DOCSLIB.ORG

KETCH1 Imports HYL1 to Nucleus for Mirna Biogenesis in Arabidopsis

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
KETCH1 Imports HYL1 to Nucleus for Mirna Biogenesis in Arabidopsis KETCH1 imports HYL1 to nucleus for miRNA biogenesis in Arabidopsis Zhonghui Zhanga,b,1, Xinwei Guoa,c,1, Chunxiao Gea,1, Zeyang Maa, Mengqiu Jianga, Tianhong Lic, Hisashi Koiwad, Seong Wook Yange, and Xiuren Zhanga,2 aDepartment of Biochemistry and Biophysics, Institute for Plant Genomics and Biotechnology, Texas A&M University, College Station, TX 77843; bGuangdong Provincial Key Laboratory of Biotechnology for Plant Development, School of Life Science, South China Normal University, Guangzhou 510631, China; cCollege of Horticulture, China Agricultural University, Beijing 100193, China; dDepartment of Horticultural Sciences, Texas A&M University, College Station, TX 77843; and eDepartment of Systems Biology, College of Life Science and Biotechnology, Yonsei University, Seoul 120-749, Republic of Korea Edited by Xuemei Chen, University of California, Riverside, CA, and approved March 9, 2017 (received for review December 2, 2016) MicroRNA (miRNA) is processed from primary transcripts with hairpin premiRNAs in mammalians (11, 12). Importin-8 facilitates the structures (pri-miRNAs) by microprocessors in the nucleus. How recruitment of AGO2-containing RISC to target mRNAs to pro- cytoplasmic-borne microprocessor components are transported into mote efficient and specific gene silencing in the cytoplasm, whereas the nucleus to fulfill their functions remains poorly understood. Here, the protein can also transport AGO2 and AGO2 partners, GW we report KETCH1 (karyopherin enabling the transport of the proteins and miRNAs, into the nucleus to balance levels of cyto- cytoplasmic HYL1) as a partner of hyponastic leaves 1 (HYL1) protein, plasmic gene-silencing effectors (13–15). Arabidopsis encodes a core component of microprocessor in Arabidopsis and functional 18 importin β-proteins, among which few have also been reported counterpart of DGCR8/Pasha in animals. Null mutation of ketch1 is to function in the miRNA pathway. Loss-of-function of HASTY embryonic-lethal, whereas knockdown mutation of ketch1 caused (HST), an ortholog of human Exportin-5 in plants (16), decreases morphological defects, reminiscent of mutants in the miRNA path- the accumulation of most of tested miRNAs, implying its critical way. ketch1 knockdown mutation also substantially reduced miRNA role in transporting miRNAs and miRNA pathway components. accumulation, but did not alter nuclear-cytoplasmic shuttling of Supersensitive to ABA and drought 2 (SAD2)/enhanced miRNA miRNAs. Rather, the mutation significantly reduced nuclear portion activity 1 (EMA1) appears to negatively impact loading of miR- PLANT BIOLOGY of HYL1 protein and correspondingly compromised the pri-miRNA NAs into AGO1-centered RISC (17). Recently, Transportin1 processing in the nucleus. We propose that KETCH1 transports (TRN1) has been identified as a positive regulator in miRNA HYL1 from the cytoplasm to the nucleus to constitute functional loading through a suppressor screening of ema1 (18). The bona microprocessor in Arabidopsis. This study provides insight into the fide cargos for these importin β-proteins remain to be identified largely unknown nuclear-cytoplasmic trafficking process of miRNA in Arabidopsis. biogenesis components through eukaryotes. Here, we identified karyopherin enabling the transport of the cytoplasmic HYL1 (KETCH1, meaning a sailboat for HYL1), a KETCH1 | importin β | HYL1 | miRNA | pri-miRNA processing member of the importin β-family, as a partner of HYL1. We found that a knockdown mutant of ketch1 through an artificial icroRNAs (miRNAs) are a class of noncoding RNAs, 21– miRNA (amiR-KETCH1) displayed developmental abnormality, M24 nt in length, that play vital roles in diverse biological processes. miRNA biogenesis starts with the transcription of long Significance primary miRNAs (pri-miRNAs) that contain hairpin-like fold- back. In animals, pri-miRNAs are initially processed to generate Microprocessor components are transported into the nucleus precursor miRNAs (premiRNAs) in the nucleus by a micropro- to process primary miRNAs (pri-miRNAs). Hyponastic leaves 1 cessor that minimally comprises of an RNase III enzyme, Drosha, (HYL1) is a core component of microprocessor in Arabidopsis. and two molecules of DGCR8/Pasha (1). PremiRNAs are This study identifies an importin β-protein, KETCH1, as a part- exported to the cytoplasm and further processed by another KETCH1 – ner of HYL1 protein. knockdown mutation causes de- RNase III enzyme, Dicer, to release 21 22 bp miRNA/* duplexes velopmental defect, reminiscent of mutants in the miRNA (2, 3). In Arabidopsis, DCL1, one of four Dicer-like enzymes, pathway. The mutation also reduces miRNA abundance but fulfills consecutive cuts of pri-miRNAs to produce miRNA/*s (4, does not affect its nuclear-cytoplasmic distribution. Rather, 5); and the entire processes occur in the nucleus and are facilitated KETCH1 knockdown mutation decreases the accumulation of by DCL1 cofactors, including hyponastic leaves 1 (HYL1), Serrate – HYL1 protein in the nucleus and compromises the HYL1-mediated (SE), and other accessory partners (4 8). Once generated, pri-miRNA processing, supporting that KETCH1 specifically trans- miRNA duplexes are exported to the cytoplasm and loaded into ports HYL1 into the nucleus to facilitate miRNA production. Given Argonaute (AGO)-containing RNA-induced silencing complexes that HYL1 and importin β-proteins are all conserved in various (RISCs) to repress the expression of their targeted genes (4, 9). organisms, this study sheds light on the poorly understood Although the biogenesis and action of mode of miRNAs have nuclear-cytoplasmic trafficking of microprocessor components been studied well, how the microprocessor components are trans- through eukaryotes. located from their cytoplasmic birthplaces to functional niches in the nucleus has been poorly defined. Nuclear-cytoplasmic traf- Author contributions: Z.Z., C.G., and X.Z. designed research; Z.Z., X.G., C.G., Z.M., M.J., and ficking of biological macromolecules through the nuclear pore X.Z. performed research; T.L., H.K., and S.W.Y. contributed new reagents/analytic tools; complex entails transport receptors, namely karyopherin proteins, Z.Z., X.G., C.G., Z.M., M.J., T.L., H.K., and S.W.Y. analyzed data; and Z.Z. and X.Z. wrote some of which also referred to importins and exportins. Importins the paper. load their cargos in the cytoplasm and release them in the nucleus The authors declare no conflict of interest. upon binding with Ran-GTPase, whereas exportins, coupled with This article is a PNAS Direct Submission. Ran-GTPase, associate with the cargos in the nucleus and dis- 1Z.Z., X.G., and C.G. contributed equally to this work. charge the cargos in the cytoplasm upon hydrolysis of GTP to GDP 2To whom correspondence should be addressed. Email: [email protected]. β (10). Several importin -family members are implicated in the This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. miRNA pathway. Exportin-5 mediates the nuclear export of 1073/pnas.1619755114/-/DCSupplemental. www.pnas.org/cgi/doi/10.1073/pnas.1619755114 PNAS Early Edition | 1of6 Downloaded by guest on September 25, 2021 could observe the strong FRET signals in the nucleus and residue amount in some spots near the nuclear envelope, suggesting that translocation of the KETCH1–HYL1 complex may happen near the nuclear envelope through KETCH1–HYL1 interaction. We did not detect obvious FRET signals in any discrete foci, like D-bodies, where endogenous HYL1 is typically located (20), suggesting that the HYL1–KETCH1 interaction is dynamic and HYL1 is discharged before its entrance into D-bodies. Alterna- tively, overaccumulation of HYL1 and KETCH1 proteins in the infiltrated cells might mask the signal from the D-bodies. We also conducted co-IP experiments with ketch1-2; PKETCH1-FM- KETCH1 complementation lines using an anti-Flag antibody and Fig. 1. KETCH1 is a partner of HYL1 in Arabidopsis.(A) Silver-stained SDS/ detected co-IP products with antibodies specifically recognizing PAGE of purified HYL1 complexes for proteomics analysis. (B and C) Specific endogenous proteins. Again, we observed the specific KETCH1– HYL1-KETCH1 interaction was confirmed in N. benthamiana by FRET (B)andin HYL1 interactions in Arabidopsis, but not control proteins, such as Arabidopsis by co-IP assays (C). In B: CFP, donor HYL1-CFP fluorescence; nFRET, normalized FRET fluorescence; YFP, acceptor YFP-KETCH1 fluorescence. The actin, and validated this interaction was RNA-independent (Fig. color bars indicate the scale of the signal strength or the distance between the 1C). Finally, an in vitro pull-down assay indicated that recombi- donor and the acceptor (DCFP/YFP). In C, actin is a control. (Scale bars, 10 μm.) nant His-SUMO-KETCH1, but not the control protein STING (21), could physically interact with HYL1 (Fig. S3E). Taking these data together, we concluded that KETCH1 is a bona fide partner characteristic of the mutants with the miRNA defect. The hypo- of HYL1 protein in vivo. morphic mutants also exhibited significantly reduced accumulation of miRNAs, but no change in nuclear-cytoplasmic distribution. In Loss-of-Function Mutation of ketch1 Causes Developmental Defect. contrast, the mutation caused less accumulation of nuclear-localized To study biological function of the KETCH1 gene, we genotyped HYL1 and compromised pri-miRNA processing in the nucleus. We a T-DNA insertion line SALK_050129/emb2734-2,whichis conclude that KETCH1 imports HYL1 protein from the cytoplasm renamed as ketch1-2
Load more

Recommended publications
  • Karyopherin Beta 3 (IPO5) (BD027479) Human Untagged Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC105419 Karyopherin beta 3 (IPO5) (BD027479) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: Karyopherin beta 3 (IPO5) (BD027479) Human Untagged Clone Tag: Tag Free Symbol: IPO5 Vector: pCMV6-XL4 E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: None Fully Sequenced ORF: >NCBI ORF sequence for BD027479, the custom clone sequence may differ by one or more nucleotides CTTCTCTCTCACGCCTAGCGCAATGGCGGCGGCCGCGGCGGASCAGCAACAGTTCTACCTGCTCCTGGGA AACCTGCTCAGCCCCGACAATGTGGTCCGGAAACAGGCAGAGGAAACCTATGAGAATANTCCCAGGCCAG TCAAAGATCACATTCCTCTTACAAGCCATCAGAAATACAACAGCTGCTGAAGAGGCTAGACAAATGGCCG CCGTTCTCCTAAGACGTCTCTTGTCCTCTGCATTTGATGAAGTCTATCCAGCACTTCCCTCTGATGTTCA GACTGCCATCAAGAGTGAGCTACTCATGATTATTCAGATGGAAACACAATCTAGCATGAGGAAAAAAGTT TGTGATATTGCGGSAGAACTGGCCAGGAATTTAATAGATGAGGATGGCAATAACCAGTGGCCCGAAGTTT GAAGTTCCTTTTTGATTCAGTCAG 5' Read Nucleotide >OriGene 5' read for BD027479 unedited Sequence: TGTATACGACTCATATAGGGCGGCCGCGAATCGGCACGAGGCGCCGGCGCCGGCGGCCGC GGCGGGGTGAGAGGCCGCGAGGCCCCGCCCCGTCCTCCCCTTTCCCCTTTGCCCCGCCCT TCCCGCGCGGCCCCCCGCAAGCCCCGCGCCGCCGCTGGTGCCGGTCCCCGCGCTGGGCCC GCCCCCGCCCCTCCCGCGGCCCGCGAGCGCGCCTCACGGCTCCTGTCTCCCCTCCCTCCT TCTCTCTCACGCCTAGCGCAATGGCGGCGGCCGCGGCGGAGCAGCAACAGTTCTACCTGC TCCTGGGAAACCTGCTCAGCCCCGACAATGTGGTCCGGAAACAGGCAGAGGAAACCTATG AGAATATCCCAGGCCAGTCAAAGATCACATTCCTCTTACAAGCCATCAGAAATACAACAG
    [Show full text]
  • Genetic and Genomic Analysis of Hyperlipidemia, Obesity and Diabetes Using (C57BL/6J × TALLYHO/Jngj) F2 Mice
    University of Tennessee, Knoxville TRACE: Tennessee Research and Creative Exchange Nutrition Publications and Other Works Nutrition 12-19-2010 Genetic and genomic analysis of hyperlipidemia, obesity and diabetes using (C57BL/6J × TALLYHO/JngJ) F2 mice Taryn P. Stewart Marshall University Hyoung Y. Kim University of Tennessee - Knoxville, [email protected] Arnold M. Saxton University of Tennessee - Knoxville, [email protected] Jung H. Kim Marshall University Follow this and additional works at: https://trace.tennessee.edu/utk_nutrpubs Part of the Animal Sciences Commons, and the Nutrition Commons Recommended Citation BMC Genomics 2010, 11:713 doi:10.1186/1471-2164-11-713 This Article is brought to you for free and open access by the Nutrition at TRACE: Tennessee Research and Creative Exchange. It has been accepted for inclusion in Nutrition Publications and Other Works by an authorized administrator of TRACE: Tennessee Research and Creative Exchange. For more information, please contact [email protected]. Stewart et al. BMC Genomics 2010, 11:713 http://www.biomedcentral.com/1471-2164/11/713 RESEARCH ARTICLE Open Access Genetic and genomic analysis of hyperlipidemia, obesity and diabetes using (C57BL/6J × TALLYHO/JngJ) F2 mice Taryn P Stewart1, Hyoung Yon Kim2, Arnold M Saxton3, Jung Han Kim1* Abstract Background: Type 2 diabetes (T2D) is the most common form of diabetes in humans and is closely associated with dyslipidemia and obesity that magnifies the mortality and morbidity related to T2D. The genetic contribution to human T2D and related metabolic disorders is evident, and mostly follows polygenic inheritance. The TALLYHO/ JngJ (TH) mice are a polygenic model for T2D characterized by obesity, hyperinsulinemia, impaired glucose uptake and tolerance, hyperlipidemia, and hyperglycemia.
    [Show full text]
  • Genes with 5' Terminal Oligopyrimidine Tracts Preferentially Escape Global Suppression of Translation by the SARS-Cov-2 NSP1 Protein
    Downloaded from rnajournal.cshlp.org on September 28, 2021 - Published by Cold Spring Harbor Laboratory Press Genes with 5′ terminal oligopyrimidine tracts preferentially escape global suppression of translation by the SARS-CoV-2 Nsp1 protein Shilpa Raoa, Ian Hoskinsa, Tori Tonna, P. Daniela Garciaa, Hakan Ozadama, Elif Sarinay Cenika, Can Cenika,1 a Department of Molecular Biosciences, University of Texas at Austin, Austin, TX 78712, USA 1Corresponding author: [email protected] Key words: SARS-CoV-2, Nsp1, MeTAFlow, translation, ribosome profiling, RNA-Seq, 5′ TOP, Ribo-Seq, gene expression 1 Downloaded from rnajournal.cshlp.org on September 28, 2021 - Published by Cold Spring Harbor Laboratory Press Abstract Viruses rely on the host translation machinery to synthesize their own proteins. Consequently, they have evolved varied mechanisms to co-opt host translation for their survival. SARS-CoV-2 relies on a non-structural protein, Nsp1, for shutting down host translation. However, it is currently unknown how viral proteins and host factors critical for viral replication can escape a global shutdown of host translation. Here, using a novel FACS-based assay called MeTAFlow, we report a dose-dependent reduction in both nascent protein synthesis and mRNA abundance in cells expressing Nsp1. We perform RNA-Seq and matched ribosome profiling experiments to identify gene-specific changes both at the mRNA expression and translation level. We discover that a functionally-coherent subset of human genes are preferentially translated in the context of Nsp1 expression. These genes include the translation machinery components, RNA binding proteins, and others important for viral pathogenicity. Importantly, we uncovered a remarkable enrichment of 5′ terminal oligo-pyrimidine (TOP) tracts among preferentially translated genes.
    [Show full text]
  • Novel Mutation and Three Other Sequence Variants Segregating with Phenotype at Keratoconus 13Q32 Susceptibility Locus
    European Journal of Human Genetics (2012) 20, 389–397 & 2012 Macmillan Publishers Limited All rights reserved 1018-4813/12 www.nature.com/ejhg ARTICLE Novel mutation and three other sequence variants segregating with phenotype at keratoconus 13q32 susceptibility locus Marta Czugala1,6, Justyna A Karolak1,6, Dorota M Nowak1, Piotr Polakowski2, Jose Pitarque3, Andrea Molinari3, Malgorzata Rydzanicz1, Bassem A Bejjani4, Beatrice YJT Yue5, Jacek P Szaflik2 and Marzena Gajecka*,1 Keratoconus (KTCN), a non-inflammatory corneal disorder characterized by stromal thinning, represents a major cause of corneal transplantations. Genetic and environmental factors have a role in the etiology of this complex disease. Previously reported linkage analysis revealed that chromosomal region 13q32 is likely to contain causative gene(s) for familial KTCN. Consequently, we have chosen eight positional candidate genes in this region: MBNL1, IPO5, FARP1, RNF113B, STK24, DOCK9, ZIC5 and ZIC2, and sequenced all of them in 51 individuals from Ecuadorian KTCN families and 105 matching controls. The mutation screening identified one mutation and three sequence variants showing 100% segregation under a dominant model with KTCN phenotype in one large Ecuadorian family. These substitutions were found in three different genes: c.2262A4C (p.Gln754His) and c.720+43A4GinDOCK9; c.2377-132A4CinIPO5 and c.1053+29G4CinSTK24. PolyPhen analyses predicted that c.2262A4C (Gln754His) is possibly damaging for the protein function and structure. Our results suggest that c.2262A4C (p.Gln754His)
    [Show full text]
  • Karyopherin Beta 3 (IPO5) Mouse Monoclonal Antibody [Clone ID: OTI1C5] Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for TA811923 Karyopherin beta 3 (IPO5) Mouse Monoclonal Antibody [Clone ID: OTI1C5] Product data: Product Type: Primary Antibodies Clone Name: OTI1C5 Applications: WB Recommended Dilution: WB 1:2000 Reactivity: Human, Mouse, Rat Host: Mouse Isotype: IgG1 Clonality: Monoclonal Immunogen: Human recombinant protein fragment corresponding to amino acids 1-220 of human IPO5 (NP_002262) produced in E.coli. Formulation: PBS (PH 7.3) containing 1% BSA, 50% glycerol and 0.02% sodium azide. Concentration: 1 mg/ml Purification: Purified from mouse ascites fluids or tissue culture supernatant by affinity chromatography (protein A/G) Conjugation: Unconjugated Storage: Store at -20°C as received. Stability: Stable for 12 months from date of receipt. Predicted Protein Size: 125.4 kDa Gene Name: importin 5 Database Link: NP_002262 Entrez Gene 70572 MouseEntrez Gene 306182 RatEntrez Gene 3843 Human O00410 This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 3 Karyopherin beta 3 (IPO5) Mouse Monoclonal Antibody [Clone ID: OTI1C5] – TA811923 Background: Nucleocytoplasmic transport, a signal- and energy-dependent process, takes place through nuclear pore complexes embedded in the nuclear envelope. The import of proteins containing a nuclear localization signal (NLS) requires the NLS import receptor, a heterodimer of importin alpha and beta subunits also known as karyopherins. Importin alpha binds the NLS-containing cargo in the cytoplasm and importin beta docks the complex at the cytoplasmic side of the nuclear pore complex.
    [Show full text]
  • Therapeutic Targeting of Nuclear Transport
    cells Review Controlling the Gatekeeper: Therapeutic Targeting of Nuclear Transport Friederike K. Kosyna * and Reinhard Depping Institute of Physiology, Center for Structural and Cell Biology in Medicine, University of Lübeck, Ratzeburger Allee 160, D-23562 Lübeck, Germany; [email protected] * Correspondence: [email protected]; Tel.: +49-451-3101-7322; Fax: +49-451-3101-7304 Received: 25 October 2018; Accepted: 17 November 2018; Published: 21 November 2018 Abstract: Nuclear transport receptors of the karyopherin superfamily of proteins transport macromolecules from one compartment to the other and are critical for both cell physiology and pathophysiology. The nuclear transport machinery is tightly regulated and essential to a number of key cellular processes since the spatiotemporally expression of many proteins and the nuclear transporters themselves is crucial for cellular activities. Dysregulation of the nuclear transport machinery results in localization shifts of specific cargo proteins and associates with the pathogenesis of disease states such as cancer, inflammation, viral illness and neurodegenerative diseases. Therefore, inhibition of the nuclear transport system has future potential for therapeutic intervention and could contribute to the elucidation of disease mechanisms. In this review, we recapitulate clue findings in the pathophysiological significance of nuclear transport processes and describe the development of nuclear transport inhibitors. Finally, clinical implications and results of the first clinical trials are discussed for the most promising nuclear transport inhibitors. Keywords: nuclear transport; exportin; importin; karyopherin; chromosome region maintenance 1 (CRM1); cancer; drug; nuclear transport inhibitor 1. Introduction The cytoplasm and the nucleoplasm are separated by the nuclear envelope in eukaryotic cells. Spatially segregation of essential cellular processes requires tight control of large molecule exchange such as RNAs, proteins, or ribonucleoprotein particles through this double membrane.
    [Show full text]
  • IPO5 Antibody
    Product Datasheet IPO5 Antibody Catalog No: #32535 Orders: [email protected] Description Support: [email protected] Product Name IPO5 Antibody Host Species Rabbit Clonality Polyclonal Purification Antibodies were purified by affinity purification using immunogen. Applications WB,IF Species Reactivity Human,Mouse Specificity The antibody detects endogenous level of total IPO5 protein. Immunogen Type Recombinant Protein Immunogen Description Recombinant protein of human IPO5. Target Name IPO5 Other Names IMB3; Pse1; imp5; KPNB3; RANBP5 Accession No. Swiss-Prot:O00410NCBI Gene ID:3843 SDS-PAGE MW 123KD Concentration 1.0mg/ml Formulation Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Storage Store at -20°C Application Details WB 1:500 - 1:2000IF 1:50 - 1:200 Images Immunofluorescence analysis of U2OS cells using IPO5 . Blue: DAPI for nuclear staining. Address: 8400 Baltimore Ave., Suite 302, College Park, MD 20740, USA http://www.sabbiotech.com 1 Western blot analysis of extracts of various cell lines, using IPO5 at 1:1000 dilution. Background Nucleocytoplasmic transport, a signal- and energy-dependent process, takes place through nuclear pore complexes embedded in the nuclear envelope. The import of proteins containing a nuclear localization signal (NLS) requires the NLS import receptor, a heterodimer of importin alpha and beta subunits also known as karyopherins. Importin alpha binds the NLS-containing cargo in the cytoplasm and importin beta docks the complex at the cytoplasmic side of the nuclear pore complex. In the presence of nucleoside triphosphates and the small GTP binding protein Ran, the complex moves into the nuclear pore complex and the importin subunits dissociate.
    [Show full text]
  • The Proteins of Keratoconus: a Literature Review Exploring Their Contribution to the Pathophysiology of the Disease
    Adv Ther (2019) 36:2205–2222 https://doi.org/10.1007/s12325-019-01026-0 REVIEW The Proteins of Keratoconus: a Literature Review Exploring Their Contribution to the Pathophysiology of the Disease Eleftherios Loukovitis . Nikolaos Kozeis . Zisis Gatzioufas . Athina Kozei . Eleni Tsotridou . Maria Stoila . Spyros Koronis . Konstantinos Sfakianakis . Paris Tranos . Miltiadis Balidis . Zacharias Zachariadis . Dimitrios G. Mikropoulos . George Anogeianakis . Andreas Katsanos . Anastasios G. Konstas Received: June 11, 2019 / Published online: July 30, 2019 Ó The Author(s) 2019 ABSTRACT abnormalities primarily relate to the weakening of the corneal collagen. Their understanding is Introduction: Keratoconus (KC) is a complex, crucial and could contribute to effective man- genetically heterogeneous multifactorial agement of the disease, such as with the aid of degenerative disorder characterized by corneal corneal cross-linking (CXL). The present article ectasia and thinning. Its incidence is approxi- critically reviews the proteins involved in the mately 1/2000–1/50,000 in the general popula- pathophysiology of KC, with particular tion. KC is associated with moderate to high emphasis on the characteristics of collagen that myopia and irregular astigmatism, resulting in pertain to CXL. severe visual impairment. KC structural Methods: PubMed, MEDLINE, Google Scholar and GeneCards databases were screened for rel- evant articles published in English between January 2006 and June 2018. Keyword combi- Enhanced Digital Features To view enhanced digital nations of the words ‘‘keratoconus,’’ ‘‘risk features for this article go to https://doi.org/10.6084/ m9.figshare.8427200. E. Loukovitis K. Sfakianakis Hellenic Army Medical Corps, Thessaloniki, Greece Division of Surgical Anatomy, Laboratory of Anatomy, Medical School, Democritus University of E.
    [Show full text]
  • 2020.09.13.295493V1.Full.Pdf
    bioRxiv preprint doi: https://doi.org/10.1101/2020.09.13.295493; this version posted September 14, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Genes with 5′ terminal oligopyrimidine tracts preferentially escape global suppression of translation by the SARS-CoV-2 NSP1 protein Shilpa Rao, Ian Hoskins*, P. Daniela Garcia*, Tori Tonn, Hakan Ozadam, Elif Sarinay Cenik, Can Cenik 1 Department of Molecular Biosciences, University of Texas at Austin, Austin, TX 78712, USA * Equal contribution Key words: SARS-CoV-2, NSP1, MeTAFlow, translation, ribosome profiling, RNA-Seq, 5′ TOP, Ribo-Seq, gene expression Abstract Viruses rely on the host translation machinery to synthesize their own proteins. Consequently, they have evolved varied mechanisms to co-opt host translation for their survival. SARS-CoV-2 relies on a non-structural protein, NSP1, for shutting down host translation. Despite this, it is currently unknown how viral proteins and host factors critical for viral replication can escape a global shutdown of host translation. Here, using a novel FACS-based assay called MeTAFlow, we report a dose-dependent reduction in both nascent protein synthesis and mRNA abundance in cells expressing NSP1. We perform RNA-Seq and matched ribosome profiling experiments to identify gene-specific changes both at the mRNA expression and translation level. We discover a functionally-coherent subset of human genes preferentially translated in the context of NSP1 expression.
    [Show full text]
  • NMDAR Signaling Facilitates the IPO5-Mediated Nuclear Import of CPEB3 Hsu-Wen Chao1, Yen-Ting Lai1,2, Yi-Ling Lu1, Chi-Long Lin3, Wei Mai3 and Yi-Shuian Huang1,2,*
    8484–8498 Nucleic Acids Research, 2012, Vol. 40, No. 17 Published online 22 June 2012 doi:10.1093/nar/gks598 NMDAR signaling facilitates the IPO5-mediated nuclear import of CPEB3 Hsu-Wen Chao1, Yen-Ting Lai1,2, Yi-Ling Lu1, Chi-long Lin3, Wei Mai3 and Yi-Shuian Huang1,2,* 1Institute of Biomedical Sciences, Academia Sinica, Taipei 11529, Taiwan, 2Graduate Institute of Microbiology, National Taiwan University, Taipei 10051, Taiwan and 3National RNAi Core Facility, Academia Sinica, Taipei 11529, Taiwan Downloaded from https://academic.oup.com/nar/article/40/17/8484/2411581 by guest on 01 October 2021 Received May 1, 2012; Revised May 23, 2012; Accepted May 28, 2012 ABSTRACT controlling gene expression, scaffold molecules, and the proteolyzed intracellular domains of synaptic receptors Cytoplasmic polyadenylation element-binding (4,5). Transcription factors, such as cyclic AMP respon- protein (CPEB)3 is a nucleocytoplasm-shuttling sive element-binding protein (CREB)2, and translation RNA-binding protein and predominantly resides in regulators, such as cytoplasmic polyadenylation element- the cytoplasm where it represses target RNA trans- binding protein (CPEB)3 and CPEB4, move to the nucleus lation. When translocated into the nucleus, CPEB3 after activation of the N-methyl-D-aspartate receptor binds to Stat5b and downregulates Stat5b-depen- (NMDAR) (6–9), suggesting that the nucleocytoplasmic dent transcription. In neurons, the activation of partition of these proteins by specific neuronal signaling N-methyl-D-aspartate receptors (NMDARs) accumu- determines their role in gene expression. lates CPEB3 in the nucleus and redistributes CPEB3 Synapse-to-nucleus communication (i.e. retrograde in the nucleocytoplasmic compartments to control trafficking of protein molecules from synaptic areas to the nucleus) plays an important role in synaptic plasti- gene expression.
    [Show full text]
  • IPO5 Promotes the Proliferation and Tumourigenicity of Colorectal Cancer
    Zhang et al. Journal of Experimental & Clinical Cancer Research (2019) 38:296 https://doi.org/10.1186/s13046-019-1290-0 RESEARCH Open Access IPO5 promotes the proliferation and tumourigenicity of colorectal cancer cells by mediating RASAL2 nuclear transportation Wenjuan Zhang1, Yanxia Lu1, Xiaomin Li1, Jianming Zhang1,2, Weihao Lin1, Wei Zhang1, Lin Zheng1 and Xuenong Li1* Abstract Background: Karyopherin nuclear transport receptors play important roles in tumour development and drug resistance and have been reported as potential biomarkers and therapeutic targets for tumour treatment. However, IPO5, one of the karyopherin nuclear transport receptor family members, remains largely uncharacterized in tumour progression. Methods: The TCGA data, quantitative reverse transcription-PCR (qRT-PCR), western blotting, and IHC analyses were used to detect IPO5 expression in CRC tissues. A series of in vivo and in vitro experiments was utilized to demonstrate the function of IPO5 in CRC tissues. Mass spectrometry (MS), CO-IP technology, subcellular fractionation, and immunofluorescence were utilized to investigate the possible mechanisms of CRC. Results: IPO5 was highly expressed and positively correlated with the clinicopathological characteristics of colorectal cancer tissues. Functional experiments indicated that IPO5 could promote the development of CRC. Mechanistically, we screened RASAL2, one cargo of IPO5, and further confirmed that IPO5 bound to the NLS sequence of RASAL2, mediating RASAL2 nuclear translocation and inducing RAS signal activation, thereby promoting the progression of CRC. Conclusions: Together, our results indicate that IPO5 is overexpressed in colorectal cancer cells. By transporting RASAL2, IPO5 may play a crucial role in CRC. Keywords: Colorectalcancer,IPO5,RASAL2,NLS,Raspathway,Karyopherins Background proteins; they include both importins and exportins [1, 2].
    [Show full text]
  • Proteomic-Based Evaluation of Nuclear Transport of NLS-Tagged Trastuzumab-Emtansine With
    bioRxiv preprint doi: https://doi.org/10.1101/769588; this version posted September 14, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. Proteomic-based evaluation of nuclear transport of NLS-tagged trastuzumab-emtansine with enhanced cytotoxic potency Vincent Lacasse1, Simon Beaudoin1, Steve Jean2, and Jeffrey V. Leyton1,3,4 1Department of Nuclear Medicine and Radiobiology, Faculty of Medicine and Health Sciences, Centre Hospitalier Universitaire de Sherbrooke (CHUS), Université de Sherbrooke (UdeS), Sherbrooke, Québec, Canada 2Department of Anatomy and Cellular Biology, Faculty of Medicine and Health Sciences, CHUS, UdeS, Sherbrooke, Québec, Canada 3Sherbrooke Molecular Imaging Centre (CIMS), Centre de Recherche du CHUS, UdeS, Sherbrooke, Québec, Canada 4Sherbrooke Pharmacology Institute, Sherbrooke, Québec, Canada Running title: Novel proteomic tool for nuclear transport regulation Corresponding author: Jeffrey V. Leyton; [email protected]; 819-346-1110 x14907 Significant abbreviations: Antibody-drug conjugate (ADC); trastuzumab-emtansine (T-DM1); trastuzumab (Tmab); Human epidermal growth factor receptor 2 (HER2); Nuclear localization sequence (NLS); Cell accumulator (Accum); Nuclear transport receptor (NTR); SAINT score (STSc); GeneMANIA (GM); Gene Set Enrichment Analysis (GSEA) 1 bioRxiv preprint doi: https://doi.org/10.1101/769588; this version posted September 14, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.
    [Show full text]