Appl Entomol Zool DOI 10.1007/s13355-017-0502-3

ORIGINAL RESEARCH PAPER

Identifcation and functional characterization of the sex‑determining gene doublesex in the sawfy, rosae (: )

Shotaro Mine1 · Megumi Sumitani2 · Fugaku Aoki1 · Masatsugu Hatakeyama3 · Masataka G. Suzuki1

Received: 19 April 2017 / Accepted: 18 May 2017 © The Author(s) 2017. This article is an open access publication

Abstract Sexual fate of the sawfy, Athalia rosae (Hyme- showed abnormalities in testes and seminal vesicles and noptera: Tenthredinidae) is determined by the complemen- lacked mature sperm. The present study provides the frst tary sex determination (CSD) mechanism as is the case in direct evidence that dsx is essential for sexual development honeybees. However, to date, genes involved in sex deter- in hymenopteran species. mination have not been identifed in this species. In this study, we attempted to identify orthologs of complementary Keywords Hymenoptera · Athalia rosae · Sex sex-determiner (csd), feminizer (fem), and doublesex (dsx) determination · Doublesex · Genitalia from the A. rosae genome, all of which are crucial compo- nents of the sex determination cascade in the honeybee. As a result, we identifed a sawfy ortholog of dsx (designated Introduction as Ardsx). Rapid amplifcation of cDNA ends (RACE) using total RNA extracted from male and female larvae In several hymenopteran , sexual fate is determined identifed three male-specifc variants and three female- by the complementary sex determination (CSD) mecha- specifc variants. Comparison between the full-length nism, in which heterozygosity at a single locus (the CSD Ardsx cDNAs and the genomic sequence revealed that exon locus) determines femaleness in diploid individuals, while 5 was differentially spliced between the male- and female- haploid individuals are hemizygous for the CSD locus and specifc variants. RT-PCR analysis demonstrated that Ardsx thus develop into males (Whiting 1933). The CSD locus pre-mRNA was spliced alternatively in a sex-dependent was frst molecularly identifed in the honeybee Apis mel- manner at almost all the developmental stages. RNAi- lifera and found to be a homolog of transformer (tra) mediated knockdown of Ardsx in males caused severe (Beye et al. 2003). The tra gene is known to be a conserved defects in the reproductive organs and, notably, induced upstream component of the sex determination cas- development of the ovipository apparatus containing the cade and induces female development by regulating sex- dorsal pair of blades and the sheath. These males also specifc alternative splicing of downstream targets such as doublesex (dsx) (Gempe and Beye 2011; Hoshijima et al. 1991). A. mellifera has two copies of tra homologs (Has- * Masataka G. Suzuki [email protected]‑tokyo.ac.jp selmann et al. 2008). One copy is named complementary sex-determiner (csd) that is the primary signal for female- 1 Department of Integrated Biosciences, Graduate School ness. It activates the other copy, named feminizer (fem), of Frontier Sciences, The University of Tokyo, 5‑1‑5 which is more conserved and retains the ancestral function Kashiwanoha, Kashiwa‑shi, Chiba 277‑8562, Japan of regulating sex-specifc alternative splicing dsx. The csd 2 Genetically Modifed Organism Research Center, was considered to have arisen from duplication of the fem National Institute of Agrobiological Sciences, Owashi, Tsukuba 305‑8634, Japan gene (Schmieder et al. 2012). Orthologs of csd and fem have been identifed not only in 3 Division of Insect Sciences, National Institute of Agrobiological Sciences, Owashi, Tsukuba 305‑8634, honeybee species but also in bumblebees and ants (Privman Japan et al. 2013; Schmieder et al. 2012). Evolutional analyses

1 3 Appl Entomol Zool demonstrate that the duplication of fem that yielded csd their gonads and genitalia (Hatakeyama et al. 1990a, b; occurred before the divergence of Aculeata species (bees Oishi et al. 1995). The male genitalia form a well-organ- and ants), and also provide evidence that these two genes ized capsule, in repose retracted within the apical segments evolved concertedly through gene conversion. On the basis of the abdomen, as those reported in other sawfy species of these fndings, it is supposed that csd likely represents (Schulmeister 2003). In particular, the genitalia of females the molecular basis for the CSD mechanism in the Aculeata consist of a unique ovipository apparatus with a saw tooth- species and, possibly, in the entire Hymenoptera order. like structure, which is characteristic for the sawfy species To verify this hypothesis, it is quite important to know (Ross 1945). Classical genetic analysis demonstrates that whether hymenopteran species, which are more primitive sexual fate in this species is also determined by the single- than Aculeata species, also have csd and fem orthologs. locus CSD system (Naito and Suzuki 1991). The number The sawfy, Athalia rosae (Hymenoptera: Tenthredinidae), of alleles at this locus in a feld population calculated by belongs to the Symphyta infra-order, which is the most random crossing is 40–50 (Fujiwara et al. 2004). However, primitive infra-order in Hymenoptera (Fig. 1a, b). Adults to date, genes involved in sex determination and sexual dif- of this species show signifcant sexual dimorphisms in ferentiation have not been identifed in this species.

Fig. 1 Identifcation of a dsx ortholog from A. rosae. Photographs of of six blast hits on the query sequence is described. One predicted a last-instar larva (a) and adult male (b) of Athalia rosae. Scale bars gene (NCBI accession number XM_012406840.1) showed signifcant indicate 2 mm. A tblastn search of the NCBI database was performed, similarities to female-specifc AmDSX isoform, ­AmDSXF1 (c) and specifying an A. rosae dataset, using the full amino acid sequence of male-specifc AmDSX isoform, ­AmDSXM (d) DSX in Apis mellifera (AmDSX) as a query sequence. Distribution

1 3 Appl Entomol Zool

The whole genome sequencing (WGS) and assem- provided by the manufacture. A homogenization pestle bly of Athalia rosae were conducted by the i5K Initiative (Funakoshi) was used for homogenizing samples. Total (Baylor College of Medicine, https://www.hgsc.bcm.edu/ RNA extracted from samples during embryonic stage to /turnip-sawfy-genome-project) and the assem- young larval stages (2 days after hatching) were precipi- bled data was submitted to the NCBI database in 2013 tated by addition of 1 μl of glycogen (20 mg/mL, Wako (GenBank assembly accession number GCA_000344095.1 Junyaku) per sample. RT-PCR reactions were performed Aros_1.0). Sequencing depth and coverage are highly according to the protocol described previously (Suzuki suffcient (genome coverage 467.2 ), and statistics of et al. 2012). The ArEF1-LP and ArEF1-RP primers were × the assembly (number of scaffolds 522; number of con- used to amplify A. rosae elongation factor-1 alpha (EF-1) tigs 7588; contig N50, 51,418; contig L50, 825) shows (NCBI accession number AB253792) as a positive con- that the quality of the Athalia rosae genome assembly is trol for the RT-PCR reaction. The primer sequences uti- good enough for sequence analyses. By using this Ath- lized in this study are indicated in Table 1. PCR products alia rosae WGS data, here, we attempted to identify csd, were analyzed on a 2% agarose gel and visualized with fem, and dsx orthologs from the A. rosae genome to gain ethidium bromide. insights into whether the molecular mechanism for the sex determination observed in Aculeata species is conserved in Quantitative real‑time RT‑PCR Symphytan species. As a result, we successfully identifed a sawfy ortholog of dsx, but failed to fnd genes homolo- qRT-PCR assays were performed according to the pro- gous to csd and fem in the honeybee, Apis mellifera. The tocol described previously (Suzuki et al. 2012). The dsx ortholog was designated as Ardsx and its functions in ArEF1-LP and ArEF1-RP primers were used to amplify sexual differentiation were assayed by RNAi analysis. Here elongation factor-1 alpha (EF-1) as an internal standard we provide several lines of evidence that Ardsx is necessary for quantifcation. All primer sequences used in the qRT- for male development in the sawfy. PCR assays are listed in Table 2.

Rapid amplifcation of cDNA ends (RACE) Materials and methods RACE was performed on the basis of previous protocols Insect (Suzuki et al. 2010), except that the cDNA templates were prepared from whole bodies of pupae. All primer The wild-type sawfies (Athalia rosae) and several mutant sequences used in RACE are listed in Table 3. strains cream eye color (cec), short wing (sw), and yellow fat body (yfb), which had been kept at the National Agri- Preparation of dsRNAs culture and Food Research Organization, were used in this study. General biology of A. rosae is described in Oishi Two sequences conserved between the Ardsx isoforms were et al. (1993). were reared continuously at 25 °C amplifed with primer pairs ArdsxdsRNAF1-ArdsxdsR- under 16 h light, 8 h dark conditions. The eggs were stored NAR1 and ArdsxdsRNAF2-ArdsxdsRNAR2 (Table 4), and in plastic containers with suffcient humidity, and we used they served as a DNA template for double-stranded RNA Japanese radish leaves (Sakata no tane) for larval feed. A (dsRNA) synthesis. Each primer contained a T7 promoter hydroponic culture kit (Green Farm) was used for cultiva- site. The dsRNA synthesis was performed according to the tion of the Japanese radish leaves. The cec gene is involved protocol described previously (Suzuki et al. 2012). in pigmentation of eye, and animals homozygous for cec display cream-eye color (Lee et al. 1998). Adult wings of animals homozygous for sw become atrophied. Animals Table 1 Primer sequences and PCR conditions utilized in this study homozygous for yfb have fat bodies with yellow color Target gene Primers Sequence (5′ 3′) (Sawa and Oishi 1989). On the basis of the phenotype of → the recessive inheritance trait described above, we discrimi- Ardsx ArdsxFMF1 AAAGATGCACAAGCCGATTTG nated diploid females from fertilized eggs from haploid ArdsxFMR1 GGCTGATGAACAAGGCTCATC males from unfertilized eggs. Ardsx1 CATAATGGATCAAAACGACAAC Ardsx2 GACGTGATTATCCCGATAAAT RNA extraction and RT‑PCR Ardsx7 TTATCCCGATAAATCG- TATAAATCTTC EF-1 ArEF1-LP CTTCACTCTTGGTGTCAAGCAGCTC Extraction of total RNA was performed using ISOGEN ArEF1-RP ACATCCTGAAGAGGAAGACGGAGAG (Nippon Gene, Tokyo, Japan) according to the protocol

1 3 Appl Entomol Zool

Table 2 Sequences of primers used for qRT-PCR by pulling a 25-μl Microcaps (Drummond) and cutting Target gene Primers Sequence (5′ 3′) the tip, was connected to a 1-ml plastic syringe. dsRNA → was injected into the dorsal hemocoel in the second Ardsx Ardsx real-time F1 GCGGGTCAAATGGATTCCAAC abdominal segment of the larva. Synthesized dsRNA was Ardsx real-time GCCCTTCTGAGTGCAGTTTGC adjusted to a fnal concentration of 1 mg/ml, and injected R1 at 3 mg per individual. EF-1 ArEF1-LP CTTCACTCTTGGTGTCAA- GCAGCTC ArEF1-RP ACATCCTGAAGAGGAAGACG- Phylogenetic analysis of Ardsx GAGAG Multiple alignment analysis of the complete amino acid sequences of Ardsx and known doublesex orthologs was Table 3 Sequences of primers used for RACE performed using Clustal X 2.0.11 (http://www.softpedia. Target gene Primers Sequence (5′ 3′) com/get/Science-CAD/Clustal-X.shtml) with the follow- → ing settings (pairwise alignment parameters: gap opening Ardsx ArdsxRACEF1 ACTGCAACTGCTATTCGCCG- penalty 17.00, gap extension penalty 0.2, identity pro- TATCG tein weight matrix; multiple alignment parameters: gap ArdsxRACER1 CCGAACGTGGGTCCACCT- GTTCTTC opening penalty 17.00, gap extension penalty 0.2, delay ArdsxRACEF2 CGCAGTGATATGTGCAGCA- divergent cutoff 30%, identity protein weight matrix). GAATCG Matrices of amino acid p distances were calculated using ArdsxRACER2 GCAGTTTGCAGCGCCAT- the program MEGA version 4.0. A comparative phyloge- AACTCTTTG netic tree was produced using the amino acid p distance ArdsxRACEF3 GCGCCATTTTGGCCTGTCGA- method and the neighbor-joining algorithm with a boot- TAATAC strap value of 1000. ArdsxRACER3 CAACGCGCACAATTCGGTG- GTGTAC Ardsx4-2F1 CGTCGCGCGTTTTCAAAAGAC Observation of internal and external genital organs Ardsx3-2F1 GCTGTGTGGTCGTCGTTCAAG Ardsx3-3F1 ACACTCTGCCGCATGCATTTC When preparing cuticle specimens of external genitalia, Ardsx3-1F1 GAGTTACCGACTGCATGGAAG dissection was performed in 70% ethanol. The genita- Ardsx4-1F1 AGTTTGATACGGCTACCGTTC lia were trimmed and then dehydrated in 100% ethanol. Ardsx3-5F1 TTGGTGGCAATTGACTGAAAG The trimmed genitalia were put in a mixed solution of Ardsx3-6F1 CGCGCATCGGAGGTTCGCAAC Canada balsam and methyl salicylate on a microscope slide, and covered with a glass coverslip to make cuti- cle specimens. The specimens were kept at 60 °C for Injection of dsRNAs into insects 24 h, and observed under a stereoscope (Olympus SZX 7). To capture images, a CCD camera (Olympus DP 7) The larvae and pupae were anesthetized by chilling for mounted on the stereoscope was used. The images were 30 min in a plastic container placed in an ice bath (Yoshi- analyzed with CellSens standard software (Olympus). yama et al. 2013). Individuals receiving injection were Adult gonads and internal reproductive organs were dis- sected out immediately after emergence in 1 PBS. The left on an ice pack during the injection procedure. Injec- × tion was performed using a handmade injection apparatus dissected organs were observed using the stereoscope as (Hatakeyama et al. 1990a, b): a fne glass needle, made described above.

Table 4 Sequences of primers used for synthesis of dsRNA

Target gene Primers Sequence (5′ 3′) → Ardsx ArdsxdsRNAF1 CCGGATCCTAATACGACTCACTATAGGGCGGAAGAACAGGTGGACCCAC ArdsxdsRNAR1 CCGGATCCTAATACGACTCACTATAGGGCGCAATTCGTCGAGATGCTTC ArdsxdsRNAF2 CCGGATCCTAATACGACTCACTATAGGGCGCTGACTTCACTGCTGCAGCGC ArdsxdsRNAR2 CCGGATCCTAATACGACTCACTATAGGGCGCAACGGAGCTAATCTCTGAAC

1 3 Appl Entomol Zool

Results of approximately 1200 bp, which was larger than the expected size (Fig. 2a, lane 1). Similar results were Homology‑based search of sex‑determining genes obtained when the RT-PCR was performed with primers from Athalia rosae genome dsx1 and dsx7, which were designed to amplify a 1018- bp cDNA fragment (Fig. 2a, lanes 3 and 4). These RT- Genetic analysis demonstrates that sexual fate in A. rosae PCR products were cloned and sequenced. The sequences is determined by the single-locus CSD system (Naito of the DNA fragments amplifed from females were iden- and Suzuki 1991). To investigate whether the molecular tical to that of XM_012406840.1, while the PCR prod- basis for the sex-determining mechanism of this insect is ucts obtained from males were found to contain an inser- the same as those reported in honeybee species, a tblastn tion of 119 bp sequence (Fig. 2b). A blastn search of the search of the NCBI database was performed, specifying A. rosae genome sequence (Version GCA_000344095.1 an A. rosae dataset containing 22,130 of gene models, Aros_1.0) revealed that scaffold 11 contained the region using the full amino acid sequence of CSD, FEM, and encoding the whole sequence of the aforementioned DSX in Apis mellifera as a query sequence. As a result, cDNAs, which spanned at least 15 kb. Comparison we were not able to fnd any sequences with signifcant between the cDNAs and the genomic DNA sequence homology to CSD and FEM. On the other hand, the demonstrated that the 119-bp fragment was derived from tblastn search retrieved one predicted gene (NCBI acces- a single intronic sequence. Thus we concluded that inclu- sion number XM_012406840.1) with signifcant higher sion of this intron in the pre-mRNA processing yields similarity (hit score >200, E value

1 3 Appl Entomol Zool

dsx1/dsx2 dsx1/dsx7 A bp

Ardsx

EF-1

Lane 12 34 B

female CATAATGGAT CAAAACGACA ACATTTTAGC GGGTCAAATG GATTCCAACG CTTCGTCGTC GAACGCAGCG CTGAGTCCAC male CATAATGGAT CAAAACGACA ACATTTTAGC GGGTCAAATG GATTCCAACG CTTCGTCGTC GAACGCAGCG CTGAGTCCAC female GTACACCACC GAATTGTGCG CGTTGTAGAA ATCATAGACT AAAAATAGCA CTCAAGGGAC ACAAGAGATA CTGCAAATAC male 81" GTACACCACC GAATTGTGCG CGTTGTAGAA ATCATAGACT AAAAATAGCA CTCAAGGGAC ACAAGAGATA CTGCAAATAC female CGTAGCTGTA ATTGCGAGAA GTGTAGGTTG ACCGCGGAAC GGCAAAGAGT TATGGCGCTG CAAACTGCAC TCAGAAGGGC male CGTAGCTGTA ATTGCGAGAA GTGTAGGTTG ACCGCGGAAC GGCAAAGAGT TATGGCGCTG CAAACTGCAC TCAGAAGGGC female GCAGGCCCAG GACGAAGCCA GGGTTCGGGG CCCGGAAGAA CAGGTGGACC CACGTTCGGT GGTAGTTGAA GGTGATCGTT male GCAGGCCCAG GACGAAGCCA GGGTTCGGGG CCCGGAAGAA CAGGTGGACC CACGTTCGGT GGTAGTTGAA GGTGATCGTT female TGATATCAGT TCCTCAACCT GCGGAAAGAA TTAGTTTAGA AGGTAGTTGT GACAGTAGCA GCGGAGGTTC GCCAGCGAGT male TGATATCAGT TCCTCAACCT GCGGAAAGAA TTAGTTTAGA AGGTAGTTGT GACAGTAGCA GCGGAGGTTC GCCAGCGAGT female AATCATGACA GTAACGGTGG ACACAGCGGT ATCGGTGGAC CGATCGTTAC GATACCAACG TCCCAGAAAT TGCCGCCTAT male AATCATGACA GTAACGGTGG ACACAGCGGT ATCGGTGGAC CGATCGTTAC GATACCAACG TCCCAGAAAT TGCCGCCTAT female CTACCCCCAC GCGGCTGCAG CGGCGTACCT ACCCCAACGA CGAAACGGTG AAAATATCGA AGTATTACTC GAGTACAGTA male CTACCCCCAC GCGGCTGCAG CGGCGTACCT ACCCCAACGA CGAAACGGTG AAAATATCGA AGTATTACTC GAGTACAGTA female CGACACTGTT GCAGAGATTT CGATACCCTT GGGAAATGTT ACCTCTGATG CTCGTTATCC TGAAAGATGC ACAAGCCGAT male CGACACTGTT GCAGAGATTT CGATACCCTT GGGAAATGTT ACCTCTGATG CTCGTTATCC TGAAAGATGC ACAAGCCGAT female 641 TTGGAAGAAG CATCTCGACG AATTGCGGAA G------male TTGGAAGAAG CATCTCGACG AATTGCGGAA GGTAAGCTCG GTGGATTGAT TTTTTTCATT AATTAACGAG ACTCTATATG female CTGACTTCAC male ACCGAGAGTC AGGTATACCT TCATCAGATA ATTGAAATAC GAAATTCTAT AGATCCTGTA TAAATTTCAG CTGACTTCAC female TGCTGCAGCG CGGTCTGAAA TTATTTATTT TATCGCGCCA TTTTGGCCTG TCGATAATAC CGAAAAAAAT GATGAGCCTT male TGCTGCAGCG CGGTCTGAAA TTATTTATTT TATCGCGCCA TTTTGGCCTG TCGATAATAC CGAAAAAAAT GATGAGCCTT female GTTCATCAGC CATTTGCAGA TTGCTGCATT TCTCGCGCGA TGAATGTAAA ATTTTTTGCA TGATCTTCTC GTATTTTCTA male GTTCATCAGC CATTTGCAGA TTGCTGCATT TCTCGCGCGA TGAATGTAAA ATTTTTTGCA TGATCTTCTC GTATTTTCTA female TACACTGCAA CTGCTATTCG CCGTATCGCA GTGATATGTG CAGCAGAATC GATAAAATTT CACTTTTTCT CAATCCGCCG male TACACTGCAA CTGCTATTCG CCGTATCGCA GTGATATGTG CAGCAGAATC GATAAAATTT CACTTTTTCT CAATCCGCCG female TTACCGTATG AGTCGGAGTA ACGTTCAATA TCGAATCAAA CATCGTCTGG AAGATTACAA AAGCATCAAT GAAGATTTAT male 104 TTACCGTATG AGTCGGAGTA ACGTTCAATA TCGAATCAAA CATCGTCTGG AAGATTACAA AAGCATCAAT GAAGATTTAT female ACGATTTATC GGGATAATCA C male ACGATTTATC GGGATAATCA C

Fig. 2 RT-PCR analysis of Ardsx expression in male and female shows Ardsx expression. The bottom panel shows amplifcation of the pupae. a RT-PCR for expression pattern analysis of Ardsx mRNAs Ar EF-1 alpha (EF-1) transcript, which served as a positive control with primers that were designed on the basis of the nucleotide for RNA extraction and RT-PCR. PCR products were separated on sequence of the predicted gene (XM_012406840.1) using cDNAs 2% agarose gels and stained with ethidium bromide. Molecular sizes, prepared from male and female pupae. Expected size of amplifed presented in base pairs, are indicated to the right of each panel. b product using a primer pair dsx1 and dsx2 is 1025 bp, whereas a Comparison of nucleotide sequences of RT-PCR products amplifed primer pair dsx1 and dsx7 is expected to amplify 1018 bp of the DNA from male and female larvae. Dashes show alignment gaps. Nucle- fragment. The approximate location of the primers (Ardsx1, Ardsx2, otides identical between both sexes are shaded black. Numbering is and Ardsx3) are described by red arrows in Fig. 3a. The upper panel relative to the 5′ end of each of the RT-PCR product

ArdsxF3 also encode the protein with an identical sequence acid sequence of the C-terminal part shows difference of 337 amino acids (ArDSX­ F). ArDSX­ M and ArDSX­ F share between ArDSX­ M and ArDSX­ F (Fig. 4a). an N-terminal region of 222 amino acids that encodes a Phylogenetic analysis using the full amino acid conserved DNA-binding domain called DM domain (or sequence of ­ArDSXF indicated that the identifed OD1 domain) and part of a conserved dimeriztion domain sequence from A. rosae was grouped with other hyme- known as OD2 domain, which is specifcally conserved nopteran DSX proteins (Fig. 4b). These results strongly among DSX proteins (Price et al. 2015) (Fig. 4a). Amino suggest that Ardsx is a dsx ortholog of A. rosae.

1 3 Appl Entomol Zool

A ATG Stop 1a 2345 M1 358 106 371 276 247 179 347 764 Ardsx 973 235 335 9707 1b ArdsxM2 40 106 276 247 179 347 764 899 371

ArdsxM3 137 276 247 179 347 764 Ardsx1 ArdsxFMF1 ArdsxFMR1 Ardsx2 Ardsx7

ATG Stop 1a 23455a b ArdsxF1 358 106 371 276 247 144 347 333 973 235 335 9707 119 1b F2 Ardsx 40 899 106 371 276 247 144 347 333

ArdsxF3 137 276 247 144 347 333 Ardsx1 ArdsxFMF1 ArdsxFMR1 Ardsx2 Ardsx7 B Male egg larva day adul t 012340123456 pupa Ardsx M1~M3 Ardsx F1~F3 EF-1

Female egg larva day adul t 0123401234567 pupa Ardsx M1~M3 Ardsx F1~F3 EF-1

Fig. 3 Structures of the Ardsx splicing variants obtained by RACE lized eggs served as females, and individuals hatched from partheno- and sexual difference in the expression pattern of Ardsx. a Upper genetic eggs served as males. For embryonic stages, total RNA was panel shows the three male-specifc Ardsx transcription variants (Ard- extracted from a single egg at day 0, day 1, day 2, day 3, and day 4 sxM1, ArdsxM2, and ArdsxM3) and lower panel indicates three female- after oviposition or parthenogenetic treatment. For larval stages, total specifc Ardsx transcription variants (ArdsxF1, ArdsxF2, and ArdsxF3) RNA was extracted from a single at day 0–day 6 after hatch- obtained by RACE. Boxes represent exons and lines are introns. Only ing for males, and at day 0–day 7 after hatching for females since the exons are drawn to scale. The white regions indicate UTRs. The black larval period of females was 1 day longer than that of males. Total regions indicate ORFs. The numbers shown above the box are exon RNA was also isolated from a pupa at day 7 after pupation and an numbers. The number indicated in each region describes the size in adult at day 5 after emerging. Bottom panel shows the results of RT- base pairs. ATG sites and stop codons are indicated. The red arrows PCR amplifcation of the EF-1 transcript, which served as a posi- show the approximate position of the primers (Ardsx1, Ardsx2, and tive control for the RT-PCR reaction. PCR products were analyzed Ardsx3) used for RT-PCR analysis illustrated in Fig. 2a. The black on a 2% agarose gel. Arrows to the left of the gel refer to position arrows indicate the approximate location of the primers (ArdsxFMF1 of female and male specifc-isoforms of Ardsx (ArdsxF1–F3 and Ard- and ArdsxFMR1) that were used for RT-PCR described in b. b Sexual sxM1–M3). Molecular sizes, presented in base pairs, are indicated to the difference in the expression pattern of Ardsx mRNA was assessed by right of each panel RT-PCR with primers described in a. Individuals hatched from ferti-

1 3 Appl Entomol Zool

A DM domain ArDSXF 1 80 ArDSXM 1 80

ArDSXF 81 160 ArDSXM 81 160 Dimerization domain ArDSXF 161 240 ArDSXM 161 233

ArDSXF 241 320 ArDSXM 233 233

ArDSXF 321 337 ArDSXM 233 233

.05 B Daphnia agna Crustacean Nasonia vitripennis

Atharia rosae Hymenoptera 100 Apis mellifera

Bombyx mori 100 97 Antheraea assama Lepidoptera 98 Ostrinia scapulalis

Onthophagus taurus 100 100 Gnatocerus cornutus 100 Coleoptera Tribolium castaneum

100 Megaselia scalaris

Musca domestica 98 Bactrocera tryoni Diptera 100 100 100 Ceratitis capitata

Drosophila melanogaster

Fig. 4 Amino acid sequence of ArDSX and phylogeny of ArDSX gus taurus (AEX92939), ­DSXF proteins from Nasonia vitripen- with other insect DSX proteins. a Amino acid sequence compari- nis (NP_001155990), Ostrinia scapulalis (BAJ25852), Antheraea son between ­ArDSXF and ­ArDSXM. Dashes show alignment gaps. assama (ADL40852), Gnatocerus cornutus (BAW32685), Tribo- Amino acids identical between both proteins are shaded black. The lium castaneum (AFQ62106), Megaselia scalaris (AAK38831), blue and the green lines indicate DM domain and dimerization Musuca domestica (AAR23812), Bactrocera tryoni (AAB99948), domain, respectively. b A comparative phylogenetic tree was pro- Ceratitis capitata (AAN63598), and Drosophila melanogaster duced using the complete amino acid sequences of ­ArDSXF and 14 (NP_001287220). Bootstrap values for 1000 replicate analyses are other known proteins, including DSX beta protein from Daphnia shown at the branching points. The bar below the tree indicates the magna (BAJ78308), ­DSXF1 from Apis mellifera (ABW99105), BmD- branch length representing the mean number of differences (0.05) per SXF from Bombyx mori (NP_001036871), ­DSXF1 from Onthopha- residue along each branch

Expression analysis of Ardsx difference in the expression pattern of Ardsx mRNA changes according to the developmental stages, RT-PCR analysis was As shown above, exon 5 of Ardsx was differentially spliced performed using cDNAs prepared from males and females at between two sexes, resulting in the male-specifc insertion of the different stages with primers that specifcally anneal to the 119-bp fragment (Fig. 3a). To investigate whether sexual the regions fanking the 119-bp fragment (Fig. 3b).

1 3 Appl Entomol Zool

As a result, the amplifcation product of 269 bp was 269 bp corresponded to the male-specifc Ardsx isoforms observed in males at all the examined stages (Fig. 3b). identifed by RACE, while the RT-PCR product of 150 bp On the other hand, the same RT-PCR amplifed the had a nucleotide sequence identical to that of the corre- 150-bp DNA fragment in females throughout the exam- sponding region in the female-specifc Ardsx isoforms. ined stages. In females, the 269-bp DNA fragment was These results clearly demonstrate that Ardsx pre-mRNA weakly detectable until 4 days after hatching. After that, is spliced alternatively in a sex-dependent manner. How- the DNA band gradually disappeared with a concomitant ever, in females, sex-specifcity of the splicing is less increase in the amplifcation level of the 150-bp DNA accurate until middle larval stages, yielding the male- fragment. After cloning of these amplifed products and specifc Ardsx in addition to the female-specifc Ardsx sequencing the cloned DNA, the amplifed product of isoforms.

Fig. 5 Effects of RNAi-mediated knockdown of Ardsx on sexual Ardsx2 (f), the negative control female (g), and Ardsx knockdown development. a Schematic diagram of two dsRNAs (Ardsx1 and female injected either with Ardsx1 (h) or Ardsx2 (i). Sa saw, Vb ven- Ardsx2) targeting Ardsx mRNA. b Quantifcation of Ardsx mRNA tral pair of blades, Db dorsal pair of blades, Sh sheaths, S9 ninth ster- expression 1 day after injection by qRT-PCR. EF-1 served as an inter- nite, Cu cuspis, He herpe, Pp parapenis, Pv penis valve; *abnormal nal standard. Error bar standard deviation (SD); *signifcant differ- tissue specifcally observed in Ardsx knockdown males. Morpholo- ences at the 0.05 level (t test) compared with the control. c Ventral gies of testes and internal reproductive organs dissected out from view of the abdominal segments of the negative control male (left), the control male (j) and Ardsx knockdown male injected either with Ardsx knockdown male (middle), and the negative control female Ardsx1 (k) or Ardsx2 (l). Ts testis, Sv seminal vesicle, Ag accessory (right). Ventral view of the external genitalia in the negative control gland male (d), Ardsx knockdown male injected either with Ardsx1 (e) or

1 3 Appl Entomol Zool

Functional analysis of Ardsx Discussion

In order to analyze the function of Ardsx, we investigated Despite the previous fnding that sexual fate in A. rosae the effects of Ardsx knockdown on sexual developments. is determined by the single-locus CSD system (Naito Two different dsRNAs (Fig. 5a, Ardsx1 and Ardsx2), and Suzuki 1991), we could not fnd genes showing sig- both of which targeted to a region common between nifcant homology to csd and fem in the A. rosae genome, Ardsx isoforms, were injected into larvae at the wan- both of which are core components for the honeybee dering stage. qRT-PCR analysis confrmed a signifcant CSD system. The csd was considered to have arisen from reduction in Ardsx mRNA level in males and females duplication of the fem gene (Schmieder et al. 2012) that injected with Ardsx1 (Fig. 5b). Similar results were is a tra homolog found in honeybees and other Aculeata observed when males and females were injected with species (Privman et al. 2013; Schmieder et al. 2012). To Ardsx2 (data not shown). Morphological analysis of adult date, the tra gene has been identifed not only in hyme- phenotypes demonstrated that negative control males and nopteran species but also in dipteran and coleopteran females, which were injected with dsRNA targeting the species. On the other hand, several previous studies and EGFP gene, had normal genital organs as observed in recent genome-wide analysis in a wide range of insect wild-type adult males and females (Fig. 5c, d, g). On the species revealed that tra shows a distinctly patchy distri- other hand, Ardsx knockdown males (Ardsx KD males) bution among insects (Geuverink and Beukeboom 2014). injected with Ardsx1 had external genital organs whose For example, no tra homologs have been identifed in shapes were very similar to those observed in the control lepidopteran insects including Bombyx mori, Danaus females (Fig. 5c). Normal females have external genitalia plexippus, and Heliconius melpomene (Geuverink and that contain an ovipository apparatus consisting of two Beukeboom 2014; Mita et al. 2004). One of the coleop- pairs of valvifers, which give rise to the other parts: a saw teran species, Tribolium castaneum, carries a tra ortholog formed by two pairs of blades (a ventral pair of blades (Shukla and Palli 2012), while the tra gene has to date derived from the frst valvifers and a dorsal pair of blades not been found in the genome of coleopteran Dendrocto- derived from the second valvifers); and a sheath com- nus ponderosae (Geuverink and Beukeboom 2014). Men- posed of a pair of appressed end segments of the second genilla moldrzyki that belongs to Strepsiptera, which is valvifers (Ross 1945) as represented by Fig. 5g. The gen- a sister order of the Coleoptera, appeared to lack a tra italia observed in the Ardsx KD males contained several homolog (Geuverink and Beukeboom 2014). The most imcomplete parts of the ovipository apparatus including interesting pattern of tra distribution is seen in the Dip- the dorsal pair of blades and the sheath, both of which tera genus. The tra gene is found in brachycera species are derived from the second valvifers (Fig. 5e). Differing including D. melanogaster, while several mosquito spe- from the normal female genitalia, Ardsx KD male geni- cies, which belong to a basal dipteran lineage, do not talia lacked the ventral blades but instead contained an possess tra (Geuverink and Beukeboom 2014). These abnormal tissue with a saw tooth-like structure. Morpho- facts imply multiple independent losses or recruitment logical analysis of internal reproductive organs revealed of tra into the sex determination cascade. It would be that these Ardsx KD males showed abnormal (Fig. 5k). possible that A. rosae, which belongs to the most primi- Moreover, the seminal ducts looked thicker than those of tive infra-order in Hymenoptera, may not possess tra the control male. The seminal vesicle flled with mature orthologs. It is well known that upstream components sperms in the control male (Fig. 5j) was not observed in of the sex determination cascade are highly evolutionar- the Ardsx knockdown males (Fig. 5k). Similar morpho- ily labile (Wilkins 1995). For example, in mosquito spe- logical abnormalities were observed in Ardsx KD males cies, Aedes aegypti and Anopheles gambiae, maleness is injected with Ardsx2 (Fig. 5f, l). determined by a dominant Y chromosome-linked M fac- Ardsx knockdown females injected either with Ardsx1 tor, but the gene encoding the M factor is completely dif- or Ardsx2 were also subjected to the same analyses but ferent between these two species. Nix, which is a distant their external genitalia showed the same phenotype as homolog of tra-2, functions as an M factor in A. aegypti, those observed in the control females (Fig. 5h, i). All while Yob, which seemed to encode a short amino acid the examined Ardsx KD females had normal ovaries and protein that may contain a helix-loop-helix motif, acts as internal reproductive organs and fertile (data not shown). an M factor in A. gambiae (Hall et al. 2015; Krzywin- These results suggest that expression of Ardsx during ska et al. 2016). In the sawfy, a gene responsible for the the pupal stage is essential for normal sexual develop- CSD system might be different from those identifed in ment in the male external genitalia and that its expres- multiple Aculeata species. However, we cannot rule out sion is also important for testis and seminal vesicle the possibility that our homology-based search using the development.

1 3 Appl Entomol Zool tblastn program provided by NCBI may be inappropriate reproductive organs were normal in appearance (Hatakey- for identifying tra orthologs such as csd and fem from the ama et al., unpublished data). If Abd-B in A. rosae also A. rosae genome because of its less conserved sequences produces abdominal segment-specifc isoforms like Abd- among groups. Bm and Abd-Br, then Abd-Bm in A. rosae may be able In this paper, we provided several lines of evidence that to facilitate the development of the ovipository apparatus a homolog of the dsx gene, named Ardsx, is also present including the dorsal pair of blades and the sheath without in the A. rosae genome (Figs. 1c, d, 4b), and showed that the help of ­ArDSXF since these organs were observed in Ardsx is transcribed into sex-specifc mRNA isoforms Ardsx knockdown adults with almost complete phenotypes; as a result of sex-specifc alternative splicing (Figs. 2, 3). whereas, concerted action of ­ArDSXF with Abd-Br may be The Ardsx mRNAs produced in males and females encode necessary for the development of the ventral pair of blades. polypeptides sharing common N-terminal sequences but It is further postulated that ­ArDSXM together with Abd- differing in C-terminal sequences (Fig. 4a), similar to the Bm represses the development of the ovipository appara- dsx orthologs identifed in the honeybee and other multiple tus, resulting in the formation of the ninth sternite covering insect species. Concerning this point, it is presumed that the copulatory organ (“9S” in Fig. 5d), and that ­ArDSXM Ardsx would take a splicing pattern similar to the honeybee plus Abd-Br promotes the development of the male copu- dsx (Amdsx), but the following two points are signifcantly latory organs. These hypotheses can explain the reason different: (1) Ardsx does not have a female-specifc exon. why the Ardsx knockdown males had the ovipository appa- In A. mellifera, the single female-specifc exon in AmdsxF1 ratus, which lacked the ventral pair of blades but instead is skipped in the male variant (AmdsxM), resulting in the had the abnormal tissue with a saw tooth-like structure. fnal two exons being shared between AmdsxF1 and Amd- It would be expected that Abd-Br alone was not able to sxM (Cho et al. 2007). Similar sex-specifc splicing pattern induce the development either of the ventral pair of blades is reported in B. mori dsx (Suzuki et al. 2001). In A. rosae, or the copulatory organs, resulting in the formation of the the male-specifc Ardsx contained a stop codon located in abnormal tissue in Ardsx knockdown males. If so, then the the middle of exon 5, while the region of 119 bp includ- knockdown of Ardsx should also cause some morphologi- ing the stop codon is skipped in the female-specifc Ardsx cal defects in the ventral pair of blades in Ardsx knockdown isoforms (Fig. 3a). In other words, Ardsx has a female- females. However, the Ardsx knockdown females exhibited specifc intron. (2) In all the dsx orthologs so far character- normal phenotype in their ovipository apparatus (Fig. 5h, ized, skipping of an exon including a female-specifc stop i). One possible explanation for these results is that insuf- codon is seen only in males, whereas in A. rosae, skipping fcient level of knockdown of endogenous ArdsxF expres- of the partial exonic region that includes the male-specifc sion might allow normal development of the ventral blades stop codon occurs in females (Fig. 3a). These fndings may in the Ardsx knockdown females. Null mutation of Ardsx imply that the regulatory mechanism of sex-specifc splic- induced by gene targeting using TALEN and CRISPR/ ing of Ardsx may be different from that of Amdsx. Cas9 will be helpful to further understand the importance Ardsx knockdown adult males had several parts of the of Ardsx functions for the development of the ovipository ovipository apparatus including the dorsal pair of blades apparatus. and the sheath, both of which are derived from the second Effects of Ardsx knockdown on the development of valvifers (Fig. 5e, f). These results indicate that develop- internal reproductive organs seemed relatively weak. Male- ment of the dorsal pair of blades and the sheath in males to-female sex reversal such as partial ovary formation is repressed by the expression of ­ArDSXM and its expres- and egg production was not seen in the Ardsx knockdown sion is essential for development of the male genitalia. males. Ardsx knockdown females were phenotypically nor- Differing from the normal ovipository apparatus, Ardsx mal and had normal fertility. In D. melanogaster, males KD male genitalia lacked the ventral pair of blades, which homozygous for dsx loss-of-function mutant alleles contain are derived from the frst valvifers (Fig. 5e, f). In D. mela- gonads with spermatogenic and undifferentiated germ cells, nogaster, one of two isoforms of Abdominal-B (Abd-B), and asexual gonads were rarely observed (Orssaud and Abd-Bm, is present only in the female genital primordium, Laugé 1982; Steinmann-Zwicky 1994). Similarly, ­ArDSXM whereas the other isoform, Abd-Br, is present only in the may be required for sperm maturation in A. rosae. Thus, male genital primordium (Casares et al. 1997; Duncan knockdown of Ardsx in males caused incomplete sper- 1996). Concerted action of these two isoforms either with matogenesis, resulting in absence of mature sperm. Taken ­DSXM or ­DSXF is important for the appropriate sexual together with the fndings that in D. melanogaster several development of genital primordium (Sánchez et al. 2001). genes such as fruitless (fru), intersex (ix), and hermaph- A previous study demonstrated that knockdown of Abd- rodite (her) act independently or dependently to regulate B in A. rosae females caused a malformed ovipositor and some aspects of sexual differentiation, we suppose that these females could not lay eggs, while ovaries and internal Ardsx function is not only required for the proper sexual

1 3 Appl Entomol Zool development for the internal reproductive organs but other Gempe T, Beye M (2011) Function and evolution of sex determina- factors also act as a downstream regulator in the sex deter- tion mechanisms, genes and pathways in insects. BioEssays 33:52–60 mination cascade in A. rosae. Geuverink E, Beukeboom LW (2014) Phylogenetic distribution and The most notable result in this study is that knockdown evolutionary dynamics of the sex determination genes doublesex of Ardsx caused ectopic formation of the ovipository appa- and transformer in insects. Sex Dev 8:38–49 ratus containing the dorsal pair of blades and the sheath in Hall AB, Basu S, Jiang X, Qi Y, Timoshevskiy VA, Biedler JK, Shara- khova MV, Elahi R, Anderson MA, Chen XG, Sharakhov IV, males, both of which showed almost complete phenotype Adelman ZN, Tu Z (2015) A male-determining factor in the (Fig. 5e, f). This fnding would seem to imply that forma- mosquito Aedes aegypti. Science 2348:1268–1270 tion of several parts of the ovipository apparatus represent Hasselmann M, Gempe T, Schiott M, Nunes-Silva CG, Otte M, Beye the default state and do not require the expression of Ardsx. M (2008) Evidence for the evolutionary nascence of a novel sex determination pathway in honeybees. Nature 454:519–522 Hymenoptera is the most basal lineage in the phylogeny Hatakeyama M, Nakamura T, Kim KB, Sawa M, Naito T, Oishi K of holometabolous insects (superorder Endopterygota), (1990a) Experiments inducing prospective polar body nuclei to being an outgroup to Diptera, Lepidoptera, and Coleop- participate in embryogenesis of the sawfy Athalia rosae (Hyme- tera (Savard et al. 2006; Trautwein et al. 2012; Misof et al. noptera). Roux’s Arch Dev Biol 198:389–394 Hatakeyama M, Sawa M, Oishi K (1990b) Ovarian development 2014; Peters et al. 2014). The dsx gene in Daphnia magna and vitellogenesis in the sawfy, Athalia rosae rufcornis Jako- that belongs to cladocera species, which are the closest rel- vlev (Hymenoptera, Tenthredinidae). Invertebr Reprod Dev atives to the insects, is expressed predominantly in males 17:237–245 and only required for male development (Kato et al. 2011). Hoshijima K, Inoue K, Higuchi I, Sakamoto H, Shimura Y (1991) Con- trol of doublesex alternative splicing by transformer and trans- These fndings lead to the inference that female sexual former-2 in Drosophila. Science 252:833–836 development might occur by default in ancestral insect spe- Kato Y, Kobayashi K, Watanabe H, Iguchi T (2011) Environmen- cies. To examine whether this hypothesis is correct or not, tal sex determination in the branchiopod crustacean Daphnia it will be important to reveal functions of dsx orthologs in magna: deep conservation of a Doublesex gene in the sex- determining pathway. PLoS Genet 7:e1001345 other hymenopteran species. Krzywinska E, Dennison NJ, Lycett GJ, Krzywinski J (2016) A maleness gene in the malaria mosquito Anopheles gambiae. Acknowledgements This work was supported by a Japan Society for Science 353:67–69 the Promotion of Science (JSPS) KAKENHI Grant-in-Aid for Sci- Lee JM, Hashino Y, Hatakeyama M, Oishi K, Naito T (1998) Egg entifc Research (B) (Grant no. 26292172). It was also supported, in deposition behavior in the haplodiploid sawfy Athalia rosae part, by a JSPS KAKENHI Grant-in-Aid for Challenging Exploratory rufcornnis Jakovlev (Hymenoptera: Symphyta: Tenthredini- Research (Grant no. 15K14892). dae). J Insect Behav 11:419–428 Misof B, Liu S, Meusemann K, Peters RS, Donath A et al (2014) Open Access This article is distributed under the terms of the Crea- Phylogenomics resolves the timing and pattern of insect evolu- tive Commons Attribution 4.0 International License (http://crea- tion. Science 346:763–767 tivecommons.org/licenses/by/4.0/), which permits unrestricted use, Mita K, Kasahara M, Sasaki S, Nagayasu Y, Yamada T et al (2004) distribution, and reproduction in any medium, provided you give The genome sequence of silkworm, Bombyx mori. DNA Res appropriate credit to the original author(s) and the source, provide a 11:27–35 link to the Creative Commons license, and indicate if changes were Naito T, Suzuki H (1991) Sex determination in the sawfy, Athalia made. rosae rufcornis (Hymenoptera): occurrence of triploid males. J Hered 82:101–104 Oishi K, Sawa M, Hatakeyama M, Kageyama Y (1993) Genet- ics and biology of the sawfy, Athalia rosae (Hymenoptera). Genetica 88:119–127 References Oishi K, Sawa M, Hatakeyama M (1995) Developmental biology of the sawfy, Athalia rosae (Hymenoptera). Proc Beye M, Hasselmann M, Fondrk MK, Page RE, Omholt SW (2003) Embryol Soc Jpn 30:1–8 The gene csd is the primary signal for sexual development in the Orssaud L, Laugé G (1982) Etude histologique de l’appareil geni- honeybee and encodes an SR-type protein. Cell 114:419–429 tal du mutant d’intersexualité doublesex (dsx) de Drosophila Casares F, Sánchez L, Guerrero I, SanchezHerrero E (1997) The geni- melanogaster Meigen (diptere: Drosophilidae). Int J Insect tal disc of Drosophila melanogaster. 1. Segmental and compart- Morphol Embryol 11:53–67 mental organization. Dev Genes Evol 207:216–228 Peters RS, Meusemann K, Petersen M, Mayer C, Wilbrandt J et al Cho S, Huang ZY, Zhang J (2007) Sex-specifc splicing of the hon- (2014) The evolutionary history of holometabolous insects eybee doublesex gene reveals 300 million years of evolution at inferred from transcriptome-based phylogeny and comprehen- the bottom of the insect sex-determination pathway. Genetics sive morphological data. BMD Evol Biol 14:52 177:1733–1741 Price DC, Egizi A, Fonseca DM (2015) The ubiquity and ancestry Duncan I (1996) How do single homeotic genes control multiple seg- of insect doublesex. Sci Rep 5:13068 ment identities? BioEssays 18:91–94 Privman E, Wurm Y, Keller L (2013) Duplication and concerted Fujiwara Y, Akita K, Okumura W, Kodaka T, Tomioka K, Naito T evolution in a master sex determiner under balancing selection. (2004) Estimation of allele numbers at the sex-determining locus Proc Biol Sci 280:20122968 in a feld population of the turnip sawfy (Athalia rosae). J Hered Ross HH (1945) Sawfy genitalia: terminology and study tech- 95:81–84 niques. Entomol News 10:261–265

1 3 Appl Entomol Zool

Sánchez L, Gorfnkiel N, Guerrero I (2001) Sex determination between Drosophila melanogaster and Bombyx mori. Insect Bio- genes control the development of the Drosophila genital disc, chem Mol Biol 31:1201–1211 modulating the response to Hedgehog, Wingless and Decapen- Suzuki MG, Imanishi S, Dohmae N, Asanuma M, Matsumoto S taplegic signals. Development 128:1033–1043 (2010) Identifcation of a male-specifc RNA binding protein Savard J, Tautz D, Richards S, Weinstock GM, Gibbs RA, Wer- that regulates sex-specifc splicing of Bmdsx by increasing RNA ren JH, Tettelin H, Lercher MJ (2006) Phylogenomic analysis binding activity of BmPSI. Mol Cell Biol 30:5776–5786 reveals bees and wasps (Hymenoptera) at the base of the radia- Suzuki MG, Suzuki K, Aoki F, Ajimura M (2012) Effect of RNAi- tion of Holometabolous insects. Genome Res 16:1334–1338 mediated knockdown of the Bombyx mori transformer-2 gene Sawa M, Oishi K (1989) Studies on the sawfy, Athalia rosae (Insecta, on the sex-specifc splicing of Bmdsx pre-mRNA. Int J Dev Biol Hymenoptera, Tenthredinidae). III. Fertilization by sperm injec- 56:693–699 tion. Zool Sci 6:557–563 Trautwein MD, Wiegmann BM, Beutel R, Kjer KM, Yeates DK Schmieder S, Colinet D, Poirié M (2012) Tracing back the nascence (2012) Advances in insect phylogeny at the dawn of the post- of a new sex-determination pathway to the ancestor of bees and genomic era. Annu Rev Entomol 57:449–468 ants. Nat Commun 3:895 Whiting PW (1933) Selective fertilization and sex determination in Schulmeister S (2003) Genitalia and terminal abdominal segments of Hymenoptera. Science 78:537–538 male basal Hymenoptera (Insecta): morphology and evolution. Wilkins AS (1995) Moving up the hierarchy: a hypothesis on the Org Divers Evol 3:253–279 evolution of a genetic sex determination pathway. BioEssays Shukla JN, Palli SR (2012) Sex determination in beetles: produc- 17:71–77 tion of all male progeny by parental RNAi knockdown of trans- Yoshiyama N, Tojo K, Hatakeyama M (2013) A survey of the effec- former. Sci Rep 2:602 tiveness of non-cell autonomous RNAi throughout development Steinmann-Zwicky M (1994) Sex determination of the Drosophila in the sawfy, Athalia rosae (Hymenoptera). J Insect Physiol germ line: tra and dsx control somatic inductive signals. Devel- 59:400–407 opment 120:707–716 Suzuki MG, Ohbayashi F, Mita K, Shimada T (2001) The mecha- nism of sex-specifc splicing at the doublesex gene is different

1 3