US 20090208953A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2009/0208953 A1 Gutmann et al. (43) Pub. Date: Aug. 20, 2009

(54) NEUROFIBROMIN PATHWAY MODULATORS Related U.S. Application Data (75) Inventors: David Gutmann, St. Louis, MO (60) Provisional application No. 60/987,156, filed on Nov. (US); Jason Weber, St. Louis,MO 12, 2007. (US) Publication Classification Correspondence Address: (51) Int. Cl. POLSNELLISHUGHART PC CI2O I/68 (2006.01) 100 SOUTH FOURTH STREET, SUITE 100 A63L/436 (2006.01) SAINT LOUIS, MO 63102-1825 (US) CI2N 5/10 (2006.01) (73) Assignee: WASHINGTON UNIVERSITY (52) U.S. Cl...... 435/6; 514/291; 435/325 INST. LOUIS, St. Louis, MO (US) (57) ABSTRACT (21) Appl. No.: 12/269,681 The present invention encompasses methods for treating neu rofibromatosis and methods for screening for modulators of (22) Filed: Nov. 12, 2008 the neurofibromin pathway. A

g-liai

sacrifia

y-N-y

{Y-Niceti Patent Application Publication Aug. 20, 2009 Sheet 1 of 15 US 2009/0208953 A1

ex-Tubulin sy....a sy-N-y

{Y-Nisieois

{-Cycii D

F.G. 1

Niff +/- Nff-i- Akt.

S6KP

S6-P

AEBP1-P

total Akt

FG 2 Patent Application Publication Aug. 20, 2009 Sheet 2 of 15 US 2009/0208953 A1

floX/mut Control Nf 1 Cre

Patent Application Publication Aug. 20, 2009 Sheet 3 of 15 US 2009/0208953 A1

Neois (i.

- is is

B None Y Rap None Y Rap Phospho S6

- i.

Affif's Niff f.

FG 4 Patent Application Publication Aug. 20, 2009 Sheet 4 of 15 US 2009/0208953 A1

xx s

s h s

s

s

s

Rs s s h h s h s

s

s

a R s h s s h s h s

s

s

s -- s s s h s h s h s

s

s - h s s h s s h

r Patent Application Publication Aug. 20, 2009 Sheet 5 of 15 US 2009/0208953 A1

A 70000 B rapamycin (nM) O 1 10 100 60000

50000

40000

30000

20000

10000

0 &n wany w xxxx O 1 10

rapamycin (nM)

S

ŠSS Patent Application Publication Aug. 20, 2009 Sheet 6 of 15 US 2009/0208953 A1

Image Min = 1857.5 Max = 13152 p/sec/cm^2/sr

Color Bar Min = 1312.5 Max = 11865

FG 6D Patent Application Publication Aug. 20, 2009 Sheet 7 of 15 US 2009/0208953 A1

& vS- ge s & s c c SX %S. s x & s S. A & & % vS s s s

FG 7 Patent Application Publication Aug. 20, 2009 Sheet 8 of 15 US 2009/0208953 A1 Nf1 +/* Nff-l- D F D F

S6-P tubulin

FG 8 Patent Application Publication Aug. 20, 2009 Sheet 9 of 15 US 2009/0208953 A1

A Nf1 +/-- Nf1 -/- SH: Hy D R D R

RaC1-GTP Patent Application Publication Aug. 20, 2009 Sheet 10 of 15 US 2009/0208953 A1

Serum A

Y-Tubulin

NPM

Phosphorylated S6

B +Ras' H EV re

y-Tubulin

:SSSSSS:::::8sssssssss: N w s :Sk: NPM

Ras

l H Raphayei

FG 1 O Patent Application Publication Aug. 20, 2009 Sheet 11 of 15 US 2009/0208953 A1

NPM

P-S6 (Ser 240/244)

S6

B Nf 1 ff Nf filmut ; GFAP-Cre Vehicle Rapamycin

s Z

COop

FIG 11 Patent Application Publication Aug. 20, 2009 Sheet 12 of 15 US 2009/0208953 A1

sSKxxxxxxxxxx

F.G. 12 Patent Application Publication Aug. 20, 2009 Sheet 13 of 15 US 2009/0208953 A1

5' erminal Oligo Pyrimidine Tract

N.V. S. OOCCCGGCGTGATTCCGTCCTGCGCGC GT CGGGAACAGGAGGCAGGCCGCCGGC CCCCACACCGAAG GCGCGCC CCACCC

-Serum transcription

- for transatian

PROTEN

FG 13 Patent Application Publication Aug. 20, 2009 Sheet 14 of 15 US 2009/0208953 A1

::

, ". S. X 3.W S.XNNNNNWNNNNNNWNNNNNNVNNNNNNWNNNN &aera ------EFs Astrocytes

8. 3.8sie &

Neities. Sixt Assiysis

FG 14. Patent Application Publication Aug. 20, 2009 Sheet 15 of 15 US 2009/0208953 A1

FG 15 US 2009/0208.953 A1 Aug. 20, 2009

NEUROFIBROMIN PATHWAY MODULATORS 0008 Another aspect of the invention encompasses a method for treating neurofibromatosis, the method compris CROSS REFERENCE TO RELATED ing administering to a subject in need thereof an inhibitor of APPLICATIONS Rac1. 0009. Yet another aspect of the invention encompasses a 0001. This application claims the priority of U.S. provi cell comprising a vector. The vector generally comprises a sional application No. 60/987,156, filed Nov. 12, 2007, which reporter gene operably linked to a mTOR-responsive pro is hereby incorporated by reference in its entirety. moter. GOVERNMENTAL RIGHTS 0010 Still another aspect of the invention encompasses a method of screening for a modulator of the neurofibromin 0002 This invention was made in part with Government pathway. The method comprises contacting a cell comprising support under Grant Number DAMD-17-03-1-0215 awarded a vector comprising a reporter gene operably linked to a by The Department of Defense and Grant Number U01 mTOR-responsive promoter with a test compound. The level CA84314 awarded by the National Cancer Institute. The of a marker encoded by the reporter gene is measured, and the Government may have certain rights in this invention. level of the marker compared to a control is indicative of a modulator of the neurofibromin pathway. FIELD OF THE INVENTION 0011. Other aspects and iterations of the invention are 0003. The present invention relates to methods for treating described more thoroughly below. neurofibromatosis and to methods for Screening for modula tors of the neurofibromin pathway. REFERENCE TO COLOR FIGURES 0012. The application file contains at least one photograph BACKGROUND OF THE INVENTION executed in color. Copies of this patent application publica 0004 NF1 is a common autosomal dominant disorder that tion with color photographs will be provided by the Office affects approximately 1:3000 people worldwide (over 100, upon request and payment of the necessary fee. 000 individuals in the United States alone) and predisposes to the development of both benign and malignant tumors, BRIEF DESCRIPTION OF THE DRAWINGS including optic glioma and malignant peripheral nerve sheath 0013 FIG.1 depicts a series of images showing that loss of tumor (MPNST). Optic glioma (astrocytoma) represents the neurofibromin in primary astrocytes results in increased second most common tumor occurring in individuals with expression of proteins involved in ribosome biogenesis. (A) NF1. Optic gliomas affect at least 15% of children with NF1, Two dimensional gel electrophoresis and MALDI-TOF typically in the first decade of life, with 52% of affected analysis demonstrated that S19, L7, and L10a as well as children developing signs or symptoms from their tumors. nucleophosmin (NPM) were increased in neurofibromin 1 Optic pathway tumors can lead to blindness or invade into (Nf1) astrocytes. (B) The two dimensional gel electro nearby brain regions or the Subarachnoid space to result in phoresis results were confirmed using Western blotting on precocious puberty or other neurological abnormalities. wild-type (Nfl**) and neurofibromin 17 (Nf1) astro 0005. The most commonly used therapy for optic pathway cytes. glioma in NF1 is chemotherapy, involving the combination of 0014 FIG.2 depicts a series of images showing that loss of carboplatin and Vincristine. Although initial clinical neurofibromin expression results in increased mTOR path responses are observed in 60-80% of children with low-grade way activation. Using activation-specific (phospho) antibod glioma, tumor progression occurs in 36% of children with ies, neurofibromin 1 (Nfl') astrocytes exhibit increased optic pathway glioma, necessitating additional therapy. S6K1 and S6 activation relative to wildtype (Nf1") astro MPNSTs are highly aggressive and malignant tumors com cytes, with no change in 4E-BP1 activation. A Small increase posed of neoplastic Schwann cells. Recent studies have in Akt activation was also observed. shown that MPNSTs are not uncommon cancers in NF1, and 0015 FIG.3 depicts a series of micrographs showing that affect nearly 10% of individuals with NF1. MPNSTs fre mTOR pathway hyperactivation is seen in NF1-associated quently recur after treatment, and often metastasize to lung mouse and human glioma. Increased S6 activation (phospho and other organs. Current treatment is wide local excision S6 antibody) is observed in two models of Nfl GEM optic followed by local radiation. However, 5-year survival rates glioma (panels B, D) relative to control brain (panels A, C) as are dismal, and no effective chemotherapy regimens are avail well as in two representative human NF1-associated gliomas able. In addition, mean survival appears to be worse in NF1 (panels E, F). subjects with MPNST than for those in the general popula 0016 FIG. 4 depicts a series of images showing that neu tion. rofibromin 1 deficient astrocytes exhibit increased mTOR 0006. There is an unmet need in the art for more effective pathway activation, which is blocked by rapamycin. (A) Neu treatment of these tumors. New treatment discovery is heavily rofibromin 1 (Nfl') astrocytes exhibit high levels of acti dependent on the ability to evaluate new chemotherapeutic vated S6 detected using phosphospecific antibodies com compounds that target this important neurofibromin growth pared to Nifl" wild-type astrocytes. (B) Treatment of regulatory pathway. neurofibromin 1 (Nfl') astrocytes with rapamycin (Rap) or an inhibitor of PI-3K to block Akt activation (LY) elimi SUMMARY OF THE INVENTION nates the increased mTOR pathway activation (S6 phospho 0007. One aspect of the present invention encompasses a rylation). method for treating neurofibromatosis, the method compris 0017 FIG. 5 depicts a graph showing that treatment of ing administering to a subject in need thereof an inhibitor of neurofibromin 1 (Nf1) astrocytes with rapamycin inhib nucleophosmin (NPM). its cell proliferation. Nfl" (wild-type) or neurofibromin 1 US 2009/0208.953 A1 Aug. 20, 2009

(Nf1) astrocytes were treated with vehicle (D) or rapamy infected with retroviruses encoding 3-galactosidase (EV) and cin (R) and proliferation measured by thymidine incorpora Rasv12. Rapamycin (100 nM) was added as indicated 24 tion. Rapamycin eliminated the neurofibromin 1 (Nfl') hours post-infection. All samples were collected 48 hours astrocyte growth advantage, but had no effect on wild-type post-infection and proteins were immunoblotted with anti astrocytes (P<0.01). bodies against Y-tubulin, Ras and NPM. 0023 FIG. 11 depicts images and micrographs showing 0018 FIG. 6 depicts images and a graph showing that that nucleophosmin expression is regulated by mTOR signal treatment of neurofibromin 1 deficient human MPNST cells ing in vitro and in vivo. (A) Nucleophosmin (NPM) expres with rapamycin results in attenuation of mTOR activation and sion is increased in neurofibromin 1 (Nf1) astrocytes. reduced cell proliferation in vitro. (A) H-thymidine incor Expression of NPM and P-S6 is inhibited by 10 nM rapamy poration in vitro demonstrates reduced cell growth in cin. Immunoblotting for total S6 demonstrates equal protein response to low doses of rapamycin (1 nM). (B) Low doses of loading. (B) P-S6 and NPM are pressed at low levels in rapamycin inhibit the increased mTOR pathway activation wild-type murine optic nerve (Nf1), but are dramatically (S6 phosphorylation: S6-P expression) observed in neurofi increased in a murine model of optic glioma Nfl'"; GFAP bromin 1 deficient ST88-14 MPNST cells. (C) Luciferin Cre), as shown by immuno-histochemistry. Following rapa bioluminescence demonstrates robust luciferase activity (red mycin treatment in vivo, both NPM and P-S6 expression are signal) in ST88-14-luc cells in vitro. The top three rows have decreased in the mouse optic gliomas. Scale bar=200 um no cells, while the bottom three rows contain 3x10, 6x10, (10x). and 9x10 ST88-14-luc cells. (D) 107 neurofibromin 1 defi 0024 FIG. 12 depicts images and a graph showing the cient MPNST cells (ST88-14-luc) were grown as a flank requirement of NPM expression and function for neurofibro tumor in immunocompromised athymic nu/nu mice for 10 min 1 (Nf1) astrocyte proliferation. (A) Expression of days. Following luciferin administration, in vivo biolumines Rac1N17 in neurofibromin 1 (Nf1) astrocytes decreases cence imaging detects the growing tumor as denoted by the NPM expression, but does not attenuate S6 phosphorylation. (B) Expression of the NPM shuttling mutant NPMdL in neu black arrow (red signal). rofibromin 1 (Nfl') astrocytes restores cell proliferation 0019 FIG. 7 depicts images showing that restoration of to wild-type levels. Inhibition of NPM shuttling function had neurofibromin GAP activity or inhibition of KRAS activity no effect on proliferation in wildtype cells. blocks mTOR pathway activation in neurofibromin 17 (0025 FIG. 13 depicts an illustration of the mTOR-respon (Nf1) astrocytes. (A) Neurofibromin 1 (Nf1) and sive luciferase reporter. 5'-RACE analysis identified the Nf1** astrocytes were transduced with MSCV-NF1 GRD or 5'-untranslated region (UTR) of mouse NPM that is con MSCV-Pac (vector control). The increase in neurofibromin served inhumans. (SEQIDNO:4)The NPM5'-UTR contains 1 (Nf1) astrocyte ribosomal S6 phosphorylation was a putative terminal oligopyrimidine (TOP) sequence (under reduced to wild-type levels by ectopic expression of the NF1 lined). The 5'-UTR of NPM was subcloned in front of the GRD, but not by transduction with MSCV-Pac. No change in firefly luciferase expression cassette from the promoter-less S6 phosphorylation was observed in Nf1" astrocytes trans pGL3 basic vector (Promega). Serum addition results in effi duced with either MSCV-NF1 GRD or MSCV-Pac. (B) Simi cient transcription of the hybrid 5'-UTRNPM-TOP-lu larly, transduction of the MSCV-dominant inhibitory K-RAS ciferase gene through basal transcription sites within the (K-RASN 17) reduced S6 phosphorylation in neurofibromin 5'-UTR of NPM. The resulting RNA hybrid transcript is then 1 (Nf1) astrocytes to wild-type levels. Control MSCV placed under the control of regulatory sequences in the NPM (MSCV-GFP) had no effect on S6 hyperactivation in neurofi 5'-UTR including the TOP sequence. Addition of hyper-ac bromin 1 (Nf1) astrocytes. tive mTOR signals results in efficient translation of the hybrid 0020 FIG. 8 depicts images showing that Rheb pharma transcript through sequences in the NPM TOP domain. cologic inhibition blocks mTOR pathway activation in Tsc1 0026 FIG. 14 depicts a graph and an image showing the deficient, but not neurofibromin 1 deficient, astrocytes. (TOP validation of the 5'NPM-TOPluciferase reporter construct PANEL) Treatment of neurofibromin 1 (Nf1) astrocytes during mTOR hyperactivation. Primary mouse embryo fibro with FTI-276 (F) had no effect on S6 activity compared to blasts (1x10) derived from wild-type or Tsc littermates control (D). (BOTTOMPANEL) In contrast, Rheb inhibition were transduced with 2 ug of NPM-TOP-luciferase plasmid in Tsc1 astrocytes reduced S6 activation. DNA and analyzed 48 hours later. Luciferin substrate was 0021 FIG. 9 depicts images and a graph showing that added and luminescence was measured in triplicate samples mTOR-dependent Rac1 hyperactivation is required for using standard luminometer techniques for luciferase detec increased proliferation of neurofibromin 1 (Nf1) astro tion. The identical assay was performed for primary mouse cytes. (A) GTP-bound Rac1 was immunoprecipitated from astrocytes (1x10) derived from wild-type or neurofibromin wild-type and Nf1 astrocytes treated with DMSO vehicle 1 littermates. As a control for NPM-TOP-luciferase or 10 nM rapamycin using PAK1-PBD affinity chromatogra mRNA expression, Northern blot analysis was performed phy. Equal protein loading was confirmed by immunoblotting using a probe specific for the NPM-TOPluciferase mRNA. for total Rac1 from a lysate aliquot prior to precipitation. (B) Equal mRNA ensures that increased luciferase expression Expression of Rac1N17 in neurofibromin 1 (Nf1) astro was due to translation and not transcription. *-p<0.01. cytes decreases cell proliferation, as determined by BrdU 0027 FIG. 15 depicts an image showing the luciferase incorporation. *, p<0.05. reporter for proliferation of MPNST cells. ST88-14 cells transduced with control or Renilla luciferase (R-luc) vectors 0022 FIG. 10 depicts a series of images showing the were seeded at 7.5x10", 1.5x10, and 2.5x10 cells respec effects of rapamycin on NPM expression. (A) Rapamycin tively (left to right) overnight and were assayed the following (Rap, 100 nM) was added as indicated to asynchronous wild day for luciferase activity. type MEFs. Forty-eight hours after rapamycin treatment, cells were harvested and proteins were separated by SDS DETAILED DESCRIPTION PAGE and immunoblotted with antibodies specific for NPM, 0028 Provided herein is a method for treating neurofibro Y-tubulin and phospho-S6. (B) Wild-type MEFs were matosis (NF1), which may be caused by a loss of neurofibro US 2009/0208.953 A1 Aug. 20, 2009

min protein function. The inventors have discovered that min 1 mouse astrocytes. Rac1 hyperactivation is mediated administering an inhibitor of either of the neurofibromin 1 by mTOR signaling in astrocytes. Rapamycin blocks Rac1 pathway components nucleophosmin or Rac1 is capable of hyperactivation in neurofibromin 1 astrocytes, indicating ameliorating the effects of loss of neurofibromin 1 function. that Rac1 may act downstream of mTOR. Rac1 also regulates The inventors have also discovered a method for identifying cell proliferation in a variety of cell types, and Rac1 mouse compounds that inhibit the neurofibromin pathway and neu embryonic fibroblasts may exhibit both impaired migration rofibromin 1 deficient cell growth. and cell proliferation. 0034. In one embodiment, inhibitors of Rac1 may also be I. Method for Treating Neurofibromatosis used to treat NF1. The Rac1 inhibitor may be capable of 0029 Provided herein is a method for treating NF1 in a substantially restoring neurofibromin 17 cell growth to Subject by administering a composition comprising an inhibi wild-type levels. Rac1 inhibitors are known in the art, and tor of NPM and/or Rac1. As detailed above, generally speak may be peptide or peptide derivative inhibitors, small ing, loss of neurofibromin protein function results in NF1. molecular weight inhibitors, antibody inhibitors, or the like. Loss of neurofibromin protein function may be due to a non For instance, in one embodiment, the Rac1 inhibitor may be functional neurofibromin 1 gene. For instance, a cell may selected from the group of inhibitors comprising NSC 23766, contain one wild-type (functional) and one mutant (non-func 553502, and EHT1864. tional) copy of the neurofibromin 1 gene, leading to reduced (c) Inhibitor Composition neurofibromin 1 expression. This 50% reduction in neurofi bromin 1 expression may be sufficient to result in the devel 0035 Also provided herein is a composition comprising opment of tumors. Alternatively, tumors may develop only an inhibitor of NPM and/or Rac1. The composition may be in after the wild-type copy of the neurofibromin 1 gene under a pharmaceutically acceptable salt form. The term “pharma goes inactivation due to an acquired somatic mutation, lead ceutically acceptable salt” refers to those salt forms which ing to complete loss of neurofibromin 1 expression in those would be apparent to the pharmaceutical chemist, i.e., those cells. which are substantially non-toxic and which provide the 0030) Disruption of both neurofibromin 1 alleles by muta desired pharmacokinetic properties, palatability, absorption, tion may occur in MPNSTs, juvenile chronic myeloid leuke distribution, metabolism or excretion. Other factors, more mia (JCML), pheochromocytoma, and dermal neurofibro practical in nature, which are also important in the selection, mas. Neurofibromin 1 inactivation and loss of neurofibromin are cost of the raw materials, ease of crystallization, yield, 1 expression may be present in NF1-associated, but not spo stability, hygroscopicity and flowability of the resulting bulk radic, pilocytic astrocytoma. The neurofibromin 1 messenger drug. Conveniently, pharmaceutical compositions may be RNA transcript may be expressed at variable levels in most prepared from the active ingredients or their pharmaceuti tissues, but may primarily be detected in astrocytes, oligo cally acceptable salts in combination with pharmaceutically dendrocytes, neurons, Schwann cells, adrenal medulla, lym acceptable carriers. phocytes, and blood vessels. 0036 Pharmaceutically acceptable salts of the active agents include, but are not limited to, salts formed with a (a) Nucleophosmin variety of organic and inorganic acids such as hydrogen chlo ride, hydroxymethane Sulfonic acid, hydrogen bromide, 0031 NF1 may be treated by administering an inhibitor of methanesulfonic acid, Sulfuric acid, acetic acid, trifluoroace nucleophosmin (NPM). An increase in mTOR activity, which tic acid, maleic acid, benzenesulfonic acid, toluenesulfonic may result from loss of neurofibromin function, may increase acid, Sulfamic acid, glycolic acid, Stearic acid, lactic acid, the translation of NPM. Inhibiting NPM function in a neu malic acid, pamoic acid, Sulfanilic acid, 2-acetoxybenzoic rofibromin 17 cellor in a subject with NF1 may restore cell acid, fumaric acid, toluenesulfonic acid, methanesulfonic proliferation to wild-type levels. NPM may be an mTOR acid, ethanedisulfonic acid, oxalic acid, isethonic acid, and effector important for regulating cell proliferation in neurofi include various other pharmaceutically acceptable salts. Such bromin 1 cells. Inhibiting NPM function may have no as, e.g., nitrates, phosphates, borates, tartrates, citrates, suc measurable effect on the basal proliferation of wild-type cinates, benzoates, ascorbates, Salicylates, and the like. Cat astrocytes, underscoring its importance in neurofibromin 1 ions such as quaternary ammonium ions are contemplated as deficient cell proliferation. pharmaceutically acceptable counterions for anionic moi 0032. In one embodiment, inhibitors of NPM may be used eties. In addition, pharmaceutically acceptable salts of the to treat NF1. The NPM inhibitor may be capable of substan compounds of the present invention may be formed with tially restoring neurofibromin 17 cell growth to wild-type alkali metals such as Sodium, potassium and lithium; alkaline levels. NPM inhibitors are known in the art, and may be earth metals such as calcium and magnesium; organic bases peptide or peptide derivative inhibitors, small molecular Such as dicyclohexylamine, tributylamine, and pyridine; and weight inhibitors, antibody inhibitors, or the like. For amino acids such as arginine, lysine and the like. instance, in one embodiment, the NPM inhibitor may be 0037. The pharmaceutically acceptable salts may be syn NSC3848884. thesized by conventional chemical methods. Generally, the salts are prepared by reacting the free base or acid with (b) Rac1 Stoichiometric amounts or with an excess of the desired salt 0033. NPM may be regulated by Rac1. Administering an forming inorganic or organic acid or base, in a Suitable sol inhibitor of Rac1 in an neurofibromin 17 cell or to a subject vent or solvent combination. with NF1 may greatly attenuate NPM expression and may 0038. In general, the counterions of the salts may be deter treat NF1. Rac1 is a small GTPase, which may act down mined by the reactants used to synthesized the compounds. stream of mTOR and modulate actin stress fiber formation. There may be a mixture of counterions of the salts, depending Levels of active, GTP-bound Rac1 are elevated in neurofibro on the reactants. For example, where NaI is added to facilitate US 2009/0208.953 A1 Aug. 20, 2009

the reaction the counterion may be a mixture of C1 and I epothilone A, epothilone B, and discodermolide (see Service, counter anions. Furthermore preparatory HPLC may cause (1996) Science, 274:2009) estramustine, nocodazole, MAP4, the original counterion to be exchanged by acetate anions and the like. Examples of Such agents are also described in when acetic acid is present in the eluent. The counterions of Bulinski (1997) J. Cell Sci. 110:3055 3064; Panda (1997) the salts may be exchanged to a different counterion. The Proc. Natl. Acad. Sci. USA 94.10560-10564: Muhlradt counterions are preferably exchanged for a pharmaceutically (1997) Cancer Res. 57:3344-3346; Nicolaou (1997) Nature acceptable counterion to form the salts described above. Pro 387:268-272; Vasquez (1997) Mol. Biol. Cell. 8:973-985; cedures for exchanging counterions are described in WO and Panda (1996) J. Biol. Chem 271:29807-29812. 2002/042265, WO 2002/042276 and S. D. Clas, “Quater 0043. Also suitable are cytotoxic agents such as epido nized Colestipol, an improved bile salt adsorbent: In Vitro phyllotoxin; an antineoplastic enzyme; a topoisomerase studies.” Journal of Pharmaceutical Sciences, 80(2): 128-131 inhibitor, procarbazine; mitoxantrone; platinum coordination (1991), the contents of which are incorporated herein by complexes such as cis-platin and carboplatin: biological reference. For clarity reasons, the counterions may not be response modifiers; growth inhibitors; antihormonal thera explicitly shown in the chemical structures herein. peutic agents; leucovorin, tegafur, and haematopoietic growth factors. (d) Inhibitor Combinations 0044 Cytostatic agents that may be used include, but are 0039. The composition may be administered in combina not limited to, hormones and steroids (including synthetic tion with a chemotherapeutic agent. The chemotherapeutic analogs): 17.alpha.-ethinylestradiol, diethylstilbestrol, test may be any pharmacological agent or compound. osterone, prednisone, fluoxymesterone, dromostanolone pro 0040. The chemotherapeutic may be a cytotoxic agent or pionate, testolactone, megestrolacetate, methylprednisolone, cytostatic agent, or combination thereof. Cytotoxic agents methyl-testosterone, prednisolone, triamcinolone, hlorotria prevent cancer cells from multiplying by: (1) interfering with nisene, hydroxyprogesterone, aminoglutethimide, estramus the cell's ability to replicate DNA and (2) inducing cell death tine, medroxyprogesteroneacetate, leuprolide, flutamide, and/or apoptosis in the cancer cells. Cytostatic agents act via toremifene, Zoladex. modulating, interfering or inhibiting the processes of cellular 0045. Other cytostatic agents are antiangiogenics Such as signal transduction which regulate cell proliferation and matrix metalloproteinase inhibitors, and other VEGF inhibi Sometimes at low continuous levels. tors, such as anti-VEGF antibodies and small molecules such as ZD6474 and SU6668 are also included. Anti-Her2 anti 0041 Classes of compounds that may be used as cytotoxic bodies from Genetech may also be utilized. A suitable EGFR agents include the following: alkylating agents (including, inhibitor is EKB-569 (an irreversible inhibitor). Also without limitation, nitrogen mustards, ethylenimine deriva included are Imclone antibody C225 immunospecific for the tives, alkyl Sulfonates, nitrosoureas and triaZenes): uracil EGFR, and Src inhibitors. mustard, chlormethine, cyclophosphamide (Cytoxan.R.), ifos 0046. Also suitable for use as a cytostatic agent is Caso famide, melphalan, chlorambucil, pipobroman, triethylene deX(R) (bicalutamide, AstraZeneca) which renders androgen melamine, triethylenethiophosphoramine, buSulfan, carmus dependent carcinomas non-proliferative. Yet another tine, lomustine, Streptozocin, dacarbazine, and example of a cytostatic agent is the antiestrogen Tamoxifen R. temozolomide; antimetabolites (including, without limita which inhibits the proliferation or growth of estrogen depen tion, folic acid antagonists, pyrimidine analogs, purine ana dent breast cancer. Inhibitors of the transduction of cellular logs and adenosine deaminase inhibitors): methotrexate, proliferative signals are cytostatic agents. Representative 5-fluorouracil, floXuridine, cytarabine, 6-mercaptopurine, 6-thioguanine, fludarabine phosphate, pentostatine, and gem examples include epidermal growth factor inhibitors, Her-2 citabine; natural products and their derivatives (for example, inhibitors, MEK-1 kinase inhibitors, MAPK kinase inhibi Vinca alkaloids, antitumorantibiotics, enzymes, lymphokines tors, PI3 inhibitors, Src kinase inhibitors, and PDGF inhibi and epipodophyllotoxins): vinblastine, Vincristine, Vin tOrS. desine, bleomycin, dactinomycin, daunorubicin, doxorubi 0047. In some embodiments, an inhibitor of NPM is cin, epirubicin, idarubicin, ara-c, paclitaxel (paclitaxel is administered in combination with an inhibitor of Rac1. In commercially available as Taxol.R.), mithramycin, deoxyco other embodiments, and inhibitor of NPM and/or and inhibi formycin, mitomycin-c, I-asparaginase, interferons (prefer tor of Rac1 is administered in combination with rapamycin. ably IFN-D), etoposide, and teniposide. Other proliferative cytotoxic agents are navelbene, CPT-11, anastrazole, letra (e) Formulations Zole, capecitabine, reloxafine, cyclophosphamide, ifosamide, 0048. The composition may further comprise one or more and droloxafine. The cytotoxic agent may also be a combina pharmaceutically acceptable additional ingredient(s) such as tion of carboplatin and Vincristine. alum, stabilizers, antimicrobial agents, buffers, coloring 0042 Microtubule affecting agents interfere with cellular agents, flavoring agents, adjuvants, and the like. mitosis and are well known in the art for their cytotoxic 0049. The composition may be in the form of tablets or activity. Microtubule affecting agents useful in the invention lozenges formulated in a conventional manner. For example, include, but are not limited to, allocolchicine (NSC 406042), tablets and capsules for oral administration may contain con halichondrin B (NSC 609395), colchicine (NSC 757), colchi ventional excipients including, but not limited to, binding cine derivatives (e.g., NSC 33410), dolastatin 10 (NSC agents, fillers, lubricants, disintegrants and wetting agents. 376128), maytansine (NSC 153858), rhizoxin (NSC Binding agents include, but are not limited to, syrup, accacia, 332598), paclitaxel (Taxol R, NSC 125973), Taxol.R deriva gelatin, Sorbitol, tragacanth, mucilage of starch and polyvi tives (e.g., derivatives (e.g., NSC 608832), thiocolchicine nylpyrrolidone. Fillers include, but are not limited to, lactose, NSC 361792), trityl cysteine (NSC 83265), vinblastine sul Sugar, microcrystalline cellulose, maizestarch, calcium phos fate (NSC 49842), vincristine sulfate (NSC 67574), natural phate, and sorbitol. Lubricants include, but are not limited to, and synthetic epothilones including but not limited to magnesium Stearate, Stearic acid, talc, polyethylene glycol, US 2009/0208.953 A1 Aug. 20, 2009

and silica. Disintegrants include, but are not limited to, potato ing largely of non-ionic lipids, some forms of which are starch and Sodium starch glycollate. Wetting agents include, effective for transporting compounds across the stratum cor but are not limited to, sodium lauryl sulfate). Tablets may be U. coated according to methods well known in the art. 0050. The composition may also be liquid formulations (f) Administration including, but not limited to, aqueous or oily Suspensions, 0055. The composition for treating NF1 may be adminis Solutions, emulsions, syrups, and elixirs. The composition tered in a pharmaceutically effective amount. The composi may also be formulated as a dry product for constitution with tion may be administered simultaneously or metronomically water or other suitable vehicle before use. Such liquid prepa with other anti-cancer treatments such as chemotherapy and rations may contain additives including, but not limited to, radiation therapy. The term “simultaneous” or “simulta Suspending agents, emulsifying agents, nonaqueous vehicles neously as used herein, means that the other anti-cancer treatment and the composition is administered within 48 and preservatives. Suspending agents include, but are not hours, 24 hours, 12 hours, 6 hours, 3 hours or less, of each limited to, Sorbitol syrup, methyl cellulose, glucose/sugar other. The term “metronomically' as used herein means the syrup, gelatin, hydroxyethylcellulose, carboxymethyl cellu administration of the composition at times different from the lose, aluminum Stearate gel, and hydrogenated edible fats. chemotherapy and at certain frequency relative to repeat Emulsifying agents include, but are not limited to, lecithin, administration and/or the chemotherapy regiment. Sorbitan monooleate, and acacia. Nonacqueous vehicles 0056. The composition may be administered in any man include, but are not limited to, edible oils, almond oil, frac ner including, but not limited to, orally, parenterally, Sublin tionated coconut oil, oily esters, propylene glycol, and ethyl gually, transdermally, rectally, transmucosally, topically, via alcohol. Preservatives include, but are not limited to, methyl inhalation, via buccal administration, or combinations or propyl p-hydroxybenzoate and Sorbic acid. thereof. Parenteral administration includes, but is not limited 0051. The composition may also be formulated as Sup to, intravenous, intraarterial, intraperitoneal, Subcutaneous, positories, which may contain Suppository bases including, intramuscular, intrathecal, and intraarticular. The composi but not limited to, cocoa butter or glycerides. The composi tion may also be administered in the form of an implant, tion may also be formulated for inhalation, which may be in which allows slow release of the composition as well as a a form including, but not limited to, a solution, Suspension, or slow controlled i.v. infusion. emulsion that may be administered as a dry powder or in the (g) Dosage form of an aerosol using a propellant, such as dichlorodifluo romethane or trichlorofluoromethane. The composition may 0057 Atherapeutically effective amount of a composition also be formulated transdermal formulations comprising required for use in therapy varies with the nature of the aqueous or nonaqueous vehicles including, but not limited to, condition being treated, the length of time that activity is desired, and the age and the condition of the Subject, and is creams, ointments, lotions, pastes, medicated plaster, patch, ultimately determined by the attendant physician. The desired or membrane. dose may be conveniently administered in a single dose, or as 0052. The composition may also be formulated for multiple doses administered at appropriate intervals, for parenteral administration including, but not limited to, by example as one, two, three, four or more subdoses per day. injection or continuous infusion. Formulations for injection Multiple doses often are desired, or required. may be in the form of Suspensions, Solutions, or emulsions in 0.058 When given in combination with other therapeutics, oily or aqueous vehicles, and may contain formulation agents the composition may be given at relatively lower dosages. In including, but not limited to, Suspending, stabilizing, and addition, the use of targeting agents may allow the necessary dispersing agents. The composition may also be provided in a dosage to be relatively low. Certain compositions may be powderform for reconstitution with a suitable vehicle includ administered at relatively high dosages due to factors includ ing, but not limited to, sterile, pyrogen-free water. ing, but not limited to, low toxicity, high clearance, low rates 0053. The composition may also be formulated as a depot of cleavage of the tertiary amine. As a result, the dosage of a preparation, which may be administered by implantation or composition may be from about 1 ng/kg to about 200 mg/kg, by intramuscular injection. The composition may be formu about 1 ug/kg to about 100 mg/kg, or about 1 mg/kg to about lated with suitable polymeric or hydrophobic materials (as an 50 mg/kg. The dosage of a composition may be at any dosage emulsion in an acceptable oil, for example), ion exchange including, but not limited to, about 1 Lug/kg, 25 mg/kg, 50 resins, or as sparingly soluble derivatives (as a sparingly g/kg, 75 g/kg, 100 g/kg, 125ug/kg, 150 g/kg, 175ug/kg. soluble salt, for example). 200 ug/kg, 225 ug/kg, 250 g/kg, 275 ug/kg, 300 ug/kg, 325 0054 The composition may also be formulated as a lipo ug/kg, 350 g/kg, 375 g/kg, 400 g/kg, 425 ug/kg, 450 Some preparation. The liposome preparation can comprise ug/kg, 475 g/kg, 500 g/kg, 525 g/kg, 550 ug/kg, 575 liposomes which penetrate the cells of interest or the stratum ug/kg, 600 g/kg, 625 g/kg, 650 g/kg, 675 ug/kg, 700 corneum, and fuse with the cell membrane, resulting in deliv ug/kg, 725 g/kg, 750 g/kg, 775 ug/kg, 800 ug/kg, 825 ery of the contents of the liposome into the cell. For example, ug/kg, 850 g/kg, 875 g/kg, 900 g/kg, 925 ug/kg, 950 liposomes may be used such as those described in U.S. Pat. g/kg,975 g/kg, 1 mg/kg, 5 mg/kg, 10 mg/kg, 15 mg/kg. 20 No. 5,077,211, U.S. Pat. No. 4,621,023 or U.S. Pat. No. mg/kg, 25 mg/kg, 30 mg/kg, 35 mg/kg, 40 mg/kg, 45 mg/kg, 4.508,703, which are incorporated herein by reference. A 50 mg/kg, 60 mg/kg, 70 mg/kg, 80 mg/kg, 90 mg/kg, or 100 composition intended to target skin conditions can be admin mg/kg. istered before, during, or after exposure of the skin of the mammal to UV or agents causing oxidative damage. Other II. Vector Suitable formulations can employ niosomes. Niosomes are 0059 Another aspect of the invention is a vector that may lipid vesicles similar to liposomes, with membranes consist be used in a method for screening for a modulator of mTOR, US 2009/0208.953 A1 Aug. 20, 2009 or alternatively, the neurofibrominpathway. Generally speak tance (Tc), bacterial kanamycin-resistance (Kan), Zeocin ing, the vector may comprise an mTOR-responsive promoter resistance, the AURI-C which confers resistance to the anti and a reporter gene. biotic aureobasidin A, phosphinothricin-resistance, neomy (a) mTOR-Responsive Promoter cin phosphotransferase gene (mptI), puromycin resistance or 0060 Typically, the mTOR-responsive promoter is sensi hygromycin-resistance. tive to changes in mTOR activity. For example, increased mTOR activity typically induces increased promoter activity (c) Neurofibromin Pathway of the mTOR-responsive promoter. Alternatively, decreased mTOR activity typically induces reduced promoteractivity of 0064. The neurofibromin pathway, as used herein, refers the mTOR-responsive promoter. Consequently, the mTOR to biomolecules whose activity contributes to the pathogen responsive promoter is typically responsive to loss of neurofi esis of NF1 due to the loss of neurofibromin protein function. bromin1 function (increased mTOR activity) and rapamycin For instance, non-limiting examples of biomolecules in the inhibition (decreased mTOR activity). neurofibromin pathway include mTOR, Rac1, NPM, S6, etc. 0061 The mTOR-responsive promoter may comprise a 0065 For example, loss of neurofibromin function in a cell terminal oligopyrimidine (TOP) sequence. Usually, TOP may result in high levels of mammalian target of rapamycin sequences are comprised of between about 5 to about 15 (mTOR) pathway activation. In addition, gliomas from Sub pyrimidine nucleic acids. Non-limiting examples of TOP jects with NF1 as well as from neurofibromin 1 genetically sequences include the sequences as set forth in Table 1. engineered mice (GEM) typically have high levels of mTOR pathway activation. Loss of neurofibromin function in human TABLE 1. MPNST cells may also correlate with high levels of mTOR activation. mTOR activation may be selectively inhibited by ACCESSION NO Sequence rapamycin. L243.71 CUCUUUCC 0.066 mTOR is a protein serine-threonine kinase that inte grates nutrient and mitogen signals to regulate cell growth M77232 CCUCUUUUCC and proliferation. mTOR may have downstream effectors, (SEQ ID NO: 1) including two signaling pathways that may act in parallel to X67247 CUCUUUCC coordinate mRNA translation: the 70-kDa ribosomal protein S6 kinase (S6K) pathway and the eukaryotic translation ini ABO28894. CCUUUCUCC tiation factor 4E (eIF4E)-binding protein 1 (4EBP1)/elF4E pathway. Increased mTOR signaling may result in phospho KO2928 CCUUUCU rylation and activation of S6K, which may then phosphory D2835 O CUUUUUCCUCUCUUC late and activate the S6 protein, a 40S ribosomal protein. (SEQ ID NO: 2) Phosphorylated S6 may increase the translation of mRNAs containing a 5'-terminal oligopyrimidine domain (5'-TOP), 0062. In one embodiment, the mTOR-responsive pro many of which are ribosomal proteins, translation elongation moter may comprise the untranslated region (UTR) sequence factors and nucleolar chaperones. Hence, both S6k and the of NPM, such as a portion of the 5' UTR. The 5' UTR may eIF4E pathway are in the neurofibromin pathway. comprise a TOP sequence. Such a TOP sequence, for instance, may comprise the sequence as set forth in Table 2. III. Cell 0067. Yet another aspect of the invention encompasses a TABLE 2 cell comprising the vector described in section II above. A cell SEQ ID NO Gene Sequence of the invention may be used in a method for screening for a modulator of mTOR, or alternatively, the neurofibrominpath 3 NPM1. CUUUCCUUGGCGUGAUUCCGUCCUGCGCGUCUGU UCUGUGGAACAGGAGGCAGUUGUUUUCCGUCCGGCU way. In some embodiments, the cell may further comprise a UCUCCCACACCGAAGUGCGCGCCUCCACCUC neurofibromin 1 gene. In certain embodiments, the cell may be an astrocyte, a glial cell, a glioma cell, a Schwann cell, or a malignant peripheral nerve sheath tumor cell (MPNST) or cell line, such as ST88-14 or NF90.8. The cell may lack (b) Reporter Gene neurofibromin 1 expression. The cell may be a mammalian 0063. The mTOR-responsive promoter is generally oper cell. Non-limiting examples of mammaliancells include cells ably linked to a reporter gene, which may encode a detectable from laboratory animals (i.e. rats, mice, guinea pigs, etc.), marker. The marker may confer a phenotype on a host cell in non-human primates, and humans. which it is expressed to facilitate the screening or detection of 0068. The cell may have reduced neurofibromin function, cells in which the activity of the m-TOR-responsive promoter which may be due to a variety of reasons, including, but not is modulated. Markers may include screening markers and/or limited to, a loss of function neurofibromin mutation or selectable markers. Non-limiting examples of Screening expression of a neurofibromin 1 Small interfering RNA. The markers may include beta-galactosidase (B-gal), beta-glucu loss of function neurofibromin mutation may result in ronidase (GUS), chloramphenicol acetyltransferase (CAT), increased mTOR pathway signaling. The neurofibromin 1 green fluorescent protein (GFP), enhanced GFP (EGFP), yel mutant cell may be a primary culture cell. Such as an astrocyte low fluorescent protein (YFP), and luciferase. In one embodi from a neurofibromin 1 conditional knockout mouse. ment, the screening marker is luciferase, or another biolumi 0069. Furthermore, the cell may also express a marker that nescent marker. Non-limiting examples of selectable markers may be used to monitor cell proliferation. For instance, EGFP may include amplicillin-resistance (Amp), tetracycline-resis or another fluorescent or bioluminescent molecule indepen US 2009/0208.953 A1 Aug. 20, 2009

dent from the marker incorporated into the vector may be Sets, Versions 1 or 2, the NCI Open Collection 1 or the used to monitor cell proliferation. ChemDiv Combilab or International Collections from the NCI. IV. Method for Screening 0073. A variety of formats may be used for screening, 0070 Still another aspect of the invention encompasses a including in vitro, cell-based, in situ, and in vivo assays. Any method for screening for a modulator of mTOR. In one Suitable cells may be used. Generally speaking, the cells embodiment, the invention encompasses a method for screen should be maintained in effective conditions, meaning con ing for a modulator of the neurofibromin pathway. Generally ditions that support cell growth/proliferation if essentially no speaking, the method comprises contacting a cell with a test other regulatory compounds are present that would interfere compound, and detecting the ability of a test compound to with cell growth/proliferation. Effective conditions include, affect the level of a marker that is operably linked to an but are not limited to, appropriate medium, temperature, pH mTOR-responsive promoter in the cell. A difference in the levels and oxygen conditions that permit cell growth. An level of the marker in a cell contacted with a test compound appropriate medium is typically a solid or liquid medium compared to the level of the marker in a control cell may comprising growth factors and carbon, nitrogen and phos indicate that the test compound is capable of modulating phate sources, as well as appropriate salts, minerals, metals mTOR, and therefore, in certain embodiments, capable of and other nutrients, such as vitamins, and includes an effec modulating the neurofibromin pathway. As used herein, tive medium in which the cell can be cultured such that the "modulating refers to increasing or decreasing the activity of cell can grow/proliferate. For example, for a mammalian cell, a biomolecule. For instance, a test compound may modulate the neurofibomin pathway if the test compound increases or the media may comprise Dulbecco's modified Eagle's decreases the activity of mTOR, Akt, NPM, Rac1, S6K1, or medium containing 10% fetal calf serum. S6. Generally speaking, the activity of a biomolecule may be 0074 Cells may be cultured in a variety of containers increased by increasing the mRNA concentration of the bio including, but not limited to, tissue culture flasks, test tubes, molecule (i.e. increasing transcription or decreasing mRNA microtiter dishes, and petri plates. Culturing is carried out at degradation), increasing the concentration of the biomolecule a temperature, pH and carbon dioxide content appropriate for (i.e. increasing translation or decreasing degradation), or the cell. Such culturing conditions are also within the skill in increasing the enzymatic activity of the biomolecule. Con the art. versely, the activity of a biomolecule may be decreased by 0075 Methods for contacting the cell with a test com decreasing the mRNA concentration of the biomolecule (i.e. pound include, but are not limited to, mixing the test com decreasing transcription or increasing mRNA degradation), pound with the cell media, electroporation, microinjection, decreasing the concentration of the biomolecule (i.e. decreas cellular expression (i.e., using an expression system includ ing translation or increasing degradation), or decreasing the ing naked nucleic acid molecules, recombinant virus, retro enzymatic activity of the biomolecule. virus expression vectors and adenovirus expression), use of 0071. In one embodiment, the method of the invention ion pairing test compounds and use of detergents for cell may be used to screen for compounds that modulate mTOR permeabilization. activity, but have no substantial effect on neurofibromin 1 0076. A modulator of the neurofibromin pathway may deficient cell growth. In another embodiment, the method of have an ICs value between 1 mM and 1 uM. In a preferred the invention may be used to screen for compounds that do not embodiment, the IC50 value may be <1 uM. substantially modulate mTOR activity, but substantially pre vent cell growth. In yet another embodiment, the method of (b) Detecting the Marker the invention may be used to screen for compounds that modulate mTOR activity and substantially prevent cell 0077. The level of the marker may be detected using tech growth. niques standard in the art including, but not limited to, colo rimetery, luminometery and fluorimetery. For example, the (a) Test Compound marker may be detected by using a fluorescent plate reader such as a FluoroSTAR dual fluorescence/luminescence plate 0072 The test compound may be present within a library reader (BMG LABTECH, Inc.). The level of the marker may (i.e., a collection of compounds). In one embodiment, the test also be detected may using pulse-labeling to determine compound may be encoded by DNA molecules within an whether a change in the level of the marker is due to a change expression library. In another embodiment, the test com in translation levels. pound may be present in conditioned media or in cell extracts. In certain embodiments, the test compound may be known in (c) Control the art as a “small molecule, which may have a molecular weight less than 10 daltons, preferably less than 10 daltons 0078. The control may be a cell that has wild-type neu and still more preferably less than 10 daltons. In some rofibromin function. The control may also be a cell contacted embodiments, the test compound may be provided as a mem with a control agent, such as PBS, cell medium, or a known ber of a combinatorial library, which includes synthetic test modulator of the neurofibromin pathway Such as rapamycin. compounds (e.g., peptides) prepared according to multiple (0079. The control may also be the level of cell growth, predetermined chemical reactions. Those having ordinary which may be indicative of the level of cytotoxicity of the test skill in the art will appreciate that a diverse assortment of such compound. A cytotoxic compound may reduce the amount of libraries may be prepared according to established proce cell growth compared to no test compound. Cell growth may dures, and members of a library of test compounds can be be determined in a number of methods, including use of a simultaneously or sequentially screened as described herein. control vector. The control vector may comprise a growth For example, the library may be the NCIStructural Diversity marker. The growth marker may be a detectable label such as US 2009/0208.953 A1 Aug. 20, 2009

EGFP. The level of EGFP may be indicative of the levelofcell the desired result. The exact amount required will vary growth and may be indicative of cell growth separate from depending on the particular compound, product or composi mTOR signaling. tion used, its mode of administration and the like. Thus, it is 0080. If contacting the cell with the test compound results not always possible to specify an exact “effective amount.” in a reduction in the level of the mTOR-responsive marker However, an appropriate effective amount may be determined compared to a no-test compound control, then the test com by one of ordinary skill in the art informed by the instant pound may be an inhibitor of the neurofibromin pathway. If disclosure using only routine experimentation. the test compound additionally does not reduce the level of I0089 “Operably linked as used herein may mean that the growth marker compared to a no-test compound control, expression of a gene is under the control of a promoter with then the test compound may not be cytotoxic. Such a test which it is spatially connected. A promoter may be positioned compound may be a selective inhibitor of the neurofibromin 5' (upstream) or 3' (downstream) of a gene under its control. pathway. The distance between the promoter and a gene may be 0081. If contacting the cell with the test compound results approximately the same as the distance between that pro in an increase in the level of the mTOR-responsive marker moter and the gene it controls in the gene from which the compared to a no-test compound control, then the test com promoter is derived. As is known in the art, variation in this pound may be an activator of the neurofibromin pathway. distance may be accommodated without loss of promoter function. The promoter may comprise a T7, TP1, lactase, or (d) High-Throughput Screening metallothionein promoter. 0082. The test compound may be screened using high (0090. “Peptide' or “polypeptide' as used herein may throughput screening. For example, a 96- or 384-well plate mean a linked sequence of amino acids which may be natural, format may be used. The test compound may be screened synthetic, or a modification or combination of natural and using a Beckman-Coulter Sagian Robotics Biomek FX Auto synthetic. mated Workstation that is capable of detecting the mTOR 0091) “Promoter as used herein may mean a synthetic or responsive marker. The high-throughput Screening may com naturally-derived molecule which is capable of conferring, prise detecting the mTOR-responsive and the growth marker activating or enhancing expression of a nucleic acid in a cell. in a dual-labeled cell, enabling direct readout of fluorescence A promoter may comprise one or more specific transcrip and bioluminescence non-destructively over the time-course tional regulatory sequences to further enhance expression of an experiment. The method may be capable of distinguish and/or to alter the spatial expression and/or temporal expres ing cytotoxic versus cytostatic compounds throughout the sion of same. A promoter may also comprise distal enhancer course of a screen by multiple robotic readouts. or repressor elements, which can be located as much as sev eral thousand base pairs from the start site of transcription. A V. Mouse Comprising Vector of the Invention promoter may be derived from Sources including viral, bac terial, fungal, plants, insects, and animals. A promoter may 0083. A further aspect of the invention encompasses a regulate the expression of a gene component constitutively, or mouse that comprises the vector detailed in section II above. differentially with respect to cell, the tissue or organ in which Methods of engineering a mouse to comprise a nucleic acid expression occurs or, with respect to the developmental stage vector are well known in the art. Such a mouse may be useful at which expression occurs, or in response to external stimuli for screening for modulators of mTOR. Such as physiological stresses, pathogens, metal ions, or inducing agents. Representative examples of promoters DEFINITIONS include the bacteriophage T7 promoter, bacteriophage T3 0084. The terminology used herein is for the purpose of promoter, SP6 promoter, lac operator-promoter, tac promoter, describing particular embodiments only and is not intended to SV40 late promoter, SV40 early promoter, RSV-LTR pro be limiting. As used in the specification and the appended moter, CMV IE promoter, SV40 early promoter or SV40 late claims, the singular forms “a,” “an and “the include plural promoter and the CMV IE promoter. referents unless the context clearly dictates otherwise. 0092. As used herein, “treating” means reversing, allevi 0085 For the recitation of numeric ranges herein, each ating, inhibiting the progress of, or preventing neurofibroma intervening number there between with the same degree of tosis, or one or more symptoms of such disorder or condition. precision is explicitly contemplated. For example, for the The term “treatment, as used herein, unless otherwise indi range of 6-9, the numbers 7 and 8 are contemplated in addi cated, refers to the act of treating as “treating is defined tion to 6 and 9, and for the range 6.0–7.0, the number 6.0, 6.1, immediately above. 6.2, 6.3, 6.4., 6.5, 6.6, 6.7, 6.8, 6.9, and 7.0 are explicitly 0093 “Vector” as used herein may mean a nucleic acid contemplated. sequence containing an origin of replication. A vector may be I0086) “Administer as used herein to describe the dosage a plasmid, bacteriophage, bacterial artificial chromosome or of a compound, may mean a single dose or multiple doses of yeast artificial chromosome. A vector may be a DNA or RNA the compound. vector. A vector may be either a self-replicating extrachro 0087. “Combination with as used herein to describe mosomal vector or a vector which integrates into a host administration of a first treatment and an additional treatment genome. Large numbers of suitable vectors and promoters are means that the first treatment may be administered prior to, known to those of skill in the art and are commercially avail together with, or after the additional treatment, or a combi able. The following vectors are provided by way of example. nation thereof. Bacterial: plNCY (Incyte Pharmaceuticals Inc., Palo Alto, I0088. “Effective amount” or “therapeutically effective Calif.), pSPORT1 (Life Technologies, Gaithersburg, Md.). amount as used herein in reference to a compound, product, pOE70, pCRE60, pGE-9 (Qiagen) pBs, phagescript, psix174, or composition as provided herein, may mean a sufficient pBluescript SK, pBsKS, pNH8a, pNH16a, pNH18a, pNH46a amount of the compound, product or composition to provide (Stratagene); pTrc99A, pKK223 3, pKK233 3, pIDR540, US 2009/0208.953 A1 Aug. 20, 2009 pRIT5 (Pharmacia); Eukaryotic: pWLineo, pSV2cat, pCG44, these experiments demonstrate that the growth of neurofibro pXT1, pSG (Stratagene) pSVK3, pBPV, pMSG, pSVL (Phar min-deficient mouse and human cells can be inhibited with macia). low doses of rapamycin. Example 3 EXAMPLES Neurofibromin Regulation of mTOR Signaling 0094. The following examples illustrate various iterations 0098. Evidence exists for direct activation of mTOR sig of the invention. naling by Akt as well as indirect activation of mTOR by Akt through the tuberous sclerosis complex (TSC)/Rheb pathway. Example 1 Studies have shown that the mTOR activation resulting from neurofibromin loss in astrocytes can be reversed by restoring NF1-Deficient Cells and Tumors Exhibit High Lev NF1-GAP activity (NF1 GRD), blocking K-RAS activity els of mTOR Pathway Activation (K-RASN 17), or inhibiting PI-3K activation of Akt. In these experiments, replacement of the GAP domain in neurofibro 0095. Two-dimensional gel proteomic profiling was used min 1 deficient astrocytes reduced S6 activation levels to to identify signaling pathways deregulated by neurofibromin normal (FIG. 7a). Similarly, the increased S6 activation in 1 inactivation in astrocytes. These experiments demonstrated neurofibromin 1 deficient astrocytes was reversed upon the increased expression of numerous members of the ribosomal introduction of a dominant inhibitory K-RAS molecule (FIG. synthesis pathway, including NPM, a key regulator of ribo 7b) or inhibition of PI-3K using the LY294.002 compound Some maturation and export (FIG. 1). Since ribosomal Syn (FIG. 4b). Collectively, these results suggest that neurofibro thesis is modulated by the mTOR/S6K pathway, the activa min regulates mTOR signaling through RAS/Akt. (0099 While one report found that neurofibromin 1 regu tion status of select members of the mTOR pathway was lation of mTOR signaling involved the TSC/Rheb pathway, analyzed, including S6K1, S6, and 4EP-B1 using activation several lines of evidence using primary astrocytes argue specificantibodies (FIG.2). Increased activation of S6K1 and against this interpretation. Previous studies on Tscl-deficient S6, but not 4E-BP1, in neurofibromin 1 deficient astrocytes astrocytes suggest that the phenotypes of these cells are dra was observed, suggesting that the S6K1/S6 arm of the mTOR matically different from neurofibromin 1 deficient astrocytes. pathway was hyperactivated. To provide an in Vivo correlate First, neurofibromin 1 deficient, but not Tscl-deficient, astro for these in vitro findings, mTOR pathway activation was cytes exhibit increased cell growth under Sub-confluent con examined in optic glioma arising in neurofibromin 1 geneti ditions. Second, Tsc1-deficient, but not neurofibromin 1 defi cally-engineered mice (GEM) and in human NF1-associated cient, astrocytes exhibit dramatic increases in cell size. Third, pilocytic astrocytoma. S6 hyperactivation in both mouse and while Tsc1-deficient astrocytes exhibit increased 4E-BP1 human optic glioma was observed by immunostaining with activation, no change in 4EBP1 activation is seen in neurofi an activation-specific S6 phospho-antibody (FIG. 3). These bromin 1 deficient astrocytes (FIG. 2). In each case, the results suggest that mTOR activation is maintained in NF1 abnormal Tsc1 and neurofibromin 1 astrocyte pheno associated tumors in vivo, and that mTOR inhibition may be types were reversed by mTOR inhibition (rapamycin treat a logical target for biologically-based therapy against tumors ment). To provide additional evidence for a TSC/Rheb-inde arising in NF1. pendent mechanism of mTOR activation in neurofibromin 1 deficient astrocytes, a compound (FTI-276) that has been Example 2 shown to block Rheb activation was examined. In these experiments, it was found that FTI-276 effectively blocks S6 Rapamycin Inhibition of mTOR Pathway Activation activation in Tsc1-deficient astrocytes; however Rheb inhibi Blocks Neurofibromin 1 Deficient Cell Growth tion in neurofibromin 1 astrocytes did not reduce S6 hyper activation (FIG. 8). These studies provide preliminary evi 0096 Pharmacologic inhibitors that block mTOR activa dence for a TSC/Rheb-independent mechanism. tion include rapamycin and related synthetic derivatives (e.g., RAD001, CCI-779). First, it was demonstrated that rapamy Example 4 cin inhibits mTOR pathway activation in neurofibromin 1 deficient astrocytes. In these experiments, complete inhibi mTOR-dependent Rac1 Hyperactivation in the tion of S6 activity was observed using phospho-specific anti Absence of Neurofibromin bodies after treatment with 1 nM rapamycin (FIG. 4). 0100. The small GTPase Rac1 has also been shown to act 0097. Second, this low dose of rapamycin was shown to downstream of mTOR and modulate actin stress fiberforma completely inhibit the proliferative advantage of neurofibro tion. Previous studies have shown that neurofibromin 1 min 1 astrocytes in vitro without any effect on the growth astrocytes have increased levels of active, GTP-bound Rac1. of wild-type (neurofibromin1") astrocytes (FIG.5). Finally, To determine whether Rac1 hyperactivation was mediated by a human NF1-associated MPNST cell line (ST88-14) was mTOR signaling in astrocytes, wild-type and neurofibromin engineered with a luciferase expression construct to allow for 1 astrocytes were treated with rapamycin (10 nM) and in vivo visualization and in vitro rapid analyses of cell growth Rac1 activation was assayed. In these experiments, it was (FIG. 6). Using the ST88-14-luc cell line, treatment with found that rapamycin blocked Rac1 hyperactivation in neu rapamycin effectively inhibited MPNST cell growth in vitro. rofibromin 1 astrocytes (FIG. 9A), indicating that Rac1 Moreover, these engineered MPNST cell lines can be acts downstream of mTOR. Rac1 has also been shown to explanted into athymic nu/nu mice and tumor growth mea regulate cell proliferation in a variety of cell types and sured by bioluminescence imaging (FIG. 6d). Collectively, Rac1 mouse embryonic fibroblasts exhibit both impaired US 2009/0208.953 A1 Aug. 20, 2009 migration and cell proliferation. To determine whether Rac1 lus to the cytosol. To disrupt this process, a mutant form of regulates cell proliferation in neurofibromin 1 astrocytes, NPM (NPM double leucine mutant: NPMdL) that prevents Rac1N17 was expressed in wild-type and neurofibromin 1 NPM shuttling from the nucleolus to the cytoplasm was astrocytes and BrdU incorporation was examined. While expressed. Previous studies have shown that this mutant expression of the dominant negative Rac1 had little effect on behaves like a true dominant-negative protein, forming hete wild-type astrocytes, it restored proliferation of neurofibro rooligomers with endogenous NPM and blocking endog min 1 astrocytes to wild-type levels (FIG. 9B). Taken enous NPM from shuttling from the nucleus to the cytoplasm. together, these data indicate that Rac1 is an important regu The effect of inhibiting NPM function on neurofibromin 17 lator of mTOR-dependent actin stress fiber formation and astrocyte proliferation was examined. Similar to what was proliferation in astrocytes. observed for rapamycin treatment and Rac1N17 expression, expression of the NPMdL mutant restored proliferation to Example 5 wild-type levels (FIG.12B). Together, these data indicate that NPM is a critical mTOR effector important for regulating cell Induction of NPM is Rapamycin-Sensitive proliferation in neurofibromin 1 astrocytes. Additionally, 0101 Loss of neurofibromin has been shown to lead to the NPMdL mutant had no measurable effect on the basal dramatic (~5-fold) induction of NPM proteins. To determine proliferation of wild-type astrocytes (FIG. 12B), underscor whether NPM accumulation was dependent on hyperactiva ing its importance in neurofibromin 1 deficient astrocyte pro tion of mTOR, it was tested whether rapamycin was able to liferation. block NPM induction in response to oncogenic Rasv12. Pri 0105. A standard statistical analysis (e.g. student's T-test, mary mouse embryo fibroblasts (MEFs) were used in lieu of standard deviations) was applied for the appropriate experi astrocytes due to their immediate availability for these experi ments in order to show statistical significance. A brief ments. Twenty-four hours post-infection, rapamycin was example Summary of protein expression significance is listed added to serum-stimulated or RasV12-infected mouse in Table 1 (shown as SD for three independent experiments). embryo fibroblasts and samples were collected 24 hours later. Analysis by Western blot demonstrated that NPM induction TABLE 1 by serum or Ras V12 was sensitive to rapamycin (Rap) treat ments (FIG. 10). Protein Proteomics Western 0102. In addition, it was also shown that the elevated NPM NPM 5.7 0.75 6.40.62 expression in neurofibromin 1 deficient astrocytes can be rpL7 S.O. O.96 S.O.O.92 restored to wild-type levels with rapamycin treatment both in rpL10a 4.3 1.31 ND vitro and in vivo (FIG. 11). Phospho-S6 ND 9.9 - 1.74 Example 6 0106 Densitometry was performed on the indicated pro tein spots (Proteomics) or bands (Western blot) to determine Nucleophosmin Induction in the Absence of Neurofi the expression fold increase from neurofibromin 1 null cells bromin Requires Rac1 Signaling over wild-type astrocytes. Standard deviations are presented (0103 Because S6K/S6 and Rac1 were the mTOR effec from three independent experiments. tors activated in neurofibromin 1 astrocytes, it was deter mined whether either of these mTOR targets regulated NPM Example 8 expression. When S6K was overexpressed in wild-type astro Screening for Modulators of the Neurofibromin cytes, there was no change in NPM expression, despite an Pathway increase in S6 phosphorylation. This is in Stark contrast to NPM regulation in primary MEFs where S6K is a potent 0107 mTOR-Responsive Luciferase Reporter inducer of NPM protein expression and highlights the poten 0108. This example describes a process for generating a tial differences in mTOR signaling mechanisms between luciferase reporter that is sensitive to mTOR pathway activa fibroblasts and astrocytes. However, when Rac1N17 (domi tion resulting from neurofibromin loss. The 5'-untranslated nant negative mutant) was expressed in neurofibromin 1 region of NPM was cloned. This region was previously shown astrocytes, NPM expression was greatly attenuated (FIG. to contain a 5'-terminal oligopyrimidine (TOP) domain, mak 12A). No change in S6 or Akt activity was observed following ing it sensitive to mTOR signals. Using this domain, a hybrid Rac1N17 expression in neurofibromin 1 or wild-type mRNA with the open reading frame of the firefly luciferase astrocytes, again demonstrating that Rac1 functions down gene was generated. stream of mTOR. Collectively, these results suggest that 0109 The hybrid mRNA was generated as follows (see NPM functions downstream of mTOR and Rac1 viaan S6K schematic of FIG. 13). 5'-RACE was used to identify the independent mechanism in neurofibromin 1 deficient astro 5'-untranslated region (UTR) of mouse NPM that is con cytes. served in humans. The NPM 5'-UTR contains a putative terminal oligopyrimidine (TOP) sequence. In order to gener Example 7 ate a hybrid reporter that is responsive to mTOR signals, the Nucleophosmin Mediates Cell Proliferation of Neu 5'-NPM TOP domain was fused to the extreme 5' end of the luciferase gene using unique Kipn and Nicol restriction sites rofibromin 1 Astrocytes in the pGL3-Basic reporter vector (Promega). The NcoI site 0104. To determine whether NPM regulates actin stress enabled placement of the TOP domain immediately adjacent fiber formation in neurofibromin 1 astrocytes, a novel to the luciferase ATG start codon without adding any NPM mutant was used to disrupt NPM function. One of the unwanted DNA sequences. This vector lacked an artificial major roles of NPM is to mobilize ribosomes from the nucleo promoter (e.g. CMV, MSCV) that could interfere with trans US 2009/0208.953 A1 Aug. 20, 2009

lation of resulting transcripts (due to addition of sequences to effects of each compound on both neurofibromin 1 deficient the 5'-UTR), and contained a polyA tail at the 3' end of the MPNST proliferation and NPM 5'-TOP-luciferase expres luciferase gene to increase RNA stability. In this regard, the sion in tandem to determine which compounds inhibit cell 5'NPM TOP reporter should reflect regulation that is solely growth versus mTOR-driven luciferase expression. Each col defined by the 5'-NPM TOP domain. umn on the plate will contain engineered MPNST cells and will be tested with 11 compounds per plate at 5uM concen Responsiveness of the Reporter to Loss of Neurofibromin 1 tration. Cells will be incubated in test compound for 72 hours. Function At a rate of 220 compounds tested per day, the diversity set will be screened in 9 days. Each plate will have a control 0110 Wild-type and neurofibromin 1 null astrocytes were column with no compounds added, which allows for a first transduced with the NPM-TOP-luciferase reporter. Cells visual “hit scan. For growth measurements, EGFP fluores were harvested and lysed 48 hours after transduction and cence will be monitored using a fluorescent plate reader assayed for luciferase activity by direct luminescence mea which will be optimized with control experiments prior to the Surements. Northern blot analysis was performed using actual screening assays. Fluorescence of each well will be probes specific for luciferase in order to normalize for any measured with a highly sensitive FluoroSTAR dual fluores alterations in the reporter's transcription rate to ensure that cence/luminescence plate reader (BMG LABTECH, Inc.) any differences in luciferase activity were a measure of trans recently installed on a Sagian Robotics System platform. This lation of the reporter and not in its transcription. As antici will allow facile and sensitive determination of cell mass as a pated, astrocytes lacking neurofibromin 1 displayed an control R-luc function of compound identity on each plate approximate 12-fold increase in TOP-luciferase activity com using a standard cell proliferation assay. The advantage of this pared to wild-type cells (FIG. 14), indicating that this reporter method is that transduced, dual-labeled MPNST cells will is responsive to signals resulting from loss of neurofibromin. enable direct readout of fluorescence and bioluminescence non-destructively over the time-course of an experiment, Screening thereby providing a method to distinguish cytotoxic versus 0111 Neurofibromin-deficient cell types would be used cytostatic compounds throughout the course of a screen by for these experiments. For the initial studies, human neurofi multiple robotic readouts. Neurofibromin1 deficient MPNST bromin 1 deficient MPNST cells (ST88-14 and NF90.8) cells have been engineered to express Renilla luciferase (FIG. could be used as a primary filter for identifying compounds 15). that inhibit mTOR pathway activation and cell growth. 0115 This method will be consistent with the biolumines MPNST cells would be engineered to independently express cence technique for measuring NPM5'-TOP-luciferase activ the mTOR reporter construct as well as a separate transgene ity. After readout on the FluoroSTAR, data will be analyzed with enhanced green fluorescent protein (EGFP) expression. using a 96-well grid template available with the instrument EGFP expression can be used to measure cell growth sepa software, which allows for fast and accurate determination of rately from mTOR activation. Compounds with activity in the emitted photons per well. The FluoroSTAR system soft this initial screen may be validated using neurofibromin 1 ware enables data to be directly transferred to Excel spread deficient astrocytes derived from postnatal day 1-2 (PN1-2) sheets where values will be further analyzed. These positive pups. This secondary screen will employ standard prolifera “hits” in the first round will then be further analyzed, includ tion assays, protein translation assessments, and measure ing tests for true positives, since a reduction in signal might ments of mTOR pathway activation, as described herein. result from fewer cells due to potential toxicity of any one 0112. The NPM 5'-TOP-luciferase reporter described compound within the Diversity Set. above may be used to screen for novel mTOR pathway inhibi 0116. Positive controls will be present in each plate in tors. For transduction of the ST88-14-EGFP+MPNST cells, a duplicate, represented by high-dose rapamycin (10 uM). puromycin cassette was placed in the NPM 5'-TOP-luciferase Negative controls will be present as vehicle only wells con construct to allow for rapid selection of EGFP+ cells express taining the same Volume and concentration of vehicle, but no ing the luciferase reporter. Luminescence and Western blot compounds. analysis will be performed using antibodies against luciferase to ensure properluciferase expression in the transduced cells. Phase II This reporter construct worked in vitro and provided a suffi 0117. Once modest throughput methods are validated in cient signal to allow for the high throughput screen (see FIG. Phase I with the smaller compound library, the Sagian Robot 14). ics System will be implemented for screens of the 90,000 0113. Two phases of screening will be employed. Phase I compound NCI Open Collection 1. The same cells, expres will be performed in 96-well plates with hand-held multipi sion cassettes and methods will be used to screen larger petters and will be used to screen the 2000-compound NCI diversity sets of compounds. As a conservative estimate, Structural Diversity Sets (Versions 1 and 2) obtained from the three-thousand compounds can be screened per day with the NCI Developmental Therapeutics Program. Results from Sagian Robotics System and thus, the Open Collection 1 can Phase I will be applied to scale up in Phase II. Phase II will be be screened in 30 days. It is reasonable to anticipate that 6,000 performed with 384-well plates and our recently purchased compounds per day may be achievable, cutting screening Beckman-Coulter Sagian Robotics Biomek FX Automated time in half. Additional libraries from the NCI, such as the Workstation will be used to screen the 90,000-compound NCI ChemDiv Combilab and International Collection, are avail Open Collection 1. able. 0118. After the first round of screening, any hits obtained Phase I could be further validated in a second round of assays using 0114. This initial screen will be performed in duplicate neurofibromin 1 and wild-type astrocytes. Astrocyte cul 96-well plates. The duplication will be used to assay the tures could be chosen as a secondary screen because (a) they US 2009/0208.953 A1 Aug. 20, 2009

are primary cell cultures directly from neurofibromin 1 could be studied for their ability to inhibit neurofibromin 1 genetically-engineered mice, (b) they are genetically engi deficient astrocyte proliferation, protein translation, NPM neered to lack neurofibromin 1 expression, and (c) they rep expression, ribosome nuclear export, and mTOR pathway resent a clinically-relevant cell type involved in the formation activation. 0119 Compounds would be expected to fall into three of NF 1 -associated brain tumors. MPNST cells have been general categories: (1) those that prevent luciferase expres adapted to growth in vitro for nearly two decades and likely sion by inhibiting mTOR pathway activity but have no effect contain a number of other genetic changes which may con on neurofibromin 1 deficient cell growth, (2) those that pre tribute to mTOR pathway hyper-activation. In this fashion, vent growth but not mTOR activity and (3) those that inhibit we will be able to evaluate compounds that specifically target both mTOR pathway activity and cell growth. Compounds mTOR activation that results from neurofibromin loss in cells that fall into class 1 or 2 are unlikely to be valuable reagents that represent a primary cell type relevant to an important for drug design, but class 1 compounds may provide impor clinical manifestation of NF1. Lead compounds showing tant molecular probes to dissect the mTOR signaling pathway selectivity will then be further tested as a function of concen in mammalian cells. Class 2 compounds are likely to be tration to generate an ICso. Only those compounds showing cytotoxic or general inhibitors of proliferation (e.g. Cdk selective cytotoxicity with ICso values <1 uM will be further inhibitors, non-specific and general kinase domain inhibi characterized. Desired compounds would be expected to tors). Compounds that fall into the third group may be of great selectively block the proliferation of neurofibromin 1, but interest, especially those compounds with ICso values <1 uM not wild-type astrocytes. Furthermore, these compounds and selectivity toward neurofibromin 1 deficient astrocytes.

SEQUENCE LISTING

<16 Oc NUMBER OF SEO ID NOS: 4

<210 SEQ ID NO 1 <211 LENGTH: 10 &212> TYPE RNA <213> ORGANISM: Homo sapiens

<4 OO SEQUENCE: 1

CCCLLCC 1O

<210 SEQ ID NO 2 <211 LENGTH: 15 &212> TYPE RNA <213> ORGANISM: Homo sapiens

<4 OO SEQUENCE: 2

CLC CLC clic 15

<210 SEQ ID NO 3 <211 LENGTH: 101 &212> TYPE RNA <213> ORGANISM: Homo sapiens

<4 OO SEQUENCE: 3

cuuucculugg cqugalulu.ccg uC clugcgcgu Culguuclugug galacaggagg caguluguuluu 60

ccguccggcu ulcucccacac Caagugcgc gccuccaccu. C

<210 SEQ ID NO 4 <211 LENGTH: 101 &212> TYPE: DNA <213> ORGANISM: Mus musculus

<4 OO SEQUENCE: 4

Ctttic cttgg cqtgatt CC g to ctg.cgcgt. Ctgttctgtg galacaggagg cagttgttitt 60

cc.gtc.cggct tcticc cacac cqaagtgcgc gcct coacct c US 2009/0208.953 A1 Aug. 20, 2009

1. A method for treating neurofibromatosis, the method 10. The cell of claim 9, wherein the cell comprises a neu comprising administering to a Subject in need thereof an rofibromin 1 mutation. inhibitor of nucleophosmin (NPM). 11. The cell of claim 9, wherein the mTOR-responsive 2. The method of claim 1, wherein the inhibitor is promoter comprises a TOP domain. NSC3848884. 3. The method of claim 1, further comprising administer 12. The cell of claim 11, wherein the TOP domain is a ing an inhibitor of Rac1. nucleophosmin 5'-UTRTOP domain (5'-NPMTOP domain). 4. The method of claim 1, further comprising administer 13. The cell of claim 9, wherein the reporter gene encodes ing rapamycin. luciferase. 5. A method for treating neurofibromatosis, the method 14. The cell of claim 9, wherein the cell is of a type selected comprising administering to a Subject in need thereof an from the group consisting of astrocyte, Schwann cell, malig inhibitor of Rac1. nant peripheral nerve sheath tumor (MPNST) strainST88-14, 6. The method of claim 5, wherein the inhibitor is selected and MPNST Strain 90.8. from the group consisting of NSC 23766, 553502, and 15. A method of screening for a modulator of the neurofi EHT1864. bromin pathway, the method comprising: 7. The method of claim 5, further comprising administer (a) contacting the cell of claim 9 with a test compound; and ing an inhibitor of NPM. (b) measuring the level of a marker encoded by the reporter 8. The method of claim 5, further comprising administer gene, wherein a level of the marker compared to a con ing rapamycin. trol is indicative of a modulator of the neurofibromin 9. A cell comprising a vector, wherein the vector comprises pathway. a reporter gene operably linked to a mTOR-responsive pro moter.