase-dependent proteolytic pathway.Am J Pathol2009;175:1453-63. Carlisle et al. 9

51. Ranbp6. http://www.ncbi.nlm.nih.gov/pubmed?Db=gene&Cmd=retrieve&dopt=full_report&list_uids=26953.RefSe q2011.

52. Stover C,Gradl G,Jentsch I,et al.cDNA cloning, chromosome assignment, and genomic structure of a human gene encoding a novel member of the RBM family.Cytogenet Cell Genet2001;92:225-30.

53. Santos JM,Freire P,Vicente M,et al.The stationary-phase morphogene bolA from Escherichia coli is induced by stress during early stages of growth.Mol Microbiol1999;32:789-98.

54. Kwok SC,Liu X,Mangel P,et al.PTX1(ERGIC2)-VP22 fusion protein upregulates interferon-beta in prostate cancer cell line PC-3.DNA Cell Biol2006;25:523-9.

55. Bauer JS,Varner J,Schreiner C,et al.Functional role of the cytoplasmic domain of the integrin alpha 5 subunit.J Cell Biol1993;122:209-21.

56. Hamidouche Z,Fromigue O,Ringe J,et al.Priming integrin alpha5 promotes human mesenchymal stromal cell osteoblast differentiation and osteogenesis.Proc Natl Acad Sci USA2009;106:18587-91.

57. Khalimonchuk O,Bird A,Winge DR.Evidence for a pro-oxidant intermediate in the assembly of cytochrome oxidase.J Biol Chem2007;282:17442-9.

58. Strzalka W,Ziemienowicz A.Proliferating cell nuclear antigen(PCNA):a key factor in DNA replication and cell cycle regulation.Ann Bot2010.

59. Hsieh CS,deRoos P,Honey K,et al.A role for cathepsin L and cathepsin S in peptide generation for MHC class II presentation.J Immunol2002;168:2618-25.

60. Cui X,Kawashima H,Barclay TB, et al.Molecular cloning and regulation of expression of two novel mouse CYP4F genes:expression in peroxisome proliferator-activated receptor alpha-deficient mice upon lipopolysaccharide and clofibrate challenges.J Pharmacol Exp Ther2001;296:542-50.

61. Matsui T,Kanai-Azuma M,Hara K,et al.Redundant roles of Sox17 and Sox18 in postnatal angiogenesis in mice.J Cell Sci2006;119:3513-26.

62. Sundberg BE,Waag E,Jacobsson JA,et al.The evolutionary history and tissue mapping of amino acid transporters belonging to solute carrier families SLC32, SLC36, and SLC38.J Mol Neurosci2008;35:179- 93.

63. Tolosano E,Fagoonee S,Hirsch E,et al.Enhanced splenomegaly and severe liver inflammation in haptoglobin/hemopexin double-null mice after acute hemolysis.Blood2002;100:4201-8.

64. Liang X,Lin T,Sun G,et al.Hemopexin down-regulates LPS-induced proinflammatory cytokines from macrophages.J Leukoc Biol2009;86:229-35.

65. Fagoonee S,Caorsi C,Giovarelli M,et al.Lack of plasma protein hemopexin dampens mercury-induced autoimmune response in mice.J Immunol2008;181:1937-47.

66. Leucci E,De Falco G,Onnis A,et al.The role of the Cdk9/Cyclin T1 complex in T cell differentiation.J Cell Physiol2007;212:411-5.

67. Cho S,Schroeder S,Kaehlcke K,et al.Acetylation of cyclin T1 regulates the equilibrium between active and inactive P-TEFb in cells.EMBO J2009;28:1407-17. Carlisle et al. 10

68. Hiramoto-Yamaki N,Takeuchi S,Ueda S,et al.Ephexin4 and EphA2 mediate cell migration through a RhoG-dependent mechanism.J Cell Biol2010;190:461-77.

69. Iancu CV,Borza T,Choe JY,et al.Recombinant mouse muscle adenylosuccinate synthetase:overexpression, kinetics, and crystal structure.J Biol Chem2001;276:42146-52.

70. Dahan O,Kupiec M.Mutations in genes of Saccharomyces cerevisiae encoding pre-mRNA splicing factors cause cell cycle arrest through activation of the spindle checkpoint.Nucleic Acids Res2002;30:4361-70.

71. Karki S,LaMonte B,Holzbaur EL.Characterization of the p22 subunit of dynactin reveals the localization of cytoplasmic dynein and dynactin to the midbody of dividing cells.J Cell Biol1998;142:1023-34.

72. Aggarwal M,Sommers JA,Morris C,et al.Delineation of WRN helicase function with EXO1 in the replicational stress response.DNA Repair(Amst)2010;9:765-76.

73. Sato Y,Koshioka S,Kirino Y,et al.Role of dipeptidyl peptidase IV(DPP4) in the development of dyslipidemia: DPP4 contributes to the steroid metabolism pathway.Life Sci2010;88:43-9.

74. Futatsumori M,Kasai K,Takatsu H,et al.Identification and characterization of novel isoforms of COP I subunits.J Biochem2000;128:793-801.

75. Demeny MA,Soutoglou E,Nagy Z,et al.Identification of a small TAF complex and its role in the assembly of TAF-containing complexes.PLoSOne2007;2:e316.

76. Dowejko A,Bauer RJ,Muller-Richter UD,et al.The human homolog of the Drosophila headcase protein slows down cell division of head and neck cancer cells.Carcinogenesis2009;30:1678-85.

77. Chow MK,Mackay JP,Whisstock JC,et al.Structural and functional analysis of the Josephin domain of the polyglutamine protein ataxin-3.Biochem Biophys Res Commun2004;322:387-94.

78. Zhang H,Zhang X,Clark E,et al.TET1 is a DNA-binding protein that modulates DNA methylation and gene transcription via hydroxylation of 5-methylcytosine.Cell Res;20:1390-3.

79. Fortier A,Diez E,Gros P.Naip5/Birc1e and susceptibility to Legionella pneumophila.Trends Microbiol 2005;13:328-35.

80. Kato Y,Miyakawa T,Kurita J,et al.Structure of FBP11 WW1-PL ligand complex reveals the mechanism of proline-rich ligand recognition by group II/III WW domains.J Biol Chem2006;281:40321-9.

81. Kou I,Nakajima M,Ikegawa S.Binding characteristics of the osteoarthritis-associated protein asporin.J Bone Miner Metab2010;28:395-402.

82. Kashiwaba S,Kitahashi K,Watanabe T,et al.The mammalian INO80 complex is recruited to DNA damage sites in an ARP8 dependent manner.Biochem Biophys Res Commun2010;402:619-25.

83. Brule H,Elliott M,Redlak M,et al.Isolation and characterization of the human tRNA(N1G37) methyltransferase(TRM5) and comparison to the Escherichia coli TrmD protein.Biochemistry 2004;43:9243-55.

84. Reynard LN,Cocquet J,Burgoyne PS.The multi-copy mouse gene Sycp3-like Y-linked(Sly) encodes an abundant spermatid protein that interacts with a histone acetyltransferase and an acrosomal protein.Biol Reprod2009;81:250-7.

85. Shiffman D,Rowland CM,Louie JZ,et al.Gene variants of VAMP8 and HNRPUL1 are associated with early-onset myocardial infarction.Arterioscler Thromb Vasc Biol2006;26:1613-8. Carlisle et al. 11

86. Sabatel C,Cornet AM,Tabruyn SP,et al.Sprouty1, a new target of the angiostatic agent 16K prolactin, negatively regulates angiogenesis.Mol Cancer2010;9:231.

87. Lee JS,Lee JE,Oh YM,et al.Recruitment of Sprouty1 to immune synapse regulates T cell receptor signaling.J Immunol2009;183:7178-86.

88. Guess J,Burch JB,Ogoussan K,et al.Circadian disruption, Per3, and human cytokine secretion.Integr Cancer Ther2009;8:329-36.

89. Apaf1. http://www.ncbi.nlm.nih.gov/pubmed?Db=gene&Cmd=retrieve&dopt=full_report&list_uids=317.20111.

90. Liu P,Nie S,Li B,et al.Deficiency in a glutamine-specific methyltransferase for release factor causes mouse embryonic lethality.Mol Cell Biol2010;30:4245-53.

91. Magnusson B,Gummesson A,Glad CA,et al.Cell death-inducing DFF45-like effector C is reduced by caloric restriction and regulates adipocyte lipid metabolism.Metabolism2008;57:1307-13.

92. Yonezawa T,Kurata R,Kimura M,et al.Which CIDE are you on?Apoptosis and energy metabolism.Mol Biosyst2011;7:91-100.

93. Huynh KD,Fischle W,Verdin E,et al.BCoR, a novel corepressor involved in BCL-6 repression.Genes Dev 2000;14:1810-23.

94. Nickerson ML,Kostiha BN,Brandt W,et al.UBIAD1 mutation alters a mitochondrial prenyltransferase to cause Schnyder corneal dystrophy.PLoSOne2010;5:e10760.

95. Nordick K,Hoffman MG,Betz JL,et al.Direct interactions between the Paf1 complex and a cleavage and polyadenylation factor are revealed by dissociation of Paf1 from RNA polymerase II.Eukaryot Cell 2008;7:1158-67.

96. Cheeseman IM,Hori T,Fukagawa T,et al.KNL1 and the CENP-H/I/K complex coordinately direct kinetochore assembly in vertebrates.Mol Biol Cell2008;19:587-94.

97. Jin J,Arias EE,Chen J,et al.A family of diverse Cul4-Ddb1-interacting proteins includes Cdt2,which is required for S phase destruction of the replication factor Cdt1.Mol Cell2006;23:709-21.

98. Nemeth MJ,Kirby MR,Bodine DM.Hmgb3 regulates the balance between hematopoietic stem cell self- renewal and differentiation.Proc Natl Acad Sci USA2006;103:13783-8.

99. Gogolevskaya IK,Kramerov DA.4.5SI RNA genes and the role of their 5'-flanking sequences in the gene transcription.Gene2010;451:32-7.

100. RefSeq. http://www.ncbi.nlm.nih.gov/pubmed?Db=gene&Cmd=retrieve&dopt=full_report&list_uids=10078.2010.

101. Hardie DG,Carling D.The AMP-activated protein kinase--fuel gauge of the mammalian cell?Eur J Biochem 1997;246:259-73.

102. Sperandio S,Tardito S,Surzycki A,et al.TOE1 interacts with p53 to modulate its transactivation potential.FEBS Lett2009;583:2165-70.

103. Radichev I,Kwon SW,Zhao Y,et al.Genetic analysis of human Orc2 reveals specific domains that are required in vivo for assembly and nuclear localization of the origin recognition complex.J Biol Chem 2006;281:23264-73. Carlisle et al. 12

104. Oh SP,Seki T,Goss KA, et al.Activin receptor-like kinase 1 modulates transforming growth factor-beta 1 signaling in the regulation of angiogenesis.Proc Natl Acad Sci USA2000;97:2626-31.

105. Mobkl2c R. http://www.ncbi.nlm.nih.gov/pubmed?Db=gene&Cmd=retrieve&dopt=full_report&list_uids=148932.2010.

106. Sowa ME,Bennett EJ,Gygi SP,et al.Defining the human deubiquitinating enzyme interaction landscape.Cell 2009;138:389-403.

107. Liu XS,Li H,Song B,et al.Polo-like kinase 1 phosphorylation of G2 and S-phase-expressed 1 protein is essential for p53 inactivation during G2 checkpoint recovery.EMBO Rep 2010;11:626-32.

108. Holmes RS,Cox LA,VandeBerg JL.Comparative studies of mammalian acid lipases:Evidence for a new gene family in mouse and rat(Lipo).Comp Biochem Physiol Part D Genomics Proteomics 2010;5:217-26.