DOCSLIB.ORG

(12) Patent Application Publication (10) Pub. No.: US 2009/0208953 A1 Gutmann Et Al

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
(12) Patent Application Publication (10) Pub. No.: US 2009/0208953 A1 Gutmann Et Al US 20090208953A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2009/0208953 A1 Gutmann et al. (43) Pub. Date: Aug. 20, 2009 (54) NEUROFIBROMIN PATHWAY MODULATORS Related U.S. Application Data (75) Inventors: David Gutmann, St. Louis, MO (60) Provisional application No. 60/987,156, filed on Nov. (US); Jason Weber, St. Louis,MO 12, 2007. (US) Publication Classification Correspondence Address: (51) Int. Cl. POLSNELLISHUGHART PC CI2O I/68 (2006.01) 100 SOUTH FOURTH STREET, SUITE 100 A63L/436 (2006.01) SAINT LOUIS, MO 63102-1825 (US) CI2N 5/10 (2006.01) (73) Assignee: WASHINGTON UNIVERSITY (52) U.S. Cl. .............................. 435/6; 514/291; 435/325 INST. LOUIS, St. Louis, MO (US) (57) ABSTRACT (21) Appl. No.: 12/269,681 The present invention encompasses methods for treating neu rofibromatosis and methods for screening for modulators of (22) Filed: Nov. 12, 2008 the neurofibromin pathway. A g-liai sacrifia y-N-y {Y-Niceti Patent Application Publication Aug. 20, 2009 Sheet 1 of 15 US 2009/0208953 A1 ex-Tubulin sy....a sy-N-y {Y-Nisieois {-Cycii D F.G. 1 Niff +/- Nff-i- Akt. S6KP S6-P AEBP1-P total Akt FG 2 Patent Application Publication Aug. 20, 2009 Sheet 2 of 15 US 2009/0208953 A1 floX/mut Control Nf 1 Cre Patent Application Publication Aug. 20, 2009 Sheet 3 of 15 US 2009/0208953 A1 Neois (i. - is is B None Y Rap None Y Rap Phospho S6 - i. Affif's Niff f. FG 4 Patent Application Publication Aug. 20, 2009 Sheet 4 of 15 US 2009/0208953 A1 xx s s h s s s s Rs s s h h s h s s s a R s h s s h s h s s s s -- s s s h s h s h s s s - h s s h s s h r Patent Application Publication Aug. 20, 2009 Sheet 5 of 15 US 2009/0208953 A1 A 70000 B rapamycin (nM) O 1 10 100 60000 50000 40000 30000 20000 10000 0 &n wany w xxxx O 1 10 rapamycin (nM) S ŠSS Patent Application Publication Aug. 20, 2009 Sheet 6 of 15 US 2009/0208953 A1 Image Min = 1857.5 Max = 13152 p/sec/cm^2/sr Color Bar Min = 1312.5 Max = 11865 FG 6D Patent Application Publication Aug. 20, 2009 Sheet 7 of 15 US 2009/0208953 A1 & vS- ge s & s c c SX %S. s x & s S. A & & % vS s s s FG 7 Patent Application Publication Aug. 20, 2009 Sheet 8 of 15 US 2009/0208953 A1 Nf1 +/* Nff-l- D F D F S6-P tubulin FG 8 Patent Application Publication Aug. 20, 2009 Sheet 9 of 15 US 2009/0208953 A1 A Nf1 +/-- Nf1 -/- SH: Hy D R D R RaC1-GTP Patent Application Publication Aug. 20, 2009 Sheet 10 of 15 US 2009/0208953 A1 Serum A Y-Tubulin NPM Phosphorylated S6 B +Ras' H EV re y-Tubulin :SSSSSS:::::8sssssssss: N w s :Sk: NPM Ras l H Raphayei FG 1 O Patent Application Publication Aug. 20, 2009 Sheet 11 of 15 US 2009/0208953 A1 NPM P-S6 (Ser 240/244) S6 B Nf 1 ff Nf filmut ; GFAP-Cre Vehicle Rapamycin s Z opCO FIG 11 Patent Application Publication Aug. 20, 2009 Sheet 12 of 15 US 2009/0208953 A1 sSKxxxxxxxxxx F.G. 12 Patent Application Publication Aug. 20, 2009 Sheet 13 of 15 US 2009/0208953 A1 5' erminal Oligo Pyrimidine Tract N.V. S. OOCCCGGCGTGATTCCGTCCTGCGCGC GT CGGGAACAGGAGGCAGGCCGCCGGC CCCCACACCGAAG GCGCGCC CCACCC -Serum transcription - for transatian PROTEN FG 13 Patent Application Publication Aug. 20, 2009 Sheet 14 of 15 US 2009/0208953 A1 :: , ". S. X 3.W S.XNNNNNWNNNNNNWNNNNNNVNNNNNNWNNNN &aera - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - EFs Astrocytes 8. 3.8sie & Neities. Sixt Assiysis FG 14. Patent Application Publication Aug. 20, 2009 Sheet 15 of 15 US 2009/0208953 A1 FG 15 US 2009/0208.953 A1 Aug. 20, 2009 NEUROFIBROMIN PATHWAY MODULATORS 0008 Another aspect of the invention encompasses a method for treating neurofibromatosis, the method compris CROSS REFERENCE TO RELATED ing administering to a subject in need thereof an inhibitor of APPLICATIONS Rac1. 0009. Yet another aspect of the invention encompasses a 0001. This application claims the priority of U.S. provi cell comprising a vector. The vector generally comprises a sional application No. 60/987,156, filed Nov. 12, 2007, which reporter gene operably linked to a mTOR-responsive pro is hereby incorporated by reference in its entirety. moter. GOVERNMENTAL RIGHTS 0010 Still another aspect of the invention encompasses a method of screening for a modulator of the neurofibromin 0002 This invention was made in part with Government pathway. The method comprises contacting a cell comprising support under Grant Number DAMD-17-03-1-0215 awarded a vector comprising a reporter gene operably linked to a by The Department of Defense and Grant Number U01 mTOR-responsive promoter with a test compound. The level CA84314 awarded by the National Cancer Institute. The of a marker encoded by the reporter gene is measured, and the Government may have certain rights in this invention. level of the marker compared to a control is indicative of a modulator of the neurofibromin pathway. FIELD OF THE INVENTION 0011. Other aspects and iterations of the invention are 0003. The present invention relates to methods for treating described more thoroughly below. neurofibromatosis and to methods for Screening for modula tors of the neurofibromin pathway. REFERENCE TO COLOR FIGURES 0012. The application file contains at least one photograph BACKGROUND OF THE INVENTION executed in color. Copies of this patent application publica 0004 NF1 is a common autosomal dominant disorder that tion with color photographs will be provided by the Office affects approximately 1:3000 people worldwide (over 100, upon request and payment of the necessary fee. 000 individuals in the United States alone) and predisposes to the development of both benign and malignant tumors, BRIEF DESCRIPTION OF THE DRAWINGS including optic glioma and malignant peripheral nerve sheath 0013 FIG.1 depicts a series of images showing that loss of tumor (MPNST). Optic glioma (astrocytoma) represents the neurofibromin in primary astrocytes results in increased second most common tumor occurring in individuals with expression of proteins involved in ribosome biogenesis. (A) NF1. Optic gliomas affect at least 15% of children with NF1, Two dimensional gel electrophoresis and MALDI-TOF typically in the first decade of life, with 52% of affected analysis demonstrated that S19, L7, and L10a as well as children developing signs or symptoms from their tumors. nucleophosmin (NPM) were increased in neurofibromin 1 Optic pathway tumors can lead to blindness or invade into (Nf1) astrocytes. (B) The two dimensional gel electro nearby brain regions or the Subarachnoid space to result in phoresis results were confirmed using Western blotting on precocious puberty or other neurological abnormalities. wild-type (Nfl**) and neurofibromin 17 (Nf1) astro 0005. The most commonly used therapy for optic pathway cytes. glioma in NF1 is chemotherapy, involving the combination of 0014 FIG.2 depicts a series of images showing that loss of carboplatin and Vincristine. Although initial clinical neurofibromin expression results in increased mTOR path responses are observed in 60-80% of children with low-grade way activation. Using activation-specific (phospho) antibod glioma, tumor progression occurs in 36% of children with ies, neurofibromin 1 (Nfl') astrocytes exhibit increased optic pathway glioma, necessitating additional therapy. S6K1 and S6 activation relative to wildtype (Nf1") astro MPNSTs are highly aggressive and malignant tumors com cytes, with no change in 4E-BP1 activation. A Small increase posed of neoplastic Schwann cells. Recent studies have in Akt activation was also observed. shown that MPNSTs are not uncommon cancers in NF1, and 0015 FIG.3 depicts a series of micrographs showing that affect nearly 10% of individuals with NF1. MPNSTs fre mTOR pathway hyperactivation is seen in NF1-associated quently recur after treatment, and often metastasize to lung mouse and human glioma. Increased S6 activation (phospho and other organs. Current treatment is wide local excision S6 antibody) is observed in two models of Nfl GEM optic followed by local radiation. However, 5-year survival rates glioma (panels B, D) relative to control brain (panels A, C) as are dismal, and no effective chemotherapy regimens are avail well as in two representative human NF1-associated gliomas able. In addition, mean survival appears to be worse in NF1 (panels E, F). subjects with MPNST than for those in the general popula 0016 FIG. 4 depicts a series of images showing that neu tion. rofibromin 1 deficient astrocytes exhibit increased mTOR 0006. There is an unmet need in the art for more effective pathway activation, which is blocked by rapamycin. (A) Neu treatment of these tumors. New treatment discovery is heavily rofibromin 1 (Nfl') astrocytes exhibit high levels of acti dependent on the ability to evaluate new chemotherapeutic vated S6 detected using phosphospecific antibodies com compounds that target this important neurofibromin growth pared to Nifl" wild-type astrocytes. (B) Treatment of regulatory pathway. neurofibromin 1 (Nfl') astrocytes with rapamycin (Rap) or an inhibitor of PI-3K to block Akt activation (LY) elimi SUMMARY OF THE INVENTION nates the increased mTOR pathway activation (S6 phospho 0007. One aspect of the present invention encompasses a rylation). method for treating neurofibromatosis, the method compris 0017 FIG. 5 depicts a graph showing that treatment of ing administering to a subject in need thereof an inhibitor of neurofibromin 1 (Nf1) astrocytes with rapamycin inhib nucleophosmin (NPM). its cell proliferation. Nfl" (wild-type) or neurofibromin 1 US 2009/0208.953 A1 Aug. 20, 2009 (Nf1) astrocytes were treated with vehicle (D) or rapamy infected with retroviruses encoding 3-galactosidase (EV) and cin (R) and proliferation measured by thymidine incorpora Rasv12.
Load more

Recommended publications
  • Regulation of the Mammalian Target of Rapamycin Complex 2 (Mtorc2)
    Regulation of the Mammalian Target Of Rapamycin Complex 2 (mTORC2) Inauguraldissertation Zur Erlangung der Würde eines Doktors der Philosophie vorgelegt der Philosophisch-Naturwissenschaftlichen Fakultät der Universität Basel von Klaus-Dieter Molle aus Heilbronn, Deutschland Basel, 2006 Genehmigt von der Philosophisch-Naturwissenschaftlichen Fakultät Auf Antrag von Prof. Michael N. Hall und Prof. Markus Affolter. Basel, den 21.11.2006 Prof. Hans-Peter Hauri Dekan Summary The growth controlling mammalian Target of Rapamycin (mTOR) is a conserved Ser/Thr kinase found in two structurally and functionally distinct complexes, mTORC1 and mTORC2. The tumor suppressor TSC1-TSC2 complex inhibits mTORC1 by acting on the small GTPase Rheb, but the role of TSC1-TSC2 and Rheb in the regulation of mTORC2 is unclear. Here we examined the role of TSC1-TSC2 in the regulation of mTORC2 in human embryonic kidney 293 cells. Induced knockdown of TSC1 and TSC2 (TSC1/2) stimulated mTORC2-dependent actin cytoskeleton organization and Paxillin phosphorylation. Furthermore, TSC1/2 siRNA increased mTORC2-dependent Ser473 phosphorylation of plasma membrane bound, myristoylated Akt/PKB. This suggests that loss of Akt/PKB Ser473 phosphorylation in TSC mutant cells, as reported previously, is due to inhibition of Akt/PKB localization rather than inhibition of mTORC2 activity. Amino acids and overexpression of Rheb failed to stimulate mTORC2 signaling. Thus, TSC1-TSC2 also inhibits mTORC2, but possibly independently of Rheb. Our results suggest that mTORC2 hyperactivation may contribute to the pathophysiology of diseases such as cancer and Tuberous Sclerosis Complex. i Acknowledgement During my PhD studies in the Biozentrum I received a lot of support from many people around me who I mention here to express my gratefulness.
    [Show full text]
  • Lymphocyte/WBC-Based Comprehensive Testing Via Next-Gen Sequencing NF1/SPRED1 and Other Rasopathy Related Conditions on Blood/Saliva
    Last Updated October 2019 Institutional Price TAT Genetic Test CPT Codes Z codes Specimen Requirements (USD$) (working days) Lymphocyte/WBC-based Comprehensive Testing via Next-Gen Sequencing NF1/SPRED1 and Other RASopathy Related Conditions on Blood/Saliva NF1- only NGS testing and copy number analysis for the NF1 gene (NF1-NG) This testing includes an average coverage of >1600x to allow for the identification of (1) 3-6ml whole blood in EDTA (purple topped) tubes mosaicism as low as 3-5% of the alleles. In addition, novel variants identified in the $1,000 81408 25 (2) Oragene 575 saliva kit (provided by the MGL) ZB6A9 NF1 gene will be confirmed via RNA-based analysis at no additional charge. RNA- $1,600 (RUSH) 81479 15 (RUSH) (3) DNA sample (25ul volume at 3ug, O.D. value at based testing will also be provided to non-founder, multigenerational families with 260:280 ≥1.8) “classic” NF1 at no additional charge if next-generation sequencing is found negative. (1) 3-6ml whole blood in EDTA (purple topped) tubes SPRED1-only NGS testing and copy number analysis for SPRED1 (SPD1-NG) $800 81405 25 (2) Oragene 575 saliva kit (provided by the MGL) This testing includes an average coverage of >1600x to allow for the identification of ZB6AC $1,400 (RUSH) 81479 15 (RUSH) (3) DNA sample (25ul volume at 3ug, O.D. value at mosaicism as low as 3-5% of the alleles after comprehensive NF1 analysis. 260:280 ≥1.8) NF1/SPRED1 NGS testing and copy number analysis for NF1 and SPRED1 (NFSP-NG) (1) 3-6ml whole blood in EDTA (purple topped) tubes 81408 This testing includes an average coverage of >1600x to allow for the identification of $1,100 25 (2) Oragene 575 saliva kit (provided by the MGL) 81405 ZB6A8 mosaicism as low as 3-5% of the alleles.
    [Show full text]
  • TSC1/TSC2 Signaling in the CNS ⇑ Juliette M
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector FEBS Letters 585 (2011) 973–980 journal homepage: www.FEBSLetters.org Review TSC1/TSC2 signaling in the CNS ⇑ Juliette M. Han, Mustafa Sahin The F.M. Kirby Neurobiology Center, Department of Neurology, Children’s Hospital Boston, Harvard Medical School, Boston, MA 02115, USA article info abstract Article history: Over the past several years, the study of a hereditary tumor syndrome, tuberous sclerosis complex Received 5 January 2011 (TSC), has shed light on the regulation of cellular proliferation and growth. TSC is an autosomal Revised 1 February 2011 dominant disorder that is due to inactivating mutations in TSC1 or TSC2 and characterized by benign Accepted 1 February 2011 tumors (hamartomas) involving multiple organ systems. The TSC1/2 complex has been found to play Available online 15 February 2011 a crucial role in an evolutionarily-conserved signaling pathway that regulates cell growth: the Edited by Wilhelm Just mTORC1 pathway. This pathway promotes anabolic processes and inhibits catabolic processes in response to extracellular and intracellular factors. Findings in cancer biology have reinforced the critical role for TSC1/2 in cell growth and proliferation. In contrast to cancer cells, in the CNS, the Keywords: mTOR TSC1/2 complex not only regulates cell growth/proliferation, but also orchestrates an intricate and Autism finely tuned system that has distinctive roles under different conditions, depending on cell type, Translation stage of development, and subcellular localization. Overall, TSC1/2 signaling in the CNS, via its multi-faceted roles, contributes to proper neural connectivity.
    [Show full text]
  • Mtor: a Pharmacologic Target for Autophagy Regulation
    mTOR: a pharmacologic target for autophagy regulation Young Chul Kim, Kun-Liang Guan J Clin Invest. 2015;125(1):25-32. https://doi.org/10.1172/JCI73939. Review mTOR, a serine/threonine kinase, is a master regulator of cellular metabolism. mTOR regulates cell growth and proliferation in response to a wide range of cues, and its signaling pathway is deregulated in many human diseases. mTOR also plays a crucial role in regulating autophagy. This Review provides an overview of the mTOR signaling pathway, the mechanisms of mTOR in autophagy regulation, and the clinical implications of mTOR inhibitors in disease treatment. Find the latest version: https://jci.me/73939/pdf The Journal of Clinical Investigation REVIEW SERIES: AUTOPHAGY Series Editor: Guido Kroemer mTOR: a pharmacologic target for autophagy regulation Young Chul Kim and Kun-Liang Guan Department of Pharmacology and Moores Cancer Center, UCSD, La Jolla, California, USA. mTOR, a serine/threonine kinase, is a master regulator of cellular metabolism. mTOR regulates cell growth and proliferation in response to a wide range of cues, and its signaling pathway is deregulated in many human diseases. mTOR also plays a crucial role in regulating autophagy. This Review provides an overview of the mTOR signaling pathway, the mechanisms of mTOR in autophagy regulation, and the clinical implications of mTOR inhibitors in disease treatment. Overview of mTOR signaling pathway such as insulin and IGF activate their cognate receptors (recep- Nutrients, growth factors, and cellular energy levels are key deter- tor tyrosine kinases [RTKs]) and subsequently activate the PI3K/ minants of cell growth and proliferation. mTOR, a serine/threon- AKT signaling axis.
    [Show full text]
  • Mutational Spectrum of the TSC1 Gene in a Cohort of 225 Tuberous Sclerosis Complex Patients: J Med Genet: First Published As 10.1136/Jmg.36.4.285 on 1 April 1999
    J Med Genet 1999;36:285–289 285 Mutational spectrum of the TSC1 gene in a cohort of 225 tuberous sclerosis complex patients: J Med Genet: first published as 10.1136/jmg.36.4.285 on 1 April 1999. Downloaded from no evidence for genotype-phenotype correlation Marjon van Slegtenhorst, Senno Verhoef, Anita Tempelaars, Lida Bakker, Qi Wang, Marja Wessels, Remco Bakker, Mark Nellist, Dick Lindhout, Dicky Halley, Ans van den Ouweland Abstract TSC1 locus on chromosome 9q34 and the Tuberous sclerosis complex is an inherited other half to the TSC2 locus on chromosome tumour suppressor syndrome, caused by a 16p13.67 The TSC1 and TSC2 genes were mutation in either the TSC1 or TSC2 identified by positional cloning89 and there is gene. The disease is characterised by a abundant evidence that both genes act as broad phenotypic spectrum that can in- tumour suppressor genes.10–13 clude seizures, mental retardation, renal The TSC2 gene consists of 41 exons, dysfunction, and dermatological abnor- spanning 43 kb of genomic DNA.14 It encodes malities. The TSC1 gene was recently a 200 kDa protein, tuberin, which has a identified and has 23 exons, spanning 45 putative GAP activity for rab515 and rap1,16 two kb of genomic DNA, and encoding an 8.6 members of the ras superfamily of small kb mRNA. After screening all 21 coding GTPases. The mutational spectrum of TSC2 exons in our collection of 225 unrelated includes a number of large deletions often dis- 17 18 patients, only 29 small mutations were rupting the PKD1 gene as well, but also 19–27 detected, suggesting that TSC1 mutations point mutations and a number of missense 28 are under-represented among TSC pa- changes.
    [Show full text]
  • Whole Exome Sequencing in Families at High Risk for Hodgkin Lymphoma: Identification of a Predisposing Mutation in the KDR Gene
    Hodgkin Lymphoma SUPPLEMENTARY APPENDIX Whole exome sequencing in families at high risk for Hodgkin lymphoma: identification of a predisposing mutation in the KDR gene Melissa Rotunno, 1 Mary L. McMaster, 1 Joseph Boland, 2 Sara Bass, 2 Xijun Zhang, 2 Laurie Burdett, 2 Belynda Hicks, 2 Sarangan Ravichandran, 3 Brian T. Luke, 3 Meredith Yeager, 2 Laura Fontaine, 4 Paula L. Hyland, 1 Alisa M. Goldstein, 1 NCI DCEG Cancer Sequencing Working Group, NCI DCEG Cancer Genomics Research Laboratory, Stephen J. Chanock, 5 Neil E. Caporaso, 1 Margaret A. Tucker, 6 and Lynn R. Goldin 1 1Genetic Epidemiology Branch, Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD; 2Cancer Genomics Research Laboratory, Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD; 3Ad - vanced Biomedical Computing Center, Leidos Biomedical Research Inc.; Frederick National Laboratory for Cancer Research, Frederick, MD; 4Westat, Inc., Rockville MD; 5Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD; and 6Human Genetics Program, Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD, USA ©2016 Ferrata Storti Foundation. This is an open-access paper. doi:10.3324/haematol.2015.135475 Received: August 19, 2015. Accepted: January 7, 2016. Pre-published: June 13, 2016. Correspondence: [email protected] Supplemental Author Information: NCI DCEG Cancer Sequencing Working Group: Mark H. Greene, Allan Hildesheim, Nan Hu, Maria Theresa Landi, Jennifer Loud, Phuong Mai, Lisa Mirabello, Lindsay Morton, Dilys Parry, Anand Pathak, Douglas R. Stewart, Philip R. Taylor, Geoffrey S. Tobias, Xiaohong R. Yang, Guoqin Yu NCI DCEG Cancer Genomics Research Laboratory: Salma Chowdhury, Michael Cullen, Casey Dagnall, Herbert Higson, Amy A.
    [Show full text]
  • Immersion Course Lecture Kelly
    Genomic Counseling in the research setting Kelly East, MS CGC Genetic Counselor HudsonAlpha Institute for Biotechnology single gene disorders • mutation in a single gene leads to disease • often has characteristic family inheritance patterns J Neurol Neurosurg Psychiatry 2002;73:ii5-ii11 Genes that code for hemoglobin 1 2 3 4 5 HBB 6 7 8 9 10 11 12 HBA2 13 14 15 16 17 18 19 20 21 22 X Y http://www.genome.gov/glossary/resources/karyotype.pdf TARDBP Genes associated ALS2 with ALS 1 2 3 4 5 C9ORF72 OPTN FIG4 ATXN2 SETX 6 7 8 9 10 11 12 ANG SPG11 FUS 13 14 15 16 17 18 VAPB UBQLN2 SOD1 19 20 21 22 X Y http://www.genome.gov/glossary/resources/karyotype.pdf complex traits • most common traits and diseases have a complex etiology • causative risks can include genetic changes (both large and small scale) environmental factors (head injury, nutrition, exposure to toxins) societal factors (death of family member, abuse, hardships) • in most cases - not triggered by a change in a single gene but rather by the interaction of several genetic, environmental and societal risks spectrum of human genetic conditions CGTATACCGGGTCATGCACGTGTAGAGCGAGTTAGCTCGCTGGCTAAAGAGGGTCGAC ATCCGCGAGTTTATGAGGAAGAATCGGCAGCTTGACCGAAGAGGCGTGGTAAGACCCG TTAGGGATCGTATACCGGGTCATGCACGTGTAGAGCGAGTTAGCTCGCTGGCTAAAGA GGGTCGACATCCGCGAGTTTATGAGGAAGAATCGGCAGCTTGACCGAAGAGGCGTGGT AAGACCCGTTAGGGATCGTATACCGGGTCATGCACGTGTAGAGCGAGTTAGCTCGCTG GCTAAAGAGGGTCGACATCCGCGAGTTTATGAGGAAGAATCGGCAGCTTGACCGAAGA GGCGTGGTAAGACCCGTTAGGGATCGTATACCGGGTCATGCACGTGTAGAGCGAGTTA in patients with a suspected genetic
    [Show full text]
  • Tuberous Sclerosis Complex: Molecular Pathogenesis and Animal Models
    Neurosurg Focus 20 (1):E4, 2006 Tuberous sclerosis complex: molecular pathogenesis and animal models LEANDRO R. PIEDIMONTE, M.D., IAN K. WAILES, M.D., AND HOWARD L. WEINER, M.D. Division of Pediatric Neurosurgery, Department of Neurosurgery, New York University School of Medicine, New York, New York Mutations in one of two genes, TSC1 and TSC2, result in a similar disease phenotype by disrupting the normal inter- action of their protein products, hamartin and tuberin, which form a functional signaling complex. Disruption of these genes in the brain results in abnormal cellular differentiation, migration, and proliferation, giving rise to the charac- teristic brain lesions of tuberous sclerosis complex (TSC) called cortical tubers. The most devastating complications of TSC affect the central nervous system and include epilepsy, mental retardation, autism, and glial tumors. Relevant animal models, including conventional and conditional knockout mice, are valuable tools for studying the normal func- tions of tuberin and hamartin and the way in which disruption of their expression gives rise to the variety of clinical features that characterize TSC. In the future, these animals will be invaluable preclinical models for the development of highly specific and efficacious treatments for children affected with TSC. KEY WORDS • tuberous sclerosis • pathogenesis • animal model Tuberous sclerosis complex is an autosomal-dominant zures, mental retardation, and autism.1,51 The number and tumor predisposition syndrome that affects approximately location of cortical tubers and the patient’s age at seizure 1 in 7500 individuals worldwide.19 The TSC is character- onset are highly correlated with neurological outcomes.1,30 ized by benign hamartomatous growths in multiple organs, Epilepsy occurs in approximately 80% of affected indi- including the kidney, skin, retina, lung, and brain.
    [Show full text]
  • Rho Guanine Nucleotide Exchange Factors: Regulators of Rho Gtpase Activity in Development and Disease
    Oncogene (2014) 33, 4021–4035 & 2014 Macmillan Publishers Limited All rights reserved 0950-9232/14 www.nature.com/onc REVIEW Rho guanine nucleotide exchange factors: regulators of Rho GTPase activity in development and disease DR Cook1, KL Rossman2,3 and CJ Der1,2,3 The aberrant activity of Ras homologous (Rho) family small GTPases (20 human members) has been implicated in cancer and other human diseases. However, in contrast to the direct mutational activation of Ras found in cancer and developmental disorders, Rho GTPases are activated most commonly in disease by indirect mechanisms. One prevalent mechanism involves aberrant Rho activation via the deregulated expression and/or activity of Rho family guanine nucleotide exchange factors (RhoGEFs). RhoGEFs promote formation of the active GTP-bound state of Rho GTPases. The largest family of RhoGEFs is comprised of the Dbl family RhoGEFs with 70 human members. The multitude of RhoGEFs that activate a single Rho GTPase reflects the very specific role of each RhoGEF in controlling distinct signaling mechanisms involved in Rho activation. In this review, we summarize the role of Dbl RhoGEFs in development and disease, with a focus on Ect2 (epithelial cell transforming squence 2), Tiam1 (T-cell lymphoma invasion and metastasis 1), Vav and P-Rex1/2 (PtdIns(3,4,5)P3 (phosphatidylinositol (3,4,5)-triphosphate)-dependent Rac exchanger). Oncogene (2014) 33, 4021–4035; doi:10.1038/onc.2013.362; published online 16 September 2013 Keywords: Rac1; RhoA; Cdc42; guanine nucleotide exchange factors; cancer;
    [Show full text]
  • Mir-126-3P Contributes to Sorafenib Resistance in Hepatocellular Carcinoma Via Downregulating SPRED1
    38 Original Article Page 1 of 14 miR-126-3p contributes to sorafenib resistance in hepatocellular carcinoma via downregulating SPRED1 Wenliang Tan1,2#, Zhirong Lin1,2#, Xianqing Chen3, Wenxin Li4, Sicong Zhu1,5, Yingcheng Wei1,2, Liyun Huo1,2, Yajin Chen1,2, Changzhen Shang1,2 1Guangdong Provincial Key Laboratory of Malignant Tumor Epigenetics and Gene Regulation, Sun Yat-sen Memorial Hospital, Sun Yat-Sen University, Guangzhou, China; 2Department of Hepatobiliary Surgery, Sun Yat-sen Memorial Hospital, Sun Yat-sen University, Guangzhou, China; 3Department of Hepatobiliary Surgery, the Eighth Affiliated Hospital, Sun Yat-sen University, Shenzhen, China; 4Department of Cardiology, the Eighth Affiliated Hospital, Sun Yat-sen University, Shenzhen, China; 5Department of Surgical Intensive Care Unit, Sun Yat-sen Memorial Hospital, Sun Yat-sen University, Guangzhou, China Contributions: (I) Conception and design: C Shang, Y Chen; (II) Administrative support: C Shang, Y Chen; (III) Provision of study materials or patients: W Tan, Z Lin; (IV) Collection and assembly of data: S Zhu, Y Wei, L Huo; (V) Data analysis and interpretation: X Chen, W Li; (VI) Manuscript writing: All authors; (VII) Final approval of manuscript: All authors. #These authors contributed equally to this work. Correspondence to: Changzhen Shang; Yajin Chen. Department of Hepatobiliary Surgery, Sun Yat-sen Memorial Hospital of Sun Yat-sen University, Guangzhou 510120, China. Email: [email protected]; [email protected]. Background: Sorafenib can prolong the survival of patients with advanced hepatocellular carcinoma (HCC). However, drug resistance remains the main obstacle to improving its efficiency. This study aimed to explore the likely molecular mechanism of sorafenib resistance. Methods: Differentially expressed microRNAs (miRNAs) related to sorafenib response were analyzed with the Limma package in R software.
    [Show full text]
  • Neurofibromatosis-1 Regulates Mtor-Mediated Astrocyte Growth
    Neurofibromatosis-1 regulates mTOR-mediated astrocyte growth and glioma formation in a TSC/Rheb-independent manner Sutapa Banerjee, Nikkilina R. Crouse, Ryan J. Emnett, Scott M. Gianino, and David H. Gutmann1 Department of Neurology, Washington University School of Medicine, St. Louis, MO 63110 Edited* by Webster K. Cavenee, Ludwig Institute, University of California at San Diego, La Jolla, CA, and approved August 15, 2011 (received for review December 17, 2010) Converging evidence from the analysis of human brain tumors seizures and death, whereas Nf1 loss in these same neuroglial and genetically engineered mice has revealed that the mamma- progenitors has no effect on mouse viability or epileptogenesis (16, lian target of rapamycin (mTOR) pathway is a central regulator of 17). Importantly, although Pten-, hamartin-, and neurofibromin- glial and glioma cell growth. In this regard, mutational inactiva- deficient glial phenotypes have different biological effects, each tion of neurofibromatosis-1 (NF1), tuberous sclerosis complex is completely inhibited by rapamycin in vitro and in vivo (15, 18– (TSC), and PTEN genes is associated with glioma formation, such 21). Collectively, these observations support a model in which fi that pharmacologic inhibition of mTOR signaling results in atten- neuro bromin-regulated mTOR-dependent growth regulation uated tumor growth. This shared dependence on mTOR suggests is distinct from TSC/Rheb-mediated mTOR-dependent growth that PTEN and NF1 (neurofibromin) glial growth regulation regulation in the brain. To
    [Show full text]
  • Snapshot: Mtorc1 Signaling at the Lysosomal Surface Liron Bar-Peled and David M
    1390 Cell SnapShot: mTORC1 Signaling at the 151 , December 7,2012©2012 ElsevierInc. DOI http://dx.doi.org/10.1016/j.cell.2012.11.038 Lysosomal Surface Liron Bar-Peled and David M. Sabatini Whitehead Institute for Biomedical Research, Massachusetts Institute of Technology, Cambridge, MA 02142, USA Nutrient signaling Wnt Growth Leu signaling factor signaling TNF signaling Amino Gln Wnt Tyrosine acids Frizzled IGF kinase TNFD receptor TNF receptor DNA Energy levels O levels SLC1A5 SLC7A5 2 damage ATP/AMP PIP2 Pten Amino acid mTORC1 Dsh1 IRS1 transporter Gln (inactive) GRB2 SOS PI3K PIP3 Gln Redd1 p53 LKB1 GEF GSK3 activity Leu GTP Ras NF1 PDK1 GAP Sestrin Movement to the activity RagAGTP lysosomal surface Movement AMPK Raf GDP away from Rapamycin RagA the lysosomal surface FKBP12 Mek Erk1/2 Rsk1 Akt1 IKK` v-ATPase GEF activity CYTOPLASM RagAGTP mTORC1 Ragulator GTP GAP activity GDP TSC complex RagC (active) Rheb Tumor suppressor Oncogene mTORC1 substrate ? Growth DOWNSTREAM CELLULAR PROGRAMS REGULATED BY mTORC1 ACTIVITY See online version for legend and references. S6K1 Amino acids LYSOSOME Protein synthesis 4EBP1 COMPLEXES AT THE LYSOSOMAL SURFACE HIF1_ Energy metabolism A B A E E G G pras40 deptor Lysosome biogenesis A BB MP1 HBXIP TSC1 TBC1D7 TFEB p14 C7orf59 raptor H mLST8 Lipin-1 D C Lipid p18 biosynthesis a d F mTOR TSC2 SREBP1/2 c cc ATG13 FIP200 Autophagy Lysosomal v-ATPase Ragulator complex mTORC1 TSC complex ULK1 SnapShot: mTORC1 Signaling at the Lysosomal Surface Liron Bar-Peled and David M. Sabatini Whitehead Institute for Biomedical Research, Massachusetts Institute of Technology, Cambridge, MA 02142, USA In mammals, the mTOR complex 1 (mTORC1) ser/thr kinase regulates cellular and organismal growth in response to a variety of environmental and intracellular stimuli.
    [Show full text]