Genes with 5' Terminal Oligopyrimidine Tracts Preferentially Escape Global Suppression of Translation by the SARS-Cov-2 NSP1 Protein
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Multiplexed Single-Cell Transcriptional Response Profiling to Define Cancer
ARTICLE https://doi.org/10.1038/s41467-020-17440-w OPEN Multiplexed single-cell transcriptional response profiling to define cancer vulnerabilities and therapeutic mechanism of action James M. McFarland 1,11, Brenton R. Paolella 1,11, Allison Warren1, Kathryn Geiger-Schuller 1,2, Tsukasa Shibue1, Michael Rothberg1, Olena Kuksenko1,2, William N. Colgan 1, Andrew Jones1, Emily Chambers1, Danielle Dionne1,2, Samantha Bender1, Brian M. Wolpin3,4,5, Mahmoud Ghandi 1, Itay Tirosh2,6, Orit Rozenblatt-Rosen1,2, Jennifer A. Roth1, Todd R. Golub 1,3,7,8, Aviv Regev 1,2,8,9,10, ✉ ✉ ✉ Andrew J. Aguirre 1,3,4,5,12 , Francisca Vazquez 1,12 & Aviad Tsherniak 1,12 1234567890():,; Assays to study cancer cell responses to pharmacologic or genetic perturbations are typically restricted to using simple phenotypic readouts such as proliferation rate. Information-rich assays, such as gene-expression profiling, have generally not permitted efficient profiling of a given perturbation across multiple cellular contexts. Here, we develop MIX-Seq, a method for multiplexed transcriptional profiling of post-perturbation responses across a mixture of samples with single-cell resolution, using SNP-based computational demultiplexing of single- cell RNA-sequencing data. We show that MIX-Seq can be used to profile responses to chemical or genetic perturbations across pools of 100 or more cancer cell lines. We combine it with Cell Hashing to further multiplex additional experimental conditions, such as post- treatment time points or drug doses. Analyzing the high-content readout of scRNA-seq reveals both shared and context-specific transcriptional response components that can identify drug mechanism of action and enable prediction of long-term cell viability from short- term transcriptional responses to treatment. -
Supplementary Materials: Evaluation of Cytotoxicity and Α-Glucosidase Inhibitory Activity of Amide and Polyamino-Derivatives of Lupane Triterpenoids
Supplementary Materials: Evaluation of cytotoxicity and α-glucosidase inhibitory activity of amide and polyamino-derivatives of lupane triterpenoids Oxana B. Kazakova1*, Gul'nara V. Giniyatullina1, Akhat G. Mustafin1, Denis A. Babkov2, Elena V. Sokolova2, Alexander A. Spasov2* 1Ufa Institute of Chemistry of the Ufa Federal Research Centre of the Russian Academy of Sciences, 71, pr. Oktyabrya, 450054 Ufa, Russian Federation 2Scientific Center for Innovative Drugs, Volgograd State Medical University, Novorossiyskaya st. 39, Volgograd 400087, Russian Federation Correspondence Prof. Dr. Oxana B. Kazakova Ufa Institute of Chemistry of the Ufa Federal Research Centre of the Russian Academy of Sciences 71 Prospeсt Oktyabrya Ufa, 450054 Russian Federation E-mail: [email protected] Prof. Dr. Alexander A. Spasov Scientific Center for Innovative Drugs of the Volgograd State Medical University 39 Novorossiyskaya st. Volgograd, 400087 Russian Federation E-mail: [email protected] Figure S1. 1H and 13C of compound 2. H NH N H O H O H 2 2 Figure S2. 1H and 13C of compound 4. NH2 O H O H CH3 O O H H3C O H 4 3 Figure S3. Anticancer screening data of compound 2 at single dose assay 4 Figure S4. Anticancer screening data of compound 7 at single dose assay 5 Figure S5. Anticancer screening data of compound 8 at single dose assay 6 Figure S6. Anticancer screening data of compound 9 at single dose assay 7 Figure S7. Anticancer screening data of compound 12 at single dose assay 8 Figure S8. Anticancer screening data of compound 13 at single dose assay 9 Figure S9. Anticancer screening data of compound 14 at single dose assay 10 Figure S10. -
EEF1D Mouse Monoclonal Antibody [Clone ID: OTI4B9] Product Data
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for CF811676 EEF1D Mouse Monoclonal Antibody [Clone ID: OTI4B9] Product data: Product Type: Primary Antibodies Clone Name: OTI4B9 Applications: IHC, WB Recommended Dilution: WB 1:500~2000, IHC 1:2000 Reactivity: Human, Mouse, Rat Host: Mouse Isotype: IgG1 Clonality: Monoclonal Immunogen: Full length human recombinant protein of human EEF1D (NP_115754) produced in E.coli. Formulation: Lyophilized powder (original buffer 1X PBS, pH 7.3, 8% trehalose) Reconstitution Method: For reconstitution, we recommend adding 100uL distilled water to a final antibody concentration of about 1 mg/mL. To use this carrier-free antibody for conjugation experiment, we strongly recommend performing another round of desalting process. (OriGene recommends Zeba Spin Desalting Columns, 7KMWCO from Thermo Scientific) Purification: Purified from mouse ascites fluids or tissue culture supernatant by affinity chromatography (protein A/G) Conjugation: Unconjugated Storage: Store at -20°C as received. Stability: Stable for 12 months from date of receipt. Gene Name: Homo sapiens eukaryotic translation elongation factor 1 delta (EEF1D), transcript variant 1, mRNA. Database Link: NP_115754 Entrez Gene 1936 Human P29692 This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 3 EEF1D Mouse Monoclonal Antibody [Clone ID: OTI4B9] – CF811676 Background: This gene encodes a subunit of the elongation factor-1 complex, which is responsible for the enzymatic delivery of aminoacyl tRNAs to the ribosome. -
Effects of Stressors on Differential Gene Expression And
EFFECTS OF STRESSORS ON DIFFERENTIAL GENE EXPRESSION AND SECONDARY METABOLITES BY AXINELLA CORRUGATA by Jennifer Grima A Thesis Submitted to the Faculty of Charles E. Schmidt College of Science in Partial Fulfillment of the Requirements for the Degree of Master of Science Florida Atlantic University Boca Raton, Florida May 2013 ACKNOWLEDGEMENTS This thesis was made possible by the help and support of my mentors and friends. Without their guidance and expertise, I would not have been able to accomplish all that I have. Their belief and encouragement in my efforts have motivated and inspired me along through this journey and into a new era in my life. First and foremost, I am grateful to Dr. Shirley Pomponi for taking on the role as my advisor and giving me the opportunity to experience life as a researcher. Not only has she guided me in my scientific studies, she has become a wonderful, lifelong friend. Dr. Pomponi and Dr. Amy Wright have also provided financial support that enabled me to conduct the research and complete this thesis. I would also like to acknowledge Dr. Amy Wright for her willingness to tender advice on all things chemistry related as well as providing me with the space, equipment, and supplies to conduct the chemical analyses. I am grateful to Dr. Esther Guzman who not only served as a committee member, but has also been readily available to help me in any endeavor, whether it be research or personal related. She is truly one of kind with her breadth of knowledge in research and her loyal and caring character. -
Structural Characterization of the Human Eukaryotic Initiation Factor 3 Protein Complex by Mass Spectrometry*□S
Supplemental Material can be found at: http://www.mcponline.org/cgi/content/full/M600399-MCP200 /DC1 Research Structural Characterization of the Human Eukaryotic Initiation Factor 3 Protein Complex by Mass Spectrometry*□S Eugen Damoc‡, Christopher S. Fraser§, Min Zhou¶, Hortense Videler¶, Greg L. Mayeurʈ, John W. B. Hersheyʈ, Jennifer A. Doudna§, Carol V. Robinson¶**, and Julie A. Leary‡ ‡‡ Protein synthesis in mammalian cells requires initiation The initiation phase of eukaryotic protein synthesis involves factor eIF3, an ϳ800-kDa protein complex that plays a formation of an 80 S ribosomal complex containing the initi- Downloaded from central role in binding of initiator methionyl-tRNA and ator methionyl-tRNAi bound to the initiation codon in the mRNA to the 40 S ribosomal subunit to form the 48 S mRNA. This is a multistep process promoted by proteins initiation complex. The eIF3 complex also prevents pre- called eukaryotic initiation factors (eIFs).1 Currently at least 12 mature association of the 40 and 60 S ribosomal subunits eIFs, composed of at least 29 distinct subunits, have been and interacts with other initiation factors involved in start identified (1). Mammalian eIF3, the largest initiation factor, is a codon selection. The molecular mechanisms by which multisubunit complex with an apparent molecular mass of www.mcponline.org eIF3 exerts these functions are poorly understood. Since ϳ800 kDa. This protein complex plays an essential role in its initial characterization in the 1970s, the exact size, translation by binding directly to the 40 S ribosomal subunit composition, and post-translational modifications of and promoting formation of the 43 S preinitiation complex ⅐ ⅐ mammalian eIF3 have not been rigorously determined. -
DNA·RNA Triple Helix Formation Can Function As a Cis-Acting Regulatory
DNA·RNA triple helix formation can function as a cis-acting regulatory mechanism at the human β-globin locus Zhuo Zhoua, Keith E. Gilesa,b,c, and Gary Felsenfelda,1 aLaboratory of Molecular Biology, National Institute of Diabetes and Digestive and Kidney Diseases, National Institutes of Health, Bethesda, MD 20892; bUniversity of Alabama at Birmingham Stem Cell Institute, University of Alabama at Birmingham, Birmingham, AL 35294; and cDepartment of Biochemistry and Molecular Genetics, University of Alabama at Birmingham, Birmingham, AL 35294 Contributed by Gary Felsenfeld, February 4, 2019 (sent for review January 4, 2019; reviewed by James Douglas Engel and Sergei M. Mirkin) We have identified regulatory mechanisms in which an RNA tran- of the criteria necessary to establish the presence of a triplex script forms a DNA duplex·RNA triple helix with a gene or one of its structure, we first describe and characterize triplex formation at regulatory elements, suggesting potential auto-regulatory mecha- the FAU gene in human erythroid K562 cells. FAU encodes a nisms in vivo. We describe an interaction at the human β-globin protein that is a fusion containing fubi, a ubiquitin-like protein, locus, in which an RNA segment embedded in the second intron of and ribosomal protein S30. Although fubi function is unknown, the β-globin gene forms a DNA·RNA triplex with the HS2 sequence posttranslational processing produces S30, a component of the within the β-globin locus control region, a major regulator of glo- 40S ribosome. We used this system to refine methods necessary bin expression. We show in human K562 cells that the triplex is to detect triplex formation and to distinguish it from R-loop stable in vivo. -
KETCH1 Imports HYL1 to Nucleus for Mirna Biogenesis in Arabidopsis
KETCH1 imports HYL1 to nucleus for miRNA biogenesis in Arabidopsis Zhonghui Zhanga,b,1, Xinwei Guoa,c,1, Chunxiao Gea,1, Zeyang Maa, Mengqiu Jianga, Tianhong Lic, Hisashi Koiwad, Seong Wook Yange, and Xiuren Zhanga,2 aDepartment of Biochemistry and Biophysics, Institute for Plant Genomics and Biotechnology, Texas A&M University, College Station, TX 77843; bGuangdong Provincial Key Laboratory of Biotechnology for Plant Development, School of Life Science, South China Normal University, Guangzhou 510631, China; cCollege of Horticulture, China Agricultural University, Beijing 100193, China; dDepartment of Horticultural Sciences, Texas A&M University, College Station, TX 77843; and eDepartment of Systems Biology, College of Life Science and Biotechnology, Yonsei University, Seoul 120-749, Republic of Korea Edited by Xuemei Chen, University of California, Riverside, CA, and approved March 9, 2017 (received for review December 2, 2016) MicroRNA (miRNA) is processed from primary transcripts with hairpin premiRNAs in mammalians (11, 12). Importin-8 facilitates the structures (pri-miRNAs) by microprocessors in the nucleus. How recruitment of AGO2-containing RISC to target mRNAs to pro- cytoplasmic-borne microprocessor components are transported into mote efficient and specific gene silencing in the cytoplasm, whereas the nucleus to fulfill their functions remains poorly understood. Here, the protein can also transport AGO2 and AGO2 partners, GW we report KETCH1 (karyopherin enabling the transport of the proteins and miRNAs, into the nucleus to balance levels of cyto- cytoplasmic HYL1) as a partner of hyponastic leaves 1 (HYL1) protein, plasmic gene-silencing effectors (13–15). Arabidopsis encodes a core component of microprocessor in Arabidopsis and functional 18 importin β-proteins, among which few have also been reported counterpart of DGCR8/Pasha in animals. -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
A Chemical-Genetic Screen for Identifying Substrates of the Er Kinase Perk
University of Pennsylvania ScholarlyCommons Publicly Accessible Penn Dissertations 2014 A Chemical-Genetic Screen for Identifying Substrates of the Er Kinase Perk Nancy L. Maas University of Pennsylvania, [email protected] Follow this and additional works at: https://repository.upenn.edu/edissertations Part of the Biology Commons, Cell Biology Commons, and the Molecular Biology Commons Recommended Citation Maas, Nancy L., "A Chemical-Genetic Screen for Identifying Substrates of the Er Kinase Perk" (2014). Publicly Accessible Penn Dissertations. 1354. https://repository.upenn.edu/edissertations/1354 This paper is posted at ScholarlyCommons. https://repository.upenn.edu/edissertations/1354 For more information, please contact [email protected]. A Chemical-Genetic Screen for Identifying Substrates of the Er Kinase Perk Abstract Cells constantly encounter changing environments that challenge the ability to adapt and survive. Signal transduction networks enable cells to appropriately sense and respond to these changes, and are often mediated through the activity of protein kinases. Protein kinases are a class of enzyme responsible for regulating a broad spectrum of cellular functions by transferring phosphate groups from ATP to substrate proteins, thereby altering substrate activity and function. PERK is a resident kinase of the endoplasmic reticulum, and is responsible for sensing perturbations in the protein folding capacity of the ER. When the influx of unfolded, nascent proteins exceeds the folding capacity of the ER, PERK initiates a cascade of signaling events that enable cell adaptation and ER stress resolution. These signaling pathways are not only essential for the survival of normal cells undergoing ER stress, but are also co-opted by tumor cells in order to survive the oxygen and nutrient-restricted conditions of the tumor microenvironment. -
Proteomics Provides Insights Into the Inhibition of Chinese Hamster V79
www.nature.com/scientificreports OPEN Proteomics provides insights into the inhibition of Chinese hamster V79 cell proliferation in the deep underground environment Jifeng Liu1,2, Tengfei Ma1,2, Mingzhong Gao3, Yilin Liu4, Jun Liu1, Shichao Wang2, Yike Xie2, Ling Wang2, Juan Cheng2, Shixi Liu1*, Jian Zou1,2*, Jiang Wu2, Weimin Li2 & Heping Xie2,3,5 As resources in the shallow depths of the earth exhausted, people will spend extended periods of time in the deep underground space. However, little is known about the deep underground environment afecting the health of organisms. Hence, we established both deep underground laboratory (DUGL) and above ground laboratory (AGL) to investigate the efect of environmental factors on organisms. Six environmental parameters were monitored in the DUGL and AGL. Growth curves were recorded and tandem mass tag (TMT) proteomics analysis were performed to explore the proliferative ability and diferentially abundant proteins (DAPs) in V79 cells (a cell line widely used in biological study in DUGLs) cultured in the DUGL and AGL. Parallel Reaction Monitoring was conducted to verify the TMT results. γ ray dose rate showed the most detectable diference between the two laboratories, whereby γ ray dose rate was signifcantly lower in the DUGL compared to the AGL. V79 cell proliferation was slower in the DUGL. Quantitative proteomics detected 980 DAPs (absolute fold change ≥ 1.2, p < 0.05) between V79 cells cultured in the DUGL and AGL. Of these, 576 proteins were up-regulated and 404 proteins were down-regulated in V79 cells cultured in the DUGL. KEGG pathway analysis revealed that seven pathways (e.g. -
CHARACTERIZING the INTERACTION BETWEEN PDCD4 and Eif3 with RESPECT to TRANSLATION REGULATION
CHARACTERIZING THE INTERACTION BETWEEN PDCD4 AND eIF3 WITH RESPECT TO TRANSLATION REGULATION DIVYA SHARMA KHANDIGA Master of Science, Bangalore University, India 2009 A Thesis/Project Submitted to the School of Graduate Studies of the University of Lethbridge in Partial Fulfillment of the Requirements for the Degree MASTER OF SCIENCE Department of Chemistry and Biochemistry University of Lethbridge LETHBRIDGE, ALBERTA, CANADA © Divya Sharma Khandiga, 2017 CHARACTERIZING THE INTERACTION BETWEEN PDCD4 AND eIF3 WITH RESPECT TO TRANSLATION REGULATION DIVYA SHARMA KHANDIGA Date of Defense: December 12, 2017 Dr. N. Thakor Assistant Professor Ph.D. Thesis Supervisor Dr. M. Roussel Professor Ph.D. Thesis Co-supervisor Dr. U. Kothe Associate Professor Ph.D. Thesis Examination Committee Member Dr. R. Golsteyn Associate Professor Ph.D. Thesis Examination Committee Member Dr. R. Fahlman Professor Ph.D. External Examiner University of Alberta Edmonton, Alberta Dr. M. Gerken Professor Ph.D. Chair, Thesis Examination Committee Dedication To my beloved family and friends, My inspiration, my parents Subraya Sharma and Kamala Sharma My dearly loved husband Samarth, sister Dr. Lakshmi and brother-in-law Dr. Pradeep My cute little niece Mithali and nephew Aathreya My adorable brother Dr. Ganesh, sister Dr. Sharadha, Silly Vidya and little angels My loving cousins and in-laws I am grateful to have them in my life, it is their well wishes, teachings, support and love that have enabled me to achieve success and happiness in life. iii Abstract Programmed cell death protein 4 (PDCD4) inhibits IRES-mediated translation of anti- apoptotic proteins such as XIAP. PDCD4 was shown to directly interact with the XIAP IRES element and inhibit translation initiation. -
Karyopherin Beta 3 (IPO5) (BD027479) Human Untagged Clone Product Data
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC105419 Karyopherin beta 3 (IPO5) (BD027479) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: Karyopherin beta 3 (IPO5) (BD027479) Human Untagged Clone Tag: Tag Free Symbol: IPO5 Vector: pCMV6-XL4 E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: None Fully Sequenced ORF: >NCBI ORF sequence for BD027479, the custom clone sequence may differ by one or more nucleotides CTTCTCTCTCACGCCTAGCGCAATGGCGGCGGCCGCGGCGGASCAGCAACAGTTCTACCTGCTCCTGGGA AACCTGCTCAGCCCCGACAATGTGGTCCGGAAACAGGCAGAGGAAACCTATGAGAATANTCCCAGGCCAG TCAAAGATCACATTCCTCTTACAAGCCATCAGAAATACAACAGCTGCTGAAGAGGCTAGACAAATGGCCG CCGTTCTCCTAAGACGTCTCTTGTCCTCTGCATTTGATGAAGTCTATCCAGCACTTCCCTCTGATGTTCA GACTGCCATCAAGAGTGAGCTACTCATGATTATTCAGATGGAAACACAATCTAGCATGAGGAAAAAAGTT TGTGATATTGCGGSAGAACTGGCCAGGAATTTAATAGATGAGGATGGCAATAACCAGTGGCCCGAAGTTT GAAGTTCCTTTTTGATTCAGTCAG 5' Read Nucleotide >OriGene 5' read for BD027479 unedited Sequence: TGTATACGACTCATATAGGGCGGCCGCGAATCGGCACGAGGCGCCGGCGCCGGCGGCCGC GGCGGGGTGAGAGGCCGCGAGGCCCCGCCCCGTCCTCCCCTTTCCCCTTTGCCCCGCCCT TCCCGCGCGGCCCCCCGCAAGCCCCGCGCCGCCGCTGGTGCCGGTCCCCGCGCTGGGCCC GCCCCCGCCCCTCCCGCGGCCCGCGAGCGCGCCTCACGGCTCCTGTCTCCCCTCCCTCCT TCTCTCTCACGCCTAGCGCAATGGCGGCGGCCGCGGCGGAGCAGCAACAGTTCTACCTGC TCCTGGGAAACCTGCTCAGCCCCGACAATGTGGTCCGGAAACAGGCAGAGGAAACCTATG AGAATATCCCAGGCCAGTCAAAGATCACATTCCTCTTACAAGCCATCAGAAATACAACAG