A Generative Cell Specific 1 Ortholog in Drosophila melanogaster

Victoria Elisabeth Garcia

A thesis

Submitted in partial fulfillment

Of the requirements for the degree of

Master of Science

University of Washington

2012

Committee:

Barbara Wakimoto

Martha Bosma

Jeffrey Riffell

Program authorized to offer degree:

Biology

INTRODUCTION AND BACKGROUND

Sexual reproduction is the dominant mode of propagation in eukarya.1 It has been shown to facilitate genomic complexity and robustness, and to speed adaptation while aiding in the suppression of harmful mutations.2 Though the process is profoundly widespread, the cellular mechanics of the fertilization process are not tightly conserved, and can vary tremendously from species to species:3 The extending pollen tubes and double fertilizations of angiosperms, for example, differ vastly from flagellum-mediated clinches and aggregations seen with the plus and minus gametes of Chlamydomonas. Variation is the rule even at the protein level: factors that mediate gamete-gamete interaction tend to be highly species-specific.4 Indeed, genes encoding many fertilization proteins show signatures of positive selection, and have been shown to have roles in speciation.5 The Generative Cell Specific 1 (GCS1) protein is exceptional in this regard:6 First identified in Arabidopsis thaliana in 2004,7 its orthologs have been recognized in a wide range of eukaryotic taxa, including plants, protists, and invertebrates.8 This uniquely broad distribution has led researchers to suggest that it may have had a fundamental role in the evolution of sexual reproduction. 6 Despite its intriguing phylogenetic distribution, the protein’s mode of action remains largely uncharacterized. In several species, the protein has been demonstrated to have an essential role in mediating the coalescence of gametes: Functional studies of the protein in Chlamydomonas 9 demonstrated a role in gamete-gamete plasma membrane fusion, and the work to date in Plasmodium9,10 and Arabidopsis11 is consistent with a similar role. The exact mechanism by which the protein does this, however, has not been characterized. Few clues can be gleaned from a superficial examination of the amino acid sequence: other than a transmembrane domain (TMD) and a putative signal sequence, the protein has no known functional motifs. It also has no known interaction partners. GCS1’s lack of recognizable functional motifs has led to speculation that it may penetrate the opposing gamete’s plasma membrane directly, like a viral FAST protein,6 but this has not yet been explored experimentally. A number of promising avenues for elucidating the GCS1 mystery exist, however. One important route is functional study of the protein in a broader variety of species. To date, GCS1 has been studied in only a fraction of the model systems where its putative orthologs have been

- 1 -

discerned. The vast majority of published GCS1 studies have focused on angiosperms, malarial parasites, and green algae. Though potential orthologs have recently been recognized in a Mycetozoa, Cilliatea, and Euglenazoa,12 it has never been studied functionally in any of those taxa. In animals, putative orthologs have been identified in Hydra and Nematostella,8 as well as in several species of arthropods;13 yet a single whole-organism in situ hybridization study constitutes the whole of the published, experimental attention its expression has there received.14 Study of GCS1s in these systems has the potential to reveal both new fusion mechanisms and new gamete interaction pathways. Additionally, studying the protein’s evolved functions across many taxa has the potential to help illuminate the workings of the common ancestral form, and thus has the potential to illuminate the evolution of sexual reproduction itself.6 Exploration of the protein’s mode of operation in new species is therefore an important avenue for research. Very recently, a large-scale computational genomics project identified potential GCS1 orthologs in several Drosophilid species.13 For several reasons, the D. melanogaster system is a particularly apt one for study of male-specific membrane-bound gamete proteins: Firstly, the stages of spermiogenesis in D. melanogaster are well characterized.15 Secondly, because tail elongation and cytokinesis are extremely membrane-intensive, the endomembrane system in developing sperm is highly sensitized, allowing interrogation of mechanisms that would otherwise be shrouded by redundancy.16 Along with ease of husbandry, and quick generation time17, there is a wealth of genetic and cytological tools available. Most importantly, the Wakimoto lab has isolated the largest collection of male sterile mutant strains existing for any organism to date. The availability of these powerful experimental tools predict that functional studies of GCS1 in D. melanogaster are likely to be highly profitable. The confirmed presence of a Drosophila GCS1 ortholog would open up a number of promising lines of inquiry. The purpose of this project, therefore, is to resolve the question of whether a GCS1 ortholog is involved in male fertility in Drosophila. The literature regarding GCS1 is here reviewed, and a promising male sterile mutant from the Wakimoto lab is analyzed. Evidence regarding the mutant’s genotype and phenotype is then evaluated in light of current knowledge of GCS1 and Drosophila spermiogenesis, and predictions are made about how a GCS1 protein might function in Drosophila.

- 2 -

RESULTS

A. Transgenic rescue of pskl- by the putative Drosophila melanogaster GCS1. The mutations under study in this work were identified and partially characterized prior to this project’s beginning. Originally recovered in a large-scale screen of EMS-induced male sterile mutations,18,19 psklZ3119, psklZ 3059, and psklZ0070 males were sterile despite producing motile sperm that could enter eggs, and had been shown to be allelic via complementation analyses. Meiotic recombination and deficiency mapping limited the pskl gene to a 66.55 kb region on chromosome 3R that included 17 genes annotated genes. One of these was CG34027, an uncharacterized gene that had recently been identified by OrthoDB as a potential ortholog of GCS1.13 The similarities between the pskl- phenotype and the GCS1 mutant phenotypes observed in Arabidposis11, Chlamydomonas9, and Plasmodium9 and were striking. In all of these, mutants produced male gametes that matured normally, and that could reach and make contact with female gametes (albeit inefficiently in Arabidopsis).20 Despite contact between the gametes, in all of these, a complete or nearly complete block to fertilization was observed. The mechanisms underlying the pskl and GCS1 mutant phenotypes furthermore also appeared to have certain commonalities: Strong evidence from Chlamydomonas9 had demonstrated a role in gamete plasma membrane interaction for GCS1, and studies in Arabidopsis11 and Plasmodium9,10 suggested that the same was true in these systems. Activity at the gamete plasma membrane seemed likely to be affected by the Pskl protein as well. The pskl mutations had been classified as one of five members of the snky class of male sterile mutations. The founding member, snky, was found to permit the formation of motile sperm that are capable of entering the egg but result in failure in sperm plasma membrane breakdown (PMBD), an essential step that occurs in the egg cytoplasm in Drosophila fertilization.21,22 Similar dynamics were also observed with mutations in the misfire 23,24, aghino, and kugi genes. CG34027 also showed a promising expression profile. A genome-wide microarray study showed that expression of CG34027 is highly enriched in the testis.25 None of the other 16 genes within the 66.55 kb region-of-interest showed similar patterns of enrichment.

- 3 -

Given these parallels, we decided to test whether lesions in CG34027 were responsible for the pskl- phenotype. To do this, we performed a transgenic rescue using a 10.323 kb KpnI genomic fragment containing CG34027. An insertion of the transgene was obtained via P- element germ line transformation. This transgene was able to rescue fertility in pskl/Df males completely or nearly completely (Table 1).

We therefore concluded that the 10.323 kb fragment contains all of the sequences necessary for pskl expression and function. Since the fragment contains only one predicted gene, CG34027, we can further conclude that pskl and CG34027 are one in the same. B. CG34027/pskl as an ortholog of GCS1. The suggestion that CG34027 could be a D. melanogaster ortholog of GCS1 comes from OrthoDB,13 which identified it as being a member of a protein family that included previously- identified GCS1s from the louse Pediculus 14 and the beetle Tribolium.9 This proposal conflicted with the findings of several recently published phylogenetic studies of GCS1,9,14 which had expressly concluded that GCS1 did not exist in Drosophila. To resolve the conflict, we created

- 4 -

an alignment of CG34027 with other identified arthropod orthologs of GCS1 (Fig. 1). We also surveyed the extant GCS1 literature to identify common traits regarding subcellular localization, amino acid sequence, and potential functional domains, which we compared with the predicted amino acid sequence and functional domains for CG34027. Finally, we sequenced CG34027 in the three pskl strains to determine whether the locations of the lesions were consistent with a GCS1 identity (Fig. 2). 1. CELLULAR AND SUBCELLULAR LOCALIZATION a. In Arabidopsis, Chlamydomonas, and Plasmodium, GCS1 is a sex-specific, Membrane-Associated Protein that localizes to the Plasma Membrane. The subcellular localization of GCS1 has been substantively studied in Plasmodium, in Chlamydomonas, and in Arabidopsis. In all of these, evidence supports localization at the plasma membrane. The studies of GCS1 in Chlamydomonas were done in 2008 by Liu, et al.9 Immunostaining of gametes transformed with a hemoagglutinin-tagged rescue construct showed protein localization in minus-type gametes at the locus where mating structure formation and plasma membrane fusion occur, between the gametes’ paired flagella. Interestingly, immunoblotting of minus-type gamete lysates after SDS-PAGE showed two distinct isoforms of the GCS1, which were later shown to differ in terms of N-glycosylation pattern.26 Treatment with trypsin caused the larger of the two isoform to disappear, demonstrating conclusively that said isoform had at least one extracellular domain.9 GCS1’s localization in Plasmodium was also studied by the 2008 Liu group.9 Unlike the gametes of Chlamydomonas, P. berghei gametes do not adhere or merge at a particular locus. Commensurate with that, when P. berghei gametes were transformed with a GFP-tagged Hap2/GCS1 rescue construct, the GFP signal was detectable faintly along the periphery of the entire male gamete. When fixed, male gametes were stained with an anti-GFP antibody, the same peripheral pattern was observed, along with a few brighter spots, consistent with plasma membrane localization. This finding is bolstered by the results of a 2009 study by Blagoborough, which tested the ability of vaccinations with GCS1 anti-sera to prevent malarial infections in mice. Rates of malarial infection were reduced 34% in treated mice, and infection intensity was reduced by 81%.10 This result implies the existence of a GCS1 extracellular epitope for antibody binding.

- 5 -

The protein’s localization in the Arabidopsis sperm plasma membrane has also been strongly shown. The first battery of experiments exploring this were done by Mori et al. in 2006.11 Membrane association was demonstrated through immunostaining of homogenized, fractionated pollen. In those studies, GCS1 was found along with the membrane. Treatment with SDS released the tagged protein from the precipitate, which demonstrated a direct membrane association. Immunolocalization studies showed that the protein localized to the periphery of generative cells. To discern between localization at the cell wall and localization at the cell membrane, immunostaining patterns in plasmolyzed cells were compared with those of normal, turgid cells. In those experiments, the GCS1 signal followed in the in-shrinking plasma membrane, rather than co-localizing with the still-rigid cell wall. Taken together, these experiments strongly demonstrate a plasma membrane association for the protein. Mori’s experiments were followed by a 2006 publication from Von Besser et al., which yielded similar results.20 The Von Besser group showed GCS1’s exclusive expression in Arabidopsis in the male germline by RT-PCR. In assays to determine subcellular localization, a YFP-tagged rescue construct produced a signal in a perinuclear ring that in some cases extended as far as the plasma membrane. This result was considered alongside the protein’s predicted amino acid sequence, which included an apparent transmembrane domain, leading the group to posit that the protein was membrane-associated, and that it was resident in the ER, on the plasma membrane, or both. The less-peripheral signal observed by the Von Besser group might be viewed as being at odds with the Mori group’s results. It should be noted, however, that proteins destined for the plasma membrane will almost always pass first through the secretory pathway. The possibility that the ER-localized protein might be en route to the plasma membrane was neither proposed nor ruled out. 2. PSKL’S PREDICTED LOCALIZATION COMPARED WITH GCS1 LOCALIZATION a. CG34027 is predicted to encode a testis-specific protein: In the model systems described above, GCS1 orthologs have been male-specific (or mating type-specific), and they have been shown to localize in the male gametes, or in body parts where the male gametes would be expected to reside. CG34027 appears to follow this pattern as well. A 2007 genome-wide microarray study showed that expression of CG34027 is enriched in the testis,

- 6 -

and only in the testis.25 This result was supported by RNA-seq data analyzed in the ModEncode project,27 which showed extremely low expression until larva L3 puff stages 3 through 6, at which point expression levels more than double. The RNA seq data (in which expression in larvae and pupae was not broken out by sex) further showsed that levels remain elevated through all stages of larval and pupal development. An elevated expression level is also seen in adult males at one, five, and thirty days post-ecclosure, however extremely low to no expression is seen adult females. This profile echoes the result shown by Steele and Dana in their 2009 in situ hybridization study of the protein in Hydra,14 and it is consistent with a localization in the male gametes. b. CG34027 is predicted to encode a membrane protein All of the GCS1 orthologs that have been studied functionally were shown strongly or conclusively to have membrane localization. Though functional studies of the CG34027 protein product have not yet been performed, hydrophobicity analysis of the FlyBase predicted protein sequence using TMHMM28 predicts two closely-spaced regions with the potential to form transmembrane helices. These are at amino acids 1202 – 1224, and at amino acids 1244-1266. While either or both of the TMDs may be used in the actual protein and predict an integral membrane protein, a single TMD would be most consistent with the topology predicted for the plant and protist GCS1 proteins. 3. THE AMINO ACID SEQUENCES AND PREDICTED PROTEIN MOTIFS OF PSKL AND GCS1 a. The GCS1 Protein Sequence: Motifs and Domains Other than its TMD and GCS1 domain, the GCS1 protein has no known functional motifs. GCS1s thus far studied have, however, had had certain canonical features. From amino terminal to carboxyl terminal, these include: (1) A signal peptide at the amino end; (2) A GCS1 domain with a pattern of conserved cysteines; (3) A transmembrane domain; and (4) In angiosperms, a histidine-rich region just before the carboxyl terminus. These features and their relative importance of have been subjects of several recent investigation. HAP2-GCS1’s amino acid sequence’s distinctive traits were first described in Mori’s 2006 study.11 Comparison of hydrophobicity plots for GCS1 orthologs in A. thaliana, O. sativa, L. longiflorum, P. polycephalum, L. major, C. merolae, and P. falciparum showed the presence of two characteristic hydrophobic regions: a smaller one at the amino end, and a larger one near the carboxyl terminal. C. reinhardtii showed a similar pattern, but with a doubled hydrophobic

- 7 -

region near the carboxyl terminal. Mori proposed that these represented a transit signal and a transmembrane domain, respectively. Subsequent studies by this group and others have consistently supported this surmise. The first study to analyze the importance of GCS1’s domains experimentally was by Wong, et al., in 2010.29 There, investigators tested the ability of a series of differently-configured rescue constructs to restore fertility in Arabidopsis GCS1 knockouts. The study’s conception of the protein sequence’s geography with relatively coarse resolution: For purposes of this work, the protein was essentially viewed as a composite of: (1) An amino arm (terminology mine), comprising the part of the sequence beginning at amino end and ending where the transmembrane domain begins; (2) A transmembrane domain (TMD); and (3) A carboxyl arm (terminology mine) which begins where the transmembrane domain ends, and runs to the sequence’s carboxyl terminal. Both the amino-terminal transit signal and the GCS1 domain reside in the amino arm. The effect of extirpation of both the amino arm and the carboxyl arm was assayed in this series of experiments, with more precise disruptions in the carboxyl arm used to examine this region in finer detail. i. The GCS1 domain and the TMD are necessary for protein function, their position with regard to one another is important. The 2010 Wong group demonstrated that the Arabidopsis GCS1 cannot function without the protein sequence’s amino arm.29 To do this, the investigators transformed a GCS1 knockout with a rescue construct consisting of a signal sequence, the TMD, the carboxyl arm, as well as a BastaR herbicide resistance cassette and an epitope tag. When knockout sperm transformed with this construct were used to pollenate wild-type plants, the resulting seed sets uniformly failed to grow on Basta-containing media. Detection of epitope tag mRNA in flowers of the transformed lines demonstrated that the failure was not for want of expression. (Through similar experiments, the group found that the carboxyl arm was likewise necessary. This result will be discussed further below.) Having established that both arms of protein sequence were needed, the investigators next asked how much variation in each arm the protein would tolerate. To test this, the investigators generated rescue constructs wherein the carboxyl and/or amino domains were exchanged with corresponding domains from either the closely related S. irio or the more distantly related O. sativa. A protein with carboxyl and amino domains that both came from O.

- 8 - sativa would not rescue function in Arabidopsis; nor would a fusion containing the Arabidopsis carboxyl arm and the O. sativa amino arm. Rescue was, however, obtained via a fusion of the Arabidopsis amino arm and the O. sativa carboxyl arm. From this, the investigators concluded that identity of amino acid sequence in the amino arm was more important than in carboxyl arm. This suggested to the investigators that the amino and carboxyl arms of the protein could be subject to different forms of selective pressure. The 2010 Mori group’s work on this general region of the Arabidopsis sequence produced similar results.30 A construct in which GFP divided the GCS1 sequence failed completely at rescue, much like the Wong group’s complete amino arm ablation did. Partial rescue was, however, obtained with a construct in which GFP was inserted between the TMD and the GCS1 signal. The finding that the GCS1 domain would be essential for GCS1 function in Arabidopsis is in concert with the Wong group’s data. The finding that the spacing of the TMD and the GCS1 domain is important for protein function is likewise consistent with what came before. The results of the 2010 Mori group’s study of the GCS1 domain in P. berghei are also not in conflict with earlier studies. A construct containing a full-length P. berghei GCS1 sequence successfully rescued fertility in GCS1 knockouts, however a variant of this construct in which the coding sequence for the GCS1 domain was excised did not restore fertility. We can therefore soundly predict that the GCS1 domain is necessary for protein function in other lineages. The 2010 Mori study was the only one of the two to independently test the importance of the transmembrane domain. To examine this, the group tested a rescue construct in which the TMD was replaced with a GFP tag. This construct failed to confer fertility to any degree. Rescue constructs lacking a TMD also failed to restore fertility in P. berghei. These results are uncontroversial, as the 2010 Wong group did not test the effect of TMD disruption on the protein. ii. The carboxyl arm of the protein sequence is less important for GCS1 protein function. As discussed above, the 2010 Wong group demonstrated that removal of the carboxyl arm in its entirety disabled Arabidopsis GCS1.29 They also showed that a chimeric construct consisting the Arabidopsis amino arm and TMD and the carboxyl arm of either the closely related S. irio or the more distantly related O. sativa was sufficient to restore fertility in GCS1

- 9 -

knockout sperm. These investigations permitted a finer dissection of the C-terminal domain, focusing on protein charge. In Arabidopsis, this region of the protein includes several histidine-rich regions, the largest of which is proximal to the TMD. To explore the importance of these tracts, rescue experiments similar to those above were performed. Variants of the protein truncated between the TMD and the large, first histidine-rich region failed to rescue fertility in GCS1 knockout sperm. A variant truncated between the large, first histidine-rich region and the smaller, second histidine rich region was capable of rescuing fertility, however. To examine the effect of the carboxyl region’s charge more closely, the investigators performed additional rescue experiments using constructs in which the sequence of residues within the large, histidine-rich region were altered. Two experimental constructs were used initially. In one, histidines within the zone of interest were replaced with polar, charged residues such as lysine and arginine. In the second, histidines were replaced with non-polar residues such as valine and alanine. The construct containing the polar, charged rescues was observed to restore fertility, while the variant with non-polar residues did not. A subsequent construct in which the large, first histidine-rich region was replaced by a non-polar sequence, but in which the two smaller, final histidine-rich regions were retained, was capable of rescuing fertility. From this, the investigators concluded that conservation of charge, but not conservation of amino acid identity, was the key to the function of the protein’s carboxyl region. The 2010 Mori group’s work on this region conflicts with the 2010 Wong group’s results.29,30 The Mori group tested three rescue constructs in which the carboxyl region was perturbed. GFP tags were inserted into the amino acid sequence in three different positions, these being: (1) Between the TMD and histidine-rich region; (2) After the histidine-rich region, at the carboxyl end of the protein; and (3) Replacing the histidine-rich region. All of these constructs rescued fertility robustly. In P. berghei, fertility was successfully rescued by a construct in which the entire region carboxyl of the TMD was eliminated. Taken on their own, the 2010 Mori group’s work suggests that the histidine-rich region if GCS1 is not essential for fertility in Arabidopsis, and the carboxyl arm of the protein may not be necessary at all in some lineages. Addressing the conflict between their group’s work and that of the 2010 Wong group, the 2010 Mori group suggested that the explanation may lie in the sequence of 34 amino acids immediately carboxyl of the TMD. This sequence, which includes 13 highly conserved residues

- 10 -

was not disrupted in any of the 2010 Mori group’s Arabidopsis constructs. Only the highly conserved first 13 amino acids of the sequence were kept in the carboxyl arm-ablated construct used by the Wong group. This, as Mori notes, suggests the possibility that the 34 amino acid sequence may be sufficient for carboxyl arm function in Arabidopsis GCS1. If this solution is the correct one, however, a question remains: Why rescue was not observed by the 2010 Wong group when they tested the construct that incorporated non-polar residues in place of histidines? As an answer, I would propose that (1) such a change might dramatically disrupt the protein’s targeting; or that (2) such a change could result in a profound disruption of the protein’s structure. In the wild-type, folded form of this polypeptide, the polar- charged residues would likely be on outward-facing parts. Hydrophobic residues, on the other hand, would under normal circumstances be expected to be inward-facing. When proteins are misconfigured such that hydrophobic residues face out, they may be targeted for degradation, particularly if the hydrophobic patch is near the amino or carboxyl terminal.31 If they escape such targeting, they may tend to form aggregates, rather than their designated function.32 It therefore seems possible that the addition of a hydrophobic sequence caused a derangement of either the protein’s function or its transport pathway that went well beyond perturbing the function of the histidine-rich region. It should be noted that, while the Wong group monitored expression of their construct’s message via RT-PCR, they did not monitor the success of its deployment to its final location, as Mori group did with their GFP-tagged constructs. The 2010 Wong group would not, therefore, have been able to tell if their construct had failed at rescue because the hydrophobic residues rendered a functional domain inoperable, or whether it failed because degradation or aggregation prevented it from ever reaching the plasma membrane. b. The Pskl protein: predicted amino acid sequence and motifs i. Essential GCS1 features are conserved in putative arthropod orthologs We reasoned that a Drosophila ortholog of GCS1 might diverge from the sequences in other lineages substantially, but it would have the following features: (1) conservation in the GCS1 domain, especially as regards the positions of the three canonical cysteines; (2) Existence and conservation of the position and charge of and only one transmembrane domain, which would be carboxyl of the GCS1 sequence; and (3) a signal sequence on the amino side of the GCS1 sequence. To analyze whether these could be said to exist in the arthropod orthologs identified by OrthoDB, we generated an alignment using CLC workbench 6.2. (CLC Bio)

- 11 -

Sequences for Tribolim castaneum, Pediculus humanus, Acyrthrosiphon pisum, Drosophila willistoni, Drosphila ananassae, Drosophila sechellia, and Drosophila erecta were included. To be sure of conservation within the GCS1 domain, the Protein Family Database’s GCS1 consensus sequence was also included. When the sequences were aligned, we saw conservation of two of the three conserved cysteines. This motif occurs at approximately position 960 within the D. melanogaster protein. We also saw conservation of hydrophobicity and position a region with a width consistent with a single-pass transmembrane domain. This region is found at position 1200 in the predicted D. melanogaster protein. Surprisingly, we saw an even higher degree of conservation in a pattern of cysteines between the GCS1 sequence and the putative TMD. The protein’s amino terminal was shown to have a slightly hydrophobic character. Notably, no amino terminal signal sequence was seen, however. Figure 1 depicts the key area from this alignment, including the TMD, the GCS1 consensus sequence, and the highly conserved cysteine-rich region between the two.

ii. Amino acid sequence length:

- 12 -

CG34027p’s predicted sequence length is consistent with those of previously studied GCS1 proteins. Per Flybase,33 CG34027 is predicted to occupy a 5,362 base pair-long genomic region, to have 15 exons, and to produce a 4560 nucleotide-long mRNA, which is predicted to encode a protein 1519 amino acids long. This is well within the range of lengths for sequences identified by the Protein Family Database12 as having a GCS1 domain exhibit a much broader range of lengths, from a maximum of 1820 amino acids (in the case of the ant Caponotus floridianus) to 64 amino acids for Populus balsamifera. It should, however, be noted that for those GCS1 proteins that have been functionally studied, the range of lengths has been narrower, with a minimum of 504 amino acids (for the S. irio protein in the 2010 Wong study) and a maximum of 1139 amino acids (for the C. reinhardtii protein from the 2008 and 2010 Liu studies). It should also be noted that lengths identified for arthropods tend to be longer, with a minimum length of 715 amino acids for Acythrosiphon pisum, and a maximum, mentioned above, of 1820 amino acids in an ant species. iii. Locations of pskl- genomic lesions We reasoned that, if CG34027 is the D. melanogaster ortholog of GCS1, the genomic lesions in psklZ3119, psklZ 3059, and psklZ0070 would be likely to disrupt the function of one or more of the GCS1-like features of the protein. If this hypothesis were correct, we would expect, for instance, to see elimination of a canonical cysteine residue, a marked change in cysteine spacing, or premature stop codon upstream of the sequence for the TMD. Because the strains were generated by EMS, we also expected that the lesions would be point mutations, most likely G/C to A/T transitions, which have been shown to account for 74% of all EMS-induced gene disruptions in Drosophila.34 To test this hypothesis, we sequenced the CG34027 gene region in psklZ3119, psklZ3059, and psklZ0070 flies, as well as in males of the bw;st parent strain. Overlapping primer sets were used to amplify the genomic region reaching from 150 bp upstream of the start of CG34027 gene region to 80 bp downstream of its end. The PCR products were then sequenced. Sequencing showed that for each pskl- strain, a premature stop codon was present in an exon upstream of the regions that code for GCS1-like features, which begin in exon 8. In the case of psklZ3119 and psklZ3059, both of which had premature stop codons in exon 6 (see Fig. 2), the premature stop codon was the only divergence from the parent strain's sequence shown by the mutant strain. In the case of psklZ0070, in addition to the premature stop codon in exon 1, the

- 13 -

region normally reaching from exon 9 to exon 14 proved resistant to PCR which may indicate a second aberration in this chromosome. These results are consistent with our hypothesis, because all three of the observed point mutations would have produced a truncated transcript that failed to code for the conserved GCS1-like parts of the protein. Given that the GCS1-like features of the protein are coded by exons 9-11, a larger-scale disruption in exons 9-14, as is suggested by psklZ0070’s PCR-resistant region, would also be consistent with our hypothesis.

Interestingly, most of the uncovered lesions are of kinds seen in a minority of EMS- induced mutations.34 While the psklZ0070 exon 1 point mutation is a common G to A transition, in which a TGG codon for Tryptophan becomes a TGA (amber) stop codon, the others are of types far less frequently seen. The psklZ3119 exon 6 point mutation is an A to T transition, wherein a Lysine (AAA) codon is converted to an ochre stop codon (TAA). This kind of mutation is seen in only 16% of EMS-induced mutations in Drosophila. The psklZ3059 exon 6 point mutation is an even rarer T to A transition, with a Leucine (TTG) codon being converted to an amber stop codon (TAG). Disruptions of this sort account are not typically produced by EMS, though they

- 14 -

are known products of other forms of mutagenesis, such as N-ethyl-N-nitrosourea (ENU).35 Additionally, the large, PCR-resistant zone in psklZ0070 is suggestive of a disruption more extensive than a point mutation, such as an inversion or a large deletion. To date, insertions or deletions of over 10bp have been observed as the products of EMS-induced mutations in Drosophila in less than 1% of cases.34 It therefore is possible that one or more of the pskl lesions were spontaneous mutations, and not the products of EMS. In conclusion, Pskl’s predicted amino acid sequence has much in common with those of previously-identified GCS1s, both in terms of conservation of residues in key areas, and in terms of motifs. Locations of genomic lesions in pskl mutants are likewise consistent. iv. Further steps needed for confirmation of the Pskl amino acid sequence. Any discussion of the CGT34027’s predicted protein must, however, be considered in light of the fact that the gene structure and splicing pattern for CG34027 has not yet been confirmed. To do so definitively, it would be necessary to perform sequencing, and 5’ and 3’ RACE of cDNA produced from isolated full-length testis mRNAs. DISCUSSION: HOW MIGHT A GCS1 PROTEIN RESULT IN AN ACROSOMAL PHENOTYPE? A. Implications of GCS1’s role as a plasma membrane fusion in Chlamydomonas reinhardtii. The mechanics of GCS1’s role in fertilization are best characterized in Chlamydomonas, and a brief review of fertilization in that system will be helpful here. The gametes of C. reinhardii are biflagellated with two possible mating types: plus (or female), and minus (or male). To merge into a zygote, a pair of gametes first bind to one another via their flagella, which are adhesive at this stage.36 Mating structures then form between the flagella of both gametes.37 These structures tightly bind to one another via the protein Fus1, which is plus- specific.38 The cells then fuse into a single, tetraflagellated gamete.39 In 2008, a study by by Liu, et al.,9 demonstrated that the HAP2/GCS1 protein is necessary for gamete plasma membrane fusion. To examine the protein’s role in this process, the group labeled wild-type plus gametes’ plasma membranes with a fluorescent lipid marker, PKH26, and observed the localization of the dye in pairings with both minus, wild-type gametes and minus, Hap2- gametes. In the wild-type pairings, the dye was quickly taken up by the minus gametes, however the dye did not pass to the minus gametes in the Hap2- pairings, despite mating structure adhesion. Transmission electron micrographs of Hap2- pairs fixed three minutes

- 15 -

after mixing showed though the mating structures adhered, the membranes did not merge, and instead remained approximately 10 nm apart. At three minutes post-mixing, the investigators identified no wild type pairs that had adhered but failed to fuse, which attests to the process’s speed. Though GCS1’s mechanism of action in Arabidopsis and Plasmodium has not been characterized as finely, evidence from those systems is consistent with a similar role. In Arabidopisis, as described above, imaging studies have shown localization at the sperm plasma membrane, or in the ER, through which plasma membrane-directed proteins pass. Arabidopsis sperm from GCS1 mutants has also been shown to fail at a point contemporaneous with sperm- egg fusion: This was shown by the 2006 Mori group11 through experiments in which tagged GCS1 knockout pollen was used to fertilize wild-type eggs. In ovules that had been successfully targeted by knockout pollen tubes, fertilization stalled, and distinct pairs of sperm nuclei were observed in the proximity of the degenerating synergids. In plants fertilized with wild-type sperm, on the other hand, this effect was not observed, because after penetrating the synergids, the sperm promptly fertilized the central and egg cells. This established that GCS1 is not necessary for synergid penetration or pollen tube bursting, but that it has a contemporaneous and essential role in mediating sperm-egg interaction in Arabidopsis, consistent with a role in sperm- egg membrane fusion. Evidence from P. berghei is likewise consistent with such a role. Demonstrated to be male-specific and necessary for fertilization, the protein has been shown to localize at the cell’s periphery.9 The protein does not mediate flagellar adhesion,9 however inoculation of hosts with antiserum blocks fertilization,10 which tends to support a plasma membrane localization and a role in gamete-gamete interaction. B. A plasma membrane fusogen in a system where plasma membranes do not fuse? Clues from the pskl- phenotype. 1. DROSOPHILA SPERM AND EGG PLASMA MEMBRANES DO NOT FUSE DURING FERTILIZATION. Though the mechanics of gamete plasma membrane interaction in Drosophila are not yet fully understood, they are known to differ materially from those seen in other animals. In mammals and in marine invertebrates, the systems where this is best studied, sperm and egg plasma membranes fuse soon after coming into contact.3 In some species, gamete plasma

- 16 -

membrane fusion then proceeds along the length of the tail in a proximal to distal direction.40 In some mammals (including the field vole and the golden hamster), the tail often fails to enter the egg completely, and breaks off rather than being incorporated into the egg.40 In Drosophila, on the other hand, the sperm enters the egg completely, with the membranes around both its head22 and its 1.8 mm tail41 intact. Breakdown of the sperm head’s plasma membrane (PMBD) occurs subsequently.22 The plasma membrane around the tail, meanwhile, does not break down, and the tail persists within the yolk as embryogenesis proceeds.22 Without PMBD, fertilization in D. melanogaster arrests, and other essential fertilization events such as sperm aster formation and chromosome decondensation, and male and female pronuclear formation, will not go forward.22 Given this, the question of how a GCS1 protein could have an essential role in Drosophilia male fertility might seem to be an inherently contradictory one: Why would a plasma membrane fusogen be necessary for fertilization in a system where the plasma membranes do not fuse? The simplest answer is that GCS1 may indeed be involved in an important membrane fusion event other than gamete plasma membrane fusion. 2. THE pskl- PHENOTYPE AND ITS IMPLICATIONS: To identify the likely locus of such an event, we turn to analysis of the pskl- phenotype: a. In pskl- sperm, acrosomal disruption accompanies male infertility Fluorescent microscopy by others in the Wakimoto lab demonstrated that pskl mutations have a disrupted acrosomal phenotype.42 Snky-GFP, an acrosomal membrane marker, was crossed into a psklZ3059 background by laboratory member Kathleen Wilson. Sperm from Homozygous psklZ3059 were then examined via confocal microscopy. The pskl males produced acrosomes that were markedly smaller than those of wild-type flies.42 To determine whether this same effect could be seen in the other pskl strains, wheat germ agglutinin, a lectin, was used to fluorescently label carbohydrate moieties on the sperm plasma membranes of pskl hemizygotes of all three strains. When this was done, a reduction in acrosomal size was seen in all three lines. Sperm that lacked acrosomes completely were seen in all three lines as well.42 The sperm of pskl- males appear to be normal in all other respects: They are motile, and capable of entering the egg.42

- 17 -

A compromised acrosome would be expected to result in male infertility through failure of PMBD. The Wakimoto lab has identified total of five male-sterile mutants that produce motile sperm capable of egg entry. In three of these, snky- 22, mfr—42, and agho, an attendant failure of PMBD has also been conclusively demonstrated. The group also includes kugi-, as well as pskl-. For all five of these mutations, a relationship to the acrosome has been demonstrated. Both Snky and Mfr are acrosomal membrane proteins.22,24 Flies with disruptions in Agho, a Golgi- associated, cytosolic protein, produce no acrosomes, while the acrosomes produced by kugi- flies are few and small.42 As discussed above, pskl- acrosomes are both small and round.42 The compromised acrosomal phenotype suggests a role for Pskl in acrosome biogenesis. Because disruption of the acrosome is linked to failure of PMBD, a failure in acrosome biogenesis would be expected to be sufficient to cause male infertility. GCS1’s demonstrated fusogenic activity in P. berghei suggests that the protein’s role in acrosome biogenesis may be a fusogenic one. C. A role for Pskl in acrosome biogeneisis: 1. ACROSOME BIOGENESIS IN D. MELANOGASTER REQUIRES VESICLE TRAFFICKING FROM THE GOLGI AND VESICLE FUSION. The derivation of mammalian acrosomes has been the subject of some debate.43 The issue is well settled in Drosophila, however. Ultrastructural studies of Drosophila spermiogenesis support a Golgi derivation for the acrosome. The acrosome’s precursor, the acroblast, forms beside the nucleus after Meiosis II, at a site where, during the Clew stage, the Golgi stacks had aggregated prior to breaking down into smaller vesicles.16 The acroblast is a ribbon-like structure that forms from those vesicles,44 becoming more spherical in intermediate spermatids, and finally narrowing and elongating in later spermatids into the needle shape seen in mature sperm.45 Molecular studies also support a Golgi derivation for the D. melanogaster acrosome. This is demonstrated in two ways. First, the acrosome is marked with Golgi-associated proteins. These include the golgin Lava Lamp,16 as well as a species of clathrin adaptors known as Golgi- localized, gamma-ear containing, ADP ribosylation factor-binding proteins (GGAs).46 Secondly, a number of Golgi-associated proteins have been shown necessary for acroblast formation or maintenance in Drosophila. Conserved Oligomeric Golgi Complex 5’s (COG5’s) Drosophila ortholog, Four Way Stop (FWS) is a protein that has shown to localize to the acroblast.16 In fws mutants, Golgi stacks vesiculate normally in early round spermatids, but

- 18 -

the acroblast fails to materialize after Meiosis II. This disruption may either reflect a failure of the Golgi-derived vesicles to merge, or instability of the organelle after vesicle fusion, possibly as the result of an imbalance of anterograde and retrograde traffic from the Golgi.16 A similar phenotype was seen in sperm of flies homozygous for a mutation in rab11.47 A small GTPase associated with the trans Golgi network in spermatocytes, Rab11 has been shown to mediate vesicle trafficking between the recycling endosome and the Golgi in mammalian cells.48 In Drosophila spermatocytes, the factor is believed to mediate vesicle transport from the Golgi to the plasma membrane.47 A like phenotype is also produced by disruption of the Drosophila ortholog of the yeast TrappII subunit.49 In yeast, TrappII localize at the trans Golgi and has been shown to mediate vesicle trafficking as both a guanine nuclear exchange factor (GEF) and as a CopI-interacting vesicle tether.50 When TrappII’s Drosophila ortholog, brunelleschi, is disrupted, acroblast fails to form.49 This kind of phenotype is also seen in giotto mutants, where a failure of PITP I, a phosphatidylinositol transfer protein that mediates the movement of lipid monomers from one compartment to another, results in the presence of Golgi-derived vesicles around the spermatocytes’ equator, but no acrosome formation.51 2. A ROLE FOR PSKL VESICLE TRAFFICKING FROM THE GOLGI IS CONSISTENT WITH THE OBSERVED FUSOGENICITY OF GCS1. As noted above, all functional studies of GCS1 in other systems support or are consistent with a role in membrane fusion. While membrane fusion between gametes is not required for fertilization in Drosophila, membrane fusion remains a key activity in Golgi trafficking and organelle biogenesis. And while Pskl does not share apparent homology with RABs, SNAREs, Syntaxins, or other known vesicle fusion proteins, one research group has proposed that it may effect fusion by penetrating target membranes directly, as with a viral FAST protein.6 It is therefore reasonable to propose that Pskl facilitates male fertility by mediating vesicle fusion in this pathway, and that the size reduction or elimination seen in pskl- sperm is due to failure of this activity. 3. CAVEAT: A VESICLE FUSION PROTEIN WOULD NEED TO BE ACROSOME-SPECIFIC IN ORDER TO PRODUCE AN ACROSOMAL PHENOTYPE SIMILAR TO THAT SEEN IN pskl- It has been posited that the demands of tail elongation render D. melanogaster a highly sensitized system for membrane biogenesis and trafficking:16 Activities of this sort that may be

- 19 -

impossible to isolate in other cell types due to redundancy of their functions become visible during Drosophila spermiogenesis, because in order to produce and deliver enough membrane to enclose its 1.8mm tail, the developing sperm needs all of the tools available.16 Consistent with this, sperm of vesicle trafficking mutants fws, giotto, and brunelleschi show defects in tail elongation, as well as in cytokinesis, another membrane-intensive process.16,49,51 In other words, while they do show disruption of acrosome disruption, they do not phenocopy pskl-. In order to phenocopy pskl-, a vesicle fusion protein would have to be acrosome-specific. 4. NEXT STEPS IN TESTING PSKL’S ROLE IN ACROSOME BIOGENESIS A number of experimental approaches are available for testing the hypothesis that Pskl is involved in acrosome biogenesis. Tracking acrosome biogenesis throughout spermiogenesis in dGCS1 mutants using confocal microscopy and GFP fusions with Agho, Snky, and Mfr should allow the definition of the first visible defect in acrosome formation in the mutants and clarify the basis for the small acrosome phenotype. A change in the localization of Agho, a trans-Golgi- associated protein, could discriminate between a role for dGCS1p in regulating Golgi integrity versus post-Golgi processes. A difference between the localization of Snky- versus Mfr- containing vesicles could reveal specificity in the types or timing of acrosomal vesicular targeting. In addition to this, fluorescently tagged forms of the protein should imaged in situ during stages of spermiogenesis from Clew to sperm maturity to identify the protein’s localization, acrosomal or otherwise. Loss or significant diminution of the signal prior to sperm maturity would tend to show a primary role for the protein in spermiogenesis, while retention of a strong signal at maturity would suggest a role in fertilization itself. If indicated by other experiments, a precise examination and comparison of the fates of acrosome-directed, Golgi-derived vesicles in pskl- and wild-type sperm at the ultrastructural level could be beneficial. D. Action at the plasma membrane: A second potential mode of action for Pskl. GCS1 proteins in other systems have been consistently shown to localize at the sperm plasma membrane. Given this, and given that pskl- sperm are expected to fail at PMBD, an activity at the plasma membrane, the possibility that Pskl may mediate fertilization through action at the plasma membrane cannot be discounted out-of-hand. Such an activity would not preclude the possibility that the protein also has a role in acrosome biogenesis, nor would a role

- 20 -

in acrosome biogenesis preclude the possibility that the protein has an additional role at the plasma membrane. Such a role would not be expected to be fusogenic, however. In mammal fertilization, the sperm plasma membrane is altered by fusion and vesiculation of the apical acrosomal membrane and the apical plasma membrane.52 however this mechanism is not expected to be involved in the process in D. melanogaster: In this system, imaging of fluorescently tagged acrosomal membrane proteins shows that the acrosome persists after PMBD.22 This, coupled with the observation that the Drosophila acrosome is bounded by a single membrane,53tends to exclude the possibility of fusion between the acrosomal and plasma membranes. Interestingly, the GCS1 protein appears to have a role in signal transduction or response in Arabidopsis,54 where it aids in pollen-tube guidance20 in addition to sperm-egg interaction. It is therefore conceivable that the protein could have such a role at the plasma membrane in D. melanogaster. If dGCS1p is indeed a plasma membrane protein, then mutations may affect its presence or distribution on the surface of the sperm. Fluorescently labeled lectins, which recognize the asymmetric distribution of glycoproteins on Drosophila sperm, would provide a convenient assay for possible effects on membrane content or organization.55. Effects on PMBD could be assayed by monitoring retention of a tagged sperm membrane protein, CD2p, by pskl- after sperm entry into the egg. CONCLUSIONS AND FUTURE DIRECTIONS

We have shown that D. melanogaster gene CG34027 is necessary for male fertility, and that its disruption underlies a phenotype wherein males are able to produce motile sperm with small or missing acrosomes, which that can enter the egg, but with which fertilization arrests soon thereafter. We have further shown that CG34027 is a D. melanogaster ortholog of GCS1, a gamete interaction protein known to have a role in plasma membrane fusion in one species, and that is expected to have a role in plasma membrane fusion in several others. Finally, we have outlined a potential role for a the protein in acrosome biogenesis, a process necessary for male fertility in D. melanogaster, as well as a second potential site of action at the plasma membrane. Mechanistic examinations of the protein’s function would be a logical next step. For instance, it would be useful to determine which specific regions of the protein are keys to function in Drosophila. This could be done in several different ways. Analysis of different

- 21 -

regions within the protein to determine the kind of selective pressure each evolved under would be useful: Areas essential for protein function would be expected to show the effects of purifying selection, while less essential regions could be expected to have undergone more neutral selection. This problem can also be analyzed molecularly, through systematic testing of specific alterations in protein sequence for ability to restore fertility to dGCS1 mutants. Choice of domains to test would be informed both by analyses of the protein’s structure and function in D. melanaogaster and other systems (described above), and by the analyses of selective pressures described above. It would also be useful to test whether the protein does, in fact, have the potential to act as a membrane fusogen. This property could be tested by expressing the protein in cultured cells, such as Drosophila S2 cells. Since S2 cells have acrosome equivalent, the protein would be expected to go by default to the plasma membrane, which means that transfected cells could be monitored for cell adhesion or coalescence. Tests of the protein’s fusogenicity in liposomes would also be possible.

MATERIALS AND METHODS

Drosophila strains The psklZ3119, psklz3059, and psklz0070 alleles were recovered after ethylmethane sulfonate (EMS)-mutagenesis from the Zuker collection by Wakimoto et al. in a screen for male sterile mutations. 18,19. Classification of these alleles as members of the snky class of fertilization- defective mutations and initial localization of the pskl gene was based on studies by Fitch, Wilson and Wakimoto (unpublished). The stock containing the pskl- deficiency chromosome, Df(3R)BSC679, was obtained from the Bloomington Drosophila Stock Center (#26531). Construction of transgenic lines: The genomic region containing CG34027 was isolated as a 12.8 kb kb SacI fragment from the Bac clone BAC9803L2 (BacPac Resources) and cloned into the plasmid pBluescript II KS(-). The construct was then amplified in DH5α cells, recovered, and subsequently digested with KpnI to recover a 10.323 kb fragment containing CG34027. This smaller fragment was then cloned into pCasPer4, which bears the w+mc gene.56 This plasmid was introduced into the w1118 strain by Genetic Services, Inc. using standard germ line transformation techniques. Four w+

- 22 -

lines carrying the transgene, denoted +t10 on chromosome 2 were obtained, and were subsequently used to construct the strains of the genotype: y w1118; P[w+mc GCS1+t10] / SM2, Cy ltH; Df(3R)BSC679 / TM6 Sb. Fertility assays: To ascertain the ability of the transgene to rescue fertility in pskl- males, the fertility of brothers of the following genotypes were compared for each pskl allele: 1) +t10; Df/pskl ; 2) Df/pskl (negative control) and 3) Df/pskl / TM6 (positive control). Single males were tested with three virgin females (y w). Percentages of fertile crosses and progeny yields were compared to those of control crosses. Progeny were counted on the 14th and 18th days after the establishment of the crosses. Sequence Analysis: Multiple sequence alignment was created using CLC DNA Workbench.5758 Potential arthropod GCS1 sequences identified by OrthoDB. Accession numbers are as follows: Acyrthosiphon pisum (ACYPI53162-PA), Pediculus humanus (PHUM458070-PA), Tribolium castaneum (TC009345), , Drosophila yakuba (FBpp0255751)Drosophila willistoni (FBpp0242543), Drosophila sechellia (FBpp0199229), Drosophila mojavensis (FBpp0173040), Drosophila melanogaster (FBpp0099438), Drosophila erecta (FBpp0130835), and Drosophila ananassae (FBpp0120294). Identification of pskl genomic lesions. Genomic DNA was extracted from males of the bw;st parent strain, as well as from males of the three pskl strains. Overlapping primer sets (See Appendix A) were used to amplify the genomic region extending from 150 base pairs upstream of the predicted transcriptional start site of CG34027 to 80 base pairs downstream of the predicted transcription termination site. The PCR products were then cycle sequenced using the Department of Biology Comparative Genomic Center.

1 Schurko, A. M., Neiman, M. & Logsdon Jr, J. M. Signs of sex: what we know and how we know it. Trends in Ecology & Evolution 24, 208-217, doi:10.1016/j.tree.2008.11.010 (2009). 2 de Visser, J. A. G. M. & Elena, S. F. The evolution of sex: empirical insights into the roles of epistasis and drift. Nature reviews. Genetics 8, 139-149 (2007).

- 23 -

3 Karr, T. L., Swanson, W. J. & Snook, R. R. in Sperm Biology (eds R. Birkhead Tim, J. Hosken David, David J. Hosken Scott PitnickA2 - Tim R. Birkhead, & Pitnick Scott) 305-365 (Academic Press, 2009). 4 Evans, J. P. Sperm-Egg Interaction. Annual Review of Physiology 74, null, doi:doi:10.1146/annurev-physiol-020911-153339 (2012). 5 Swanson, W. J. & Vacquier, V. D. The rapid evolution of reproductive proteins. Nature reviews. Genetics 3, 137-144 (2002). 6 Wong, J. L. & Johnson, M. A. Is HAP2-GCS1 an ancestral gamete fusogen? Trends in Cell Biology 20, 134-141, doi:10.1016/j.tcb.2009.12.007 (2010). 7 Johnson, M. A. et al. Arabidopsis hapless Mutations Define Essential Gametophytic Functions. Genetics 168, 971-982, doi:10.1534/genetics.104.029447 (2004). 8 Hirai, M. et al. Male Fertility of Malaria Parasites Is Determined by GCS1, a Plant-Type Reproduction Factor. Current Biology 18, 607-613, doi:10.1016/j.cub.2008.03.045 (2008). 9 Liu, Y. et al. The conserved plant sterility gene HAP2 functions after attachment of fusogenic membranes in Chlamydomonas and Plasmodium gametes. Genes & Development 22, 1051-1068, doi:10.1101/gad.1656508 (2008). 10 Blagborough, A. M. & Sinden, R. E. Plasmodium berghei HAP2 induces strong malaria transmission-blocking immunity in vivo and in vitro. Vaccine 27, 5187-5194, doi:10.1016/j.vaccine.2009.06.069 (2009). 11 Mori, T., Kuroiwa, H., Higashiyama, T. & Kuroiwa, T. GENERATIVE CELL SPECIFIC 1 is essential for angiosperm fertilization. Nat Cell Biol 8, 64-71 (2006). 12 Sonnhammer, E. L. L., Eddy, S. R., Birney, E., Bateman, A. & Durbin, R. Pfam: Multiple sequence alignments and HMM-profiles of protein domains. Nucleic Acids Research 26, 320-322, doi:10.1093/nar/26.1.320 (1998). 13 Waterhouse, R. M., Zdobnov, E. M., Tegenfeldt, F., Li, J. & Kriventseva, E. V. OrthoDB: the hierarchical catalog of eukaryotic orthologs in 2011. Nucleic Acids Research 39, D283-D288, doi:10.1093/nar/gkq930 (2011). 14 Steele, R. E. & Dana, C. E. Evolutionary History of the HAP2/GCS1 Gene and Sexual Reproduction in Metazoans. PLoS ONE 4, e7680, doi:10.1371/journal.pone.0007680 (2009). 15 Fuller, M. T. in The Development of Drosophila melanogaster Vol. I (ed M. Bate and A. Martinez-Arias) 71-148 (Cold Spring Harbor Laboratory Press, 1993). 16 Farkas, R. M., Giansanti, M. G., Gatti, M. & Fuller, M. T. The Drosophila Cog5 Homologue Is Required for Cytokinesis, Cell Elongation, and Assembly of Specialized Golgi Architecture during Spermatogenesis. Molecular biology of the cell 14, 190-200, doi:10.1091/mbc.E02-06-0343 (2003). 17 Ashburner, M., Golic, K. & Hawley, S. Drosophila: A Laboratory Handbook. (Cold Spring Harbor Laboratory Press, 2004). 18 Wakimoto, B. T., Lindsley, D. L. & Herrera, C. Toward a Comprehensive Genetic Analysis of Male Fertility in Drosophila melanogaster. Genetics 167, 207-216, doi:10.1534/genetics.167.1.207 (2004). 19 Koundakjian, E. J., Cowan, D. M., Hardy, R. W. & Becker, A. H. The Zuker Collection: A Resource for the Analysis of Autosomal Gene Function in Drosophila melanogaster. Genetics 167, 203-206, doi:10.1534/genetics.167.1.203 (2004).

- 24 -

20 von Besser, K., Frank, A. C., Johnson, M. A. & Preuss, D. Arabidopsis HAP2 (GCS1) is a sperm-specific gene required for pollen tube guidance and fertilization. Development 133, 4761-4769, doi:10.1242/dev.02683 (2006). 21 Fitch, K. R. & Wakimoto, B. T. The Paternal Effect Genems(3)sneakyIs Required for Sperm Activation and the Initiation of Embryogenesis inDrosophila melanogaster. Developmental biology 197, 270-282, doi:10.1006/dbio.1997.8852 (1998). 22 Wilson, K. L., Fitch, K. R., Bafus, B. T. & Wakimoto, B. T. Sperm plasma membrane breakdown during Drosophila fertilization requires sneaky, an acrosomal membrane protein. Development 133, 4871-4879, doi:10.1242/dev.02671 (2006). 23 Ohsako, T., Hirai, K. & Yamamoto, M.-T. The Drosophila misfire gene has an essential role in sperm activation during fertilization. Genes & Genetic Systems 78, 253-266 (2003). 24 Smith, M. & Wakimoto, B. Complex regulation and multiple developmental functions of misfire, the Drosophila melanogaster ferlin gene. BMC Developmental Biology 7, 21 (2007). 25 Chintapalli, V. R., Wang, J. & Dow, J. A. T. Using FlyAtlas to identify better Drosophila melanogaster models of human disease. Nat Genet 39, 715-720, doi:http://www.nature.com/ng/journal/v39/n6/suppinfo/ng2049_S1.html (2007). 26 Liu, Y., Misamore, M. J. & Snell, W. J. Membrane fusion triggers rapid degradation of two gamete-specific, fusion-essential proteins in a membrane block to polygamy in Chlamydomonas. Development 137, 1473-1481, doi:10.1242/dev.044743 (2010). 27 Celniker, S. E. et al. Unlocking the secrets of the genome. Nature 459, 927-930, doi:http://www.nature.com/nature/journal/v459/n7249/suppinfo/459927a_S1.html (2009). 28 Krogh, A., Larsson, B., von Heijne, G. & Sonnhammer, E. L. L. Predicting transmembrane protein topology with a hidden markov model: application to complete genomes. Journal of Molecular Biology 305, 567-580, doi:10.1006/jmbi.2000.4315 (2001). 29 Wong, J. L., Leydon, A. R. & Johnson, M. A. HAP2(GCS1)-Dependent Gamete Fusion Requires a Positively Charged Carboxy-Terminal Domain. PLoS Genet 6, e1000882, doi:10.1371/journal.pgen.1000882 (2010). 30 Mori, T., Hirai, M., Kuroiwa, T. & Miyagishima, S.-y. The Functional Domain of GCS1- Based Gamete Fusion Resides in the Amino Terminus in Plant and Parasite Species. PLoS ONE 5, e15957, doi:10.1371/journal.pone.0015957 (2010). 31 Wickner, S., Maurizi, M. R. & Gottesman, S. Posttranslational Quality Control: Folding, Refolding, and Degrading Proteins. Science 286, 1888-1893, doi:10.1126/science.286.5446.1888 (1999). 32 Dobson, C. M. Principles of protein folding, misfolding and aggregation. Seminars in Cell & Developmental Biology 15, 3-16, doi:10.1016/j.semcdb.2003.12.008 (2004). 33 Tweedie, S. et al. FlyBase: enhancing Drosophila Gene Ontology annotations. Nucleic Acids Research 37, D555-D559, doi:10.1093/nar/gkn788 (2009). 34 Cooper, J. L. et al. Retention of Induced Mutations in a Drosophila Reverse-Genetic Resource. Genetics 180, 661-667, doi:10.1534/genetics.108.092437 (2008). 35 Flibotte, S. et al. Whole-Genome Profiling of Mutagenesis in Caenorhabditis elegans. Genetics 185, 431-441, doi:10.1534/genetics.110.116616 (2010).

- 25 -

36 Goodenough, U. W. & Jurivich, D. Tipping and mating-structure activation induced in Chlamydomonas gametes by flagellar membrane antisera. The Journal of Cell Biology 79, 680-693, doi:10.1083/jcb.79.3.680 (1978). 37 Goodenough, U. W., Detmers, P. A. & Hwang, C. Activation for cell fusion in Chlamydomonas: analysis of wild-type gametes and nonfusing mutants. The Journal of Cell Biology 92, 378-386, doi:10.1083/jcb.92.2.378 (1982). 38 Misamore, M. J., Gupta, S. & Snell, W. J. The Chlamydomonas Fus1 Protein Is Present on the Mating Type plus Fusion Organelle and Required for a Critical Membrane Adhesion Event during Fusion with minus Gametes. Molecular biology of the cell 14, 2530-2542, doi:10.1091/mbc.E02-12-0790 (2003). 39 Wilson, N. F., Foglesong, M. J. & Snell, W. J. The Chlamydomonas Mating Type Plus Fertilization Tubule, a Prototypic Cell Fusion Organelle: Isolation, Characterization, and In Vitro Adhesion to Mating Type Minus Gametes. The Journal of Cell Biology 137, 1537-1553, doi:10.1083/jcb.137.7.1537 (1997). 40 Yanagimachi, R. in Current Topics in Developmental Biology Vol. Volume 12 (eds A. A. Moscona & Monroy Alberto) 83-105 (Academic Press, 1978). 41 Perotti, M.-E. in The Functional Anatomy of the Spermatozoan, Proceedings of the Second International Symposium (ed B.A. Afzelins) 57-68 (Pergamon Press, 1975). 42 Wakimoto lab, unpublished data. 43 RAMALHO-SANTOS, J. & MORENO, R. D. Targeting and fusion proteins during mammalian spermiogenesis. Biological Research 34, 147-152 (2001). 44 Kondylis, V. & Rabouille, C. The Golgi apparatus: Lessons from Drosophila. FEBS letters 583, 3827-3838, doi:10.1016/j.febslet.2009.09.048 (2009). 45 Stanley, H. P., Bowman, J. T., Romrell, L. J., Reed, S. C. & Wilkinson, R. F. Fine structure of normal spermatid differentiation in Drosophila melanogaster. Journal of Ultrastructure Research 41, 433-466, doi:10.1016/s0022-5320(72)90049-4 (1972). 46 Hirst, J. & Carmichael, J. A potential role for the clathrin adaptor GGA in Drosophila spermatogenesis. BMC Cell Biology 12, 22 (2011). 47 Giansanti, M. G., Belloni, G. & Gatti, M. Rab11 Is Required for Membrane Trafficking and Actomyosin Ring Constriction in Meiotic Cytokinesis of Drosophila Males. Molecular biology of the cell 18, 5034-5047, doi:10.1091/mbc.E07-05-0415 (2007). 48 Wilcke, M. et al. Rab11 Regulates the Compartmentalization of Early Endosomes Required for Efficient Transport from Early Endosomes to the Trans-Golgi Network. The Journal of Cell Biology 151, 1207-1220, doi:10.1083/jcb.151.6.1207 (2000). 49 Robinett, C. C., Giansanti, M. G., Gatti, M. & Fuller, M. T. TRAPPII is required for cleavage furrow ingression and localization of Rab11 in dividing male meiotic cells of Drosophila. Journal of Cell Science 122, 4526-4534, doi:10.1242/jcs.054536 (2009). 50 Sacher, M., Kim, Y.-G., Lavie, A., Oh, B.-H. & Segev, N. The TRAPP Complex: Insights into its Architecture and Function. Traffic 9, 2032-2042, doi:10.1111/j.1600- 0854.2008.00833.x (2008). 51 Giansanti, M. G. et al. The Class I PITP Giotto Is Required for Drosophila Cytokinesis. Current Biology 16, 195-201, doi:10.1016/j.cub.2005.12.011 (2006). 52 Barros, C., Bedford, J. M., Franklin, L. E. & Austin, C. R. MEMBRANE VESICULATION AS A FEATURE OF THE MAMMALIAN ACROSOME REACTION. The Journal of Cell Biology 34, C1-5, doi:10.1083/jcb.34.3.C1 (1967).

- 26 -

53 Baccetti, B. in Advances in Insect Physiology Vol. Volume 9 (eds M. J. Berridge J.E. Treherne & V. B. Wigglesworth) 315-397 (Academic Press, 1972). 54 Geitmann, A. & Palanivelu, R. Fertilization requires communication: Signal generation and perception during pollen tube guidance. Floriculture and Ornamental Biotechnology 1, 77-89 (2007). 55 Baker, S. S., Thomas, M. & Thaler, C. D. Sperm Membrane Dynamics Assessed by Changes in Lectin Fluorescence Before and After Capacitation. Journal of andrology 25, 744-751 (2004). 56 Thummel CS, P. V. D. I. S. New pCaSpeR P element vectors. Drosophila Information Service 71, 150 (1992). 57 CLC Bio (www.clcbio.com) 58 Feng, D.-F. & Doolittle, R. Progressive sequence alignment as a prerequisitetto correct phylogenetic trees. Journal of Molecular Evolution 25, 351-360, doi:10.1007/bf02603120 (1987).

- 27 -

APPENDIX A: Overlapping primer sets for PCR and sequencing

The following table lists the primers used for PCR and sequencing. “P” here stands for “Proximal,” and designates the primer closest to the chromosome 3 centromere for any given primer pair. The “D” stands for “Distal,” and designates the primer closest to the tip of chromosome 3’s right arm.

Primer ID>: Oligo: 5'-> 3' 1-P TCAGGGCAGGAATAGCTGA 1-D GGCCGAAGAGTTTGTGGA 2-P GAGGTTGTGGCAGAGTCCTT 2-D GATGAAACACCCGAATGCTC 3-P CGTCGTCTGACTTCTCGTCCT 3-D ATGTGTGCATCAAGGACGTTT 4-P GTGTCGAAGCCAAATCGAC 4-D CAGCATCGAATAGTGCCAGA 5-P AACGGGTTTCGCTAGATTGA 5-D TGGATGAATCGAATAAGGACGTA 6-P AACGCATTCATAGTCACTGGA 6-D AGAAGGCAACCTGGATTCTG 7-P ACGCAGCTTGGTGGTTAGAA 7-D AGCAATTCCTATAAGACGTTTCC 8-P CAGAAGGCAATCCACTAGGC 8-D CGAAAGCCTTGATTCTATTGTG 9-P TCGGCTTGGAACTGAAGTCT 9-D GCCTATTTACCCGTGGACAG 10-P AAAATCCATAGCACTCGCTGA 10-D AGAAGGAACCAGTACCCGATT 11-P GGGAAATGCCGTCAAAGTA 11-D AAACAACGCAGACGATATTGA 12-P GATTTTTCCTGTATGGAAGTTCATT 12-D CGGCGTAGGGATAAAAGGAT 13-P CGCGCCATTTTAGTAACTCC 13-D CGAGCCTGTTGTGATGTACC 14-P TCATTAGTCGCGCAGGAT 14-D GCCCGACAGTATGAATGC 15-P CCCTGCTAACCACAATCAGA 15-D AAAGGCAAATTACTGCTGCAT

- 28 -

List of References

Ashburner, M., Golic, K. & Hawley, S. Drosophila: A Laboratory Handbook. (Cold Spring Harbor Laboratory Press, 2004).

Baccetti, B. in Advances in Insect Physiology Vol. Volume 9 (eds M. J. Berridge J.E. Treherne & V. B. Wigglesworth) 315-397 (Academic Press, 1972).

Baker, S. S., Thomas, M. & Thaler, C. D. Sperm Membrane Dynamics Assessed by Changes in Lectin Fluorescence Before and After Capacitation. Journal of andrology 25, 744-751 (2004).

Barros, C., Bedford, J. M., Franklin, L. E. & Austin, C. R., Membrane vesiculation as a feature of the mammalian acrosome reaction. The Journal of Cell Biology 34, C1-5, doi:10.1083/jcb.34.3.C1 (1967). von Besser, K., Frank, A. C., Johnson, M. A. & Preuss, D. Arabidopsis HAP2 (GCS1) is a sperm-specific gene required for pollen tube guidance and fertilization. Development 133, 4761-4769, doi:10.1242/dev.02683 (2006).

Blagborough, A. M. & Sinden, R. E. Plasmodium berghei HAP2 induces strong malaria transmission-blocking immunity in vivo and in vitro. Vaccine 27, 5187-5194, doi:10.1016/j.vaccine.2009.06.069 (2009).

Celniker, S. E. et al. Unlocking the secrets of the genome. Nature 459, 927-930, doi:http://www.nature.com/nature/journal/v459/n7249/suppinfo/459927a_S1.html (2009).

Chintapalli, V. R., Wang, J. & Dow, J. A. T. Using FlyAtlas to identify better Drosophila melanogaster models of human disease. Nat Genet 39, 715-720, doi:http://www.nature.com/ng/journal/v39/n6/suppinfo/ng2049_S1.html (2007).

Cooper, J. L. et al. Retention of Induced Mutations in a Drosophila Reverse-Genetic Resource. Genetics 180, 661-667, doi:10.1534/genetics.108.092437 (2008).

Dobson, C. M. Principles of protein folding, misfolding and aggregation. Seminars in Cell & Developmental Biology 15, 3-16, doi:10.1016/j.semcdb.2003.12.008 (2004).

Evans, J. P. Sperm-Egg Interaction. Annual Review of Physiology 74, null, doi:doi:10.1146/annurev-physiol-020911-153339 (2012).

Farkas, R. M., Giansanti, M. G., Gatti, M. & Fuller, M. T. The Drosophila Cog5 Homologue Is Required for Cytokinesis, Cell Elongation, and Assembly of Specialized Golgi Architecture during Spermatogenesis. Molecular biology of the cell 14, 190-200, doi:10.1091/mbc.E02-06-0343 (2003).

- 29 -

Feng, D.-F. & Doolittle, R. Progressive sequence alignment as a prerequisitetto correct phylogenetic trees. Journal of Molecular Evolution 25, 351-360, doi:10.1007/bf02603120 (1987). Fitch, K. R. & Wakimoto, B. T. The Paternal Effect Genems(3)sneakyIs Required for Sperm Activation and the Initiation of Embryogenesis inDrosophila melanogaster. Developmental biology 197, 270-282, doi:10.1006/dbio.1997.8852 (1998).

Flibotte, S. et al. Whole-Genome Profiling of Mutagenesis in Caenorhabditis elegans. Genetics 185, 431-441, doi:10.1534/genetics.110.116616 (2010).

Fuller, M. T. in The Development of Drosophila melanogaster Vol. I (ed M. Bate and A. Martinez-Arias) 71-148 (Cold Spring Harbor Laboratory Press, 1993).

Geitmann, A. & Palanivelu, R. Fertilization requires communication: Signal generation and perception during pollen tube guidance. Floriculture and Ornamental Biotechnology 1, 77-89 (2007).

Giansanti, M. G. et al. The Class I PITP Giotto Is Required for Drosophila Cytokinesis. Current Biology 16, 195-201, doi:10.1016/j.cub.2005.12.011 (2006).

Giansanti, M. G., Belloni, G. & Gatti, M. Rab11 Is Required for Membrane Trafficking and Actomyosin Ring Constriction in Meiotic Cytokinesis of Drosophila Males. Molecular biology of the cell 18, 5034-5047, doi:10.1091/mbc.E07-05-0415 (2007).

Goodenough, U. W. & Jurivich, D. Tipping and mating-structure activation induced in Chlamydomonas gametes by flagellar membrane antisera. The Journal of Cell Biology 79, 680-693, doi:10.1083/jcb.79.3.680 (1978).

Goodenough, U. W., Detmers, P. A. & Hwang, C. Activation for cell fusion in Chlamydomonas: analysis of wild-type gametes and nonfusing mutants. The Journal of Cell Biology 92, 378-386, doi:10.1083/jcb.92.2.378 (1982).

Hirai, M. et al. Male Fertility of Malaria Parasites Is Determined by GCS1, a Plant-Type Reproduction Factor. Current Biology 18, 607-613, doi:10.1016/j.cub.2008.03.045 (2008).

Hirst, J. & Carmichael, J. A potential role for the clathrin adaptor GGA in Drosophila spermatogenesis. BMC Cell Biology 12, 22 (2011).

Johnson, M. A. et al. Arabidopsis hapless Mutations Define Essential Gametophytic Functions. Genetics 168, 971-982, doi:10.1534/genetics.104.029447 (2004).

Karr, T. L., Swanson, W. J. & Snook, R. R. in Sperm Biology (eds R. Birkhead Tim, J. Hosken David, David J. Hosken Scott PitnickA2 - Tim R. Birkhead, & Pitnick Scott) 305-365 (Academic Press, 2009).

- 30 -

Kondylis, V. & Rabouille, C. The Golgi apparatus: Lessons from Drosophila. FEBS letters 583, 3827-3838, doi:10.1016/j.febslet.2009.09.048 (2009).

Koundakjian, E. J., Cowan, D. M., Hardy, R. W. & Becker, A. H. The Zuker Collection: A Resource for the Analysis of Autosomal Gene Function in Drosophila melanogaster. Genetics 167, 203-206, doi:10.1534/genetics.167.1.203 (2004).

Krogh, A., Larsson, B., von Heijne, G. & Sonnhammer, E. L. L. Predicting transmembrane protein topology with a hidden markov model: application to complete genomes. Journal of Molecular Biology 305, 567-580, doi:10.1006/jmbi.2000.4315 (2001).

Liu, Y. et al. The conserved plant sterility gene HAP2 functions after attachment of fusogenic membranes in Chlamydomonas and Plasmodium gametes. Genes & Development 22, 1051-1068, doi:10.1101/gad.1656508 (2008).

Liu, Y., Misamore, M. J. & Snell, W. J. Membrane fusion triggers rapid degradation of two gamete-specific, fusion-essential proteins in a membrane block to polygamy in Chlamydomonas. Development 137, 1473-1481, doi:10.1242/dev.044743 (2010).

Misamore, M. J., Gupta, S. & Snell, W. J. The Chlamydomonas Fus1 Protein Is Present on the Mating Type plus Fusion Organelle and Required for a Critical Membrane Adhesion Event during Fusion with minus Gametes. Molecular biology of the cell 14, 2530-2542, doi:10.1091/mbc.E02-12-0790 (2003).

Mori, T., Kuroiwa, H., Higashiyama, T. & Kuroiwa, T. GENERATIVE CELL SPECIFIC 1 is essential for angiosperm fertilization. Nat Cell Biol 8, 64-71 (2006).

Mori, T., Hirai, M., Kuroiwa, T. & Miyagishima, S.-y. The Functional Domain of GCS1-Based Gamete Fusion Resides in the Amino Terminus in Plant and Parasite Species. PLoS ONE 5, e15957, doi:10.1371/journal.pone.0015957 (2010).

Ohsako, T., Hirai, K. & Yamamoto, M.-T. The Drosophila misfire gene has an essential role in sperm activation during fertilization. Genes & Genetic Systems 78, 253-266 (2003).

Perotti, M.-E. in The Functional Anatomy of the Spermatozoan, Proceedings of the Second International Symposium (ed B.A. Afzelins) 57-68 (Pergamon Press, 1975).

Ramalho-Santos, J. & Moreno, R. D. Targeting and fusion proteins during mammalian spermiogenesis. Biological Research 34, 147-152 (2001).

Robinett, C. C., Giansanti, M. G., Gatti, M. & Fuller, M. T. TRAPPII is required for cleavage furrow ingression and localization of Rab11 in dividing male meiotic cells of Drosophila. Journal of Cell Science 122, 4526-4534, doi:10.1242/jcs.054536 (2009).

- 31 -

Sacher, M., Kim, Y.-G., Lavie, A., Oh, B.-H. & Segev, N. The TRAPP Complex: Insights into its Architecture and Function. Traffic 9, 2032-2042, doi:10.1111/j.1600- 0854.2008.00833.x (2008).

Schurko, A. M., Neiman, M. & Logsdon Jr, J. M. Signs of sex: what we know and how we know it. Trends in Ecology & Evolution 24, 208-217, doi:10.1016/j.tree.2008.11.010 (2009).

Smith, M. & Wakimoto, B. Complex regulation and multiple developmental functions of misfire, the Drosophila melanogaster ferlin gene. BMC Developmental Biology 7, 21 (2007).

Sonnhammer, E. L. L., Eddy, S. R., Birney, E., Bateman, A. & Durbin, R. Pfam: Multiple sequence alignments and HMM-profiles of protein domains. Nucleic Acids Research 26, 320-322, doi:10.1093/nar/26.1.320 (1998).

Stanley, H. P., Bowman, J. T., Romrell, L. J., Reed, S. C. & Wilkinson, R. F. Fine structure of normal spermatid differentiation in Drosophila melanogaster. Journal of Ultrastructure Research 41, 433-466, doi:10.1016/s0022-5320(72)90049-4 (1972).

Steele, R. E. & Dana, C. E. Evolutionary History of the HAP2/GCS1 Gene and Sexual Reproduction in Metazoans. PLoS ONE 4, e7680, doi:10.1371/journal.pone.0007680 (2009).

Swanson, W. J. & Vacquier, V. D. The rapid evolution of reproductive proteins. Nature reviews. Genetics 3, 137-144 (2002).

Thummel CS, P. V. D. I. S. New pCaSpeR P element vectors. Drosophila Information Service 71, 150 (1992).

Tweedie, S. et al. FlyBase: enhancing Drosophila Gene Ontology annotations. Nucleic Acids Research 37, D555-D559, doi:10.1093/nar/gkn788 (2009). de Visser, J. A. G. M. & Elena, S. F. The evolution of sex: empirical insights into the roles of epistasis and drift. Nature reviews. Genetics 8, 139-149 (2007)

Wakimoto, B. T., Lindsley, D. L. & Herrera, C. Toward a Comprehensive Genetic Analysis of Male Fertility in Drosophila melanogaster. Genetics 167, 207-216, doi:10.1534/genetics.167.1.207 (2004).

Waterhouse, R. M., Zdobnov, E. M., Tegenfeldt, F., Li, J. & Kriventseva, E. V. OrthoDB: the hierarchical catalog of eukaryotic orthologs in 2011. Nucleic Acids Research 39, D283- D288, doi:10.1093/nar/gkq930 (2011).

Wickner, S., Maurizi, M. R. & Gottesman, S. Posttranslational Quality Control: Folding, Refolding, and Degrading Proteins. Science 286, 1888-1893, doi:10.1126/science.286.5446.1888 (1999).

- 32 -

Wilcke, M. et al. Rab11 Regulates the Compartmentalization of Early Endosomes Required for Efficient Transport from Early Endosomes to the Trans-Golgi Network. The Journal of Cell Biology 151, 1207-1220, doi:10.1083/jcb.151.6.1207 (2000).

Wilson, K. L., Fitch, K. R., Bafus, B. T. & Wakimoto, B. T. Sperm plasma membrane breakdown during Drosophila fertilization requires sneaky, an acrosomal membrane protein. Development 133, 4871-4879, doi:10.1242/dev.02671 (2006).

Wilson, N. F., Foglesong, M. J. & Snell, W. J. The Chlamydomonas Mating Type Plus Fertilization Tubule, a Prototypic Cell Fusion Organelle: Isolation, Characterization, and In Vitro Adhesion to Mating Type Minus Gametes. The Journal of Cell Biology 137, 1537-1553, doi:10.1083/jcb.137.7.1537 (1997).

Wong, J. L. & Johnson, M. A. Is HAP2-GCS1 an ancestral gamete fusogen? Trends in Cell Biology 20, 134-141, doi:10.1016/j.tcb.2009.12.007 (2010).

Wong, J. L., Leydon, A. R. & Johnson, M. A. HAP2(GCS1)-Dependent Gamete Fusion Requires a Positively Charged Carboxy-Terminal Domain. PLoS Genet 6, e1000882, doi:10.1371/journal.pgen.1000882 (2010).

Yanagimachi, R. in Current Topics in Developmental Biology Vol. Volume 12 (eds A. A. Moscona & Monroy Alberto) 83-105 (Academic Press, 1978).

- 33 -