DOCSLIB.ORG

DNA·RNA Triple Helix Formation Can Function As a Cis-Acting Regulatory

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
DNA·RNA Triple Helix Formation Can Function As a Cis-Acting Regulatory DNA·RNA triple helix formation can function as a cis-acting regulatory mechanism at the human β-globin locus Zhuo Zhoua, Keith E. Gilesa,b,c, and Gary Felsenfelda,1 aLaboratory of Molecular Biology, National Institute of Diabetes and Digestive and Kidney Diseases, National Institutes of Health, Bethesda, MD 20892; bUniversity of Alabama at Birmingham Stem Cell Institute, University of Alabama at Birmingham, Birmingham, AL 35294; and cDepartment of Biochemistry and Molecular Genetics, University of Alabama at Birmingham, Birmingham, AL 35294 Contributed by Gary Felsenfeld, February 4, 2019 (sent for review January 4, 2019; reviewed by James Douglas Engel and Sergei M. Mirkin) We have identified regulatory mechanisms in which an RNA tran- of the criteria necessary to establish the presence of a triplex script forms a DNA duplex·RNA triple helix with a gene or one of its structure, we first describe and characterize triplex formation at regulatory elements, suggesting potential auto-regulatory mecha- the FAU gene in human erythroid K562 cells. FAU encodes a nisms in vivo. We describe an interaction at the human β-globin protein that is a fusion containing fubi, a ubiquitin-like protein, locus, in which an RNA segment embedded in the second intron of and ribosomal protein S30. Although fubi function is unknown, the β-globin gene forms a DNA·RNA triplex with the HS2 sequence posttranslational processing produces S30, a component of the within the β-globin locus control region, a major regulator of glo- 40S ribosome. We used this system to refine methods necessary bin expression. We show in human K562 cells that the triplex is to detect triplex formation and to distinguish it from R-loop stable in vivo. Its formation causes displacement from HS2 of ma- formation, a potential source of confusion. jor transcription factors and RNA Polymerase II, and consequently We then applied these methods to search for other examples in loss of factors and polymerase that bind to the human e- and of DNA·RNA triplexes and identified an interaction between an γ-globin promoters, which are activated by HS2 in K562 cells. This RNA sequence present within an intron of the human adult results in reduced expression of these genes. These effects are β-globin gene and an upstream regulatory element within hy- observed when a small length of triplex-forming RNA is intro- persensitive site 2 (HS2) of the β-globin locus control region duced into cells, or when a full-length intron-containing human (LCR). The effect of this interaction is to displace transcription β-globin transcript is expressed. Related results are obtained in factors from the regulatory site and affect expression of members human umbilical cord blood-derived erythroid progenitor-2 cells, of the β-globin family. This system represents a feedback mech- in which β-globin expression is similarly affected by triplex forma- anism in which a transcript could affect its own expression by tion. These results suggest a model in which RNAs conforming to forming a triple-strand structure at a nearby regulatory element. the strict sequence rules for DNA·RNA triplex formation may par- ticipate in feedback regulation of genes in cis. Results In Vivo Triplex-Forming RNA in K562 Cells: The FAU Gene as a Source · · DNA RNA triplex | human globin genes | FAU gene | DNA RNA triplex and Target. The methods we employed for detecting DNA·RNA RNA-mediated gene expression triple-stranded structure formation in vitro are shown in SI Ap- pendix, Fig. S1 B–D, using a previously published and well- he fact that both DNA and RNA can form triple-stranded characterized triplex-forming sequence (3). RNA and individual Tstructures has been known for a long time (1, 2), and the rules governing the formation of such structures have been well Significance established (3, 4). Triplexes in which all three strands are RNA were the first to be observed (1) in vitro. Triplexes in which all RNA containing only pyrimidines, transcribed from genomic three strands are DNA (H-DNA) form under superhelical stress DNA, can form DNA∙RNA triple helices with other sites in the (5, 6), and short runs of all-RNA triplex structures have been genome. We characterize an intronic sequence in the human shown to protect a long-noncoding RNA (lncRNA) from deg- β-globin gene that forms a triplex with an upstream regulatory radation or misfolding (7–12). Triple-strand structures can also site in the β-globin locus, causing displacement of transcription be formed between a DNA duplex and single-stranded RNA factors and down regulation of expression of the genes in the (ssRNA), but the sequence constraints are greater than with locus. Consequently, overexpression of a full-length β-globin structures in which all three strands are DNA (13–17). As shown transcript containing the intron results in decreased expres- · in SI Appendix, Fig. S1A, a typical DNA RNA triplex requires sion of members of the β-globin gene cluster. This is a cis- that the RNA bases be pyrimidines, with U favored over C en- regulatory feedback mechanism in which overexpression of ergetically (4). An rU base forms a triplex with an A·TDNA the β-globin gene could result in signals to down-regulate that base pair; an rC base, typically protonated, forms triplex with a expression. Balance in the expression of the many genes as- G·C DNA base pair. Such DNA·RNA complexes are among the sociated with hemoglobin biosynthesis is essential for ery- most stable triplex polynucleotide structures (15, 17). The RNA throid cell function. polypyrimidine strand binds in a direction antiparallel to the DNA polypyrimidine strand. One consequence of this strand Author contributions: Z.Z., K.E.G., and G.F. designed research; Z.Z. performed research; polarity is that, except when the sequences are palindromic, a Z.Z. and G.F. analyzed data; and Z.Z. and G.F. wrote the paper. transcript cannot form a DNA·RNA triplex with its own Reviewers: J.D.E., University of Michigan; and S.M.M., Tufts University. template. Thus, source and target sequences will generally The authors declare no conflict of interest. be distinct. Published under the PNAS license. Taking these constraints into account, we searched the human 1To whom correspondence should be addressed. Email: [email protected]. genome for candidate sequences that might be either a DNA This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. target for DNA·RNA triplex formation, or the source of an RNA 1073/pnas.1900107116/-/DCSupplemental. capable of binding to such DNA sequences. As a demonstration Published online March 13, 2019. 6130–6139 | PNAS | March 26, 2019 | vol. 116 | no. 13 www.pnas.org/cgi/doi/10.1073/pnas.1900107116 Downloaded by guest on September 27, 2021 DNA strands are labeled for electrophoresis studies, and sensi- triplex formation and eliminating heteroduplex formation as an tivity of complexes to RNases distinguishes triplex from hetero- explanation for our results. duplex when the sequence is palindromic. To distinguish between these possibilities in vitro, FAU-triplex Using these guidelines for formation of DNA·RNA triplexes gel-shift assays were performed with fluorescent tagged oligo- (3, 4) (SI Appendix, Fig. S1), we first searched the Cold Spring nucleotides, as shown in Fig. 1B. We observed that Cy5-labeled Harbor Laboratory long RNA-sequencing database in K562 cells FAU triplex-forming RNA (FAU-tfRNA) forms a complex with for RNAs (>200-nt long) containing at least 20-nt-long stretches its Cy3-labeled DNA templates at pH 6.5. This complex is re- of polypyrimidines. Because we wanted to explore the potential sistant to RNase H cleavage but is degraded by RNase A, as has role of such triplexes in gene regulation, we were interested in been shown to be consistent with formation of a DNA·RNA RNAs transcribed from nonrepetitive DNA near putative gene triplex (22) (SI Appendix, Fig. S1). A third possible outcome, promoter regions. Such a configuration should favor interac- involving complete displacement of one of the two DNA strands, tions between RNA and its DNA target. We initially focused on is ruled out by the electrophoretic results (Fig. 1B) (RNase H). FAU (FAU ubiquitin-like and ribosomal protein S30 fusion), a Complex formation is dependent on the RNA sequence, as Cy5- proapoptotic regulatory gene that is expressed in K562 cells and labeled PolyU-RNA is unable to produce a band shift with the down-regulated in human breast, prostate, and ovarian cancers FAU-DNA duplex in our triplex gel-shift assay (SI Appendix, Fig. (18–21). Our search showed that one of the more abundant S2). The results indicate that triplexes rather than R-loops are RNAs satisfying the criteria for triplex formation corresponded formed in vitro between FAU-tfRNA and its targeting DNA in sequence to FAU antisense transcript (Fig. 1A). This RNA duplex, similarly to what is observed in the “model” triplex in SI contains a U-rich sequence, (UCU)6, which could in principle be Appendix, Fig. S1. targeted back to the FAU gene as part of a canonical triplex. To further exclude the possibility of an R-loop structure, we However, because it happens to be a palindromic sequence it also subjected these FAU double-stranded (dsDNA)/ssRNA could also form an R-loop in which the RNA partially displaces complexes to dimethyl sulfate (DMS) footprinting to deter- one of the DNA strands, and forms a heteroduplex with the mine the accessibility of guanines in the DNA duplex at the other, while still maintaining a complex with three strands. We N7 position. In triple-stranded structures in which all three chose this gene as a way to develop methods for demonstrating strands are DNA, it has been shown that formation of dC·dG·dC BIOCHEMISTRY A CCTGTGTCTTCTTCTTCTTCTTCTCTCCTGTTTGG BC DMS - + + RNase A RNase H Proteinase K 32P-FAU DNA Duplex + + + FAU RNA --+ DNA/RNA Hybrid DNA/RNA DNA (+) DNA Duplex Triplex RNA DNA Duplex RNA DNA/RNA Hybrid DNA/RNA DNA (+) Triplex RNA Hybrid DNA/RNA DNA Duplex DNA (+) Triplex RNA Hybrid DNA/RNA DNA (+) DNA Duplex Triplex DNA·RNA triplex DNA RNA 5’-GTGGCCAAACAGGAGAAGAAG AAGAAGAAGACAGGTCGGGC -3’ Fig.
Load more

Recommended publications
  • Novel TAL1 Targets Beyond Protein-Coding Genes: Identification of TAL1-Regulated Micrornas in T-Cell Acute Lymphoblastic Leukemia
    Letters to the Editor 1603 REFERENCES 8 Yoshida K, Sanada M, Shiraishi Y, Nowak D, Nagata Y, Yamamoto R et al. Frequent 1 Rozman C, Montserrat E. Chronic lymphocytic leukemia. N Engl J Med 1995; 333: pathway mutations of splicing machinery in myelodysplasia. Nature 2011; 478: 64–69. 1052–1057. 9 Papaemmanuil E, Cazzola M, Boultwood J, Malcovati L, Vyas P, Bowen D et al. 2 Zenz T, Mertens D, Kuppers R, Dohner H, Stilgenbauer S. From pathogenesis to Somatic SF3B1 mutation in myelodysplasia with ring sideroblasts. N Engl J Med treatment of chronic lymphocytic leukaemia. Nat Rev Cancer 2010; 10: 37–50. 2011; 365: 1384–1395. 3 Puente XS, Pinyol M, Quesada V, Conde L, Ordonez GR, Villamor N et al. Whole- 10 Damm F, Nguyen-Khac F, Fontenay M, Bernard OA. Spliceosome and other novel genome sequencing identifies recurrent mutations in chronic lymphocytic leu- mutations in chronic lymphocytic leukemia and myeloid malignancies. Leukemia kaemia. Nature 2011; 475: 101–105. 2012; 26: 2027–2031. 4 Quesada V, Conde L, Villamor N, Ordonez GR, Jares P, Bassaganyas L et al. Exome 11 Wahl MC, Will CL, Luhrmann R. The spliceosome: design principles of a dynamic sequencing identifies recurrent mutations of the splicing factor SF3B1 gene in RNP machine. Cell 2009; 136: 701–718. chronic lymphocytic leukemia. Nat Genet 2012; 44: 47–52. 12 David CJ, Manley JL. Alternative pre-mRNA splicing regulation in cancer: pathways 5 Wang L, Lawrence MS, Wan Y, Stojanov P, Sougnez C, Stevenson K et al. SF3B1 and programs unhinged. Genes Dev 2010; 24: 2343–2364.
    [Show full text]
  • Supplementary Materials: Evaluation of Cytotoxicity and Α-Glucosidase Inhibitory Activity of Amide and Polyamino-Derivatives of Lupane Triterpenoids
    Supplementary Materials: Evaluation of cytotoxicity and α-glucosidase inhibitory activity of amide and polyamino-derivatives of lupane triterpenoids Oxana B. Kazakova1*, Gul'nara V. Giniyatullina1, Akhat G. Mustafin1, Denis A. Babkov2, Elena V. Sokolova2, Alexander A. Spasov2* 1Ufa Institute of Chemistry of the Ufa Federal Research Centre of the Russian Academy of Sciences, 71, pr. Oktyabrya, 450054 Ufa, Russian Federation 2Scientific Center for Innovative Drugs, Volgograd State Medical University, Novorossiyskaya st. 39, Volgograd 400087, Russian Federation Correspondence Prof. Dr. Oxana B. Kazakova Ufa Institute of Chemistry of the Ufa Federal Research Centre of the Russian Academy of Sciences 71 Prospeсt Oktyabrya Ufa, 450054 Russian Federation E-mail: [email protected] Prof. Dr. Alexander A. Spasov Scientific Center for Innovative Drugs of the Volgograd State Medical University 39 Novorossiyskaya st. Volgograd, 400087 Russian Federation E-mail: [email protected] Figure S1. 1H and 13C of compound 2. H NH N H O H O H 2 2 Figure S2. 1H and 13C of compound 4. NH2 O H O H CH3 O O H H3C O H 4 3 Figure S3. Anticancer screening data of compound 2 at single dose assay 4 Figure S4. Anticancer screening data of compound 7 at single dose assay 5 Figure S5. Anticancer screening data of compound 8 at single dose assay 6 Figure S6. Anticancer screening data of compound 9 at single dose assay 7 Figure S7. Anticancer screening data of compound 12 at single dose assay 8 Figure S8. Anticancer screening data of compound 13 at single dose assay 9 Figure S9. Anticancer screening data of compound 14 at single dose assay 10 Figure S10.
    [Show full text]
  • Effects of Stressors on Differential Gene Expression And
    EFFECTS OF STRESSORS ON DIFFERENTIAL GENE EXPRESSION AND SECONDARY METABOLITES BY AXINELLA CORRUGATA by Jennifer Grima A Thesis Submitted to the Faculty of Charles E. Schmidt College of Science in Partial Fulfillment of the Requirements for the Degree of Master of Science Florida Atlantic University Boca Raton, Florida May 2013 ACKNOWLEDGEMENTS This thesis was made possible by the help and support of my mentors and friends. Without their guidance and expertise, I would not have been able to accomplish all that I have. Their belief and encouragement in my efforts have motivated and inspired me along through this journey and into a new era in my life. First and foremost, I am grateful to Dr. Shirley Pomponi for taking on the role as my advisor and giving me the opportunity to experience life as a researcher. Not only has she guided me in my scientific studies, she has become a wonderful, lifelong friend. Dr. Pomponi and Dr. Amy Wright have also provided financial support that enabled me to conduct the research and complete this thesis. I would also like to acknowledge Dr. Amy Wright for her willingness to tender advice on all things chemistry related as well as providing me with the space, equipment, and supplies to conduct the chemical analyses. I am grateful to Dr. Esther Guzman who not only served as a committee member, but has also been readily available to help me in any endeavor, whether it be research or personal related. She is truly one of kind with her breadth of knowledge in research and her loyal and caring character.
    [Show full text]
  • Ldb1 Is Essential for Development of Nkx2.1 Lineage Derived Gabaergic and Cholinergic Neurons in the Telencephalon
    Developmental Biology 385 (2014) 94–106 Contents lists available at ScienceDirect Developmental Biology journal homepage: www.elsevier.com/locate/developmentalbiology Ldb1 is essential for development of Nkx2.1 lineage derived GABAergic and cholinergic neurons in the telencephalon Yangu Zhao a,n,1, Pierre Flandin b,2, Daniel Vogt b, Alexander Blood a, Edit Hermesz a,3, Heiner Westphal a, John L. R. Rubenstein b,nn a Program on Genomics of Differentiation, Eunice Kennedy Shriver National Institute of Child Health and Human Development, NIH, Bethesda, MD 20892, USA b Department of Psychiatry and the Nina Ireland Laboratory of Developmental Neurobiology, University of California San Francisco, San Francisco, CA 94143, USA article info abstract Article history: The progenitor zones of the embryonic mouse ventral telencephalon give rise to GABAergic and cholinergic Received 1 June 2013 neurons. We have shown previously that two LIM-homeodomain (LIM-HD) transcription factors, Lhx6 and Received in revised form Lhx8, that are downstream of Nkx2.1, are critical for the development of telencephalic GABAergic and 8 October 2013 cholinergic neurons. Here we investigate the role of Ldb1, a nuclear protein that binds directly to all LIM-HD Accepted 9 October 2013 factors, in the development of these ventral telencephalon derived neurons. We show that Ldb1 is expressed Available online 21 October 2013 in the Nkx2.1 cell lineage during embryonic development and in mature neurons. Conditional deletion of Ldb1 Keywords: causes defects in the expression of a series of genes in the ventral telencephalon and severe impairment in the Differentiation tangential migration of cortical interneurons from the ventral telencephalon.
    [Show full text]
  • Open Dogan Phdthesis Final.Pdf
    The Pennsylvania State University The Graduate School Eberly College of Science ELUCIDATING BIOLOGICAL FUNCTION OF GENOMIC DNA WITH ROBUST SIGNALS OF BIOCHEMICAL ACTIVITY: INTEGRATIVE GENOME-WIDE STUDIES OF ENHANCERS A Dissertation in Biochemistry, Microbiology and Molecular Biology by Nergiz Dogan © 2014 Nergiz Dogan Submitted in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy August 2014 ii The dissertation of Nergiz Dogan was reviewed and approved* by the following: Ross C. Hardison T. Ming Chu Professor of Biochemistry and Molecular Biology Dissertation Advisor Chair of Committee David S. Gilmour Professor of Molecular and Cell Biology Anton Nekrutenko Professor of Biochemistry and Molecular Biology Robert F. Paulson Professor of Veterinary and Biomedical Sciences Philip Reno Assistant Professor of Antropology Scott B. Selleck Professor and Head of the Department of Biochemistry and Molecular Biology *Signatures are on file in the Graduate School iii ABSTRACT Genome-wide measurements of epigenetic features such as histone modifications, occupancy by transcription factors and coactivators provide the opportunity to understand more globally how genes are regulated. While much effort is being put into integrating the marks from various combinations of features, the contribution of each feature to accuracy of enhancer prediction is not known. We began with predictions of 4,915 candidate erythroid enhancers based on genomic occupancy by TAL1, a key hematopoietic transcription factor that is strongly associated with gene induction in erythroid cells. Seventy of these DNA segments occupied by TAL1 (TAL1 OSs) were tested by transient transfections of cultured hematopoietic cells, and 56% of these were active as enhancers. Sixty-six TAL1 OSs were evaluated in transgenic mouse embryos, and 65% of these were active enhancers in various tissues.
    [Show full text]
  • Transcritional Regulatory Networks Downstream of TAL1/SCL in T-Cell Acute Lymphoblastic Leukemia
    Supplemental Materials Transcritional Regulatory Networks Downstream of TAL1/SCL in T-cell Acute Lymphoblastic Leukemia Palomero et al. Figure S1. Downregulation of TAL1 by RNA interference does not affect apoptosis in Jurkat cells. Figure S2. Scatter plots of Chromatin immunoprecipitations performed with TAL1#370 antibody in Jurkat cells. Figure S3. Target validation by gene-specific quantitative RT-PCR (qRT-PCR) Table S1. Genes regulated by TAL1 knockdown are identified as direct targets of this transcription factor using ChIP on chip. Table S2. Analysis of TAL1, E2A and HEB binding to TAL1 direct targets identified by ChIP on chip. Table S3. Previously described TAL1 targets. Figure S1. Downregulation of TAL1 by RNA interference does not affect apoptosis in Jurkat cells. Annexin V staining was used to quantify apoptosis rates in Jurkat cell clones expressing TAL1 shRNA (right panels) or a control shRNA (left panels). The percentage of apoptotic cells is indicated in the bottom right corner of each graph, while the dead cell percentage is indicated in the top right corner. PI: propidium iodide. Name Description p-value IFRD1 interferon-related developmental regulator 1 0.009927703 PCK2 phosphoenolpyruvate carboxykinase 2 (mitochondrial) 0.00445631 ATRX alpha thalassemia/mental retardation syndrome X-linked (RAD54 homolog, S. cerevisiae) 0.010847575 CDK6 cyclin-dependent kinase 6 0.044093956 Table S1. Genes regulated by TAL1 knockdown are identified as direct target of this transcription factor using ChIP on chip. The p-value determined by the error model applied to the ChIP on chip fluorescence data is indicated in the right column. Name Description Name Description E2A E2A HEB HEB TAL1 TAL1 Signal transduction-Receptor Transporters-lipids/small molecules MUC16 mucin 16 ABCC12 ATP-binding cassette, sub-fam.
    [Show full text]
  • Function of Bromodomain and Extra-Terminal Motif Proteins (Bets) in Gata1-Mediated Transcription
    University of Pennsylvania ScholarlyCommons Publicly Accessible Penn Dissertations 2015 Function of Bromodomain and Extra-Terminal Motif Proteins (bets) in Gata1-Mediated Transcription Aaron James Stonestrom University of Pennsylvania, [email protected] Follow this and additional works at: https://repository.upenn.edu/edissertations Part of the Molecular Biology Commons, and the Pharmacology Commons Recommended Citation Stonestrom, Aaron James, "Function of Bromodomain and Extra-Terminal Motif Proteins (bets) in Gata1-Mediated Transcription" (2015). Publicly Accessible Penn Dissertations. 1148. https://repository.upenn.edu/edissertations/1148 This paper is posted at ScholarlyCommons. https://repository.upenn.edu/edissertations/1148 For more information, please contact [email protected]. Function of Bromodomain and Extra-Terminal Motif Proteins (bets) in Gata1-Mediated Transcription Abstract Bromodomain and Extra-Terminal motif proteins (BETs) associate with acetylated histones and transcription factors. While pharmacologic inhibition of this ubiquitous protein family is an emerging therapeutic approach for neoplastic and inflammatory disease, the mechanisms through which BETs act remain largely uncharacterized. Here we explore the role of BETs in the physiologically relevant context of erythropoiesis driven by the transcription factor GATA1. First, we characterize functions of the BET family as a whole using a pharmacologic approach. We find that BETs are broadly required for GATA1-mediated transcriptional activation, but that repression is largely BET-independent. BETs support activation by facilitating both GATA1 occupancy and transcription downstream of its binding. Second, we test the specific olesr of BETs BRD2, BRD3, and BRD4 in GATA1-activated transcription. BRD2 and BRD4 are required for efficient anscriptionaltr activation by GATA1. Despite co-localizing with the great majority of GATA1 binding sites, we find that BRD3 is not equirr ed for GATA1-mediated transcriptional activation.
    [Show full text]
  • ARID5B As a Critical Downstream Target of the TAL1 Complex That Activates the Oncogenic Transcriptional Program and Promotes T-Cell Leukemogenesis
    Downloaded from genesdev.cshlp.org on October 10, 2021 - Published by Cold Spring Harbor Laboratory Press ARID5B as a critical downstream target of the TAL1 complex that activates the oncogenic transcriptional program and promotes T-cell leukemogenesis Wei Zhong Leong,1 Shi Hao Tan,1 Phuong Cao Thi Ngoc,1 Stella Amanda,1 Alice Wei Yee Yam,1 Wei-Siang Liau,1 Zhiyuan Gong,2 Lee N. Lawton,1 Daniel G. Tenen,1,3,4 and Takaomi Sanda1,4 1Cancer Science Institute of Singapore, National University of Singapore, 117599 Singapore; 2Department of Biological Sciences, National University of Singapore, 117543 Singapore; 3Harvard Medical School, Boston, Massachusetts 02215, USA; 4Department of Medicine, Yong Loo Lin School of Medicine, National University of Singapore, 117599 Singapore The oncogenic transcription factor TAL1/SCL induces an aberrant transcriptional program in T-cell acute lym- phoblastic leukemia (T-ALL) cells. However, the critical factors that are directly activated by TAL1 and contribute to T-ALL pathogenesis are largely unknown. Here, we identified AT-rich interactive domain 5B (ARID5B) as a col- laborating oncogenic factor involved in the transcriptional program in T-ALL. ARID5B expression is down-regulated at the double-negative 2–4 stages in normal thymocytes, while it is induced by the TAL1 complex in human T-ALL cells. The enhancer located 135 kb upstream of the ARID5B gene locus is activated under a superenhancer in T-ALL cells but not in normal T cells. Notably, ARID5B-bound regions are associated predominantly with active tran- scription. ARID5B and TAL1 frequently co-occupy target genes and coordinately control their expression.
    [Show full text]
  • Prox1regulates the Subtype-Specific Development of Caudal Ganglionic
    The Journal of Neuroscience, September 16, 2015 • 35(37):12869–12889 • 12869 Development/Plasticity/Repair Prox1 Regulates the Subtype-Specific Development of Caudal Ganglionic Eminence-Derived GABAergic Cortical Interneurons X Goichi Miyoshi,1 Allison Young,1 Timothy Petros,1 Theofanis Karayannis,1 Melissa McKenzie Chang,1 Alfonso Lavado,2 Tomohiko Iwano,3 Miho Nakajima,4 Hiroki Taniguchi,5 Z. Josh Huang,5 XNathaniel Heintz,4 Guillermo Oliver,2 Fumio Matsuzaki,3 Robert P. Machold,1 and Gord Fishell1 1Department of Neuroscience and Physiology, NYU Neuroscience Institute, Smilow Research Center, New York University School of Medicine, New York, New York 10016, 2Department of Genetics & Tumor Cell Biology, St. Jude Children’s Research Hospital, Memphis, Tennessee 38105, 3Laboratory for Cell Asymmetry, RIKEN Center for Developmental Biology, Kobe 650-0047, Japan, 4Laboratory of Molecular Biology, Howard Hughes Medical Institute, GENSAT Project, The Rockefeller University, New York, New York 10065, and 5Cold Spring Harbor Laboratory, Cold Spring Harbor, New York 11724 Neurogliaform (RELNϩ) and bipolar (VIPϩ) GABAergic interneurons of the mammalian cerebral cortex provide critical inhibition locally within the superficial layers. While these subtypes are known to originate from the embryonic caudal ganglionic eminence (CGE), the specific genetic programs that direct their positioning, maturation, and integration into the cortical network have not been eluci- dated. Here, we report that in mice expression of the transcription factor Prox1 is selectively maintained in postmitotic CGE-derived cortical interneuron precursors and that loss of Prox1 impairs the integration of these cells into superficial layers. Moreover, Prox1 differentially regulates the postnatal maturation of each specific subtype originating from the CGE (RELN, Calb2/VIP, and VIP).
    [Show full text]
  • Genes with 5' Terminal Oligopyrimidine Tracts Preferentially Escape Global Suppression of Translation by the SARS-Cov-2 NSP1 Protein
    Downloaded from rnajournal.cshlp.org on September 28, 2021 - Published by Cold Spring Harbor Laboratory Press Genes with 5′ terminal oligopyrimidine tracts preferentially escape global suppression of translation by the SARS-CoV-2 Nsp1 protein Shilpa Raoa, Ian Hoskinsa, Tori Tonna, P. Daniela Garciaa, Hakan Ozadama, Elif Sarinay Cenika, Can Cenika,1 a Department of Molecular Biosciences, University of Texas at Austin, Austin, TX 78712, USA 1Corresponding author: [email protected] Key words: SARS-CoV-2, Nsp1, MeTAFlow, translation, ribosome profiling, RNA-Seq, 5′ TOP, Ribo-Seq, gene expression 1 Downloaded from rnajournal.cshlp.org on September 28, 2021 - Published by Cold Spring Harbor Laboratory Press Abstract Viruses rely on the host translation machinery to synthesize their own proteins. Consequently, they have evolved varied mechanisms to co-opt host translation for their survival. SARS-CoV-2 relies on a non-structural protein, Nsp1, for shutting down host translation. However, it is currently unknown how viral proteins and host factors critical for viral replication can escape a global shutdown of host translation. Here, using a novel FACS-based assay called MeTAFlow, we report a dose-dependent reduction in both nascent protein synthesis and mRNA abundance in cells expressing Nsp1. We perform RNA-Seq and matched ribosome profiling experiments to identify gene-specific changes both at the mRNA expression and translation level. We discover that a functionally-coherent subset of human genes are preferentially translated in the context of Nsp1 expression. These genes include the translation machinery components, RNA binding proteins, and others important for viral pathogenicity. Importantly, we uncovered a remarkable enrichment of 5′ terminal oligo-pyrimidine (TOP) tracts among preferentially translated genes.
    [Show full text]
  • E Proteins and ID Proteins: Helix-Loop-Helix Partners in Development and Disease
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector Developmental Cell Review E Proteins and ID Proteins: Helix-Loop-Helix Partners in Development and Disease Lan-Hsin Wang1 and Nicholas E. Baker1,2,3,* 1Department of Genetics, Albert Einstein College of Medicine, 1300 Morris Park Avenue, Bronx, NY 10461, USA 2Department of Developmental and Molecular Biology, Albert Einstein College of Medicine, 1300 Morris Park Avenue, Bronx, NY 10461, USA 3Department of Ophthalmology and Visual Sciences, Albert Einstein College of Medicine, 1300 Morris Park Avenue, Bronx, NY 10461, USA *Correspondence: [email protected] http://dx.doi.org/10.1016/j.devcel.2015.10.019 The basic Helix-Loop-Helix (bHLH) proteins represent a well-known class of transcriptional regulators. Many bHLH proteins act as heterodimers with members of a class of ubiquitous partners, the E proteins. A widely expressed class of inhibitory heterodimer partners—the Inhibitor of DNA-binding (ID) proteins—also exists. Genetic and molecular analyses in humans and in knockout mice implicate E proteins and ID proteins in a wide variety of diseases, belying the notion that they are non-specific partner proteins. Here, we explore relationships of E proteins and ID proteins to a variety of disease processes and highlight gaps in knowledge of disease mechanisms. E proteins and Inhibitor of DNA-binding (ID) proteins are widely conferring DNA-binding specificity and transcriptional activation expressed transcriptional regulators with very general functions. on heterodimers with the ubiquitous E proteins (Figure 1). They are implicated in diseases by evidence ranging from Another class of pervasive HLH proteins acts in opposition to confirmed Mendelian inheritance, association studies, and E proteins.
    [Show full text]
  • Accepted Version
    Article A catalog of genetic loci associated with kidney function from analyses of a million individuals WUTTKE, Matthias, et al. Abstract Chronic kidney disease (CKD) is responsible for a public health burden with multi-systemic complications. Through trans-ancestry meta-analysis of genome-wide association studies of estimated glomerular filtration rate (eGFR) and independent replication (n?=?1,046,070), we identified 264 associated loci (166 new). Of these, 147 were likely to be relevant for kidney function on the basis of associations with the alternative kidney function marker blood urea nitrogen (n?=?416,178). Pathway and enrichment analyses, including mouse models with renal phenotypes, support the kidney as the main target organ. A genetic risk score for lower eGFR was associated with clinically diagnosed CKD in 452,264 independent individuals. Colocalization analyses of associations with eGFR among 783,978 European-ancestry individuals and gene expression across 46 human tissues, including tubulo-interstitial and glomerular kidney compartments, identified 17 genes differentially expressed in kidney. Fine-mapping highlighted missense driver variants in 11 genes and kidney-specific regulatory variants. These results provide a comprehensive priority [...] Reference WUTTKE, Matthias, et al. A catalog of genetic loci associated with kidney function from analyses of a million individuals. Nature Genetics, 2019, vol. 51, no. 6, p. 957-972 DOI : 10.1038/s41588-019-0407-x PMID : 31152163 Available at: http://archive-ouverte.unige.ch/unige:147447 Disclaimer: layout of this document may differ from the published version. 1 / 1 HHS Public Access Author manuscript Author ManuscriptAuthor Manuscript Author Nat Genet Manuscript Author . Author manuscript; Manuscript Author available in PMC 2019 August 19.
    [Show full text]