University of Florida Thesis Or Dissertation

PHYLOGENETIC SYSTEMATICS OF SYNCEPHALIS (ZOOPAGALES: ZOOPAGOMYCOTA), A GENUS OF UBIQUITOUS MYCOPARASITES

KATHERINE LOUISE LAZARUS

A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE

UNIVERSITY OF FLORIDA

2016

ACKNOWLEDGMENTS

I would like to acknowledge substrate sample, culture, and sequence contributors, Gerald L. Benny, Hsiao-Man Ho, Matthew E. Smith, Kerry O’Donnel and the NRRL (Agriculture Research Service Culture Collection). I would like to thank members of the Smith Lab, Rosanne Healy, Alija Mujic, Nicole Reynolds and Arthur

Grupe and I would like to thank my advisor Matthew E. Smith and committee members

Jeffrey Rollins and Gerald Benny for their guidance, feedback and support. I would also like to acknowledge IFAS and the University of Florida.

TABLE OF CONTENTS

page

ACKNOWLEDGMENTS ...... 3

LIST OF TABLES ...... 5

LIST OF FIGURES ...... 6

ABSTRACT ...... 7

CHAPTER

1 INTRODUCTION ...... 9

2 MATERIALS AND METHODS ...... 14

Sampling, Isolation, Co-Culturing on Host Fungi, and Axenic Culturing ...... 14 PCR and Sequencing ...... 16 Sequence and Phylogenetic Analysis ...... 18

3 RESULTS ...... 26

4 DISCUSSION ...... 31

Overview ...... 31 Clade Analysis ...... 31 The Hypogena Clade ...... 31 The Vivipara Clade ...... 33 The Obconica Clade ...... 34 The Cornu Clade ...... 35 The Sphaerica Clade ...... 37 The North American and Asian Depressa Clades ...... 38 Species Clade A, Species Clade B, and unidentified, divergent species ...... 39 The Parvula Clade, Syncephalis nana and Syncephalis clavata ...... 39 Sequence Analysis of the Internal Transcribed Spacer region (ITS) ...... 40 Ecology ...... 42

5 CONCLUSION ...... 46

LIST OF REFERENCES ...... 49

BIOGRAPHICAL SKETCH ...... 54

LIST OF TABLES

Table page

2-1 Collection data for the 88 Syncephalis spp. isolate sequences included in the phylogenetic analysis ...... 23

2-2 Primers implemented in this study, with their target gene region and varying specificity ...... 25

3-1 Detecting Syncephalis ITS sequences in GenBank ...... 30

LIST OF FIGURES

Figure page

2-1 Morphology across the genus Syncephalis ...... 21

2-2 Ribosomal DNA (rDNA) primer map ...... 22

3-1 Maximum Likelihood (ML) phylogeny ...... 28

3-2 Length of sequences from complete internal transcribed spacer region (ITS1- 5.8S-ITS2) for 31 Syncephalis isolates from 18 species ...... 29

Abstract of Thesis Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Master of Science

PHYLOGENETIC SYSTEMATICS OF SYNCEPHALIS (ZOOPAGALES: ZOOPAGOMYCOTA) A GENUS OF UBIQUITOUS MYCOPARASITES

Katherine Lazarus

May 2016

Chair: Matthew E. Smith Major: Plant Pathology

Phylogenetic relationships among species of the mycoparasite genus

Syncephalis were examined by using sequences from three nuclear encoded ribsosomal DNA genes and one protein encoded gene. The data consist of 18S, 5.8S and 28S rDNA and RPB1 for 88 Syncephalis isolates from 23 named species. I revived a culturing technique using beef liver and cellophane to grow several Syncephalis isolates without their host fungi to obtain pure DNA for some isolates. Most isolates, however, were grown in co-cultures with their host fungi and I designed Syncephalis- specific primers to obtain sequence data. Individual and combined datasets were analyzed by maximum likelihood (ML) and Bayesian analysis (BA) methods. I recovered

14 well-supported lineages and determined that most major clades contained isolates from distant localities on multiple continents. Many clades had taxonomic issues, evidently due to high phenotypic plasticity and species dimorphism. I also conducted an analysis of Syncephalis ITS sequences using complete ITS sequence data (ITS1-5.8S-

ITS2) for 31 unique isolates of 18 species and determined that Syncephalis species, on average, have long ITS sequences relative to other fungi. Commonly employed

eukayotic and fungal primers (ITS1, ITS1-f) appear compatible across phylogentically diverse Syncephalis species, but paradoxically Syncepahlis sequences are rarely recovered in environmental molecular diversity surveys.

CHAPTER 1 INTRODUCTION

Species of Syncephalis (Zygomycota: Piptocephalidaceae) are obligate parasites of saprobic microfungi in Mortierellomycotina and Mucoromycotina that commonly occur in soil and dung around the world. They are inconspicuous, and may superficially resemble other zygomycetes in Mortierellomycotina and Mucoromycotina as well as some anamorphic Ascomycota (Bawcutt 1983). The morphology of a typical species is a single, straight or recurved, merosporangiophore (ranging from 30 (S. hypogena R.K.

Benj.) to 775 (S. obliqua H.M. Ho & Benny) µm in height) supporting an apical, fertile vesicle that produces a number of branched or unbranched, cylindrical merosporangia.

Merosporangiophores arise from a base of simple rhizoids, which are used to anchor to substrates or to host hyphae. Alternatively, merosporangiophores can also be born aerially on the thin (1 µm thick), cobweb-like hyphae of the Syncephalis itself.

Merospores germinate to produce more fine hyphae, which eventually develop simple haustoria to penetrate a host fungus and grow intracellularly in an obligate, biotrophic parasitism (Benjamin 1959, Embree 1963).

Tieghem and Le Monnier first established the genus in 1873 and subsequently, approximately 65 species have been described. Classification has been based on morphological characters, such as merosporangiophore shape, spore ornamentation, fertile vesicle shape, number of merospores per merosporangium, the arrangement of merosporangia on the fertile vesicle, and merosporangia branching pattern (Ho 2001).

Syncephalis species may be readily isolated from the environment with the use of selective media and maintained in dual culture with their host fungi. Syncephalis spp. are widespread in environments that have a rapid turnover of organic material,

especially woodland and pasture habitats (Richardson & Leadbeater 1972). Soil, plant debris, and dung (especially of herbivores) are prime substrates for isolation.

Occasionally, a gram of soil may contain multiple Syncephalis species (K. Lazarus, personal observation). As ubiquitous mycoparasites, they likely influence the population levels of host fungi in terrestrial environments by inhibiting the vigor and sporulation of their hosts (Jeffries 1985).

Typical hosts for Syncephalis species belong to the zygomycete subphyla

Mucoromycotina and Mortierellomycotina (Baker et al., 1977; Richardson & Leadbeater,

1972). Hosts include several model zygomycetes, such as species of Phycomyces,

Rhizopus and Mucor, as well as post-harvest decay pathogens and Choanephora cucurbitarum (Berk. & Ravenel) Thaxt., a pathogen of cucurbits and several other crops.

Species of Syncephalis frequently parasitize Mucor spp. and Rhizopus spp. in nature, making these mycoparasites candidates for biocontrol research. Host range studies

(Hunter & Butler 1975, Baker et al., 1977) have determined that individual species of

Syncephalis are often capable of parasitizing multiple genera and species across the

Mucoromycotina and Mortierellomycotina, and rarely, some species of Dikarya.

For example, Syncephalis californica W.E. Hunter & E.E. Butler was capable of parasitizing 12 species of Mucorales from 8 different genera (Hunter & Butler 1975).

Similarly, Syncephalis sphaerica Tiegh. was able to parasitize 23 species of Mucorales from 19 genera (Baker et al., 1977). Although S. sphaerica was able to grow on seven

Dikarya in pure culture, the parasite could only sporulate on Sporobolomyces salmonicolor (B. Fisch. & Brebeck) Kluyver & C.B. Niel (Sporidiobolales, Basidiomycota)

and Magnusiomyces tetrasperma (Macy & M.W. Mill.) de Hoog & M.T. Sm.

(=Endomyces tetrasperma) (Saccharomycetales, Ascomycota) (Baker et al., 1977).

Syncephalis belongs to the order Zoopagales, which is arguably the most understudied order of fungi. Zoopagales are underrepresented in public databases with only approximately 134 identified DNA sequences in GenBank, many of which are relatively uninformative 18S rDNA sequences (K. Lazarus, personal observation). The genus Syncephalis is no exception; until this study GenBank contained only six sequences for one isolate of one Syncephalis species (S. depressa Tiegh. & G. Le

Monn.). Furthermore, until now there have been no published ITS rDNA sequences for the genus, despite the fact that the ITS region is now accepted as a universal fungal

DNA barcode marker (Schoch et al., 2012). The lack of verified Syncephalis ITS sequences is particularly problematic because if Syncephalis species are recovered in environmental DNA sequencing studies from soil or dung, there would be no way to actually identify these fungi as species of Syncephalis. Without sequence data it is challenging to assess any ecology and distribution of Syncephalis species in nature without extensive culturing from soil and dung.

Currently no molecular phylogeny exists for the genus Syncephalis, although S. depressa has been included in several phylogenetic analyses of zygomycete fungi

(White et al., 2006; James et al., 2006; Tanabe et al., 2000). These phylogenetic treatments suggest that the genus Syncephalis is allied with other genera of parasitic fungi in Zoopagales, including Thamnocephalis and Rhopalomyces. Members of another diverse mycoparasitic genus, Piptocephalis, are apparently more distantly related (White et al 2006). However, most of the phylogenetic analyses of Zoopagales

to date have included only a few species and have employed only weakly informative loci such as 18S rDNA.

In addition to their inconspicuous growth habits within soil and dung, most species Zoopagales have remained understudied because they are obligately associated with their host organisms. The tight symbiotic associations of these haustorial parasites means that they are directly attached to hosts and are therefore not easy to separate from host tissues. This makes Zoopagales such as Syncephalis species particularly difficult to include in molecular studies because DNA sequences of the parasites are easily contaminated by host DNA. In addition, most primers used for

PCR and sequencing of fungi were designed based on the more commonly studied

Dikarya and Mucoromycotina and therefore may not amplify Zoopagales DNA templates as easily.

The aim of this study is to develop a preliminary phylogenetic framework for the genus Syncephalis using four genes (18S, 5.8S, 28S, and RPB1). I hypothesize that distinctive morphological features, such as curved merosporangiophores, asymmetrical placement of merosporangia on the fertile vesicle, and production of branching merosporangia may be phylogenetically informative characters to help identify monophyletic groups within Syncephalis. Additionally, I hypothesize there may be phylogenetic patterns in host preference such that some lineages are likely to be restricted to hosts in either the subphylum Mucoromycotina or the subphylum

Mortierellomycotina. I also expect to see patterns of geographical distribution within and among clades. I predict that, based on the global ubiquity of potential host fungi, clades of Syncephalis will contain species with a wide geographic distribution.

In order to eliminate problems with DNA contamination from host fungi, I designed and tested Syncephalis-preferential primers to amplify Syncephalis DNA from dual culture DNA extractions. I also investigated a culturing technique originally designed by J.J. Ellis in 1966 to grow species of Syncephalis mycoparasites in pure culture without their host fungi.

Currently, nothing is known about the ecology and diversity of Syncephalis from environmental DNA samples. I sequenced full ITS rDNA from several phylogenetically diverse isolates to search for the presence of Syncephalis environmental sequences in

GenBank and therefore determine whether previous studies unknowingly detected these fungi. In addition to providing a framework for future phylogenetic studies of

Zoopagomycota, our DNA sequences will also assist future environmental diversity studies of Syncephalis and provide an example for characterizing similarly obscure, yet ubiquitous fungal lineages.

CHAPTER 2 MATERIALS AND METHODS

Sampling, Isolation, Co-Culturing on Host Fungi, and Axenic Culturing

Dual cultures of Syncephalis spp. and their host fungus, were isolated by GL

Benny and I from soil and dung samples. Samples were collected from across North

America by GL Benny, JW Kimbrough and ME Smith (Table 2-1). I also received dual cultures from around the world via the United States Agriculture Research Service

(ARS) Culture Collection (NRRL), Hsiao-Man Ho, and from the preserved culture collection of R. K. Benjamin. The datasets for the phylogeny and ITS sequence analysis include additional sequence data collected by Hsaio-Man Ho and Yi-Ting Chen.

For dung and soil samples, I used an isolation technique employed in Benny et al., (in review) to obtain co-cultures of Syncephalis and their hosts. This approach uses low nutrient agar in combination with benomyl to inhibit some rapidly growing

Ascomycota while at the same time enhancing visibility of Syncephalis and other mycoparasitic zygomycetes. I used Wg10 (One-Tenth Strength Wheat Germ Agar: wheat germ, 1.5 g [microwave 3 min in 300ml of distilled water and filter through cheese cloth, add water to supernatant up to 1 liter]; dextrose, 0.5 g; agar 15 g) and Wg5 (One-

Fifth Strength Wheat Germ Agar: as in Wg10, but with 3 g wheat germ and 1 g dextrose). Wg5 and Wg10 media were autoclaved, cooled and supplemented with benomyl at 20ppm and antibiotics (50 ppm sterile chlortetracycline hydrochloride, 100 ppm streptomycin sulfate). To isolate Syncephalis, ca. 2-3 grams of soil was sprinkled onto Wg10 and Wg5 plates and observed regularly for 5-14 days while being incubated at 21-23 C. When Syncephalis merosporangiophores were observed, they were transferred along with their presumed host fungi to a new plate of Wg10 agar with

antibiotics and benomyl. Cultures were parafilmed and maintained at 21-23 C. Well- established dual cultures were stored as agar cubes in sterile water. For long term storage (> one year) dual cultures were stored in a -80 C freezer by scraping sporulating host and parasite tissue into 2 ml screw-top tubes containing 1.5 mls of 10% glycerol and 90% sterile water solution.

Using a culturing recipe modified from Ellis (1966), Ellis liver agar (ELA), I was able to grow four different Syncephalis species axenically, without a host fungus: S. digitata H.M. Ho & Benny (S521-36), S. fuscata Indoh (S228-34), S. obconica Indoh

(S227-37) and S. plumigaleata Embree (S24-1). The pure culture medium was

MEYE+BL (Malt Extract-Yeast Agar + Beef Liver: malt extract, 3 g; yeast extract, 3 g; peptone, 5 g; dextrose, 10g; agar 20 g; distilled water, 1L). Prior to media preparation, frozen beef liver was thawed and washed in three changes of distilled water. The liver and media were autoclaved and cooled separately. The media was supplemented with antibiotics (50 ppm sterile chlortetracycline hydrochloride, 100 ppm streptomycin sulfate). A 1 x 1 x 1 cm cube of autoclaved liver was cut and placed aseptically in the middle of a plate. Media was then poured around the liver without covering the liver cube completely.

To obtain the pure cultures, parasite merosporgangiophores and parasite hyphae from a dual culture was carefully transferred directly to the liver cube with a fine, flame- sterilized wire. Successful pure culture transfers grew abundant fine hyphae and merosporangiophores within 2-3 days at 21-23 °C. Successive (5-6) pure culture transfers were also viable, as long as the transferred tissue was placed in direct contact with the liver cube (Figure 2-1).

The pure parasite culturing technique success came later in the course of the study, but will likely be valuable in future Syncephalis PCRs. This may potentially allow future use of existing, general eukaryotic primers to acquire additional loci. I tested another modification that may improve the ease of pure Syncephalis DNA extractions:

MEYE (Malt Extract-Yeast Agar) plates were covered with a sheet of sterile, wet cellophane and then a cube of sterile beef liver was placed on top. Pure parasite hyphae from a previous isolation were transferred to the liver cube. Parasite hyphae grew as abundantly over the layer of cellophane and could be more easily scraped off for DNA extraction.

PCR and Sequencing

Syncephalis preferential primers were designed after collecting pure Syncephalis tissue from dual cultures. To do this I touched the tip of a sterile, stainless steel minuten insect pin to a mature Syncephalis spore head, then transferred the liquid spore mass to a tube of CTAB for DNA extraction. Approximately 40-60 merosporangiophores worth of merospores were collected per extraction for several isolates of different species of

Syncephalis.

Pure cultures of Syncephalis species or dual cultures of Syncephalis species and their host fungi were scraped into 1.5 mL tubes with a sterilized transfer tool, crushed with a micropestle and DNA was extracted using the CTAB method (Gardes and Bruns

1993). Four DNA gene fragments were analyzed, including those coding for the RPB1

(DNA-dependent RNA polymerase II largest subunit), and three loci from the nuclear rDNA: 18S (small subunit), 5.8S and 28S (large subunit). I designed several primers for rDNA and RPB1 that were optimized to amplify Syncephalis DNA but not the DNA of known host fungi in the Mucoromycotina and Mortierellomycotina (see below). The

complete (18s-ITS1-5.8s-ITS2-28S) or partial rDNA, and RPB1 sequences were amplified using combinations of several forward and reverse primers of varying specificity (Table 2-2; Figure 2-1). The PCR reactions for the RPB1 gene spanned a middle section (about 650 base pairs), that nest between RPB1 primers Dt and Ft

(Tanabe et al. 2002).

Combinations of general and fungal-specific PCR primers were used to amplify and sequence SSU, 5.8S, LSU and RPB1 from the pure Syncephalis extractions.

Alignments were made in Mesquite v. 3.03 (Maddison and Maddison 2015) from 3-5 species of Syncephalis for each gene. GenBank sequences from host fungi (Mucor spp., Rhizopus spp., Absidia spp. and Morierella spp.) were also included in each of the gene alignments. These first few pure Syncephalis extractions and alignments helped to determine multiple 20-30 bp regions that were conserved among our Syncephalis spp. sequences but divergent from representative host fungi sequences. I designed the

Syncephalis preferential primers using the Primer3 software (Untergrasser et al., 2012).

The PCR reactions were conducted on an BioRad C1000 Thermal Cycler

(Applied Biosystems, Foster City, CA, USA), and the reactions were conducted using the following settings: initial denaturation at 95 °C for 60 s; 34 cycles of 95 °C for 30 s, annealing at 50-68 °C (depending on the primer’s optimum) for 30 s, 72 °C extension for

100 s; final extension of 5 min at 72 °C. The annealing temperatures were determined experimentally by running PCR using a temperature gradient. Selection of an appropriate annealing temperature was based on the highest temperature (ranging between 58.4-64.6 °C) that gave a single detectable amplification product in gel electrophoresis. A touchdown PCR program was used when the standard amplification

protocol was unsuccessful: 20 cycles of 95 °C for 30 s, 67 °C for 40 s (reduced by 0.5 degree each cycle to 57 °C), 72 °C extension for 100 s; 20 cycles of 95 °C for 30 s, 56

°C for 40 s, 72 °C extension for 100 s; final extension of 5 min at 72 °C. All PCR products were evaluated for successful amplification using SYBR Green and 1.5% agarose gels with TAE buffer for gel electrophoresis.

Successful PCR amplicons were then prepared for sequencing using an enzymatic purification using Exonuclease I and shrimp alkaline phosphatase enzymes

(Werle et al., 1994). Purified products were sequenced by the University of Florida’s

Interdisciplinary Center for Biotechnology Research (ICBR)

(http://www.biotech.ufl.edu/).

Sequence chromatograms were analyzed, trimmed, edited, and assembled using

Sequencher 4.1 (GeneCodes, Ann Arbor, MI). Consensus sequences were exported for phylogenetic analysis.

Sequence and Phylogenetic Analysis

Sequences were aligned with MUSCLE v. 3.8.31 (Edgar 2004) and improved manually in Mesquite v. 3.03 (Maddison & Maddison 2015). Ambiguously aligned regions were excluded with Gblocks v0.91b (Castresana 2002), using the least stringent character selection (e.g. allow smaller final blocks, allow gap positions within the final blocks, allow less strict flanking positions) for the 18S, 5.8S and RPB1 genes. The 28S gene contained the most ambiguous sequence regions but also the most phylogenetic signal so ambiguous regions were removed manually.

A phylogenetic analysis was conducted using four gene regions: 18S, 5.8S, 28S and RPB1. Individual maximum likelihood (ML) trees were constructed for each gene separately to check for potential discordance among the different phylogenies. When no

supported discordance was detected I concatenated the gene data into a supermatrix, which I used to build a consensus tree. The internal transcribed spacer regions (ITS1 and ITS2) were too divergent to align across the genus Syncephalis so these regions were excluded from the phylogenetic analyses. The final concatenated dataset contained of 2082 aligned characters for 88 Syncephalis isolates, including 23 described species. The 18S, 5.8S, 28S and RPB1 genes were comprised of 355, 182,

908 and 634 characters respectively.

Phylogenetic inferences were estimated using Bayesian posterior probability

(BPP) and maximum likelihood (ML) analyses. ML was estimated using RAxML v. 8.2.4

(Stamatakis 2014) with a GTR+I+G model of nucleotide substitution. Rapid bootstrapping was implemented with 1000 replicates to assess clade support. ML bootstrap values ≥70 were considered significant. For the Bayesian analysis, the RPB1 locus was partitioned by codon positions 1, 2 and 3, and the partitions were evaluated for the best models of nucleotide substitution. Partitioning, models of nucleotide substitution and the priors were determined in PartitionFinder v. 1.0.1 (Lanfear 2012) under the Bayesian information criterion (BIC). Bayesian posterior probabilities (BPP) were estimated using MrBayes 3.2.6 (Ronquist et al., 2011). Twenty million Markov

Chain Monte Carlo (MCMC) simulation generations were run in two parallel searches on four chains, and trees were sampled every 1000 generations. The first 5000 trees samples in each set were discarded as burnin. To determine whether stationarity was reached, Tracer v. 1.6 (Rambaut et al., 2014) was used to detect lack of convergence in the MCMC run and ensure the coverage was sufficient. Bayesian posterior probability

(BPP) values ≥0.97 were considered significant. All phylogenetic analyses were performed on the Cipres Portal v. 3.1. (Miller et al., 2010).

For the internal transcribed spacer region (ITS) analysis, only unique (<99% similarity), complete ITS sequences (ITS1-5.8-ITS2) were compared using the

Nucleotide BLAST (Basic Local Alignment Search Tool) with sequences in GenBank. I also used the “align two or more sequences” function in nucleotide BLAST to compare

ITS sequence diversity between several species of Syncephalis from this study.

Figure 2-1. Morphology across the genus Syncephalis. A. Galls produced by S. californica on Rhizopus oryzae; B. S. californica hyphae growing intracellulary in R. oryzae; C., D. S. fuscata growing axenically on beef liver media; E., F. Spherical fertile vesicle and merospores with refractive bodies of S. sphaerica; G. Asymmetrical attachment of merosporangia in S. plumigaleata; H. S. obconica; I., Dimorphic merosporangiophores of S. unispora; J. Basal rhizoids of S. unispora; K. Lower hemisphere attachment of merosporangia in S. hypogena; L. Pear-shaped fertile vesicle of S. pyriformis; M. Curved merosporangiophore of S. cornu; N. Merosporangiophores of S. nodosa attached to host hyphae; O., P. maturation of merosporangiophores of S. depressa. Scale bar= 20 µm.

Figure 2-2. Ribosomal DNA (rDNA) primer map. Syncephalis preferential primers are shown in red whereas other fungal-specific or general eukaryote primers are shown in black. Refer to Table 2 for commonly used primer pairs.

Table 2-1. Collection data for the 88 Syncephalis spp. isolate sequences included in the phylogenetic analysis. Symbols ※’s indicate the isolate is the type species sequence. ◊’s indicate isolates that were successfully grown on cow liver media without a host fungus.

Syncephalis Culture Strain Host Substrate Location Type Axenic adunca NRRL 22626 - Mucor sp. unknown unknown aurantiaca NRRL 6269 - Umbellopsis sp. unknown unknown californica RSA 2626 - Rhizopus cf. oryzae Soil Los Angeles Co., CA, USA clavata unknown KHRD unknown Dung Kaohsiung, Taiwan cornu RSA 2525 - unknown unknown unknown cornu RSA 2593 - Mucor sp. Dung Alachua Co., FL, USA cornu NRRL 6268 - Mucor sp. Dung Los Angeles Co., CA, USA cornu S293 39 Mortierella sp. Soil Okaloosa Co., FL, USA cornu A-12027 - Mucor sp. Plant debris unknown cornu A-13796 - Mucor sp. unknown India cornu A-5447 - Rhizopus sp. Soil Austrailia cornu BCRC 34595 PTMD Mucor sp. Dung Pingtung, Taiwan cornu BCRC 34577 CHDD Mucor sp. Dung Changhua, Taiwan cornu STDTFEBb - unknown Soil Taipei Co., Taiwan curvata S113 33 unknown Soil Hampshire Co., MA, USA depressa S116 4 unknown Soil Hampshire Co., MA, USA depressa S227 10 Mortierella sp. Soil Fayette Co., GA, USA depressa NRRL 22627 - unknown unknown unknown depressa STSTT - unknown Soil Taipei Co., Taiwan depressa STDTFEBa - unknown Soil Taipei Co., Taiwan digitata S521 36 Mortierella elongata Soil Wilcox Co., GA, USA ※ ◊ digitata S34 M08 unknown Soil Cumberland Co., ME, USA floridana S80 32 Cunninghamella echinulata Soil Sarasota Co., FL, USA ※ fuscata S228 34 Zygorhyncus sp. Soil Hill Co., GA, USA ◊ hypogena RSA 1618 - Mortierella bisporalis Soil Los Angeles Co., CA, USA ※ intermedia NRRL 6286 - unknown Dung Ukraine intermedia DTSTM - unknown Dung Taipei Co., Taiwan intermedia DNTXd - unknown Dung Taipei Co., Taiwan nana NRRL 6287 - Absidia regnieri Plant debris Ghana nodosa S117 5 Zygorhyncus sp. Soil Hampshire Co., MA, USA nodosa RSA 2187 - Mucor hiemalis Soil London, UK nodosa RSA 2670 - unknown Soil Los Angeles Co., CA, USA nodosa A-9779 Mucor sp. Dung Los Angeles Co., CA, USA nodosa BCRC 34618 STMD-1 unknown Dung Taipei, Taiwan obconica S227 37 Mortierella sp. Soil Fayette Co., GA, USA ◊ obconica BCRC 34804 NTHSS Mucor sp. Soil Nantou Co., Taiwan obliqua BCRC 34749 KHKYS unknown unknown Taiwan obliqua BCRC 34750 YLDTS unknown unknown Taiwan obliqua unknown TPBHSS unknown unknown Taiwan obliqua unknown TNML unknown unknown Taiwan obliqua BCRC 34165 S121102 Mucor sp. Soil Ilan Co., Taiwan ※ obliqua BCRC 34596 TP228MD unknown Dung Taiwan obliqua DNTXc - unknown Dung Taipei Co., Taiwan

Table 2-1. Continued. Syncephalis Culture Strain Host Substrate Location Type Axenic parvula unknown SJNWS unknown unknown Taiwan plumigaleata S24 1 Mucor sp. Soil Hampshire Co., MA, USA ◊ plumigaleata RSA 2622 - Mucor sp. Soil Los Angeles Co., CA, USA pseudoplumigaleata S71 2 Mucor moelleri, Cokeromyces sp. Soil Sarasota Co., FL, USA ※ pyriformis BCRC 34472 HFS07S01 Cunninghamella sp. Soil Nantou Co., Taiwan ※ sphaerica S105 3 Zygorhyncus sp. Soil Hamilton Co., FL, USA sphaerica S120 6 unknown Soil Hampshire Co., MA, USA sphaerica S85 M09 Mucor sp. Soil Lake Co., FL, USA sphaerica BCRC 34578 STMD-4 Mucor sp. Dung Taipei, Taiwan sphaerica SCANSAa - unknown Soil Chiayi Co., Taiwan sphaerica SCANSAb - unknown Soil Chiayi Co., Taiwan unispora S205 9 Cunninghamella bainieri Soil Okaloosa Co., FL, USA ※ vivipara BCRC 34710 PYLLMS unknown Soil Taiwan vivipara unknown TDDR unknown unknown Taiwan vivipara unknown TDDR unknown unknown Taiwan vivipara BCRC 34778 HLLYTS-1 unknown Soil Hualien Co., Taiwan vivipara BCRC 34777 TNKMMD unknown unknown Taiwan vivipara unknown LHC-2 unknown unknown Taiwan vivipara unknown VERMI unknown unknown Taiwan sp. S234 M03 unknown Soil Franklin Co., GA, USA sp. S482 M04 Mortierella sp. Soil Okaloosa Co., FL, USA sp. S526 M05 unknown Soil Crisp Co., GA, USA sp. S227 M10 Mortierella sp. Soil Fayette Co., GA, USA sp. S439 M11 unknown Soil Alachua Co., FL, USA sp. D1481 - unknown Dung CA, USA sp. RSA 2663 - unknown Soil Los Angeles Co., CA, USA sp. MES2 41 Rhizopus sp. Soil CA, USA sp. NRRL 1615 - Umbelopsis ramannianus unknown WI, USA sp. A-13648 - Mucor hiemalis Soil India sp. A-14907 - unknown unknown unknown sp. A-23985 - Rhizopus sp. Plant debris AZ, USA sp. A-7159 - Mucor sp. Soil New Zealand, North Island sp. A-5446 - Mucor hiemalis, Umbelopsis ramannianus Soil VT, USA sp. A-6786 - unknown unknown Australia sp. A-13833 - unknown unknown unknown sp. NRRL 6484 - Umbellopsis sp. unknown unknown sp. A-9791 - unknown Dung CA, USA sp. BCRC 34742 TYSWS unknown Soil Taoyuan, Taiwan sp. BCRC 34734 WSHS unknown Soil Taipei, Taiwan sp. BCRC 34773 TTPNS unknown Soil Nantou Co., Taiwan sp. BCRC 34776 HLLYTS-2 unknown Soil Hualien Co., Taiwan sp. STNTUEb - unknown Soil Taipei Co., Taiwan sp. SYSB - unknown Soil Yunlin Co., Taiwan sp. SNTTF - unknown Soil Taipei Co., Taiwan sp. SCANSAe - unknown Soil Chiayi Co., Taiwan sp. SNTTa - unknown Soil Taipei Co., Taiwan

Table 2-2. Primers implemented in this study, with their target gene region and varying specificity. The "commonly paired with" column notes the most successful primer combinations for obtaining PCR amplification and clean sequences.

Primer name Sequence 5'-3' Forward/ reverse Gene region Annealing Intended Commonly paired with Reference temperature°C target forward 18S ITS1 TCCGTAGGTGAACCTGCGG 64.5 Eukaryotes SYN4 White et al., 1990 forward 18S NS7 GAGGCAATAACAGGTCTGTGATGC 64.6 Eukaryotes SYN-5.8s-R1, SYN-5.8s-R3 White et al., 1990 forward 5.8S SYN-5.8s-F1 TTAATGCGACCCGCAACAC 60.2 Syncephalis SYN4 this study forward 5.8S SYN-5.8s-F2 GCTAGCAACGGATCACTCG 62.3 Syncephalis SYN4, LR5 this study reverse 5.8S SYN-5.8s-R1 CTCGATGACTCACGTGTTGC 62.4 Syncephalis NS7 this study reverse 5.8S SYN-5.8s-R3 GTGTTGCGGGTCGCATTA 59.9 Syncephalis NS7 this study reverse 28S SYN4 CYGATGTTGACCCGRCTG 62.2 Syncephalis ITS1, SYN-5.8s-F1, SYN-5.8s-F2 this study forward 28S SYN-LSU-F1 CGGGAATAGCCCAATCTGA 60.2 Syncephalis LR5 this study reverse 28S LR5 TCCTGAGGGAAACTTCG 57.2 Fungi SYN-LSU-F1 Vilgalys & Hester, 1990 forward 28S LROR ACCCGCTGAACTTAAGC 57.2 Fungi LR5 Vilgalys & Hester, 1990 forward RPB1 RPB1-SYNsp-F1 TCACCSCARAAGAACGCG 61 Syncephalis RPB1-SYNsp-R1 this study forward RPB1 RPB1-SYNsp-F2 CTKATGTGGGYGCCCAACT 62.3 Syncephalis RPB1-SYNsp-R1, RPB1-SYN-R2 this study forward RPB1 RPB1-SYNsp-F3 CTGCTCACRGGCATCAT 58.4 Syncephalis RPB1-SYNsp-R1 this study reverse RPB1 RPB1-SYNsp-R1 ACGGGCTCGATTCAACTCTCGA 64.5 Syncephalis RPB1-SYNsp-F1, RPB1-SYNsp-F2, RPB1-SYNsp-F3, RPB1-SYN-F3 this study forward RPB1 RPB1-SYN-F1 AACWTGCACGTGCCGCAGTC 64.5 zygomycetes RPB1-SYNsp-R1 this study forward RPB1 RPB1-SYN-F3 AAGAAYGCGCCCGTYATGGG 64.5 zygomycetes RPB1-SYNsp-R1 this study reverse RPB1 RPB1-SYN-R2 GGAATACGCTTGCCTTCGAC 62.4 zygomycetes RPB1-SYNsp-F2 this study

CHAPTER 3 RESULTS

The individual ML analysis of 18S, 5.8S, 28S and RPB1 gene alignments yielded no significant conflicts in their topologies, so the loci were concatenated and analyzed together (Figure 3-1).

The analysis identified fourteen major clades with strong ML bootstrap and BPP support. Five clades (/hypogena, /cornu, /sphaerica, North American /depressa and

/obconica) had nomenclatural problems whereby isolates morphologically identified as one species were resolved in monophyletic clades with isolates that were identified as different species. Further morphological analyses are needed to determine appropriate names for some of these clades. I found approximately ten undescribed species that were not readily assignable to a known species. Seven isolates (Figure 3-1, in circles labeled 1 through 7) were considered divergent enough to constitute their own unique clades, and three unidentified isolates (sp. 2, STNTUEb; sp. 3, TYSWS; sp. 5, D1481) that may also be new species. Additionally, two clades (designated /spp. A, /spp. B) contain no isolates identified to species; these clades may also contain undescribed species of Syncephalis.

The best ML tree and the Bayesian consensus tree had slightly different topologies. The differences were mostly due to rearrangements in the backbone relationships, particularly among clades on long branches, whereas the two different analyses recovered the same major terminal clades. There was no maximum likelihood

BS support for the deeper relationships between terminal clades of Syncephalis. The

Bayesian consensus tree did have BPP support for a few of these relationships (data not shown), but there were no analogous branching relationships with the ML phylogeny

to map these BPP support values. Posterior probability support was found for the placement of Rhopalomyces elegans Corda, as the outgroup.

The analysis revealed that five out of fourteen supported clades containing two or more species names may not actually be different species based on their very close placement in the phylogeny. There is some preliminary evidence for geographic patterns and host preferences that are specific to different Syncephalis clades.

Additionally, there is evidence for cryptic species for S. intermedia Tiegh. and S. depressa, which each form two distinct lineages in the Ukraine and Taiwan (S. intermedia) and North America and Taiwan (S. depressa).

Analysis of the isolates with complete ITS sequence data revealed that the average length of the entire ITS1-5.8S-ITS2 region in Syncephalis is 848.8 base pairs, with a median of 806 base pairs and high overall variability in length (shortest = 641 bp,

S. sp. (MES2-41); longest = 1266 bp, S. pseudoplumigaleata H.M. Ho & Benny (S71-

2))(Figure 3-2). Using BLASTn (Madden 2009) to compare the 31 unique Syncephalis

ITS rDNA sequences against GenBank revealed that only 4 out of 31 sequences have closely matching environmental fungal ITS rDNA sequences. The remaining sequences show homology to GenBank sequences only in the conserved 5.8S region (Table 3-1).

Analysis of a phylogenetically diverse Syncephalis rDNA sequence alignment revealed that commonly used, general eukaryote and fungal-specific primers (e.g. ITS1, ITS1F,

ITS4) all matched well with Syncephalis rDNA. This suggests that poor primer annealing is probably not the reason this lineage is rarely detected in molecular environmental surveys.

Figure 3-1. Maximum Likelihood (ML) phylogeny of 88 isolates of Syncephalis species based on 2082 aligned nucleotides from four genes (18S, 5.8S, 28S, and RPB1). Thickened branches represent ML bootstrap support ≥70 and posterior probabilities ≥97. ML bootstrap values above nodes are based on 1000 replicates. Posterior probabilities are presented below nodes. Asterisks indicate maximum support. Sequences of unique isolates that were not affiliated with any particular clade are designated with circled numbers 1-7. Cross symbols (※) indicate ex-type cultures. Diamond symbols (◊) indicate isolates that were successfully grown axenically on cow liver media without a host fungus.

Figure 3-2. Length of sequences from complete internal transcribed spacer region (ITS1-5.8S-ITS2) for 31 Syncephalis isolates from 18 species. Species with identical (<1% bp difference) were listed together on the x-axis. Refer to Table 3 for closest matching ITS sequences in GenBank.

Table 3-1. Detecting Syncephalis ITS sequences in GenBank. The 31 unique (<99% similarity) internal transcribed spacer (ITS1-5.8S-ITS2) sequences from this study are shown in order of increasing sequence length. The BLASTn tool was used to determine the sequence similarities between the Syncephalis ITS sequences generated in this study with the existing sequences in GenBank. The “%QC” column gives the query coverage defined as the percent of the query Syncephalis sequence that overlaps with the subject sequence with the highest homology. The “% ID” column gives the percent identity shared between the Syncephalis query sequence and the GenBank sequence with the highest similarity. The four sequences indicated with an asterisk indicate that the Syncephalis query sequence query matched a GenBank sequence over part of ITS1 and ITS2 regions and not just the more conserved 5.8S region.

ITS % % GenBank length Species (n= 18) Isolate(s) (n=31 unique; 43 total) QC ID Top BLAST match name Accession Isolation source 635 S. sp. MES2-41 26 95 Uncultured fungus clone IIP2-27 EU516669 Austria, soil 664 S. sp. S227-37 97* 90 Uncultured fungus clone IIP2-27 EU516669 Austria, soil 669 S. digitata S521-36 97* 91 Uncultured fungus clone IIP2-27 EU516669 Austria, soil 672 S. intermedia NRRL 6286 100* 96 Uncultured fungus clone HME_S05-24 JX898583 NY, USA Cave and Mine 672 S. parvula SJNWS 42* 99 Uncultured fungus clone 035A13995 JX368434 TX USA cotton monoculture soil 761 S. adunca, S. cornu, S. cornu NRRL22626, NRRL6268, CHDD 41 82 Uncultured fungus clone HME_S05-24 JX898583 NY, USA Cave and Mine 765 S. sp., S. nodosa A-6786, RSA 2187 25 94 Uncultured fungus clone ACV_S09-20 JX898617 NY, USA Cave and Mine 777 S. nodosa RSA 2670, STMD1 24 94 Uncultured fungus clone ACV_S09-20 JX898617 NY, USA Cave and Mine 786 S. sp., S. fuscata, S. sphaerica A-5446, S228-34, S120-52 29 94 Uncultured fungus clone IIP2-27 EU516669 Austria, soil 796 S. nodosa A-9779 24 92 Uncultured fungus clone ACV_S09-20 JX898617 NY, USA Cave and Mine 796 S. cornu, S. curvata A-12027, S113-33 42 83 Uncultured fungus clone GMW_S06-09 JX898590 NY, USA Cave and Mine 798 S. cornu A-13796 38 80 Uncultured fungus clone GMW_S06-09 JX898590 NY, USA Cave and Mine 799 S. sp. RSA 2663 24 94 Uncultured fungus clone ACV_S09-20 JX898617 NY, USA Cave and Mine 801 S. sp. A-7159 42 81 Uncultured fungus clone GMW_S06-09 JX898590 NY, USA Cave and Mine 803 S. aurantiaca, S. sp. NRRL 6269, NRRL 1615 50 79 Uncultured fungus clone HME_S05-24 JX898583 NY, USA Cave and Mine 806 S. cornu RSA 2525, RSA 2593 42 83 Uncultured fungus clone GMW_S06-09 JX898590 NY, USA Cave and Mine 809 S. depressa S227-10 50 79 Uncultured fungus clone HME_S05-24 JX898583 NY, USA Cave and Mine 853 S. pyriformis HFS07S01 27 96 Uncultured fungus clone IIP2-27 EU516669 Austria, soil 860 S. sp. A-13833 31 87 Uncultured fungus clone IIP1ab15 EF635761 Austria, soil 886 S. plumigaleata S24-1 30 87 Uncultured fungus clone IIP1ab15 EF635761 Austria, soil 905 S. floridana S80-32 22 93 Uncultured fungus clone GMW_S06-09 JX898590 NY, USA Cave and Mine 937 S. obliqua TNML , KHKYS 28 87 Uncultured fungus clone IIP1ab15 EF635761 Austria, soil 944 S. obliqua YLDTS 22 93 Uncultured fungus clone HME_S05-24 JX898583 NY, USA Cave and Mine 957 S. vivipara HLLYTS1 40 77 Uncultured fungus clone HME_S05-24 JX898583 NY, USA Cave and Mine 950 S. plumigaleata RSA 2464, RSA 2622, RSA 2632 23 93 Uncultured fungus clone IIP1ab15 EF635761 Austria, soil 954 S. hypogena RSA 1618 22 92 Uncultured fungus clone IIP1ab15 EF635761 Austria, soil 969 S. sp. A-13648 27 87 Uncultured fungus clone IIP1ab15 EF635761 Austria, soil 969 S. vivipara PTLLMS 21 93 Uncultured fungus clone GMW_S06-09 JX898590 NY, USA Cave and Mine 1018 S. californica RSA 2626 31 82 Uncultured fungus clone HME_S05-24 JX898583 NY, USA Cave and Mine 1036 S. sp. A-23985 30 82 Uncultured fungus clone HME_S05-24 JX898583 NY, USA Cave and Mine 1266 S. pseudoplumigaleata S71-2 15 94 Uncultured fungus clone RFLP30 FJ528704 Australia, soil

CHAPTER 4 DISCUSSION

Overview

In this discussion I make preliminary inferences on shared characteristics of well- supported clades, such as morphology, host preferences and specificity, and biogeography. Isolates from several clades without names need to be compared with taxonomic descriptions to ensure these do not correspond to species that were already described, but for which the original descriptions are unclear or the taxonomic concept is in need of revision. More collections are needed from type localities, particularly in

Europe. Some species will remain as tenuous placeholders until the taxonomy is refined. Only a few isolates were successfully grown in axenic culture on beef liver without their host fungi. However, these axenically grown isolates were phylogenetically distant from one another (Figure 3-1) and we suspect that many other Syncephalis isolates could potentially be grown using this technique.

Clade Analysis

The Hypogena Clade

The Hypogena Clade is comprised of Syncephalis plumigaleata and S. hypogena isolates from North America, and S. obliqua H.M. Ho & Benny, isolates from Asia. The epithet hypognea was chosen for the clade name because the S. hypogena isolate sequenced in our study is the type strain. Although S. plumigaleata was described prior to S. hypogena, S. plumigaleata was originally described from Zimbabwe so it is possible that our S. plumigaleata may not correspond well with type. Our isolates identified as S. plumigaleata are North American.

Syncephalis plumigaleata is divided into two geographically distinct subclades with an isolate form eastern North America in one clade and an isolate from western

North America in another. Sister to the western North America S. plumigaleata, is a clade of S. obliqua isolates from India and Taiwan, including the type specimen of S. obliqua (S121102), as well as the type strain RSA 1618 of the morphologically anomalous S. hypogena.

Both S. plumigaleata and S. obliqua are species with relatively tall merosporangiophores (height always > 200 µm and frequently > 600 µm), and both species have an unusual, asymmetrical placement of merosporangia on the fertile vesicle (Figure 2-1g). The more recently described S. obliqua is distinguished from S. plumigaleata because it has smaller, cylindrical spores that are smooth whereas S. plumigaleata has larger oval spores that have punctate spore ornamentation.

One particularly striking relationship was the phylogenetic placement of the type strain of S. hypogena with S. plumigaleata and S. obliqua. Syncephalis hypogena produces tiny merosporangiophores (40-100 µm tall) and this species has a unique merosporangia attachment that is only on the bottom hemisphere of the fertile vesicle

(Figure 2-1k). The merosporangia are also much shorter, comprising only 1-2 spores in

S. hypogena instead of 4-6 in S. plumigaleata. Syncephalis hypogena is morphologically very different from its closest relatives, suggesting the need for further investigation.

Several Syncephalis species have been reported to produce dimorphic merosporangiophores that can vary in height and dimensions, vesicle size and dimensions, and merospore size, dimensions and number. Both Syncephalis vivipara

B.S. Mehrotra & R. Prasad, and Syncephalis unispora nom. prov. are described with merosporangiophores that are dimorphic, with some short and some tall and with few of medium height (Figure 2-1i).

Considering its phylogenetic placement among species that have both short and tall merosporangiophores, it seems plausible that S. hypogena could perhaps be another species with dimorphic merosporangiophores with the potential produce S. obliqua-like or S. plumigaleata-like morphs. Alternatively, there may be high phenotypic diversity among species of the Hypogena Clade. The ancestor of this clade may have been dimorphic with some taxa subsequently losing the dimorphic merosporangiophore morphology and instead having only short or tall merosporangiophores.

The Vivipara Clade

The Vivipara Clade is comprised of Syncephalis floridana nom. prov., and

Syncephalis vivipara B.S. Mehrortra & R. Prasad. Although these species are morphologically similar in the merosporangiophore and vesicle dimensions, spore dimensions and number of spores per merosporangium, they have been documented from different continents: S. floridana is only known from North America whereas S. vivipara is from Asia. Unique features noted in S. vivipara include: spores germinating directly from merosporangia (hence the etymology of its species epithet), merosporangia of varying lengths on a single vesicle, and two distinct size ranges for merosporangiophores. However, the smaller merosporangiophores of S. vivipara are the same size as typical merosporangiophores of S. floridana.

Sister taxon, S. unispora nom. prov. was excluded from the Vivipara Clade based on its numerous morphological differences, including smaller merosporangiophores, single-spored merosporangia, and rounder and larger spores. Nonetheless S. unispora

also produces merosporangiophores in two distinct size ranges. The phylogenetic placement of S. floridana among these taxa, and the fact that S. floridana merosporangiophores are similar in size to the small merosporangiophores of S. vivipara, suggests the possibility that S. floridana could also produce dimorphic merosporangiophores that have not yet been observed. Syncephalis floridana appears to be a unique species based on the multi-locus phylogeny and the relatively low ITS sequence similarity with S. vivipara.

Syncephalis floridana and S. vivipara, were originally described attacking species of Cunninghamella. Cunninghamella spp. as natural hosts have been considered unique (Mehrotra & Prasad 1970) whereas Rhizopus spp. and Mucor spp. are more common hosts of the Syncephalis species isolates in this study (Table 2-1). Species of

Cunninghamella are nested within the Mucorales, but they form a clade that is relatively divergent from the other more typical Mucoralean hosts of Syncephalis spp. (Mucor,

Chaonephora, Cokeromycers and Rhizopus spp. (White et al., 2006; Hoffman et al.,

2013). This is preliminary evidence that suggests the possibility that some clades of

Syncephalis may show host preferences toward some particular host taxa.

The Obconica Clade

The Obconica Clade contains two described species: Syncephalis digitata nom. prov. and Syncephalis obconica Indoh. The clade has strong molecular support, despite a unique, obtuse merosporangia branching style present in S. obconica that is quite distinct from the morphology of S. digitata. However, it is evident this feature was variable or at least difficult to observe, because Indoh’s original 1962 species description judged the merosporangia to be simple rather than branched. Later, Indoh

examined well-developed specimens, with larger fertile vesicles, and determined that the merosporangia were predominately branched (Kuzuha 1973).

Syncephalis digitata, on average, has fewer merosporangia per fertile vesicle than S. obconica. However, both S. obconica and S. digitata have a small, similarly shaped fertile vesicle with a truncate top. Additionally, Kuzuha revisted Indoh’s S. obconica species description (Kuzuha 1973) and acknowledged additional morphological variation within the species including: smaller merosporangiophores, longer spores, a smaller number of spores per merosporangium, and variable vesicle shape. Because some of the variability within S. obconica observed by Kuzuha (Kuzuha

1973) overlaps morphologically with the description of S. digitata, more work is needed to clarify the identity of these two species. Furthermore, the Obconica Clade appears to have high phenotypic diversity with some isolates, inconsistently producing branching merosporangia depending on the host interactions or environmental factors.

The Obconica Clade also appears to exhibit preference to hosts in the genus

Mortierella. Mortierella spp. are members of subphylum Mortierellomycotina, which are phylogenetically divergent from Mucorales (Mucoromycotina). Four different isolate locations in North America (from Georgia, Florida and Maine) were found to have a

Syncephalis species parasitizing Mortierella enlongata Linnem. or an unidentified species of Mortierella. However, one slightly more divergent Taiwan isolate of S. obconica was found parasitizing a Mucor sp.

The Cornu Clade

The Cornu Clade is comprised of three species: Syncephalis cornu Tiegh. & G.

Le Monn., S. curvata Bainier and S. adunca Vuill. This large clade could be phylogenetically divided into two well-supported subclades and there are some

morphological differences between these two subclades. The one very distinctive uniting feature of the entire Cornu Clade is the characteristic, strongly curved, fishhook- like merosporangiophores that are found in all species within this group (Figure 2-1m)

Bainier (Bainier 1883) distinguished S. curvata for having spore ornamentations that were “fine, transverse, striations” instead of “very minute protuberances when matured,” as in the description of S. cornu (Tieghem & Le Monnier 1873). However, the validity of the species S. curvata’s has been historically contentious, as discussed by

Bawcutt (1966). Several authors (e.g. Zychya (1935), Indoh (1965), Moller (1901), and

Naumov (1939)) have suggested that S. curvata is likely a synonym of S. cornu.

The BS and BPP support as well as the ITS sequence fata also suggest that S. adunca (RSA 2627) is probably a distinct species in the Cornu Clade. Syncephalis curvata and S. cornu are both, on average, taller and have larger spores than S. adunca. Syncephalis adunca is also considered unique for having smooth spores, with granulose tips (Vuillemin 1903).

Spore ornamentation was a distinguishing character in the morphological descriptions for these Syncephalis spp. with a fishhook merosporangiophores. But this feature may actually be too variable among isolates to be phylogenetically informative, considering skillfully identified (leg: Dr. Gerald Benny & Dr. Hsiao-Man Ho) S. cornu isolates appear in both Cornu subclades. Subtle difference in spore ornamentations is also difficult to judge with light microscopy, and this feature may vary with spore maturity (Bawcutt 1966).

Syncephalis californica also has a strongly curved merosporangiophore but is unique for maintaining a relatively constant diameter from the base to the apex.

Syncephalis californica diverges near the fishhook clade in both the ML and Bayesian analyses, but lacks statistical support to be sister to the fishhook clade. However, the strongly curved merosporangiophore may still have a single evolutionary origin in

Syncephalis. Including additional species with fishhook merosporangiophores in future phylogenetic analyses may allow us resolve an origin to this character: Several taxa have been described that should be examined in the future, including S. reflexa Tiegh.,

S. nigricans Tiegh., and S. glabra Morini. Syncephalis glabra is unique because the merosporangiophores start development straight and become curved later as they mature (Bawcutt 1966).

The Sphaerica Clade

Phylogenetically our isolates identified as S. fuscata Indoh and S. sphaerica

Tiegh., resolve in a single clade with strong BS and BPP support. Isolates had very little molecular variation despite being from multiple localities in Eastern North America and

Taiwan. One isolate from Taiwan is also molecularly affiliated with the clade (S. sp.

STNTUEb), but its morphology was not examined in this study.

Morphologically, S. fuscata and S. sphaerica both have well-developed rhizoids, notable refractive bodies in both ends of their merospores, and spherical fertile vesicles with merosporangia that cover the upper half. However, S. fuscata tends to be larger on average (e.g. fertile vesicle diameter, height and dimensions of merosporangiophores, and number of merospores per merosporangium). Some other distinguishing characters include the basal septum that divide the merosporangiophore from its rhizoids in S. sphaerica and the rhizoids in S. fuscata that darken with maturity as well as the merosporangiophores that are occasionally dichotomously branched in S. fuscata.

Syncephalis fuscata Indoh was considered similar to S. obliqua by Ho and Benny

(2008) in their original description of S. obliqua. Syncephalis obliqua also has a well- developed rhizoid system that is similar to S. fuscata, but these two species are nonetheless genetically divergent.

This analysis did not include type specimens, or type locality representatives for either S. fuscata (from Japan) or S. sphaerica (from France) so further sampling is needed to substantiate the genetic identities of the isolates used in this analysis.

The North American and Asian Depressa Clades

Syncephalis aurantiaca Vuill.and Syncephalis depressa Tiegh., share several, atypical morphological features that could explain their phylogenetic placement together, including: merosporangia arranged in a ring around a bald crown, and the ability to form branching merosporangia. However, S. depressa is known for having extensive peripherally branching merosporangia.

There is also another, genetically distant, clade with isolates from Asia that are identified as S. depressa. Syncephalis depressa was described from France over 100 years ago and unfortunately our analysis lacks a type sequence or type locality representative. More work is needed to determine which clade (if either) contains the legitimate taxon S. depressa.

The characters considered depressa-like, such as extensively branching merosporangia, and bald fertile vesicle tops could have multiple evolutionary origins or losses, based on the phylogenetic distance between the Asian Depressa Clade and the

North American Depressa clade. . A ring of merosporangia that forms a bald top of the fertile vesicle is also a feature in the Nodosa Clade and the Obconica Clade.

The two Syncephalis intermedia Tiegh. isolates comprising the Asian Intermedia

Clade and single S. intermedia isolate from the Ukraine are also polyphyletic. Like the

S. depressa isolates in this analysis, the S. intermedia isolates are morphologically identified as one species, but molecularly divergent, and also lacking a type specimen in the analysis. The key characters used to identify S. intermedia’s (such as a basal merosporangiophore septum, presence of simple and branched merosporangia) may not be phylogenetically distinguishing features.

Species Clade A, Species Clade B, and unidentified, divergent species

This analysis recovered several divergent clades with no known species names

(Clade A and Clade B), and several divergent isolates that represent unique taxa

(STNTUEb #2, TYSWS #3 and D1481 #5). These isolates should be examined morphologically, because they are potentially undescribed species.

The Parvula Clade, Syncephalis nana and Syncephalis clavata

This analysis also revealed that several known species (Syncephalis nana Dade,

Syncephalis clavata H.M. Ho & Benny, and Syncephalis parvula Gruhn) are quite unique molecularly and were resolved on long phylogenetic branches.

Syncephalis nana, in particular, is on a very long branch. Our S. nana isolate is the only one in this analysis to come from Africa (Ghana) and this suggests that sampling on different continents that have not been sampled extensively (e.g. in the tropics and in the Southern Hemisphere) may yield other highly divergent isolates and new genetic diversity for the genus Syncephalis. Morphologically S. nana is relatively small and inconspicuous, but unique from most other Syncephalis species because of it has fusiform merospores whereas those of most other species are cylindrical.

Syncephalis nana may also have a unique mode of spore development (Bawcutt 1966).

Sequence Analysis of the Internal Transcribed Spacer region (ITS)

The ITS sequences of S. digitata (S521-36) and S. sp. (S227-37) of the

Obconica Clade are similar to each other (98% shared sequence identity), and the closest match in GenBank (97% sequence query coverage; 91% sequence identity) was an uncultured fungus clone (EU516669) from a study on soil fungal communities in snow-covered, primary successional soils in Europe (Kuhnert et al., 2012). My ITS sequence for S. intermedia (RSA 6286) also closely matched (100% query coverage;

96% identity) a different uncultured fungus clone isolate (JX898583) from a study on the mycobiome of caves and mines affected by White Nose Bat Syndrome (Zhang et al.,

2014). Interestingly, these four ITS sequences have exceedingly short sequences for the genus Syncephalis. Although the average Syncephalis species had an ITS sequence that was 806.8 bp, these species that were detected as soil clones had ITS lengths that ranged 664-672. Shorter sequence length may correlate to a higher likelihood of gene fragment amplification in PCR in pooled DNA amplification studies and it is also likely that it is easier to sequence these shorter fragments.

Generally, it appears the majority of our Syncephalis isolates have no close ITS sequence matches in the GenBank. The closest GenBank matches for the other complete ITS sequences had low query coverage (15-50%) and were only homologous to the more conserved 5.8S region. However, our isolate of Syncephalis parvula had a low sequence query cover (42%) to its top match (JX368434) because its top match was an incomplete ITS sequence (only ITS1), but actually is also likely another

GenBank Syncephalis sequence.

The ITS region appears to be extremely divergent between clades of

Syncephalis, but is apparently conserved within species. I analyzed ITS sequence

similarity between the two supported clades within the /cornu clade: 4 ITS sequence types (<99% similarity threshold) from 6 isolates in the /cornu subclade containing S. curvata, ranging from 796-806 bp in length; and 1 ITS sequence type from 3 isolates in the /cornu subclade containing S. adunca that is 761 bp in length. Between the two subclades, sequence query cover and identity range 87- 88% and 82-86% respectively.

Between the 6 isolates in the Cornu/Curvata subclade, query cover and identity range

(97-100%) and (84-98%) respectively. The sequence diversity of ITS likely varies within other clades, but query cover appears to be the most conserved feature. There was so much variation in ITS sequence length, that having a similar length ITS (within 10 bp) gave a quick indication that isolates were probably closely related.

Within the Vivipara Clade, we have full ITS sequence data for two S. vivipara isolates (HLLYTS1 and PTLLMS) and S. floridana (S80-32). The sequences have 100% query coverage. The two S. vivipara isolates share 97% sequence identity with each other and 85-86% sequence identity with S. floridana, which is apparently enough divergence to be a separate species.

Originally, I hypothesized that a poor fit of fungal or eukaryotic primers (e.g. low homology at the priming sites leading to poor primer annealing) relative to other fungal lineages, could be a major reason that Syncephalis sequences are rare in environmental diversity studies using PCR amplification. However, small subunit sequence alignments of approximately 40 phylogenetically diverse Syncephalis isolates reveal that the primer ITS1 (eukaryote-specific) matched all our isolates perfectly, and only two isolates (S. nana (RSA6287) and S. sp (MES2)) varied in 1 out of 22 base pairs of primer ITS1-F (fungal-specific). This suggests that poor primer fit is probably not

the issue for detecting this Syncephalis in environmental sequencing studies. Compared to some fungal lineages Syncephalis species have relatively long ITS sequences

(Schoch et al., 2012). Longer sequences take longer to replicate in PCR amplifications.

The extra base pair insertions that are making some ITS sequences of Syncephalis so long may form secondary structures that inhibit or slow PCR. Finally, in nature, these parasites may just have a proportionally lower biomass in a given environmental sample than other fungi, and could vary with fluctuations in host populations. These features could make amplification of sequences from this lineage more challenging compared to culture-based isolations with selective media.

Ecology

Based on previous culture-based observations and the new phylogenetic data, we know that small volumes of soil substrate can harbor diverse Syncephalis species.

We were able to isolate and sequence three unique strains from a soil sample from

Fayette Co., GA, USA (S227) and several other soil samples yielded two or more species of Syncephalis (Benny et al in review).

We also discovered less genetic diversity was found in some species clades despite sampling from multiple localities. For instance, the isolates of the Sphaerica

Clade (S105-3, FL, USA; S228-34, GA, USA; and A-5446, VT, USA) are 99-100% identical in their ITS1-5.8S-ITS2 sequences, and from three localities in Eastern USA.

Additionally, the isolates S. digitata and S. sp. (S521-36, GA, USA; S227-37, GA, USA) from different localities in Georgia, USA are 98% identical in ITS1-5.8S-ITS2 sequence.

This S. digitata sequence type also is also one of the very few apparent Syncephalis sequences in GenBank, (EU516669) which was from Austria (Table 3-1). These may be

cosmopolitan isolates and species since they have been recovered from a wide geographic distribution.

Most clades (9 out of 14) contain isolates from multiple continents. Preliminary evidence suggests the possibility that the North American Depressa Clade is endemic to North America. However, these biogeographical inferences could be the result of small sample sizes (typically 2-3 isolates per clade).

Although the biogeographical patterns of plants and animals are relatively well known, the field of fungal biogeography is still in its infancy. Recent evidence suggests that some symbiotic fungi (such as ectomycorrhizal fungi) have constrained distributions with species and/or lineages often endemic to particular continents or regions. In contrast, other symbiotic fungi (such as lichens) can be more widespread with species or lineages distributed between continents or even across the globe (Tedersoo et al

2010; Talbot et al 2014)

Syncephalis spp. apparently follow the “everything is everywhere” biogeographical model of distribution with wide distributions that span multiple continents. The known host fungi for Syncephalis are mostly rapidly growing, abundantly sporulating, generalist saprotrophs that are considered ubiquitous in soil across the globe (Benny et al 2016). The widespread nature of the host fungi is likely one factor that may enable Syncephalis species to disperse to many habitats and across continents.

Host specificity may be another biological feature impacting diversity and distribution of Syncephalis species. Species with a wider host range have a higher chance contacting a suitable host following a dispersal event. However, if a diversity of

suitable hosts are commonly and easily reached in the environment, effectiveness of infection establishment or competition may become new evolutionary pressures.

Syncephalis spp. are wet-spored at maturity (Figure 2-1p) and the limitations and major mechanisms of dispersal are not well known. They might disperse by sticking to grazing or passing arthropods. Anecdotal observations from culturing (GL Benny, personal communication) suggests there may be some sort of volatile production that attracts mites to feed on merosporangiophores. However, oceans are still a huge physical barrier for arthropods. Another potential and likely mechanism for dispersal is anthropogenic, especially from the transport of plant material and soil.

It is notable that Syncephalis clades that are widespread across the globe often have certain notable biological features. For instance, some taxa readily produce melanized, thick-walled, sexual zygospores that can serve as resistant propagules.

Some of the most geographically widespread clades (e.g. Cornu, Nodosa and

Sphaerica clades) regularly produce zoospores in co-cultures with their hosts.

Syncephalis curvata (Cornu clade) was also reported by Bainier (1882) to produce chlamydospores (asexual resistant propagules) when vigorously parasitizing Rhizopus stolonifer (Ehrenb.) Vuill..

Host specificity may be another biological feature impacting diversity and distribution of Syncephalis spp. Species with a wider host range have a higher chance contacting a suitable host following a dispersal event. However, if a diversity of suitable hosts are commonly and easily reached in the environment, effectiveness of infection establishment or competition may become new evolutionary pressures.

There is circumstantial evidence that members of the Obconica clade and the

Vivipara clade may have an alternative strategy of specializing on particular host fungi

(e.g. Obconica clade on Mortierella spp. and Vivipara clade on Cunninghamella spp.).

However, more sampling and environmental data is needed to confirm these observations of potential host preferences or specialization.

The galling reactions in the hosts from the parasitism by S. californica on

Rhizopus stolinifer (Figure 2-1a) (WE Butler, 1975) and by S. torpedospora and S. parvula on Mortierella alpina (Gruhn & Petzold, 1991) were suggested to be the a result of a highly evolved host-parasite relationship. In fact, the host hyphae of Mortierella alpina was observed growing towards and coiling around the infective spores of S. parvula. Gruhn & Petzold (1991) hypothesized that the Syncephalis parasites may produce exudates from their germinating spores that influence the growth patterns of the host fungi but more research is needed to examine this possibility.

CHAPTER 5 CONCLUSION

A large number of isolates that were thought to be different species were placed together phylogentically. And conversely, some isolates that were identified as the same species were in different clades. This highlights the difficulty of identifying and describing Syncephalis species based on morphology alone. Syncephalis species are microscopic and have a simple morphology with a few characters to observe and compare. Some features that are considered diagnostic to some species appear to vary depending on maturity (e.g. the punctated spores of S. cornu, the simple and branching merosporangia in S. obconica). Quantitative traits may also vary depending on the compatibility of the host-parasite interaction, although this has not been explicitly examined.

Some researchers have documented the dimorphic merosporangiophore growth habits in some species (e.g. S. vivipara and S. unispora), and a range of intraspecies variation in other morphological features, such as merosporangiophores. It is possible that species are overestimated based on phenotypic variation. This could be an explanation for so many terminal species clades with multiple species names including:

S. curvata and S. cornu of the Cornu clade, S. fuscata and S. sphaerica of the

Sphaerica Clade, S. aurantiaca and S. depressa of the North American Depressa

Clade. However considering Syncephalis spp. are so ubiquitous, we have relatively minimal sampling and observational data to clarify species concepts.

Conversely, some morphologically described species may contain additional, cryptic species. Due to simple morphology with a limited number of observable, distinguishing characters, isolates may be identified as a single species, but not be closely related.

Characters like branching merosporangia and the ring pattern of merosporangia on the fertile vesicle are pervasive in several clades. These characters that are polyphletic and appear in multiple clades were previously thought to be phylogenetically informative. My data suggests that these features may have multiple evolutionary origins and explain the appearance of isolates tentative identified as S. depressa and S. intermedia being resolved in distant phylogenetic lineages within the tree. There are likely many discrete species isolates within molecularly diverse clades like the Hypogena Clade.

Future analyses will benefit from sequencing more type cultures, cultures from type localities, and morphologically well-characterized isolates as well as examining cultures from areas with few collections (e.g. tropical habitats and areas of the Southern

Hemisphere). Sequencing other previously described species should help to resolve some potential morphological synapomophies (e.g. curved merosporangiophores of the

Cornu Clade and Californica Clade) that appear in several clades that may share a common ancestor.

Culture collections will be useful in the future to make stronger inferences regarding the patterns of host preference among Syncephalis clades. Although we did not routinely sequence DNA from host fungi, it should be possible to make PCR primers to preferentially amplify and sequence host DNA. However, it is important to note the selective media in this study has limitations for observing natural host-parasite pairings.

Benomyl is a fungicide that, in addition to inhibiting most Dikarya, will also inhibit the growth of some known hosts of Syncephalis, particularly most species of Mortierella.

For this reason, collecting environmental sequence data may be useful to understand

the diversity and distribution of a wider diversity of Syncephalis species across the globe and in particular habitat types.

We demonstrated the utility of Syncephalis preferential primers in dual, host-parasite

DNA extractions. In the future we should attempt to use these primers on a more diverse pool of substrata such as DNA from soil, dung, and plant debris. We expect with the right preferential primers, we will recover more Syncephalis sequence diversity than studies implementing general eukaryotic or fungal primers, despite the tendency for species of Syncephalis to have longer than normal ITS sequences.

Future studies involving a close symbiosis, inconspicuous or microscopic organisms, and organisms with unknown DNA sequences, may benefit from strategies implemented in this study, such as finding ways to collect pure tissue, and sequence data in order to design lineage specific primers.

LIST OF REFERENCES

Bainier, G. (1883). Observations sur les Mucorinees. Ann. Sci. Nat. Bot. ser. 6 15:70- 104, pls. 17-19.

Baker, K. L. et al. (1977). Host range and axenic culture of the mycoparasite Syncephalis sphaerica (Mucoales). Mycologia 69:1008-1015.

Bawcutt, R. A. (1966). A study on an isolate of Syncephalis from Leicester, Durham theses, Durham University.

Bawcutt, R. A. (1983). Biology of Syncephalis leadbeateri sp. nov. (Mucorales) and observations on Syncephalis. Trans Brit. Myc. Soc. 80 (2), 219-230.

Benjamin, R. K. (1959). The merosporangiferous Mucorales. Aliso 4(2): 321-433.

Benjamin, R. K. (1966). The Merosporangium. Mycologia 58:1-42.

Benjamin, R. K. (1985). A novel new species of Syncephalis (Zoopagales: Piptocephalidaceae) from California that forms hypogenous merosporangia. Aliso 11(1):1-15.

Benny, G. L., Smith M. E., Kirk P. M., Tretter E. D., White M. M. (2016). Challenges and future perspectives in the systematics of Kickxellomycotina, Mortierellomycotina, Mucoromycotina, and Zoopagomycotina. In: Biology of Microfungi (D-W Li, ed.) Springer Press.pgs. 65-126. DOI 10.1007/978-3-319-29137-6_5

Benny, G. L., Ho, H. M., Smith, M. E., Lazarus, K. L. (in review). Five new species of the obligate mycoparasite Syncephalis (Zoopagales, Zoopagomycotina) from soil.

Benny, G. L. (2008). The methods used by Dr. RK Benjamin and other mycologists to isolate zygomycetes. Aliso. 26: 37-61.

Dade, H. A. (1937). New Gold Coast Fungi 1. Trans Brit. Myc. Soc. 21(1):16-28.

Darriba D., Taboada G. L., Doallo R. & Posada D. (2012). "jModelTest 2: more models, new heuristics and parallel computing". Nature Methods 9(8): 772.

Edgar, R. C. (2004). MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 32(5): 1792-1797.

Ellis, J.J. (1966). On growing Syncephalis in pure culture. Mycologia 58: 465-469.

Embree, R. W. (1963). Observations on Mortierella vesiculosa. Trans. Brit. Mycol. Soc. 46, 560-564.

Embree, R. W. (1965). A new species of Syncephalis (Mucorales). American Journal of Botany. 52: 737-741.

Gardes, M. & Bruns, T. D. (1993). Molecular tools for the identification of ectomycorrhizal fungi — taxon-specific oligonucleotide probes for suilloid fungi. Molecular Ecology, 2: 233–242.

Gouy, M. Guindon, S. & Gascuel., O. (2010). SeaView version 4: a multiplatform graphical user interface for sequence alignment and phylogenetic tree building. Molecular Biology and Evolution 27(2): 221-224.

Gruhn, U. & Petzold H. (1971). Two new species of Syncephalis (Zoopagales, Piptocephalidaceae). Can. J. Microbiol. 37: 355-360.

Guindon, S., Dufayard, J.F., Lefort, V., Anisimova, M., Hordijk, W., Gascuel, O. (2010). New Algorithms and Methods to Estimate Maximum-Likelihood Phylogenies: Assessing the Performance of PhyML 3.0. Systematic Biology. 59 (3): 307-321.

Ho, H. M. & Benny G. L. (2008). A new species of Syncephalis from Taiwan. Botanical Studies. 49: 45-48.

Ho, H. M. (2001). The Meerosporangiferous Fungi from Taiwan (I): Two New Records of Syncephalis. Taiwania, 46(4): 318-324.

Hoffman, K., Pawlowska, J., Walther, G., Wrzosek, M., De Hoog, G. S., Benny, G. L., Kirk, P. M., Voigt, K (2013). The family structure of the Mucorales: A synoptic revision based on comprehensive multigene-genealogies. Persoonia 30: 57-76

Hunter, W. E., & Butler, E. E. (1975). Syncephalis californica, a Mycoparasite Inducing Giant Hyphal Swellings in Species of Mucorales. Mycologia, 67(4): 863–872.

Indoh, H. (1962). Studies on the Japanese Mucorales. I. On the genus Syncephalis. Sc. Rep. T.K.D. Sect. B. Vol. II. No. 160.

Jeffries, P. (1985). Mycoparasitism within the Zygomycetes. Bot J Linnean Soc. 91:135- 150.

Kuhnert, R., Oberkofler, I., Peintner U. (2012). Fungal Growth and Biomass Development is Boosted by Plants in Snow-Covered Soil. Microbial Ecology 64:79-90.

Kuzuha, S. (1973). Notes on Japanese Syncephalis. Trans. Mycol. Soc. Japan 14: 237- 245.

Lanfear, R., Calcott, B., Ho, S. Y. W., Guindon, S. (2012). PartitionFinder: combined selection of partitioning schemes and substitution models for phylogenetic

analyses. Molecular Biology and Evolution 29 (6): 1695-1701. http://dx.doi.org/10.1093/molbev/mss020

Madden T. (2002). The BLAST Sequence Analysis Tool. 2002 Oct 9 [Updated 2003 Aug 13]. In: McEntyre J, Ostell J, editors. The NCBI Handbook [Internet]. Bethesda (MD): National Center for Biotechnology Information (US); 2002-. Chapter 16. Available from: http://www.ncbi.nlm.nih.gov/books/NBK21097/

Mehrotra, B. S. & Prasad, R. (1964). Syncephalis depressa from India. Mycologia. 56: 905-908.

Miller, M.A., Pfeiffer, W., and Schwartz, T. (2010) "Creating the CIPRES Science Gateway for inference of large phylogenetic trees" in Proceedings of the Gateway Computing Environments Workshop (GCE), 14 Nov. 2010, New Orleans, LA pp 1 - 8.

Moller, A. (1901). Phycomyceten und Ascomyceten. Botanische Mittheilungen aus den Tropen, 9: 1-319.

Morini, F. (1902). Contributo allo studio del gen. Syncephalis. Mem. R. Accad. Sci. Ist. Bologna, ser. 5, 9: 229-236.

Naumov (1939). Cles des Mucorinees (Mucorales). Encyclopedie Mycologique, 9, 1- 137. Paul Lechecalier, Paris.

Rambaut A, Suchard M. A., Xie D & Drummond A. J. (2014). Tracer v1.6, Available from http://beast.bio.ed.ac.uk/Tracer

Richardson, M. J. (2005). The occurrence and distribution of Piptocephalis, Syncephalis, and Chaetocladium species on dung. Mycol. Res.109(12): 1425- 1428.

Ronquist F., Teslenko M., Van der Mark P., Ayres D. L., Darling A., Höhna S., Larget B., Liu L., Suchard M. A., Huelsenbeck J. P. (2012). MrBayes 3.2: Efficient Bayesian Phylogenetic Inference and Model Choice Across a Large Model Space. Syst Biol. 61(3):539. doi:10.1093/sysbio/sys029.

Stamatakis, A. (2014). RAxML Version 8: A tool for Phylogenetic Analysis and Post- Analysis of Large Phylogenies. Bioinformatics 10.1093/bioinformatics/btu033 http://bioinformatics.oxfordjournals.org/content/early/2014/01/21/bioinformatics.bt u033.abstract

Talbot J. M., Bruns T. D., Taylor J., Smith D. P., Branco S., Glassman S. I., Erlandson S., Vilgalys R., Liao S., Smith M. E., Peay K. G. (2014). Endemism and functional convergence across the North American soil mycobiome. Proceedings of the

National Academy of Science. 111(17): 6341–6346 DOI:10.1073/pnas.1402584111

Tanabe, Y., Saikawa M., Watanabe, M. M., Sugiyama, J. (2004). Molecular phylogeny of Zygomycota based on EF-1a and RPB1 sequences: limitations and utility of alternative markers to rDNA. Mol Phylogenet Evol 30:438–449.

Tedersoo L, May TW, Smith ME. (2010). Ectomycorrhizal lifestyle in fungi: global diversity, distribution, and evolution of phylogenetic lineages. Mycorrhiza. 20: 217-263. DOI: 10.1007/s00572-009-0274-x

Thaxter, R. (1897). New or peculiar Zygomycetes. 2. Syncephalastrum and Syncephalis. Botanical Gazette. 24: 1-15.

Tieghem, P Van (1875). Nouvelles recherches sur les Mucorinees. Ann. Sci. Nat. Bot., ser. 6 1:5-175, pls. 1-4. (1876): Troisieme meoire sure les Mucorinees. 1. C. ser. 6 4: 312-398, pls. 10-13. And G. Le Monnier (1873): Recherches sur les Mucorinees. 1. C. ser. 5 17: 261-399, pls. 20-25.

Tretter E. D., E. M. Johnson, Y. Wang, P. Kandel, M. M. White. (2013). Examining new phylogenetic markers to uncover the evolutionary history of early-diverging fungi: comparing MCM7, TSR1 and rRNA genes for single- and multi-gene analyses of the Kickxellomycotina. Persoonia 30: 106-125.

Untergrasser A, Cutcutache I, Koressaar T, Ye J, Faircloth BC, Remm M, Rozen SG (2012). Primer3 - new capabilities and interfaces. Nucleic Acids Research 40(15): e115 Koressaar T, Remm M (2007) Enhancements and modifications of primer design program Primer3 Bioinformatics 23(10): 1289-91.

Vilgalys, R. & Hester, M. (1990). Rapid genetic identification and mapping of enzymatically amplified ribosomal DNA from several Cryptococcus species. J Bacteriol 172:4238–4246.

Vuillemin, P. (1902). Cepalidees. Bull. Mensuel séances Soc. Sci. Nancy, ser. 3 3: 21- 83. (1903): Le Syncephalis adunca sp. nov. et al serie des Cornutae. Ann. Mycol. 1: 420-427, pl. 8.

White, M. M., James, T. Y., O’Donnel, K., Cafaro, M. J., Tanabe, Y., Sugiyama, J. (2006). Phylogeny of the Zygomycota based on nuclear ribosomal sequence data. Mycologia 98(6): 872-884.

White, T., Bruns T., Lee S., Taylor J. (1990). Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR Protocols: A Guide to Methods and Applications 18: 315– 322.

Zhang T., Victor T. R., Rajkumar S. S., Li X., Okoniewski J. C., et al. (2014). Mycobiome of the Bat White Nose Syndrome Affected Caves and Mines Reveals Diversity of Fungi and Local Adaptation by the Fungal Pathogen Pseudogymnoascus (Geomyces) destructans. PLoS ONE 9(9): e108714. DOI: 10.1371/journal.pone.0108714

Zycha, H. (1935). Mucorine. in Kryptogamen-Flora der Mark Bradenburg. 6a, 1-264. Gebruder Borntraeger, Leipzig.

BIOGRAPHICAL SKETCH

Katherine Lazarus was born in Novi, Michigan. She received her Bachelor of

Science in plant biology in 2013 from the University of Michigan. While an undergraduate student at University of Michigan, she engaged in several self-motivated research projects involving fungal biology and molecular ecology, in the lab of Dr.

Timothy James. She wrote an undergraduate thesis and journal publication on the phylogenetic diversity and ecology of a group of cryptic, fungal relatives, the

Cryptomycota. She was also motivated early on to teach science, and lead discussion sections for introductory biology. Following graduation, she transitioned into the role of

Graduate Research Assistant upon the enrollment in the graduate program in the

University of Florida’s Plant Pathology Department, where she studied evolutionary biology in the lab of Dr. Matthew E. Smith. She also continued teaching introductory and graduate-level fungal biology. In the spring of 2016 she earned her Master of Science.

She will continue to pursue opportunities to engage in critical scientific thought, and has a particular dedication to public outreach including teaching and scientific illustration.