Persoonia 30, 2013: 106–125 www.ingentaconnect.com/content/nhn/pimj RESEARCH ARTICLE http://dx.doi.org/10.3767/003158513X666394

Examining new phylogenetic markers to uncover the evolutionary history of early-diverging fungi: comparing MCM7, TSR1 and rRNA genes for single- and multi-gene analyses of the

E.D. Tretter1, E.M. Johnson1, Y. Wang1, P. Kandel1, M.M. White1

Key words Abstract The recently recognised protein-coding genes MCM7 and TSR1 have shown significant promise for phylo­genetic resolution within the and , but have remained unexamined within other DNA replication licensing factor fungal groups (except for ). We designed and tested primers to amplify these genes across early-diverging fungal clades, with emphasis on the Kickxellomycotina, zygomycetous fungi with characteristic flared septal walls Kickxellomycotina forming pores with lenticular plugs. resolution and congruence with MCM7 and TSR1 were com- MCM7 pared against those inferred with nuclear small (SSU) and large subunit (LSU) rRNA genes. We also combined MS277 MCM7 and TSR1 data with the rDNA data to create 3- and 4-gene trees of the Kickxellomycotina that help to resolve MS456 evolutionary relationships among and within the core clades of this . Phylogenetic inference suggests ribosomal biogenesis protein that Barbatospora, Orphella, Ramicandelaber and Spiromyces may represent unique lineages. It is suggested that Trichomycetes these markers may be more broadly useful for phylogenetic studies among other groups of early-diverging fungi. TSR1 Article info Received: 27 June 2012; Accepted: 2 January 2013; Published: 20 March 2013.

Introduction of and Kickxellomycotina, as well as four species of have their genomes available The molecular revolution has transformed our understanding of (based on available online searches and the list at http://www. the evolutionary relationships between groups of fungi – with fungalgenomes.org). Furthermore, many early-diverging fungi examples of both artificial and natural clades being refuted will prove difficult to genome-sequence as they have not yet or recognised, respectively. However, in the early-diverging been cultured axenically and offer genomic DNA samples that fungi, the process has been only partially successful. Some are low in concentration and potentially contaminated with monophyletic groups have been broken up. For example, the host DNA. This is particularly true of the symbiotic members Chytridio­mycota had two other phyla, the Blastocladiomycota of the Entomophthoromycotina, Kickxellomycotina and Zoop­ and the , created for certain taxa previ- agomycotina, each of which has at least one major clade with ously belonging to it (James et al. 2006b, Hibbett et al. 2007). no member species yet successfully cultured. For this reason, The Zygomycota has been split into numerous subphyla finding powerful single-copy nuclear genes that can be amplified (Hibbett et al. 2007). However, the relationships between and and sequenced using current techniques (for available samples) sometimes within these groups have resisted efforts with exist- remains a reasonable phylogenetic option in pursuit of answers ing phylogenetic techniques for genes in broad usage. James et to critical evolutionary questions while also considering project al. (2006a) were unable to define well-supported relationships timeframes and budgets. between most of the basal groups, leading them to be regarded Fortunately, the wealth of information emerging from genomic as within the most recent reclassification of sequencing projects can be utilized concurrently to discover Fungi (Hibbett et al. 2007). Additional genes might provide candidate single-copy genes for such purposes. Using a bio- better support for phylogenetic analyses and understanding informatics approach, Aguileta et al. (2008) mined genomic of these evolutionary relationships, especially when combined sequences among Fungi to identify clusters of orthologous with increased taxon sampling. Ultimately, well-supported single-copy genes. Individual phylogenetic trees, inferred from phylogenies (depicted as trees) allow one to (re-)evaluate and the predicted protein sequences, were compared to a phylo- hopefully improve classification systems, as well as understand genetic tree based on a concatenated alignment of protein the ancient environmental pressures that have guided and sequences. Two genes, MS456 and MS277, demonstrated shaped fungal diversity. high topological congruence with the overall consensus tree While improving molecular techniques and phylogenomics using all of the genes in the study (Aguileta et al. 2008). MS456 undoubtedly will provide better evidence to address these corresponds to the MCM7 gene, a DNA replication licensing questions, the results may not be evident for some time. Firstly, factor that forms part of a hexameric protein complex required only a limited number of early-diverging taxa have been ge- for DNA replication (Moir et al. 1982, Kearsey & Labib 1998). nome sequenced. Efforts with additional taxa are in progress, MS277 corresponds to the TSR1 gene, a ribosome biogenesis but currently only three species of , one each protein (Gelperin et al. 2001). Although Aguileta et al. (2008) demonstrated the utility and 1 Boise State University, Department of Biological Sciences, Boise, Idaho, 83725-1515 USA; power of these two genes for phylogenetic analysis, neither corresponding author e-mail: [email protected]. primer sequences nor PCR protocols were provided. Schmitt

© 2013 Naturalis Biodiversity Center & Centraalbureau voor Schimmelcultures You are free to share - to copy, distribute and transmit the work, under the following conditions: Attribution: You must attribute the work in the manner specified by the author or licensor (but not in any way that suggests that they endorse you or your use of the work). Non-commercial: You may not use this work for commercial purposes. No derivative works: You may not alter, transform, or build upon this work. For any reuse or distribution, you must make clear to others the license terms of this work, which can be found at http://creativecommons.org/licenses/by-nc-nd/3.0/legalcode. Any of the above conditions can be waived if you get permission from the copyright holder. Nothing in this license impairs or restricts the author’s moral rights. E.D. Tretter et al.: Assessing MCM7 and TSR1 for Kickxellomycotina phylogenetics 107 et al. (2009) aligned amino acid sequences (from GenBank) to tunity to assess the inferred evolutionary relationships and design new degenerate primers to amplify regions of both history among members of the Kickxellomycotina, one of the MCM7 and TSR1. With these primers, they were able to first multi-gene phylogenies with such a focus (but also see sequence MCM7 and TSR1 for 42 species of lichenised as- Wang 2012). comycetes. The resulting phylogeny was well-resolved and demonstrated the potential use of these genes for other taxa. Materials and Methods Raja et al. (2011) performed additional testing of MCM7 among the Ascomycota and found that it resolved relationships more DNA samples used for this study were extracted according strongly than the ribosomal large subunit (LSU), one of the most to White (2006). Some samples were prepared from axenic commonly used genes within the ascomycetes. Morgenstern et cultures, whereas others were prepared from the dissection of al. (2012) generated a phylogeny using MCM7 sequences from host (Table 2). genome-sequenced fungi, which included some early-diverging taxa. Hermet et al. (2012) utilized both MCM7 and TSR1 in a PCR amplification study of Mucor, demonstrating the potential utility of the MCM7 and TSR1 genes outside of the . Despite the apparent MCM7 phylogenetic potential, beyond the Mucorales (Hermet et al. Initial attempts to amplify MCM7 were conducted using the 2012) these genes have not yet been investigated for their primers MCM7-709for and MCM7-1348rev of Schmitt et al. power to resolve relationships among the early-diverging fungi. (2009). PCR products from three taxa ( braziliensis, To address this and potentially improve our understanding Dipsacomyces acuminosporus and culisetae) were of evolution within this section of the fungal tree of life, we amplified successfully and sequenced using the same primers. attempted to amplify and sequence the MCM7 and TSR1 However, further attempts using these primers with other taxa genes for putative species within the Kickxellomycotina. This were unsuccessful. We subsequently designed new primers, subphylum is a diverse group, among which members may be assuming that the taxa of interest had primer sites that were not saprotrophic, mycoparasitic, or obligate symbionts of arthro- well-matched to the originals of Schmitt et al. (2009). pods. Natural affinities among its members have long been Specifically, using those three sequences (above) with others suspected on morphological grounds (Moss & Young 1978). from GenBank and several from genome-sequencing projects Some molecular-based studies (James et al. 2006a, Sekimoto published online (see Table 2), a reference alignment of MCM7 et al. 2011) have suggested it is monophyletic, whereas others protein sequences was compiled, spanning the Dikarya and (White et al. 2006a) have suggested the relationship between several groups of early-diverging fungi, that was used to design the Kickxellomycotina and closely related taxa may be more six new degenerate primers (Table 1). Two sets of primers were complex. Some studies, such as Tanabe et al. (2004), have been used for the majority of our data collection. One set uses the inconclusive, with different genes disagreeing on the monophyly Schmitt et al. (2009) primer MCM7-709for but with our reverse of the clade. Furthermore, the relationships between the four primer (MCM7-16r). The latter appeared to be more conserved orders (, , Harpellales and Kickxel­ amongst a greater diversity of taxa and worked well on the lales) that comprise the subphylum are not fully substantiated. majority of early-diverging fungi tested, except for members of Our primary goal was to assess the phylogenetic utility of MCM7 the Harpellales where a second set, MCM7-8bf and MCM7-16r, and TSR1 for these early-diverging fungal taxa. In so doing, we was compatible with the majority of the taxa tested from that compared these genes against a combined nuclear 18S and . Both primer combinations amplified a region of approxi- 28S rDNA phylogeny, with attention to tree congruence and mately 850 base pairs. resolution. Additionally, 3-gene (18S+28S+MCM7) and 4-gene The PCR reagents used for the MCM7-709for and MCM7- (18S+28S+MCM7+TSR1) phylogenies were examined to as- 1348rev primer combination included 11 µL of Promega Go- sess their use in combination. These data provide an oppor- Taq Green Hot Master Mix, 2.20 µL of each primer at 10 µM

Table 1 Primers used to amplify nuclear (SSU and LSU) rDNA or protein-coding genes (MCM7; TSR1), among the Kickxellomycotina and some other early- diverging fungi.

Primer name Gene Source Direction Sequence (5’–3’) Translated amino acid Length Degeneracy acid sequence (5’–3’)

MCM7-709for MCM7 Schmitt et al. 2009 For ACIMGIGTITCVGAYGTHAARCC TRVSDVKP 23 bp 481 MCM7-8bf MCM7 New for this study For GTIGCIGCITAYYTITGYGAY VAAYLCD 21 bp 16 MCM7-8af MCM7 New for this study For TGYGGIWSIGARGTITTYCARGA CGSEVFQ 23 bp 64 MCM7-1348rev MCM7 Schmitt et al. 2009 Rev GATTTDGCIACICCIGGRTCWCCCAT MGDPGVAKS 26 bp 242 MCM7-16r MCM7 New for this study Rev GTYTGYTGYTCCATIACYTCRTG HEVMEQQT 23 bp 32 TSR1-1018f TSR1 New for this study For AAYGARCARACITGGCCIACIGA NEQTWPT(D/E) 23 bp 8 TSR1-1492f TSR1 New for this study For TGGGAYCCITWYGARAAYYTICC WDP(Y/F)ENLP 23 bp 64 TSR1-2356r TSR1 New for this study Rev CAYTTCATRTAICCRTGIGTICC GTHGYMKC 23 bp 8 NS1AA SSU rDNA Wang 2012 For AAGCCATGCATGTCTAAGTATAA – 23 bp – SR1R SSU rDNA Vilgalys & Hester 1990 For TACCTGGTTGATYCTGCCAGT – 21 bp 2 NS8AA SSU rDNA Wang 2012 Rev TACTTCCTCTAAATGACCAAGTTTG – 25 bp – NS8 SSU rDNA White et al. 1990 Rev TCCGCAGGTTCACCTACGGA – 20 bp – ITS1F LSU rDNA Gardes & Bruns 1993 For CTTGGTCATTTAGAGGAAGTAA – 22 bp – ITS3 LSU rDNA White et al. 1990 For GCATCGATGAAGAACGCAGC – 20 bp – NL1 LSU rDNA O’Donnell 1993 For GCATATCAATAAGCGGAGGAAAAG – 24 bp – NL1AA LSU rDNA Wang 2012 For GAGTGAAGCGGGAAIAGCTCAAG – 23 bp – NL4 LSU rDNA O’Donnell 1993 Rev GGTCCGTGTTTCAAGACGG – 19 bp – LR5 LSU rDNA Vilgalys & Hester 1990 Rev TCCTGAGGGAAACTTCG – 17 bp – LR7AA LSU rDNA Wang 2012 Rev CCACCAAGATCTGCACTAGA – 20 bp – LR11 LSU rDNA Vilgalys lab page3 Rev GCCAGTTATCCCTGTGGTAA – 20 bp – 1 Degeneracy given by Schmitt et al. (2009) as 32 (three-fold degeneracies calculated as two-fold). 2 Degeneracy given by Schmitt et al. (2009) as 16 (three-fold degeneracies calculated as two-fold). 3 Available at http://www.biology.duke.edu/fungi/mycolab/primers.htm. 108 Persoonia – Volume 30, 2013 9 KC297632 KC297633 – – KC456420 KC297630 KC297631 – KC297629 KC297634 KC297635 KC297636 KC297637 KC297638 KC297639 KC297640 KC297641 – – KC297642 – – – – TSR1 24 Scaffold – KC297587 KC297588 KC297585 KC297586 KC297597 KC297583 KC297584 KC297596 KC297582 KC297589 JX155485 KC297590 KC297591 JX155486 KC297592 KC297593 KC297594 KC297598 KC297599 KC297595 KC297581 KC297601 JX155471 KC297602 MCM7 AACP01000247.1 AACP01000184.1 AACS02000002.1 AACS02000003.1 753037-756512 361829-364983 14 Scaffold 1 Scaffold KC297600 KC297566 – KC297569 KC297567 2079337 – JX155645 KC297571 28S AF453938 AF041494

7595-11423 3398-5725 40229-42782 EU840227.1 AACD01000102.1 AACD01000107.1 171606 2074749- KC297570 GenBank accession or genome identifier KC297614 NG_017182.1 AF368509.1 NG_027617.1 – KC297616 KC297617 DQ322626.1 KC297615 DQ273830.1 Supercontig 63 186963- Supercontig 63 164434- AMAG_00422.2 AMAG_17353.1 Supercontig 6 Supercontig 6 RO3G_11608 RO3G_12091.3 BR000310.1 BR000310.1 AAEY01000032.1 AAEY01000024.1 Supercontig NG_027619 BDEG_04439.1 BDEG_02071.1 AY635829.1 DQ273787.1 2081357 – JX155619 KC297619 18S CU329672.1 NC_003421.2 CU329671.1 CU329670.1 NC_001144.5 NC_001144.5 BK006936.2 BK006938.2 X62396 Supercontig NG_027618.1 SPPG_04788.3 SPPG_02880.2 M92991 800000-801950 804000-809666 106477-109288 4335584-4338189 11 Scaffold NG_017190.1 11 Scaffold NG_027559.1 5 Scaffold 121 Scaffold 3595-5518 121 Scaffold 81 Scaffold 24 Scaffold U77377.1 14 188674- 190464 32 115-2731 188875 2079534- KC297618

7f-16r 1018f-2356r NG_017183.1 NG_027647.1 7f-16r 7f-16r – – 7f-16r 1018f-2356r NG_017180.1 NG_027650.1 7f-16r 1018f-2356r NG_017164 NG_027644.1 7f-16r 1018f-2356r NG_017191.1 NG_027654.1 7f-16r – 7f-16r 1018f-2356r NG_017166.1 DQ273806.1 8bf-16r 8bf-16r 1492f-2356r 8bf-16r 1492f-2356r AF007537.1 8bf-16r 1492f-2356r AF007534.1 8bf-16r 1492f-2356r AF007539.1 8bf-16r 1492f-2356r AF031064.1 AF007538.1 8bf-16r 1492f-2356r AF031065.1 AF007541.1 1492f-2356r AF031066.1 AF007542.1 FJ517544.1 8bf-16r AF007543.1 AF031068.1 – DQ273810.1 NG_027560.1 8bf-16r 1492f-2356r AF007532.1 AF031069.1 – – – – – – – – 7f-16r –

8bf-16r – MCM7 TSR1 – – – – – – – – – –

– – – – – – – –

– – – – – – – – – – – – – – – – – – – – –

– 28S – – – – –

– – – –

Primer combination SR1R-NS8 ITS1F-NL4 8bf-16r 1492f-2356r – – – – – – NS1AA-NS8AA ITS1F-LR5 8bf-16r SR1R-NS8 – SR1R-NS8 NL1-LR11 – 7f-16r 1492f-2356r – NS1AA-NS8AA NL1AA-LR7AA NS1AA-NS8AA 8bf-16r NL1AA-LR7AA 8bf-16r – – – – – – – – – – – – – – –

– NS1AA-NS8AA NL1AA-LR7AA 8bf-16r – 18S – – – – –

– – – –

– – – – – – – – – – – – – – – – – – – –

– – – – –

– – – –

yes USA MMW no Norway yes MMW China yes – China – no no USA USA MMW NKR no Canada GenBank/MMW – –

– – –

no Norway MMW Culture Country Coll. no USA MMW

– – – – –

–

– – yes 5 5 5

4 3 3 3 sample – sample – sample yes sample – sample – sample – sample – sp. DNA DNA DNA DNA DNA DNA DNA Simulium vandalicum Heterodera glycines Paracapnia Heterodera glycines sequencing project sequencing project sequencing project

GenBank sequencing project

GenBank 6 A4 GenBank A-10835 AFTOL 1564 JGI sequencing project 28638 AFTOL 2808 AFTOL

1555 JGI sequencing project

7 TN-49-W4a NRRL ARS-2273 ARSEF3074 Adult Chironomidae AFTOL yes NRRL NRRL DUH0008925 AFTOL NRRL-2693 NRRL-2925 ARS Culture Collection NRRL-2642 ARS Culture Collection yes NRRL-3781 ARS Culture Collection yes NRRL-2810 ARS Culture Collection yes NRRL-3067 ARS Culture Collection yes NRRL-22631 ARS Culture Collection yes NOR-40-W10 ARS Culture Collection yes + W12 Leuctrid yes NS-34-W16 ARSEF 6175 Eggs/cysts, ARSEF 6176 Eggs/cysts, NRRL-1566 ARS Culture Collection yes

Brazil 2 AFTOL

CA-18-W17 ID-130-N5 Ephemeroptera Plecoptera NRRL

38327 ATCC Broad Institute 99-880 Broad Institute B-3501A GenBank 521 FGSC JEL423 Broad Institute okayama7#130 JEL318 AFTOL NRRL NOR-56-W1 Thaumaleidae Isolate # Source / Host CBS277.49 JGI sequencing project TN-22-W5B Thaumaleidae

972h- GenBank S288c GenBank DAOM BR117 Broad Institute

8

8

8

8 8

8

8

8 8 8

8

8 sp. Barbatospora ambicaudata Coemansia reversa Entomophaga conglomerata Entomophthora muscae Mucor circinelloides Conidiobolus coronatus Dimargaris bacillispora Coelomomyces stegomyiae Coprinopsis cinerea Kickxella alabastrina Dipsacomyces acuminosporus Martensiomyces pterosporus Linderina pennispora Spirodactylon aureum Spiromyces minutus Spiromyces aspiralis Orphella catalaunica Orphella dalhousiensis Ramicandelaber longisporus Ramicandelaber longisporus Coemansia braziliensis

Ustilago maydis Saccharomyces cerevisiae

Allomyces macrogynus Allomyces arbuscula

Bojamyces Capniomyces sasquatchoides Batrachochytrium dendrobatidis elegans Schizosaccharomyces pombe Aspergillus nidulans Cryptococcus neoformans

Rhizopus oryzae Phycomyces blakesleeanus

Spizellomyces punctatus Rhizophlyctis rosea Harpellomyces eccentricus and source, amplified with specific primer combinations. 2 Fungal species, isolate number, Table Species Harpellomyces montanus

E.D. Tretter et al.: Assessing MCM7 and TSR1 for Kickxellomycotina phylogenetics 109 Mycological – – – – – – – – – – – – – KC297651 – KC297649 KC297643 – – KC297650 – – – KC297652 – KC297653 – KC297645 – – – – – – – – – – KC297644 – KC297646 KC297647 KC297648 Kansas of MCB, Laia Guàrdia Valle; LGV, University the JX155469 JX155470 AEW26378.1 JX155452 JX155454 JX155443 JX155433 JX155468 JX155437 JX155442 JX155426 JX155423 JX155422 JX155474 KC297604 KC297603 JX155472 JX155421 KC297605 JX155473 JX155466 JX155467 JX155420 JX155475 JX155465 JX155481 JX155480 AEW26370.1 KC297606 JX155477 KC297607 KC297608 JX155478 KC297609 KC297610 KC297611 KC297612 JX155479 AEW26363.1 KC297613 AEW26366.1 AEW26371.1 AEW26374.1 from C. Ferrington, Jr.; isolates culturable Leonard LCF, – KC297568 JX155628 JQ302945 KC297572 KC297573 JX155646 JQ302956 JX155647 JQ302931 JX155651 JX155650 JQ302835 KC297574 JQ302943 KC297575 KC297576 JX155648 KC297577 KC297578 KC297579 KC297580 JX155649 DQ367494.1 DQ367512.1 JQ302939 from generated were – JQ302841 DQ367446.1 AF277043.1 AF277004.1 JQ302900 JQ302836 JQ302904 AF277014.1 JQ302913 AF277018.1 JQ302828 JQ302874 AF277037.1 AF277045.1 JX155634 JQ302823 AF277034.1 JQ302901 AF277041.1 JQ302912 AF277031.1 JQ302948 JQ302867 KC297620 AF277024.1 JQ302832 KC297621 AF277013.1 AF031074.1 JQ302882 AF277005.1 JQ302822 JQ302853 JX155624 KC297622 JQ302865 KC297623 JX155622 KC297625 KC297626 KC297627 KC297628 JX155623 - sequences was taken from isolate MS 115. was taken from isolate C13. the of JKM, JK Misra; JL, Joyce Longcore; Some The LSU rDNA The LSU rDNA Mazzucchelli; Reeves. K. 8bf-16r – 8bf-16r 8bf-16r – – 8bf-16r – 8bf-16r – 8bf-16r – 8bf-16r – 8bf-16r – 8bf-16r – 8bf-16r – 8af-16r – 8bf-16r 1492f-2356r DQ367456.1 JQ302921 8bf-16r 1492f-2356r DQ367451.1 EF396194.1 8bf-16r – 8bf-16r – 8bf-16r – 8bf-16r – 8bf-16r 1492f-2356r JQ302897 8bf-16r – 8bf-16r 1492f-2356r JQ302893 8bf-16r – 8bf-16r 1492f-2356r NG_017185.1 NG_027648.1 8bf-16r – 8bf-16r 8bf-16r 1492f-2356r 1492f-2356r AF277030.1 JQ302861 JQ302833 Will WKR, Maria Gabriela 30488, CBS 445.63”. Moss; NL1AA-LR7AA 8bf-16r – – – – NL1AA-LR7AA 8bf-16r – – – NL1AA-LR7AA 8bf-16r – – – – – – – – – – – – – – – – – – – – – Steve was not specified in GenBank. SM, B. Strongman; GM, – – – – – – – – NS1AA-NS8AA NL1AA-LR7AA 8bf-16r 1492f-2356r – NS1AA-NS8AA NL1AA-LR7AA 8bf-16r – NS1AA-NS8AA NL1AA-LR7AA 8bf-16r 1492f-2356r JX155620 – SR1R-NS8 NL1AA-LR7AA 8bf-16r 1492f-2356r JX155621 – – – NS1AA-NS8AA NL1AA-LR7AA 8bf-16r – NS1AA-NS8AA NL1AA-LR7AA 8bf-16r 1492f-2356r JX155625 NS1AA-NS8AA NL1AA-LR7AA NS1AA-NS8AA 8bf-16r NL1AA-LR7AA NS1AA-NS8AA 8bf-16r NL1AA-LR7AA – NS1AA-NS8AA 8bf-16r NL1AA-LR7AA NS1AA-NS8AA – 8bf-16r NL1AA-LR7AA – NS1AA-NS8AA 8bf-16r NL1AA-LR7AA NS1AA-NS8AA – 8bf-16r NL1AA-LR7AA – NS1AA-NS8AA 8bf-16r NL1AA-LR7AA – 8bf-16r – – – NS1AA-NS8AA NL1AA-LR7AA 8bf-16r – – – – – Lichtwardt; W. was taken from isolate “MUCL Robert RWL, The isolate used for the SSU rDNA The SSU rDNA (http://www.broadinstitute.org/). Lopez Lastra; DBS, Douglas Clarke; MIT in collaboration with the user community. (http://www.jgi.doe.gov/) (http://www.broadinstitute.org/). Paula PVC, yes USA RWL no Canada DBS no Norway RWL yes Australia KUMYCOL/RWL – yes Chile RWL yes USA RWL yes USA RWL no USA MMW yes USA KUMYCOL/RWL – no Norway RWL no USA GenBank/JKM – no USA MMW yes USA GenBank/RWL – yes Costa Rica RWL no Canada RWL yes Australia RWL no USA LCF no Canada MMW no Canada MMW no no Spain no USA no LGV Canada no USA no JKM DBS Canada no Norway no MMW DBS Norway RWL USA MMW MMW yes Malaysia CLL no Argentina LCF yes Australia LCF/BH no Canada DBS no Australia KUMYCOL – Beard; CLL, Claudia yes France KUMYCOL/RWL – no Australia RWL yes USA LCF Reynolds; yes USA KUMYCOL/RWL – ‘Eddie’ yes USA GenBank/RWL – no Canada MCB no Canada MCB yes USA KUMYCOL/CEB – Nicole sp. yes Argentina LCF

sp. yes USA LCF/MMW – sp. yes Australia LCF/BH sp. sp. sp. sp. sp. NKR, Prosimulium White; Elliptera astigmatica Paraheptagyia Chironomus Corynoneura Dicrotendipes fumidus Simulium vittatum Anopheles hilli Cricotopus Cricotopus Baetis rhodani Antocha sp. Allocapnia mixtum ovarian cysts inextentus nr. Tanytarsus sp. Tanytarsus mixtum ovarian cysts Chironomus mixtum ovarian cysts Paracapnia angulata Culiseta impatiens Aedes crinifer Psectrocladius sordidellus Orthocladius 2012 study). with Wang this study (or as joint effort Merlin Adult in silico testing. MMW, Sequencing Project, Broad Institute of Harvard and MIT TN-3-16 Chironomidae RMBL-31-1 ARG-24-2F NOR-58-10 LCF-BT-1 KS-F1-3 NS-X-10 Chironomidae SC-DP-2 AUS-X-1 CHI-27-1 KS-6-6 Chironomidae RMBL-13-41 NOR-35-1 NF-MC-15 Adult Prosimulium UT-1-W16a OR-8-W10 Tipulidae MIS-21-127 KS-1-2 Chironomidae NF-15-5A AUS-77-4 KS-19-M23 Capniidae AUS-126-30 CR-143-8 Simuliidae NF-MC-18 Adult Prosimulium LCF#3 Dixidae ALG-10-W3 43-1-2 Trichoptera ALG-13-W1 Trichoptera NS-X-2 SPA-X-40 NH-1-M869a Nemoura PEI-X-6 Isopoda CA-10-W15 PEI-X-4 Ephemeroptera Ephemeroptera NOR-31-2 NOR-7-W12 Ephemerellidae Siphloneuridae OR-11-W8 Simuliidae COL-18-3 Ephemeroptera MAL-X-1 ARG-15-6F Scirtidae FRA-12-3 41-1-6 32-1-8 Orthocladiinae Cafaro; J. Alen Rizzo; BH, Barb Hayford; CEB, Charles bold were generated for AR, Matías sp. (cysts) MJC, sp. nov. sp. sp. sp. sp. sp. tricho Trichopteran tricho Trichopteran Colbo; sp. or Pennella sp. was not available from the genome sequencing project, so data from other isolates was used. was not available from the genome sequencing project, so data from other isolates was used. Amy Slaymaker; Culture Collection, represented as KUMYCOL. Data derived from Rhizopus oryzae Species used for initial primer design and Murray AS, Accession numbers in Data derived from Origins of Multicellularity Sequencing Project, Broad Institute of Harvard and These sequence data were produced by the US Department of Energy Joint Genome Institute rDNA rDNA Trichozygospora chironomidarum Trichozygospora Smittium tipulidarum Smittium tronadorium Stachylina lentica Smittium orthocladii Smittium gravimetallum Stachylina Smittium megazygosporum Smittium morbosum Smittium cylindrosporum Smittium commune Smittium coloradense Graminella microspora Caudomyces Caudomyces Capniomyces stellatus 1 2 3 4 5 6 7 8 Smittium caudatum Harpella melusinae Furculomyces boomerangus Genistelloides hibernus Smittium angustum Smittium annulatum Harpella Pseudoharpella arcomylica Unnamed Smittium culicis Unnamed Lancisporomyces falcatus Lancisporomyces vernalis Legerioides tumidus Legeriomyces minae Legeriosimilis Legeriomyces Legeriosimilis Pennella Pteromaktron sp. Smittium culisetae Smittium culisetae Coleopteromyces amnicus Smittium mucronatum Smittium simulii Austrosmittium sp. 110 Persoonia – Volume 30, 2013

concentration, 0.44 µL of 25 mM MgCl2 (to a total concentration Electrophoresis and sequencing of 2.5 mM), 4.16 µL dH2O, and 2 µL of genomic DNA. Cycling For all amplified sequences, the PCR product was electro- conditions used an initial denaturation step of 95 °C for 2 min, phoresed in 1 % Lonza Seaplaque GTG agarose (low EDTA 1X 45 cycles of 95 °C for 30 s, annealing at 56 °C for 45 s, and TAE buffer), stained with Gelstar nucleic acid stain (Cambrex), extension at 72 °C for 1 min 15 s, a final extension at 72 °C and visualized on a Clare Chemical DR46B transilluminator. for 10 min, followed with a final hold step at 4 °C. Reagents Bands of the appropriate size were excised with medium sized for the MCM7-8bf and MCM7-16r primer were identical except pipet tips (pre-cut by a few mm to increase the bore necessary that 0.35 µL of 50 µg/µL BSA was added (while reducing the for bands being cut) and DNA was extracted using a ‘freeze water by an equal amount). Cycling conditions included an and squeeze’ method. Briefly, pipet tips with excised gel cores initial denaturation step of 95 °C for 2 min, with 45 cycles of were placed in a 1.5 mL microcentrifuge tube, frozen at -20 °C, denaturation at 95 °C for 30 s, annealing at 50 °C for 45 s, and spun at 14500´G for 10 min, frozen again at -20 °C again, extension at 72 °C for 1.5 min, followed by a final extension step and similarly centrifuged once more. Cycle sequencing reac- at 72 °C for 10 min, before a final hold at 4 °C. tions were set up using the Applied Biosystems BigDye v. 3.1 kit for bidirectional sequencing. The resulting products were TSR1 sent to the University of Wisconsin Madison Biotechnology As with the MCM7, except with greater sequence variation of the Centre for capillary electrophoresis. TSR1 gene, a reference alignment was prepared but used first to conduct in silico testing before attempting amplifications of it. Phylogenetic analyses Specifically, the translated protein sequences of both primers DNA sequences were first aligned using the MUSCLE algorithm were compared visually to the translated protein sequences in (Edgar 2004) and then imported into Mesquite (Maddison & the alignment to assess their conservation and putative com- Maddison 2011) for final manual adjustment. Introns were patibility. Again, sequences from GenBank and various ge- removed from the MCM7 sequences via visual inspection for nome sequencing projects (see Table 2) were used to make translation into hypothetical proteins. For the MCM7 protein this initial assessment. When published primers (Schmitt et al. alignment, the reading frame was designated and set, and the 2009) did not appear compatible with the early-diverging fungi, nucleotide sequences translated into proteins. This protein based on estimated compatibility with the Blastocladiomycota, alignment was then re-aligned with MUSCLE (Edgar 2004). Re- Chytridiomycota and Mucoromycotina, the closest relatives to gions of poor or ambiguous alignment were manually removed. the Kickxellomycotina for which we had data, we considered Each of the alignments was tested using an appropriate model the development of new primers. Ultimately, three new primers selection program. The 18S and 28S nucleotide sequences, as were developed and tested (Table 1). One set (TSR1-1018f with well as each of the three individual codon positions of the MCM7 TSR1-2356r) successfully amplified products 1250–1300 bp nucleotide alignment, were tested with jModelTest (Guindon & for most non-harpellid Kickxellomycotina. The other set (TSR1- Gascuel 2003, Posada 2008). Model selection was based on 1492f to TSR1-2356r) generated fragments from 700–800 bp the corrected AIC (AICc) score. For all sequences tested, except but was more broadly compatible within the Kickxellomycotina. for the 2nd codon position of the MCM7 nucleotide alignment, Since the latter products were generated entirely from within the the GTR+ Γ+I method had the highest AICc score. For the 2nd range of the gene region amplified by the other set, only this codon position, the GTR+ Γ model was slightly higher; however, shorter region was used within the analysis (longer sequences for simplicity of analysis, the GTR+ Γ+I model was used in all were truncated accordingly). cases. The ProtTest programme (Drummond & Strimmer 2001, Guindon & Gascuel 2003, Abascal et al. 2005) was used on rRNA genes preliminary MCM7 and TSR1 datasets to determine the best Ribosomal RNA gene sequences were amplified and sequenc­ model of amino acid evolution for these genes. The LG+ Γ+I ed as well as obtained from GenBank (Table 2). Wang et al. model, described by Le & Gascuel (2008), consistently received (2013) developed primers for both the small rDNA subunit (18S), the highest score and was used. specifically primers NS1AA and NS8AA, and the large subunit Phylogenetic inference was conducted through both the Maxi­ (28S), with primers NL1AA and LR7AA. Those primers were mum-Likelihood (ML) method and Bayesian inference (BI). The specifically designed to avoid amplification of host DNA from Bayesian tree was used as the primary tree for all analyses, with mixed genomic DNA samples, a situation that is not uncommon the Maximum-Likelihood results offered as well, considering when fungi are prepared as micro-dissections from possible Bayesian overestimation of branch supports (Suzuki digestive tracts. PCR reagents used for the NS1AA and NS8AA et al. 2002). MrBayes v. 3.1.2 was used for Bayesian inference primer combination included 11 µL of Promega Go-Taq Green (Huelsenbeck & Ronquist 2001, Ronquist & Huelsenbeck 2003, Master Mix, 0.66 µL of each primer at 10 µM concentration, Altekar et al. 2004). The LG+ Γ+I model of protein evolution,

0.88 µL of 25 mM MgCl2 (to a final concentration of 2.5 mM), mentioned above, is not implemented natively in MrBayes

0.35 µL of 50 µg/µL BSA, 6.45 µL dH2O, and 2 µL of genomic v.3.1.2 and was done by setting a fixed GTR model and us- DNA. Cycling conditions included an initial denaturation step ing the LG exchange matrix and equilibrium frequencies as a of 95 °C for 2 min, 45 cycles of denaturation at 95 °C for 30 s, dirichlet prior. The online version of AWTY was used to assess annealing at 62 °C for 45 s, and extension at 72 °C for 3 min, tree convergence (Wilgenbusch et al. 2004). GARLI v. 2.0 was with a final extension step at 72 °C for 10 min and a final hold used for maximum-likelihood calculations (Zwickl 2006). at 4 °C. The PCR cocktail used for the NL1AA and LR7AA Nine analyses were performed: MCM7 nucleotide, MCM7 pro- primer combination included 11 µL of Promega Go-Taq Green tein, TSR1 protein, 18S, 28S, nuclear 18S + 28S, 3-gene (18S Hot Master Mix, 0.66 µL of each primer at 10 µM concentration, + 28S + MCM7 protein), 4 gene (18S + 28S + MCM7 protein +

0.44 µL of 25 mM MgCl2 (to a total concentration of 2.5 mM), TSR1 protein) and 18S + 28S for the taxa in the TSR1 protein

2.20 µL of 5M Betaine, 0.35 µL of 50 µg/µL BSA, 4.69 µL dH2O, alignment only. For the MCM7 nucleotide tree, each codon and 2 µL of genomic DNA. Cycling conditions included an initial position was treated as an independent partition. For all trees, denaturation step of 95 °C for 2 min, 45 cycles of denaturation different genes were always treated as unlinked partitions. For at 95 °C for 30 s, annealing at 56 °C for 45 s, and extension all trees, 10 mil generations (BI) and 100 bootstrap replicates at 72 °C for 3 min, with a final extension at 72 °C for 10 min (ML) were performed, with half of the BI generations treated followed by a final hold at 4 °C. as burn-in. E.D. Tretter et al.: Assessing MCM7 and TSR1 for Kickxellomycotina phylogenetics 111

55.9% Aspergillus nidulans FGSC A4 Ascomycota MCM7 Protein Tree 99.9% MCM7 Protein Tree 54 Saccharomyces cerevisiae S288c 85 69.1% Schizosaccharomyces pombe 972h- 100.0% 40 Mucor circinelloides CBS277.49 Mucoromycotina 100.0% 95 Rhizopus oryzae 99-880 74.0% 100 Phycomyces blakesleeanus NRRL 1555 44 83.1% Coprinopsis cinerea Okayama 7 #130 Basidiomycota 100.0% 62 Ustilago maydis 521 73 Cryptococcus neoformans B-3501A

97.5% Dimargaris bacillispora NRRL 2808 Dimargaritales 100.0% 59 Ramicandelaber longisporus ATCC 6175 Ramicandelaber 100 Ramicandelaber longisporus ATCC 6176 Barbatospora ambicaudata TN-49-W4a Barbatospora

100.0% 94.4% Spiromyces minutus NRRL-3067 58 Spiromyces 86 Spiromyces aspiralis NRRL-22631 100.0% Orphella catalaunica NOR-40-W10 + W12 92 Orphella dalhousiensis NS-34-W16 Orphella

99.9% 100.0% Coemansia reversa NRRL 1564 98.2% 100 Coemansia braziliensis 74 NRRL-1566 53.0% 75 Spirodactylon aureum NRRL-2810 26 53.5% Kickxella alabastrina 100.0% NRRL-2693 31 Linderina pennispora NRRL-3781 100 96.8% Dipsacomyces acuminosporus NRRL-2925 86.4% 58 Martensiomyces pterosporus NRRL-2642 48 100.0% Harpellomyces montanus TN-22-W5B 90.3% 98 Harpellomyces eccentricus NOR-56-W1 Harpellales 73 100.0% Caudomyces sp. nov. OR-8-W10 100 Caudomyces sp. nov. UT-1-W16a Bojamyces sp. CA-18-W17

80.4% Capniomyces sasquatchoides ID-130-N5 100.0% 63 Legeriosimilis sp. CA-10-W15 99.9% 100 Legeriosimilis sp. NOR-31-2 59.8% 78 Legerioides tumidus NH-1-M869a 57.5% 32 100.0% 99.8% 99.7% Legeriomyces minae PEI-X-6 - 99 85 82 Legeriomyces sp. nov. PEI-X-4

92.5% Capniomyces stellatus MIS-21-127 100.0% 100.0% 73 Trichopteran trichomycete ALG-13-W1 81 100 Trichopteran trichomycete ALG-10-W3 66.5% Graminella microspora NOR-35-1 98.9% 73.5% - Pteromaktron sp. OR-11-W8 66 - 100.0% Smittium culisetae COL-18-3 100 Smittium culisetae MAL-X-1

60.0% 99.9% Genistelloides hibernus KS-19-M23 50.8% - 94 Lancisporomyces falcatus NS-X-2 72.7% 79 Lancisporomyces vernalis SPA-X-40

100.0% 39 100.0% Harpella-like (cysts) NF-MC-15 100.0% 99 100 Harpella melusinae (cysts) NF-15-5A 100 100.0% Harpella sp. (cysts) NF-MC-18 100 Pennella sp. NOR-7-W12 100.0% Furculomyces boomerangus AUS-77-4 100 Smittium angustum AUS-126-30 92.1% Smittium culicis 43-1-2 97.4% 68 Smittium annulatum CR-143-8 57 Smittium coloradense RMBL-13-41 100.0% Smittium mucronatum FRA-12-3 100 Austrosmittium sp. 32-1-8 Smittium caudatum KS-1-2

80.9% Smittium simulii 41-1-6 76.8% 92.9% 91 Smittium commune KS-6-6 96.4% 92.0% - 52.2% 84 Trichozygospora chironidarum TN-3-16 44 32 20 79.9% Smittium cylindrosporum CHI-27-1 84.2% 100.0% 41 Smittium orthocladii LCF-BT-1 16 100.0% 100 Smittium tronadorium ARG-24-2F Pseudoharpella arcomylica 80 LCF 3 99.8% 91.3% Coleopteromyces amnicus ARG-15-6F

76 38 Smittium tipulidarum RMBL-31-1 100.0% Smittium gravimetallum KS-F1-3 98.3% 100 Smittium megazygosporum SC-DP-2 37 100.0% Smittium morbosum AUS-X-1 100.0% 99 Stachylina lentica NOR-58-10 100 Stachylina sp. NS-X-10 100.0% Conidiobolus coronatus NRRL 28638 Entomophthoromycotina 100.0% 97 Entomaphaga conglomerata ARS-2273 97 Entomophthora muscae ARSEF3074 NRRL A-10835 100.0% Allomyces macrogynus ATCC 38327 Blastocladiomycota 100.0% 99 Allomyces arbuscula Brazil 2 100 Coelomomyces stegomyiae DUH0008925 Batrachochytrium dendrobatidis JEL423 Chytridiomycota 100.0% Spizellomyces punctatus DAOM BR117 95 Rhizophlyctis rosea JEL318

Fig. 1 Phylogeny of the Kickxellomycotina and other fungal taxa based on an alignment of MCM7 translated protein sequences. Tree is based on a 50 % majority-rules consensus of 10k trees produced with Bayesian inference (5k used as burn-in). Numbers above branches are Bayesian posterior probabilities. Numbers below branches are maximum-likelihood bootstrap supports produced from 100 bootstrap replicates. Bold branches are highly supported (> 95 % BPP and > .70 MLBP). 112 Persoonia – Volume 30, 2013

TSR1 Protein Tree 97% Aspergillus nidulans FGSC A4 Ascomycota TSR1 Protein 100% 73 Saccharomyces cerevisiae S288c 98 100% Schizosaccharomyces pombe 972h- Tree 99% Coprinopsis cinerea Basidiomycota 70 Okayama 7 #130 80% 83 Ustilago maydis 521 77 Cryptococcus neoformans B-3501A 65% 100% Mucor circinelloides CBS277.49 Mucoromycotina 100% - 87 Dimargaris bacillispora NRRL 2808 (Host Sequence?) 100% 95 Rhizopus oryzae 99-880 99 Phycomyces blakesleeanus NRRL 1555 Rhopalomyces elegans NRRL A-10835 Zoopagomycotina Ramicandelaber longisporus ATCC 6175 Ramicandelaber Barbatospora ambicaudata TN-49-W4a Barbatospora 100% Coemansia reversa 85% NRRL 1564 100% Kickxellales 100 40 Coemansia braziliensis NRRL-1566 100 Spirodactylon aureum NRRL-2810 74% 100% Kickxella alabastrina 48 NRRL-2693 100% 74 96% Dipsacomyces acuminosporus NRRL-2925 86 44 Martensiomyces pterosporus NRRL-2642 Linderina pennispora NRRL-3781 100% 99% Spiromyces minutus NRRL-3067 100% Spiromyces 97 90 Spiromyces aspiralis NRRL-22631 75 100% Caudomyces sp. nov. OR-8-W10 Harpellales 86% 100 Caudomyces sp. nov. UT-1-W16a 51 100% Smittium culisetae COL-18-3 52% 99% 100 Smittium culisetae MAL-X-1 23 49 100% Genistelloides hibernus KS-19-M23 52% Capniomyces stellatus MIS-21-127 100% 89% 84 44 72 57 Trichopteran trichomycete ALG-13-W1 100% Harpella melusinae (cysts) NF-15-5A

100 Smittium simulii 41-1-6 100% Smittium culicis 43-1-2 99 Smittium mucronatum FRA-12-3 Entomophthora muscae ARSEF3074 Entomophthoromycotina 53% 100% Allomyces macrogynus ATCC 38327 Blastocladiomycota 24 100% 100 Allomyces arbuscula Brazil 2 90 Coelomomyces stegomyiae DUH0008925 Spizellomyces punctatus DAOM BR117 Chytridiomycota Batrachochytrium dendrobatidis JEL423

Fig. 2 Phylogeny of the Kickxellomycotina based on an alignment of TSR1 translated protein sequences. The method of tree calculation and the tree format are the same as Fig. 1.

A total of nine topologies were produced by our analyses (Fig. (on the 5’ end) of the MCM7 gene. Several clades within the 1–5 and S1–S4). Six of the analyses used a large number of Kickxellomycotina appear to be variable at the MCM7-709f prim- taxa (76–81) and were primarily intended to investigate the ing site. For these orders, the MCM7-8bf forward primer, which use of MCM7, whereas three of the analyses used a smaller is further downstream, appears to have a higher success rate number (38–39) and were intended to evaluate the use of TSR1 but is also specific to the Kickxellomycotina and is not recom- and the combined four-gene analysis (see Table 2). For all of mended for use with other clades. Both primer combinations the analyses, branches were considered well-supported (and appear to work well for genomic samples derived from axenic shown in figures with heavy bold lines) if they had a Bayesian cultures, but sometimes amplify bacterial genes in vouchers posterior probability (BPP) of > 0.95 and a maximum-likelihood prepared from dissected guts. Additionally they occasion- bootstrap proportion (MLBP) of > 0.70. ally amplify host MCM genes, although not MCM7. For example, the MCM2 gene for the host arthropod was amplified in a few of Results our attempts from mixed genomic samples. These issues are similar to those we observe for primers used to amplify other We report 68 new MCM7 sequences, 26 new TSR1 sequences, genes used for phylogenetic studies, such as RPB1 and RPB2, and 46 new rDNA sequences (Table 2) for a variety of taxa when used under similar conditions. Schmitt et al. (2009) did not within the early-diverging fungal lineages. We amplified most report any size variation or introns within their MCM7 dataset. of the lineages tested with at least one primer combination for However, we observed spliceosomal introns for some species each gene. Recommended primer combinations for MCM7 within the Blastocladiomycota, Chytridiomycota, Entomoph­ (Table 3) and TSR1 (Table 4) are provided for each primer thoromycotina, Kickxellomycotina and Zoopagomycotina. No and clade tested. pattern was observed regarding intron position or presence. For MCM7, primer combination MCM7-709f and MCM7-16r The largest fragment sequenced in this study was 1139 bp, was effective for most taxa, with the exception of the Harpel­ about 300 bp larger than the observed average size, within lales. MCM7-16r appeared to be more conserved than MCM7- our study, of 850 bp (for primers MCM7-709 and MCM7-16r). 1348rev, amplifies a larger region, and is highly conserved We also experienced minor size variation (~10 aa) within the and therefore useful for placing distantly related taxa. Fewer translated amino acid sequences. Our alignment also had a spurious bands were noted in PCR attempts with MCM7-16r. small ambiguously aligned region (approx. 15 aa) which was We were unable to develop a primer closer to the beginning excluded from analysis. E.D. Tretter et al.: Assessing MCM7 and TSR1 for Kickxellomycotina phylogenetics 113

100.0% Aspergillus nidulans FGSC A4 Ascomycota Nuclear SSU + LSU Tree 100.0% Nuclear SSU + LSU Tree 95 Saccharomyces cerevisiae S288c 100 94.3% Schizosaccharomyces pombe 972h- 99.8% 68 Coprinopsis cinerea (mixed strains) Basidiomycota 100.0% 85 Cryptococcus neoformans B-3501A 100.0% 87 Ustilago maydis (mixed strains) 79 100.0% Mucor circinelloides CBS277.49 Mucoromycotina 100.0% 80.4% 100 Rhizopus oryzae 99-880 100 - Phycomyces blakesleeanus NRRL 1555 69.7% Rhopalomyces elegans NRRL A-10835 Zoopagomycotina 94.1% 77 Ramicandelaber longisporus ATCC 6175 Ramicandelaber 56 Dimargaris bacillispora NRRL 2808 Dimargaritales Barbatospora ambicaudata TN-49-W4a Barbatospora 99.9% Coemansia reversa NRRL 1564 100.0% 86 Spirodactylon aureum NRRL-2810 Kickxellales 70.5% 100 Coemansia braziliensis NRRL-1566 94.0% - 93.9% Kickxella alabastrina NRRL-2693 100.0% 62 62 Linderina pennispora NRRL-3781 100 71.1% Dipsacomyces acuminosporus 100.0% NRRL-2925 - Martensiomyces pterosporus NRRL-2642 100 100.0% 100.0% Orphella catalaunica NOR-40-W10 + W12 Orphella 91 100 Orphella dalhousiensis NS-34-W16 100.0% Spiromyces minutus NRRL-3067 100 Spiromyces aspiralis NRRL-22631 Spiromyces Harpellomyces montanus TN-22-W5B Harpellales 100.0% Bojamyces sp. CA-18-W17

68 71.9% Capniomyces sasquatchoides sp. nov. ID-130-N5 100.0% 53 Legeriomyces minae PEI-X-6 88.6% 100 Legeriomyces sp. nov. PEI-X-4 100.0% 38 95.2% Legerioides tumidus NH-1-M869a 98 58 Legeriosimilis sp. CA-10-W15 Legeriosimilis sp. NOR-31-2 100.0% 99.9% Capniomyces stellatus MIS-21-127 51.4% 50 100.0% 89 Trichopteran trichomycete ALG-13-W1 91.2% - 100 Trichopteran trichomycete ALG-10-W3 44 100.0% Graminella microspora NOR-35-1 100.0% 92 Pteromaktron sp. OR-11-W8

99.4% 100 99.4% Smittium culisetae COL-18-3 67 100 Smittium culisetae MAL-X-1 100.0% Pennella sp. NOR-7-W12 90 72.8% 99.8% 100.0% Genistelloides hibernus KS-19-M23 100.0% 36 68 Lancisporomyces falcatus 83 NS-X-2 100 Lancisporomyces vernalis SPA-X-40 Harpella-like (cysts) NF-MC-15 100.0% Harpella melusinae (cysts) NF-15-5A 100 Harpella sp. (cysts) NF-MC-18 94.9% Smittium culicis 43-1-2 95.3% 81 Smittium annulatum CR-143-8

100.0% - 81.6% Smittium mucronatum FRA-12-3 - Smittium coloradense 93.6% 74 RMBL-13-41 - Smittium caudatum KS-1-2 Smittium simulii 41-1-6 99.2% Smittium commune KS-6-6 87 Trichozygospora chironidarum TN-3-16 63.9% 83.6% Smittium cylindrosporum CHI-27-1 - 100.0% - Smittium gravimetallum KS-F1-3 52.6% 100 Smittium megazygosporum SC-DP-2 95.4% - 72.3% Smittium orthocladii LCF-BT-1 100.0% - 84 Smittium tronadorium ARG-24-2F 100.0% 100 Coleopteromyces amnicus ARG-15-6F 93 Smittium tipulidarum RMBL-31-1 Pseudoharpella arcomylica LCF 3 100.0% Caudomyces sp. nov. OR-8-W10 74.4% 100 Caudomyces sp. nov. UT-1-W16a 46 100.0% Smittium morbosum AUS-X-1 90 Stachylina lentica NOR-58-10 100.0% Furculomyces boomerangus AUS-77-4 100 Smittium angustum AUS-126-30 100.0% Conidiobolus coronatus NRRL 28638 Blastocladiomycota 97 Entomophthora muscae ARSEF3074 90.9% 100.0% Allomyces macrogynus 55 ATCC 38327 Entomophthoromycotina 100.0% 100 Allomyces arbuscula Brazil 2 97 Coelomomyces stegomyiae DUH0008925

100.0% Batrachochytrium dendrobatidis JEL423 Chytridiomycota 100.0% 90 Spizellomyces punctatus (mixed strains) 90 Rhizophlyctis rosea JEL318

Fig. 3 Phylogeny of the Kickxellomycotina based on a concatenated alignment of nuclear small subunit (SSU) and nuclear large subunit (LSU) rDNA. Tree is based on a 50 % majority-rules consensus of 10k trees produced with Bayesian inference (5k used as burn-in). Numbers above branches are Bayesian posterior probabilities. Numbers below branches are maximum-likelihood bootstrap supports produced from 100 bootstrap replicates. Bold branches are highly supported (> 95 % BPP and > .70 MLBP).

For TSR1, primer combination TSR1-1018f–TSR1-2356r work- Kickxellomycotina, TSR1-1492f and TSR1-2356r appears to ed best for members of the Blastocladiomycota, Entomoph­ work for most clades. TSR1-1018f and TSR1-2356r works for thoromycotina and Zoopagomycotina. In our view, it is prefer- many groups, except for the Harpellales. able over TSR1-1492f–TSR1-2356r because it amplifies a Schmitt et al. (2009) did report the presence of both introns and larger region. This region appears to be more conserved and hypervariable regions within TSR1, and both of these phenom- is recommended for the Chytridiomycota, which we found did ena were observed within our sample set as well. Introns often not have the correct primer site for TSR1-1018f. Within the occurred within highly variable sections of the gene that were 114 Persoonia – Volume 30, 2013 Nuclear SSU + LSU 100.0% Aspergillus nidulans FGSC A4 Ascomycota Nuclear SSU + LSU 100.0% 84 Saccharomyces cerevisiae S288c + MCM7 Protein Tree 100 + MCM7 Protein Tree 98.7% Schizosaccharomyces pombe 972h- 99.3% 72 Coprinopsis cinerea (mixed strains) Basidiomycota 100.0% 84 Cryptococcus neoformans B-3501A 100.0% 99 Ustilago maydis (mixed strains) 90 100.0% Mucor circinelloides CBS277.49 Mucoromycotina 100.0% 100 Rhizopus oryzae 99-880 100 Phycomyces blakesleeanus NRRL 1555 66.7% Rhopalomyces elegans NRRL A-10835 Zoopagomycotina 68.7% - 99.7% Dimargaris bacillispora NRRL 2808 Dimargaritales - 52 Ramicandelaber longisporus ATCC 6175 Ramicandelaber Barbatospora ambicaudata TN-49-W4a Barbatospora 100.0% Coemansia reversa NRRL 1564 100.0% 100 Coemansia braziliensis NRRL-1566 Kickxellales 100.0% 100 Spirodactylon aureum NRRL-2810 100.0% 81 99.9% Kickxella alabastrina NRRL-2693 78 42 100.0% Linderina pennispora NRRL-3781 100 86.5% Dipsacomyces acuminosporus 100.0% NRRL-2925 - Martensiomyces pterosporus NRRL-2642 100 100.0% 100.0% Orphella catalaunica NOR-40-W10 + W12 Orphella 88 100 Orphella dalhousiensis NS-34-W16 100.0% 100.0% Spiromyces minutus NRRL-3067 Spiromyces 97 100 Spiromyces aspiralis NRRL-22631

100.0% Harpellomyces montanus TN-22-W5B 100.0% 42 Caudomyces sp. nov. OR-8-W10 Harpellales 100 Caudomyces sp. nov. UT-1-W16a Bojamyces sp. CA-18-W17

78.2% Capniomyces sasquatchoides sp. nov. ID-130-N5 100.0% - Legeriomyces minae PEI-X-6 100.0% 100 Legeriomyces sp. nov. PEI-X-4 100.0% 89 61.1% Legerioides tumidus NH-1-M869a 100 100.0% 100.0% - Legeriosimilis sp. CA-10-W15 100.0% 99.9% 73 100 Legeriosimilis sp. NOR-31-2 58 91 100.0% Capniomyces stellatus MIS-21-127 99.4% 100.0% 92 Trichopteran trichomycete ALG-13-W1 35 100 Trichopteran trichomycete ALG-10-W3 66.8% 100.0% Graminella microspora 23 NOR-35-1 100.0% 100 Pteromaktron sp. OR-11-W8 100 100.0% Smittium culisetae COL-18-3 100 Smittium culisetae MAL-X-1 100.0% 100.0% Harpella-like (cysts) NF-MC-15 98 100.0% 100 Harpella melusinae (cysts) NF-15-5A 100 100.0% Harpella sp. (cysts) NF-MC-18 - Pennella sp. NOR-7-W12 53.9% Genistelloides hibernus KS-19-M23 100.0% 100.0% 27 Lancisporomyces vernalis SPA-X-40 100 100 Lancisporomyces falcatus NS-X-2 100.0% Furculomyces boomerangus AUS-77-4 100 Smittium angustum AUS-126-30

100.0% Smittium simulii 41-1-6 98.6% 97 Smittium commune KS-6-6 97.5% 79 Trichozygospora chironidarum TN-3-16 53.3% 39 99.5% Smittium cylindrosporum CHI-27-1 29 96.1% 100.0% 53 Smittium orthocladii LCF-BT-1 20 100.0% 100 Smittium tronadorium ARG-24-2F Pseudoharpella arcomylica 85 LCF 3 100.0% 92.9% Coleopteromyces amnicus ARG-15-6F

96 43 Smittium tipulidarum RMBL-31-1 99.8% 100.0% Smittium gravimetallum KS-F1-3 70 100 Smittium megazygosporum SC-DP-2 100.0% Smittium culicis 43-1-2 99.9% 97 Smittium annulatum CR-143-8 99.4% 35 Smittium coloradense RMBL-13-41 100.0% 39 Smittium mucronatum FRA-12-3 100 71.7% Smittium caudatum KS-1-2 10 100.0% Smittium morbosum AUS-X-1 100 Stachylina lentica NOR-58-10 100.0% Allomyces macrogynus ATCC 38327 Blastocladiomycota 100.0% 100 Allomyces arbuscula Brazil 2 93.3% 100 Coelomomyces stegomyiae DUH0008925 46 100.0% Conidiobolus coronatus NRRL 28638 Entomophthoromycotina 98 Entomophthora muscae ARSEF3074

100.0% Batrachochytrium dendrobatidis JEL423 Chytridiomycota 100.0% 99 Spizellomyces punctatus (mixed strains) 100 Rhizophlyctis rosea JEL318

Fig. 4 Phylogeny of the Kickxellomycotina based on a concatenated alignment of SSU and LSU rDNA as well as MCM7 translated protein sequences. The method used for tree inference and the format of the tree are the same as for Fig. 3. not well aligned, making them difficult to precisely locate. At To assess the congruence of the MCM7 gene to the accepted this scale of phylogenetic comparison, the introns could not be phylogeny of the trichomycete fungi, the topology of the MCM7 reliably aligned between various taxa and were thus excluded nucleotide and protein trees was compared to a tree based from further consideration. Introns are listed and positions on 18S and 28S rDNA as well as to existing analyses. The given within Fig. 6. Several hypervariable regions could not MCM7 nucleotide tree had one significant and well-supported be aligned and also needed to be excluded within the dataset. incongruity with the rDNA tree as well as the accepted phy- Of the 9 253 characters in the complete alignment, 1 226 of logeny: the basidiomycete Ustilago maydis was placed in a them were excluded in the final analysis. The overall rate of well-supported group including the Kickxellomycotina, the success for amplifications seemed to be lower with TSR1 than Zoopagomycotina and the Blastocladiomycota, instead of with with MCM7, but no host insect sequences were observed for the other basidiomycetes. In general, the MCM7 nucleotide TSR1 during the course of this study. tree failed to recover a higher-level classification of the fungi Nuclear SSU + LSU

E.D. Tretter et al.: Assessing+ MCM7 MCM7 and TSR1Protein for Kickxellomycotina phylogenetics 115

+Nuclear TSR1 SSU Protein + LSU Tree 100.0% Aspergillus nidulans FGSC A4 Ascomycota 100.0% + MCM7 Protein 95 Saccharomyces cerevisiae S288c 100 99.9% Schizosaccharomyces pombe 972h- + TSR1 Protein Tree 76.1% Basidiomycota 94 Coprinopsis cinerea (mixed strains) 100.0% Ustilago maydis (mixed strains) 100.0% 100 Cryptococcus neoformans B-3501A 98 100.0% Mucor circinelloides CBS277.49 Mucoromycotina 99.6% 100.0% 100 Rhizopus oryzae 99-880 39 100 Phycomyces blakesleeanus NRRL 1555 Rhopalomyces elegans NRRL A-10835 Zoopagomycotina 99.9% Ramicandelaber longisporus ATCC 6175 Ramicandelaber 72 Barbatospora ambicaudata TN-49-W4a Barbatospora 100.0% Coemansia reversa NRRL 1564 100.0% Kickxellales 99.8% 100 Coemansia braziliensis NRRL-1566 89.8% 100 72 Spirodactylon aureum NRRL-2810 74.8% 68 Kickxella alabastrina NRRL-2693 - 100.0% Linderina pennispora NRRL-3781 100.0% 100 100.0% Dipsacomyces acuminosporus NRRL-2925 100 100.0% 83 Martensiomyces pterosporus NRRL-2642 100 100.0% Spiromyces minutus NRRL-3067 Spiromyces 100 Spiromyces aspiralis NRRL-22631 100.0% Capniomyces stellatus MIS-21-127 Harpellales 99.9% 100 Trichopteran trichomycete ALG-13-W1 100.0% 100.0% 82.7% 74 Smittium culisetae COL-18-3 95 100 Smittium culisetae 100.0% - MAL-X-1 Genistelloides hibernus KS-19-M23 100 55.8% Harpella melusinae (cysts) NF-15-5A - 100.0% Caudomyces sp. nov. OR-8-W10 100.0% 100 Caudomyces sp. nov. UT-1-W16a 100 100.0% Smittium culicis 43-1-2 100.0% 100 Smittium mucronatum FRA-12-3 93 Smittium simulii 41-1-6 100.0% Allomyces macrogynus ATCC 38327 Blastocladiomycota 100.0% 100 Allomyces arbuscula Brazil 2 100.0% 100 Coelomomyces stegomyiae DUH0008925 80 Entomophthora muscae ARSEF3074 Entomophthoromycotina 100.0% Batrachochytrium dendrobatidis JEL423 Chytridiomycota 100 Spizellomyces punctatus (mixed strains)

Fig. 5 Phylogeny of the Kickxellomycotina based on a concatenated alignment of SSU and LSU rDNA as well as MCM7 and TSR1 translated protein se- quences. The method used for tree inference and the format of the tree are the same as for Fig. 3.

MCM7-709f Red - Location of feature on reference C. reversa seq. MCM7 532-554 Blue - Location of feature on reference A. nidulans seq. MCM7 821-843 Intron screening only performed on region of interest for this study. MCM7-8bf MCM7-1348r MCM7-16r 565-585 1174-1199 1411-1433 854-874 1460-1485 1697-1719 MCM7-8af 589-611 1 878-900 2604 1 2328

612 750 964 978 1324 1353 Intron 1 901 Intron 2 1039 Intron 3 1253 Intron 4 1257 Intron 5 1610 Intron 6 1639 R.zrosea B.zdendrobatidis L.zfalcatus B.zambicaudata C.zcinerea A.zarbuscula S.zpunctatus C.zcinerea C.zneoformans A.zmacrogynus E.zconglomerata E.zconglomerata C.zstegomyiae E.zmuscae E.zmuscae P.zblakesleeanus R.zelegans R.zelegans R.zrosea TSR1TSR1 S.zpunctatus TSR1-1018f TSR1-1492f TSR1-2356r 1051-1073 1591-1613 2314-2336 1 1122-1144 1605-1627 2367-2389 2505 1 2492

1701 1753 1875 2067 2101 2239 2314 Intron 1 1724 Intron 2 1776 Intron 3 1889 Intron 4 2072 Intron 5 2154 Intron 6 2292 Intron 7 2367 C.zcinerea E.zmuscae C.zcinerea S.zsimulii C.zcinerea C.zcinerea E.zmuscae C.zneoformans H.zmelusinae C.zneoformans E.zmuscae E.zmuscae E.zmuscae M.zcircinelloides P.zblakesleeanus M.zcircinelloides P.zblakesleeanus P.zblakesleeanus R.zoryzae R.zoryzae R.zelegans R.zoryzae R.zelegans S.zculicis S.zmucronatum

Fig. 6 Map of the genes MS456 (MCM7) and MS277 (TSR1). 5’ end is at left. Forward primers are marked with blue arrows, reverse primers with red ar- rows. Introns are labelled in green. Red numbers designate the position of the feature on a reference sequence from C. reversa. Blue numbers designate the position of features on a reference sequence from A. nidulans. Intron locations are given by the position in the alignment in which those introns would be present, if they existed in the reference species, 116 MCM7 Nucleotide Tree Persoonia – Volume 30, 2013 MCM7 Nucleotide Tree 100.0% Aspergillus nidulans FGSC A4 52.6% 77 Saccharomyces cerevisiae S288c - Schizosaccharomyces pombe 972h- 100.0% Mucor circinelloides CBS277.49 100.0% 96 Rhizopus oryzae 99-880 100 Phycomyces blakesleeanus NRRL 1555 Barbatospora ambicaudata TN-49-W4a 100.0% Coemansia reversa NRRL 1564 99.1% 100 Coemansia braziliensis NRRL-1566 90.2% 68 Spirodactylon aureum NRRL-2810 57 96.8% Kickxella alabastrina 100.0% NRRL-2693 54 Linderina pennispora NRRL-3781 100 100.0% Dipsacomyces acuminosporus NRRL-2925 100 Martensiomyces pterosporus NRRL-2642 98.8% Harpellomyces montanus TN-22-W5B 87 Harpellomyces eccentricus NOR-56-W1 100.0% Furculomyces boomerangus AUS-77-4 100 Smittium angustum AUS-126-30 100.0% 83.6% Smittium culicis 43-1-2 68.6% 19 71.8% 97 Smittium annulatum CR-143-8 - 54 Smittium caudatum KS-1-2 100.0% Smittium coloradense RMBL-13-41 81 Smittium mucronatum FRA-12-3

95.7% Austrosmittium sp. 32-1-8 59 100.0% Smittium simulii 41-1-6 56.0% 99.7% 99 Smittium commune KS-6-6 49 87.9% 100 Trichozygospora chironidarum TN-3-16 68.1% 82.0% 14 Coleopteromyces amnicus ARG-15-6F - 20 83.1% 90.3% Pseudoharpella arcomylica LCF 3 91.3% - 95.8% 54.4% - Smittium cylindrosporum - CHI-27-1 42 - Smittium tipulidarum RMBL-31-1 95.8% 92.3% 100.0% Smittium orthocladii LCF-BT-1 46 20 100 Smittium tronadorium ARG-24-2F 100.0% Smittium gravimetallum KS-F1-3 100 Smittium megazygosporum SC-DP-2

100.0% Smittium morbosum AUS-X-1 100.0% 84.0% 100 Stachylina lentica NOR-58-10 21 100 Stachylina sp. NS-X-10 100.0% Harpella-like (cysts) NF-MC-15 100.0% 100 Harpella melusinae (cysts) NF-15-5A 100 100.0% Harpella sp. (cysts) NF-MC-18 100 Pennella sp. NOR-7-W12 Bojamyces 100.0% sp. CA-18-W17 99.7% 100.0% Graminella microspora NOR-35-1 97 99.8% 99.7% 57 100.0% 77 Pteromaktron sp. OR-11-W8 59 71 76 100.0% Smittium culisetae COL-18-3

94.9% 100 Smittium culisetae MAL-X-1

- 95.7% Capniomyces sasquatchoides sp. nov. ID-130-N5 100.0% Legeriosimilis sp. CA-10-W15 82.4% 49 99 Legeriosimilis 36 sp. NOR-31-2 100.0% 74.1% Legerioides tumidus NH-1-M869a 28 65 100.0% Legeriomyces minae PEI-X-6 100 Legeriomyces sp. nov. PEI-X-4 99.6% 57.6% Capniomyces stellatus MIS-21-127 35 100.0% Trichopteran trichomycete ALG-13-W1 64.0% 52 100 - Trichopteran trichomycete ALG-10-W3 55.3% 100.0% Genistelloides hibernus KS-19-M23 - 72.2% 98 Lancisporomyces falcatus NS-X-2 89 Lancisporomyces vernalis SPA-X-40 100.0% Caudomyces sp. nov. OR-8-W10 100 Caudomyces sp. nov. UT-1-W16a 99.8% 99.9% Spiromyces minutus NRRL-3067 72 76 Spiromyces aspiralis NRRL-22631 100.0% Orphella catalaunica NOR-40-W10 + W12 99 Orphella dalhousiensis NS-34-W16 100.0% Ramicandelaber longisporus ATCC 6175 61.6% 100 Ramicandelaber longisporus ATCC 6176 25 Dimargaris bacillispora NRRL 2808 97.2% Allomyces macrogynus ATCC 38327 100.0% 100.0% 91 Allomyces arbuscula Brazil 2 76 100 Coelomomyces stegomyiae DUH0008925 Rhopalomyces elegans NRRL A-10835 Ustilago maydis MUCL 30488 99.5% Coprinopsis cinerea Okayama 7 #130

72.1% 73 Cryptococcus neoformans B-3501A

27 100.0% Conidiobolus coronatus NRRL 28638 100.0% 96 Entomaphaga conglomerata ARS-2273 99 Entomophthora muscae ARSEF3074

99.9% Batrachochytrium dendrobatidis JEL423 100.0% 81 Spizellomyces punctatus DAOM BR117 95 Rhizophlyctis rosea JEL318

Fig. S1 Phylogeny of the Kickxellomycotina based on an alignment of MCM7 nucleotide sequences. Tree is based on a 50 % majority-rules consensus of 10k trees produced with Bayesian inference (5k used as burn-in). The three codon positions were all considered to be on different, unlinked partitions during tree calculation. Numbers above branches are Bayesian posterior probabilities. Numbers below branches are maximum-likelihood bootstrap supports produced from 100 bootstrap replicates. Bold branches are highly supported (> 95 % BPP and > .70 MLBP). E.D. Tretter et al.: Assessing MCM7 and TSR1 for Kickxellomycotina phylogenetics 117

100.0% Aspergillus nidulans FGSC A4 Nuclear SSU Tree 100.0% Nuclear SSU Tree 93 Saccharomyces cerevisiae S288c 91 Schizosaccharomyces pombe 972h- 100.0% 92.5% Coprinopsis cinerea (unspecified strain) 100.0% 80 92 Cryptococcus neoformans B-3501A 98 60.7% Ustilago maydis MUCL 30488 66.8% 100.0% 23 Mucor circinelloides CBS277.49 - 100.0% 100 Rhizopus oryzae 99-880 52.7% 100 Phycomyces blakesleeanus NRRL 1555 21 Rhopalomyces elegans NRRL A-10835

77.6% 56.8% Dimargaris bacillispora NRRL 2808 100.0% 14 31 Ramicandelaber longisporus ATCC 6175 100 Ramicandelaber longisporus ATCC 6176 Batrachochytrium dendrobatidis JEL423 Barbatospora ambicaudata TN-49-W4a Entomaphaga conglomerata ARS-2273 83.2% 100.0% Coemansia reversa NRRL 1564 24 100.0% 92 Spirodactylon aureum NRRL-2810 99.9% 83.1% 100 Coemansia braziliensis NRRL-1566 99.1% 77 31 Kickxella alabastrina NRRL-2693 74 100.0% Linderina pennispora NRRL-3781 97.0% 100 63.8% Dipsacomyces acuminosporus 99.3% NRRL-2925 33 52 Martensiomyces pterosporus NRRL-2642 97 100.0% Orphella catalaunica NOR-40-W10 + W12 100 Orphella dalhousiensis NS-34-W16 100.0% Spiromyces minutus NRRL-3067 98 Spiromyces aspiralis NRRL-22631 Harpellomyces montanus TN-22-W5B 86.1% Bojamyces sp. CA-18-W17 33 Capniomyces sasquatchoides sp. nov. ID-130-N5 61.5% Legerioides tumidus NH-1-M869a 51.3% 36 99.9% Legeriosimilis sp. CA-10-W15 35 82 Legeriosimilis sp. NOR-31-2

56.9% Capniomyces stellatus MIS-21-127 - 62.7% Trichopteran trichomycete ALG-13-W1 99.1% 57.6% 89.1% 85 Trichopteran trichomycete ALG-10-W3 67 50 44 100.0% Legeriomyces minae 81.8% PEI-X-6 100 37 Legeriomyces sp. nov. PEI-X-4 58.9% 93.7% Graminella microspora NOR-35-1 - 100.0% 73 Pteromaktron sp. OR-11-W8 84.6% 98 64.6% Smittium culisetae COL-18-3 38 100 Smittium culisetae MAL-X-1 Pennella sp. NOR-7-W12 88.0% Genistelloides hibernus KS-19-M23 95.3% 99.5% 63 Lancisporomyces falcatus NS-X-2 58 65 Lancisporomyces vernalis SPA-X-40 100.0% Caudomyces sp. nov. OR-8-W10

97.1% 100 Caudomyces sp. nov. UT-1-W16a Harpella-like (cysts) NF-MC-15 48 100.0% Harpella melusinae (cysts) NF-15-5A 100 Harpella sp. (cysts) NF-MC-18 100.0% 100.0% Furculomyces boomerangus AUS-77-4

100 100 Smittium angustum AUS-126-30 Smittium simulii 41-1-6 Smittium commune KS-6-6 62.9% Smittium cylindrosporum CHI-27-1 83.8% 41 66.6% Smittium orthocladii LCF-BT-1 41 81.3% 43 Smittium tronadorium ARG-24-2F 49 Trichozygospora chironidarum TN-3-16 60.7% 53.5% Coleopteromyces amnicus ARG-15-6F - 86.9% 53 Smittium tipulidarum 100.0% RMBL-31-1 43 Pseudoharpella arcomylica LCF 3 96 100.0% Smittium gravimetallum KS-F1-3 100 Smittium megazygosporum SC-DP-2 100.0% Smittium morbosum AUS-X-1 87 Stachylina lentica NOR-58-10 Smittium culicis 43-1-2

89.5% Smittium mucronatum FRA-12-3 61 Smittium annulatum CR-143-8 81.8% Smittium caudatum KS-1-2 51 Smittium coloradense RMBL-13-41 92.4% Conidiobolus coronatus NRRL 28638 68 Entomophthora muscae ARSEF3074 79.2% 100.0% Allomyces macrogynus 28 ATCC 38327 96.0% 100 Allomyces arbuscula Brazil 2 76 Coelomomyces stegomyiae DUH0008925 100.0% Spizellomyces punctatus DAOM BR117 97 Rhizophlyctis rosea JEL318 Fig. S2 Phylogeny of the Kickxellomycotina based on an alignment of nuclear small subunit (SSU) rDNA . Tree is based on a 50 % majority-rules consensus of 10k trees produced with Bayesian inference (5k used as burn-in). The three codon positions were all considered to be on different, unlinked partitions during tree calculation. Numbers above branches are Bayesian posterior probabilities. Numbers below branches are maximum-likelihood bootstrap supports produced from 100 bootstrap replicates. Bold branches are highly supported (> 95 % BPP and > .70 MLBP). 118 Persoonia – Volume 30, 2013

100% Coemansia reversa Nuclear LSU Tree NRRL 1564 Nuclear LSU Tree 94 Coemansia braziliensis NRRL-1566 88% 82% Kickxella alabastrina NRRL-2693 43 90% 29 Linderina pennispora NRRL-3781 100% 47 94% Dipsacomyces acuminosporus NRRL-2925 100 100% 55 Martensiomyces pterosporus NRRL-2642

97 Spirodactylon aureum NRRL-2810 100% 100% Orphella dalhousiensis NS-34-W16

84 100 Orphella catalaunica NOR-40-W10 + W12 100% Spiromyces minutus NRRL-3067 100 Spiromyces aspiralis NRRL-22631 Harpellomyces montanus TN-22-W5B 90% Smittium culicis 43-1-2 31 58% Austrosmittium sp. 32-1-8 Smittium annulatum CR-143-8 80% 15 Smittium coloradense RMBL-13-41 96% 25 Smittium mucronatum FRA-12-3 26 Smittium caudatum KS-1-2

59% Bojamyces sp. CA-18-W17 100% Legeriomyces minae PEI-X-6 72% 36 100 Legeriomyces 25 sp. nov. PEI-X-4 Capniomyces sasquatchoides sp. nov. ID-130-N5 73% Legerioides tumidus NH-1-M869a 31 Legeriosimilis 97% sp. CA-10-W15 Legeriosimilis 62% 56 sp. NOR-31-2 9 99% Capniomyces stellatus MIS-21-127 100% 73% 100% Trichopteran trichomycete ALG-13-W1 68 88 26 100 Trichopteran trichomycete ALG-10-W3 68% Genistelloides hibernus KS-19-M23 100% 56 Lancisporomyces vernalis SPA-X-40 99% 91 Lancisporomyces falcatus NS-X-2 38 Harpella-like (cysts) NF-MC-15 100% Harpella melusinae (cysts) NF-15-5A 100 99% Harpella sp. (cysts) NF-MC-18 47 Pennella sp. NOR-7-W12 71% Graminella microspora NOR-35-1 95% 100% 56 Pteromaktron sp. OR-11-W8 18 100 100% Smittium culisetae COL-18-3 100 Smittium culisetae MAL-X-1 Smittium simulii 41-1-6 96% Trichozygospora chironidarum TN-3-16 100% 83% 69 Smittium commune KS-6-6 49 59 Smittium tipulidarum RMBL-31-1 64% 100% Smittium gravimetallum KS-F1-3 52 100% 100% 100 Smittium megazygosporum SC-DP-2 70 78 62% 67% Smittium cylindrosporum CHI-27-1 44 42 53% Smittium orthocladii LCF-BT-1 100% 60 Smittium tronadorium ARG-24-2F 81 Coleopteromyces amnicus ARG-15-6F

74% Pseudoharpella arcomylica LCF 3 100% 25 Caudomyces sp. nov. OR-8-W10 94% 100 Caudomyces sp. nov. UT-1-W16a 40 100% Stachylina lentica NOR-58-10 53% [14] 64 Smittium morbosum AUS-X-1 100% Furculomyces boomerangus AUS-77-4 100 Smittium angustum AUS-126-30 Barbatospora ambicaudata TN-49-W4a 51% Cryptococcus neoformans B-3501A 81% 9 Dimargaris bacillispora NRRL 2808

74% 16 100% Rhopalomyces elegans NRRL A-10835 26 89 Ramicandelaber longisporus ATCC 6175 100% Mucor circinelloides CBS277.49 100% 100 Rhizopus oryzae 99-880 65% 100 Phycomyces blakesleeanus NRRL 1555 31 Coprinopsis cinerea (unspecified strain) Ustilago maydis (unspecified strain) 100% 100% 99% Saccharomyces cerevisiae S288c 96 80 100% 67 Aspergillus nidulans FGSC A4 89 Schizosaccharomyces pombe 972h- 100% Conidiobolus coronatus NRRL 28638 69 Entomophthora muscae ARSEF3074 100% Allomyces macrogynus ATCC 38327 100% 100 Allomyces arbuscula Brazil 2 96 Coelomomyces stegomyiae DUH0008925 Spizellomyces punctatus (unspecified strain) 86% - Batrachochytrium dendrobatidis JEL423 Rhizophlyctis rosea JEL318

Fig. S3 Phylogeny of the Kickxellomycotina based on an alignment of nuclear large subunit (LSU) rDNA . Tree is based on a 50 % majority-rules consensus of 10k trees produced with Bayesian inference (5k used as burn-in). The three codon positions were all considered to be on different, unlinked partitions during tree calculation. Numbers above branches are Bayesian posterior probabilities. Numbers below branches are maximum-likelihood bootstrap supports produced from 100 bootstrap replicates. Bold branches are highly supported (> 95 % BPP and > .70 MLBP). E.D. Tretter et al.: Assessing MCM7Nuclear and TSR1 for SSU Kickxellomycotina + LSU phylogenetics 119 Tree for TSR1 Taxa Nuclear SSU + LSU 100.0% Aspergillus nidulans FGSC A4 100.0% 96 Saccharomyces cerevisiae S288c Tree for TSR1 taxa 100 77.7% Schizosaccharomyces pombe 972h- 99.8% 57 Coprinopsis cinerea (mixed strains) 100.0% 90 Cryptococcus neoformans B-3501A 100.0% 86 Ustilago maydis (mixed strains) 84 100.0% Mucor circinelloides CBS277.49 100.0% 91.2% 100 Rhizopus oryzae 99-880 100 - Phycomyces blakesleeanus NRRL 1555 53.0% Rhopalomyces elegans NRRL A-10835 98.6% 79 Ramicandelaber longisporus ATCC 6175 64 Dimargaris bacillispora NRRL 2808

99.9% Barbatospora ambicaudata TN-49-W4a 99.9% Coemansia reversa 71 NRRL 1564 100.0% 87 Spirodactylon aureum NRRL-2810 100 67.9% Coemansia braziliensis NRRL-1566 52 Kickxella alabastrina NRRL-2693 100.0% Linderina pennispora NRRL-3781 100.0% 100 100.0% 81.0% Dipsacomyces acuminosporus NRRL-2925 77 57 Martensiomyces pterosporus 100 NRRL-2642 100.0% Spiromyces minutus NRRL-3067 100 Spiromyces aspiralis NRRL-22631 100.0% Capniomyces stellatus MIS-21-127 100.0% 87 Trichopteran trichomycete ALG-13-W1 100.0% 93 100.0% Smittium culisetae COL-18-3 90 100.0% 100 Smittium culisetae MAL-X-1 74 67.4% Genistelloides hibernus KS-19-M23 67.7% 44 Harpella melusinae (cysts) NF-15-5A 40 100.0% Smittium culicis 43-1-2 100.0% 99.6% 70 Smittium mucronatum FRA-12-3 100 64 Smittium simulii 41-1-6 100.0% Caudomyces sp. nov. OR-8-W10 100 Caudomyces sp. nov. UT-1-W16a Entomophthora muscae ARSEF3074 99.9% 100.0% Allomyces macrogynus ATCC 38327 77 100.0% 100 Allomyces arbuscula Brazil 2 100 Coelomomyces stegomyiae DUH0008925 99.6% Batrachochytrium dendrobatidis JEL423 85 Spizellomyces punctatus (mixed strains)

Fig. S4 Phylogeny of the Kickxellomycotina based on a concatenated alignment of nuclear small subunit (SSU) and nuclear large subunit (LSU) rDNA. For this tree, only taxa for which we had TSR1 were included in the alignment, to provide a basis for comparison to the TSR1 protein tree. Tree is based on a 50 % majority-rules consensus of 10k trees produced with Bayesian inference (5k used as burn-in). Numbers above branches are Bayesian posterior probabilities. Numbers below branches are maximum-likelihood bootstrap supports produced from 100 bootstrap replicates. Bold branches are highly supported (> 95 % BPP and > .70 MLBP). that was congruent with the accepted phylogeny (James et al. MCM7 analysis, and was incongruent in several places within 2006a, White et al. 2006a, Hibbett et al. 2007). We suspect that the order Harpellales. This may be due to significant sequence the third codon base is saturated at this level of taxon selection length variation and the difficulty in accurately identifying and and is introducing noise into the analysis. It is recommended removing introns within this group. that future studies utilizing MCM7 to study the entire tree of Fungi or large clades either use the amino acid translation, or Discussion at least consider excluding the third codon base from analysis, if it is not otherwise down-weighted. Overall assessment of MCM7 and TSR1 The MCM7 protein analysis was, in general, more congruent We developed and tested, along with those from Schmitt et al. with both the rDNA and the accepted phylogeny. No well- (2009), primers for MCM7 and TSR1 that amplify regions of supported incongruities between the MCM7 protein analysis these genes suitable for phylogenetic reconstruction among and the accepted phylogeny were apparent. The MCM7 pro- the early-diverging fungi. Within the Kickxellomycotina we were tein analysis did have one incongruity involving Coemansia able to sequence three of the four orders for MCM7 as well as braziliensis, Coemansia reversa and Spirodactylon aureum four other genera that may represent new orders; for TSR1, that was also shown by the MCM7 nucleotide analysis. This is we were able to sequence two of these orders and three of discussed more in-depth in the section on Kickxellales below. these other genera. Finally, we also amplified and sequenced To assess the congruence of TSR1, we compared its topology other groups of early-diverging fungi, including members of the to a smaller rDNA analysis containing only the taxa for which Blastocladiomycota, Chytridiomycota, Entomophthoromycotina we had data on TSR1. A few well-supported incongruities were and Zoopagomycotina for comparative purposes. The Glomero­ noted. Dimargaris bacillospora placed within the Mucoromyco­ mycota, Mucoromycotina or the Neocallimastigomycota were tina; this species is an obligate mycoparasite of Mucorales that not tested. Our assessment of each primer (and combinations is often cultured with Cokeromyces recurvatus (Benny 2005), of them) for both MCM7 and TSR1 among the clades tested, and it is likely that our DNA isolate was derived from such a are detailed in Table 3 and 4. mixed culture. As this may indicate that our sequence is derived Phylogenetic utility for the genes varied. The translated MCM7 from the host, not from Dimargaris, we removed this taxon from protein sequences appear to be similar in resolving power to the four-gene analysis. This analysis also placed Coprinopsis the SSU rDNA (see Table 5), potentially making it a valuable cinerea with Ustilago maydis, instead of with Cryptococcus single copy protein-coding gene contribution to multi-gene neoformans, placed C. reversa with C. braziliensis similar to the studies. Congruity with earlier multi-gene trees (Aguileta et al. 120 Persoonia – Volume 30, 2013

Table 3 MCM7 protein-coding gene testing status among early-diverging fungal groups with notes on earlier and newly established primer combinations.

Clade tested Recommended primers Notes

Chytridiomycota MCM7-709f, MCM7-16r Blastocladiomycota MCM7-709f, MCM7-16r MCM7-709f, MCM7-16r MCM7-709f, MCM7-8af, MCM7-16r MCM7-709f preferred over MCM7-8af Kickxellomycotina Harpellales MCM7-8bf, MCM7-16r MCM7-709f works for a couple of species Kickxellales MCM7-8bf, MCM7-16r MCM7-709f works for some but not all species Asellariales – Attempted unsuccessfully Dimargaritales MCM7-709f, MCM7-16r MCM7-8bf not tested Orphella clade MCM7-8bf, MCM7-16r MCM7-709f may work, but not as well as 8bf Barbatospora clade MCM7-8bf, MCM7-16r MCM7-709f not tested Spiromyces clade MCM7-8bf, MCM7-16r MCM7-709f amplified an incorrect gene when attempted Ramicandelaber clade MCM7-709f, MCM7-8bf, MCM7-16r MCM7-709f seemed to sequence better

Table 4 TSR1 protein-coding gene testing status among early-diverging fungal groups with notes on earlier and newly established primer combinations.

Clade tested Recommended primers Notes

Chytridiomycota TSR1-1492f, TSR1-2356r Not sequenced, but amplification product noted. Blastocladiomycota TSR1-1018f, TSR1-2356r TSR1-1492f not tested. Zoopagomycotina TSR1-1018f, TSR1-2356r TSR1-1492f not tested. Entomophthoromycotina TSR1-1018f, TSR1-2356r TSR1-1492f not tested. Kickxellomycotina Harpellales TSR1-1492f, TSR1-2356r TSR1-1018f does not appear to work. Kickxellales TSR1-1018f, TSR1-1492f, TSR1-2356r TSR1-1018f and TSR-1492f both work well. Asellariales - Attempted unsuccessfully. Dimargaritales TSR1-1018f, TSR1-2356r TSR1-1492f not tested. Orphella clade TSR1-1492f, TSR1-2356r PCR product did not sequence cleanly but was identifiable as fungal TSR1. Barbatospora clade TSR1-1492f, TSR1-2356r TSR1-1018f amplified but would not sequence. Spiromyces clade TSR1-1018f, TSR1-1492f, TSR1-2356r TSR1-1018f and TSR1-1492f both work well. Ramicandelaber clade TSR1-1018f, TSR1-1492f, TSR1-2356r TSR1-1018f and TSR1-1492f both work well.

2008) suggests that it is resistant to environmental selective Phylogenetic analyses pressures and long-branch attraction. Whereas MCM7 analyses were generally congruent to those from rDNA, without having Fungi phylogenies based on whole-genomes for comparison, it is Except for the Kickxellomycotina, taxon sampling limits our difficult to estimate whether the MCM7 protein or the rDNA commentary about the other fungal groups. However, by tree better reflects the evolutionary history in the few cases comparing our trees to evolutionary hypotheses presented by where they disagree. others, we offer our assessment of the power of these genes In our view, TSR1 was more challenging (and perhaps less use- for large-scale phylogenetic reconstruction. The relationships ful) when compared to MCM7, at least at the taxonomic scale within the early-diverging fungal lineages are still in need of refinement. Hibbett et al. (2007) could not distinguish between of this study. While it was possible to reconstruct a phylogeny early-diverging fungal clades at higher taxonomic levels due of fungi with TSR1 that was congruent on the large scale with to limited molecular phylogenetic support (and to some extent previous analyses (James et al. 2006a, White et al. 2006a, Liu taxon sampling). However, existing analyses do offer hints. et al. 2009) and with the combined rDNA analysis here, it did James et al. (2006a) used a combination of three rDNA genes present more hindrances in this regard than MCM7. Further- and three protein-coding genes to place the Entomophthoromy­ more, introns needed to be removed from further consideration cotina, Kickxellomycotina and Zoopagomycotina on an unsup- in preparing the alignment file. Nonetheless, at this time, these ported branch along with the Dikarya, the , and issues do not seem severe enough to suggest eliminating TSR1 the Mucoromycotina. However, our MCM7 protein tree (Fig. 1) from future consideration. They should, however, be taken into placed the Entomophthoromycotina, the Kickxellomycotina and account by those considering its potential utility. TSR1 is likely to the Zoopagomycotina in a group together with Blastocladiomy­ be more useful in studies on clades of more closely related spe- cota, and separate from the Dikarya and the Mucoromycotina. cies, where its greater variability may be considered an asset. That branch was supported by the Bayesian but not by the Combined analyses using both the 3- and 4-gene datasets had maximum-likelihood analysis (BPP: 98.3 %, MLBP: 37/100). greater resolving power than any single-gene analysis. The The four-gene tree (Fig. 5) placed representatives of the 3-gene analysis utilizing the rDNA (SSU and LSU) along with Entomophthoromycotina together with Blastocladiomycota in MCM7 protein sequences yielded high resolving power across a well-supported group (BPP: 100.0 %, MLBP: 80/100); the the greatest number of taxa, whereas the four-gene analysis Dikarya, Kickxellomycotina, Mucoromycotina and Zoopago­ utilizing these genes along with the TSR1 protein sequences mycotina were placed in another well-supported group (BPP: had the highest proportion of fully-supported branches of any 99.9 %, MLBP: 78/100). analysis (noting also the differences in taxon number between With regard to the later-diverging fungi, the TSR1 protein tree them). Since this, along with Wang (2012), represent the first (Fig. 2) placed the Dikarya on a well-supported branch (BPP: multi-gene studies primarily concentrating on the Kickxellomy­ 100.0 %, MLBP: 70/100). The MCM7 protein tree (Fig. 1) placed cotina that includes sequences from both rDNA and protein- the Ascomycota together with the Mucoromycotina, but was not coding genes, we also present a clade-based phylogenetic well supported (BPP: 69.1 %, MLBP: 40/100). Multi-gene analy- perspective on the various clades presented (Fig. 1–5). ses (Fig. 4, 5) recovered a well-supported Dikarya (3-gene: E.D. Tretter et al.: Assessing MCM7 and TSR1 for Kickxellomycotina phylogenetics 121

Table 5 Comparative analysis of phylogenetic trees.

Alignment Figure Treebase # ML score (RAxML) # Taxa in # Char in # Interior # Interior % Interior Alignment Alignment Branches Branches Branches Total Supported Supported

MCM7 protein Fig. 1 13444 -12111.24453 81 266 72 39 54.17 % TSR1 protein Fig. 2 13444 -8224.179649 39 207 33 21 63.64 % Nuclear SSU + LSU Fig. 3 13444 -25369.28207 76 2492 67 40 59.70 % Nuclear SSU+LSU+MCM7 protein Fig. 4 13444 -38458.25623 76 2758 73 51 69.86 % Nuclear SSU+LSU+MCM7 protein+TSR1 protein Fig. 5 13444 -35502.47807 38 2965 35 29 82.86 % MCM7 nucleotide1 Fig. S1 13444 -34531.25508 81 780 75 41 54.67 % SSU rDNA1 Fig. S2 13444 -14149.10549 78 1414 66 28 42.42 % LSU rDNA1 Fig. S3 13444 -11824.38916 77 1078 65 26 40.00 % SSU+LSU (TSR1 taxa)1 Fig. S4 13444 -20628.4317 39 2492 35 25 71.43 % 1 Not presented in main body of document – see supplementary materials.

BPP: 98.7 %, MLBP: 72/100; 4-gene: BPP: 99.9 %, MLBP: (Fig. 5; BPP: 100.0 %, MLBP: 100/100) multi-gene analyses. 94/100) as well as a well-supported Dikarya+Mucoromycotina This strongly suggests that the Harpellales and Kickxellales clade (3-gene: BPP: 100.0 %, MLBP: 90/100; 4-gene: BPP: (except for Ramicandelaber) form a monophyletic group, and 100.0 %, MLBP: 98/100). Ramicandelaber may not be closely related to the Kickxellales. Within this group, no tree (in which they are present) places Kickxellomycotina the genera Barbatospora or Orphella in a monophyletic clade The Kickxellomycotina, the primary focus of this study, are a together with only the Harpellales, and no tree places the subphylum of fungi previously placed within the Zygomycota. Spiromyces together with only the Kickxellales. Thus, The Kickxellomycotina are differentiated from other fungi by the our suggestion is that these genera may represent distinct production of septal walls with a lenticular pore, containing a evolutionary clades. plug of material (Hibbett et al. 2007). This characteristic septal pore has been confirmed from all four orders within the Kickxel­ Harpellales lomycotina, and has only otherwise been found in the genus Harpellales is a diverse order of symbiotic fungi that live within Ballocephala and Zygnemomyces within the Entomophthoro­ the guts of aquatic insect larvae or rarely, isopods (White 1999). mycotina (Saikawa 1989, Saikawa et al. 1997). However, no Along with the Asellariales, they are often referred to as ‘gut molecular data from these two genera have yet been examined, fungi’, and can shift between parasitic, commensalistic and and the morphology is not conclusive, so the affinity of these mutualistic roles (Lichtwardt et al. 2007). The Harpellales genera is uncertain. Members of the Kickxellomycotina produce have a unique , whether biconical or uniconical, that branched or unbranched septate thalli, sometimes with aseptate distinguishes them from other orders within the Kickxellomy­ regions, such as in the main axis of Pteromaktron. They include cotina. Most species of Harpellales also produce unispored arthropod symbionts (Harpellales and Asellariales), haustorial merosporangia (Moss & Young 1978) for asexual reproduction, mycoparasites (Dimargaritales), and saprobes (Kickxellales referred to as trichospores (noting that Carouxella and Klasto­ except for Martensella, which is a non-haustorial mycoparasite). stachys remain attached to the generative cell, which Asexual one- or two-spored merosporangia are produced (in is dehiscent, similar to the arthrospores of the Asellariales). Harpellales these merosporangia are referred to as trichos- These spores are specialized for the aquatic environment, with pores) as well as . The sexual spores can vary in many species having mucilaginous non-motile appendages. shape, being spherical in the Asellariales, Dimargaritales and Moreover, trichospores are sensitive to the precise condition Kickxellales, biconical (or rarely uniconical) within the Harpel­ of the insect gut in which they germinate, and rapidly extrude lales, and coiled within Orphella (Moss & Young 1978,Valle & a sporangiospore when appropriate conditions are detected Santamaria 2005, Valle & Cafaro 2008). within the correct host gut. During this extrusion process, a The MCM7 protein tree (Fig. 1) recovered a monophyletic mucilaginous holdfast is excreted which secures the thal- Kickxellomycotina with seven major subclades (BPP: 100.0 %, lus to the gut lining of the host. Some genera of Harpellales MLBP: 86/100). These included three of the four known orders; (Genistello­spora, Harpella and Pennella) are also known to oc- Dimargaritales, Harpellales and Kickxellales, and four genera, casionally infest the ovaries of developing black , replacing Barbatospora, Orphella, Ramicandelaber and Spiromyces, the eggs with ovarian cysts containing spores in the adult black likely to represent new orders (in a subsequent publication). flies (White et al. 2006b). The flying adult then oviposits these The TSR1 protein tree (Fig. 2) also recovered a monophyletic cysts among egg masses, allowing for effective dispersal and Kickxellomycotina, with five of the main subclades represented upstream transmission. (the Asellariales, Dimargaritales and Orphella have yet to yield The existing classification of the Harpellales includes two fami- sequences), although it was only strongly supported below lies – the , which are members that have Ramicandelaber (BPP: 100.0 %, MLBP: 74/100). The 4-gene branched thalli and are usually found in the hindgut, whereas analysis (Fig. 5) was also able to recover a monophyletic Kick­ the are all unbranched and typically found in the xellomycotina (BPP: 99.8 %, MLBP: 72/100), but the 3-gene midgut of their host (Lichtwardt et al. 2007). However, molecular- analysis (Fig. 4) was not (BPP: 99.9 %, MLBP: 42/100) – it based phylogenetic analyses have typically not supported this placed Rhopalomyces elegans (Zoopagomycotina) in a clade separation. The most complete phylogenetic analyses of the with Dimargaris and Ramicandelaber. This may be due to long- Harpellales to date were provided by White (2006), White et branch attraction between Dimargaris and Rhopalomyces, as al. (2006a), and Wang et al. (2013). White (2006) designated both have highly divergent rDNA sequences. a ‘Smittium’ clade consisting of Smittium and a few related All trees presented a branch that contained all members of the genera, and a ‘non-Smittium’ clade for Smittium culisetae and orders Harpellales and Kickxellales except for the genus Rami­ most of the other genera of the Harpellales. Wang et al. (2013) candelaber. This branch was well supported in both the MCM7 are moving Smittium culisetae to a new genus (we use S. (Fig. 1; BPP: 99.9 %, MLBP: 74/100) and TSR1 (Fig. 2; BPP: culisetae here, ahead of print). That 2-gene study again found 100.0 %, MLBP: 74/100) single-gene analyses, and in both evidence of a Smittium / non-Smittium phylogenetic split and the 3-gene (Fig. 4; BPP: 100.0 %, MLBP: 97/100) and 4-gene further defined the ‘Smittium allies’ to include Austrosmittium, 122 Persoonia – Volume 30, 2013

Coleopteromyces, Furculomyces, Pseudoharpella, Stachylina life history, along with the similarity between the arthrospores of and Trichozygospora. Asellaria to the asexual reproductive propagules of Carouxella Our 3-gene analysis (Fig. 4) provides further evidence of this (Harpellales) have been used to suggest that the two orders split, with Coleopteromyces, Furculomyces, Smittium, Stachyli­ may be sister taxa (Moss & Young 1978). On the other hand, na and Trichozygospora all placed together and well supported spherical zygospores have been observed for Asellaria (Valle (BPP: 99.8 %, MLBP: 70/100). Another well-supported clade & Cafaro 2008), unlike the biconical zygospores of the Harpel­ includes Bojamyces, Capniomyces, Genistelloides, Graminella, lales. Septal structure has been observed for both Asellaria and Harpella, Lancisporomyces, Legerioides, Legeriomyces, Pen­ Orchesellaria, and is characteristic of the Kickxellomycotina nella, Pteromaktron and Smittium culisetae (BPP: 100.0 %, (septa with a lenticular pore and an electron-dense plug), but MLBP: 98/100). Harpellomyces and Caudomyces were placed without the spherical occluding bodies of the Dimargaritales as just outside this group, although only strongly supported (Moss 1975). by the Bayesian analysis (Harpellomyces: BPP: 100.0 %, Despite significant effort with all primer combinations listed in MLBP: 58/100). The MCM7 protein analysis alone is not as this paper (along with some other attempted but unsuccess- well-resolved, but still contains all of the same clades, support- ful primers not provided), we have been unable to amplify ing the conclusion that both of these analyses are underlying and sequence MCM7 or TSR1 for any member of Asellaria. the correct species tree. This is another indication that family Unpublished RPB1 and RPB2 sequences for Asellaria have structure will need to be reconsidered, pending improved taxon been known for some time (Hibbett et al. 2007), and we have sampling, to more naturally represent the actual relationships. successfully amplified additional sequences for these genes as The TSR1 analysis of the Harpellales (Fig. 2) does not fully well as the SSU and LSU rDNA (for another manuscript), but agree with the phylogeny provided by the MCM7 protein or even with working genomic samples we were unable to amplify rDNA tree (Fig. 1, 3). Although a monophyletic Harpellales or sequence MCM7. Some bands were visible in the gels, but was obtained, the topology within the group is not completely either would not sequence directly or were deemed incorrect congruent with the other analyses, or analyses using RPB1 and products. Similarly, all attempts to amplify and sequence TSR1 RPB2 (not shown, White et al. unpubl. data). TSR1 presented with Asellaria failed to even produce bands. We also attempted difficulties from aligning the nucleotide sequences to identifying to amplify and sequence both of these single-copy genes for and removing introns, and finally in aligning the proteins and Orchesellaria and Baltomyces, but with no success to date. removing ambiguously aligned regions. Sampled members of the Harpellales seemed to have more introns as well as greater Kickxellales size variation within the protein, compared to related groups. The Kickxellales are primarily saprobic (except one genus, Mar­ Additional taxon sampling within the Harpellales might help to tensella, which is mycoparasitic) fungi in the Kickxellomycotina. resolve these issues. The 4-gene tree incorporating the TSR1 Saprobic members of this group have been found associated protein (Fig. 5) did have the same topology as the one from with soil, dung, and insect carcasses (Benny 2005). Members of the 3-gene analysis (Fig. 4). this order reproduce asexually by means of sporocladia that pro- Ecological and morphological correlations for these endosym­ duce multiple, unispored merosporangia supported upon small bionts are difficult to place. The ‘non-Smittium’ clade represents basal cells, the pseudophialides, and also sexually through a diverse assemblage with variable characteristics, whereas spherical zygospores (Benny 2005). The sporocladia may be the Smittium clade has much greater morphological similarity. either single- or multi-celled (Benny 2005). Most Kickxellales Nearly all members of the Smittium clade have a single ap- genera release their spores in a droplet of liquid at maturity, pendage as well as a collar left where the trichospore dehisces referred to by Moss & Young (1978) as ‘slime spores’, with only from the fertile thallus. Trichozygospora is the exception, with the genera Spiromyces and Spirodactylon being dry-spored its large number of very thin appendages on both the sexual (Benny 2005). Moss & Young (1978) described this slime as and asexual spores, but is otherwise similar in shape possibly being related to a special intracellular structure found and collar presence. Many members of the non-Smittium clade in the pseudophialide, referred to as the ‘labyrinthiform orga- have more than one appendage, and most of them have no nelle’ and possibly homologous to the trichospores appendage collar on the trichospore. A collar is present in Smittium culi­ produced by the Harpellales. This study also compared the setae and Bojamyces, but for both it is flared, and perhaps morphology of the reproductive structure of the two groups, unlike most species of Smittium. Additionally, phylogenetically describing the structures as having a shared ‘coemansoid’ related genera Graminella and Pteromaktron have a ball-like morphology and suggesting the two groups may be closely or knob-like structure on the appendage near its attachment to related. This relationship has since been supported by several the spore. Whether or not this knotted portion of the appendage molecular-based phylogenetic studies (O’Donnell et al. 1998, might represent some remnant of an earlier dehiscent collar James et al. 2006a, White et al. 2006a). The Kickxellales have a or collar-like structures, homologous to the collar of Smittium, septal structure similar to the Harpellales and Asellariales, with is unknown. The Smittium clade is also almost completely re- a lenticular septal pore with an electron-dense plug (O’Donnell stricted to Diptera hosts (except for Coleopteromyces, with one et al. 1998). species from aquatic Coleoptera), whereas the non-Smittium All trees inferred for this study revealed a strongly-supported clade has members that utilize a diverse group of hosts in- and monophyletic Kickxellales clade that includes Coemansia, cluding not only Diptera, but also Ephemeroptera, Isopoda, Dipsacomyces, Kickxella, Linderina, Martensiomyces and Plecoptera and Trichoptera. Spirodactylon (3-gene: BPP: 100.0 %, MLBP: 100/100; 4-gene: BPP: 100.0 %, MLBP: 100/100). This clade never included Asellariales Ramicandelaber. Spiromyces is included as a strongly-sup- The Asellariales represent a much smaller grouping of endo­ ported sister clade to this group in the four-gene analysis (BPP: symbiotic fungi, consisting of Asellaria and Baltomyces (within 100.0 %, MLBP: 100/100), but for that analysis Orphella was Isopoda) as well as Orchesellaria (in Collembola). The Asellari­ not available. Within the 3-gene analysis (Fig. 4; BPP: 100.0 %, ales produce branched, septate thalli within the hindgut of their MLBP: 100/100) and the rDNA-based analysis (Fig. 3; BPP: host, extending from a specialized holdfast cell with a secreted 100.0 %, MLBP: 100/100), Orphella seems to be more closely mucilaginous holdfast (Lichtwardt & Manier 1978). This order related to the monophyletic Kickxellales group than Spiromy­ is distinguished by the breaking up of the thallus at maturity to ces. As such, it appears that Ramicandelaber is not part of produce arthrospores. The general similarity in growth form and the Kickxellales, and Spiromyces may not be, unless Orphella E.D. Tretter et al.: Assessing MCM7 and TSR1 for Kickxellomycotina phylogenetics 123

(currently, still a member of the Harpellales) is considered to clear because the three-gene analysis placed Dimargaris in an be a member of the Kickxellales as well (see more on this in unsupported group with Rhopalomyces (BPP: 66.7 %, MLBP: the Spiromyces and Ramicandelaber sections). not present). The notion that Dimargaritales is one of the most Within the monophyletic Kickxellales, relationships are difficult early-diverging members of the Kickxellomycotina is evocative. to resolve. The group consisting of Coemansia braziliensis, Several features of Dimargaritales bear close resemblance to Coemansia reversa and Spirodactylon aureum was first shown members of the Zoopagomycotina, particularly Piptocephalis by O’Donnell et al. (1998) and again by White et al. (2006a). and Syncephalis that are mucoralean mycoparasites (Benny This relationship is further demonstrated by both the MCM7 2005). Beyond the lifestyle, these genera also have multispored (Fig. 1; BPP: 98.2 %, MLBP: 75/100) and TSR1 phylogenies merosporangia and appear to have a similar growth form. It (Fig. 2; BPP: 100.0 %, MLBP: 100/100), providing multi-gene may be that the Kickxellomycotina either descend from within support. However, in both the MCM7 (Fig. 1; BPP: 100.0 %, the Zoopagomycotina or form a sister clade to it. Molecular MLBP: 100/100) and TSR1 (Fig. 2; BPP: 100.0 %, MLBP: analyses thus far, including this one, have been unable to fully 100/100) analyses, C. reversa and C. braziliensis are placed resolve the phylogenetic position of the Zoopagomycotina, and together, while in the rDNA analysis (as for the previous pub- point to the need for further study. lished analyses, which also utilised rDNA) C. reversa is placed We suggest that the MCM7 gene will be particularly useful for together with S. aureum, which renders Coemansia polyphyletic Dimargaritales due to the consistent sequence length and reli- (Fig. 3; BPP: 99.9 %, MLBP: 86/100). This may represent a true able alignment. Dimargaritales have demonstrated extremely instance of incomplete lineage sorting within the Kickxellales. diverged and variable rDNA sequences that make them difficult Alternately, it may be due to long-branch attraction related to to align and result in long-branch attraction artifacts (White et al. Spirodactylon, which appears to be unusually diverged from the 2006a). MCM7 does not suffer from this problem and trees have other Kickxellales with regard to rDNA but not MCM7 or TSR1. relatively consistent branch-lengths, at least as demonstrated Other relationships between the members of the Kickxellales by our Dimargaris representative. are more difficult to resolve. Both the MCM7 and TSR1 indi- vidual gene trees (Fig. 1, 2) are not well resolved within the Distinct lineages: Barbatospora, Orphella, Kickxellales clade. The 3-gene tree (Fig. 4) is well resolved with Ramicandelaber and Spiromyces regard to internal members of the group; a poorly-supported Several genera of Harpellales and Kickxellales have consist- group consisting of Dipsacomyces and Martensiomyces is the ently not clustered with their respective orders. These unique most early-diverging member (BPP: 86.5 %, MLBP: not pre- genera (lineages) are examined. sent), followed by well-supported individual branches containing Barbatospora has not been reported since the type B. ambi­ Linderina (BPP: 100.0 %, MLBP: 78/100) and Kickxella (BPP: caudata was described from blackflies in the Great Smoky 100.0 %, MLBP: 81/100). The 4-gene analysis (Fig. 5), however, Mountains National Park, USA (White et al. 2006c). Although does not strongly support these internal branches (possibly due the general growth form of Barbatospora resembles the Harpel­ to contrasting signal from TSR1), but does strongly support lales, with a branched, septate thallus and a secreted holdfast, the relationship between Dipsacomyces and Martensiomyces it also presents unique morphological features. These include (BPP: 100.0 %, MLBP: 83/100). This relationship is present, a ‘cap-like’ structure at the terminal end of the trichospores, although not as strongly supported, in all four individual-gene which typically falls away at maturity, to reveal a set of append- analyses (Fig. 1, 2, S2, S3) as well as previously by O’Donnell ages or appendage-like structures on either end of the asexual et al. (1998). spore. However, much about the morphology of this species is not known, including the presence and form of zygospores, Dimargaritales the septal wall structure, and the method of spore extrusion Dimargaritales is an unusual group of Kickxellomycotina. My- and germination. Barbatospora was placed, on morphological coparasites of Mucorales and Ascomycota, they have several grounds, in Harpellales within the family Legeriomycetaceae. morphological and life history features that differentiate them Phylogenetically, Barbatospora consistently places within a from other Kickxellomycotina. While they retain the diagnostic branch that includes the Harpellales, the Kickxellales, Orphella lenticular septal cavity with an electron-dense plug (Jeffries & and Spiromyces. This placement is well-supported in the MCM7 Young 1979, Brain et al. 1982), the plug has globose bodies (Fig. 2; BPP: 99.9 %, MLBP: 74/100), TSR1 (Fig. 2; BPP: 100.0 %, to either side of the septum in the Dimargaritales (Benjamin MLBP: 74/100), 3-gene (Fig. 4; BPP: 100.0 %, MLBP: 97/100), 1959), which can be dissolved in 2–3 % KOH, unlike the septal and 4-gene (Fig. 5; BPP: 100.0 %, MLBP: 100/100) analyses, plugs of the Kickxellales. Other unique features include bispored and is present (but not completely supported) in the rDNA (Fig. merosporangia (all other Kickxellomycotina are unispored) and 3; BPP: 100.0 %, MLBP: 68/100) analysis as well. Within this the presence of haustoria. group, the Harpellales, Kickxellales, Orphella and Spiromyces We attempted to amplify and sequence MCM7 and TSR1 for are together on a strongly-supported branch within the TSR1 our single representative of this order, Dimargaris bacillosporus (Fig. 2; BPP: 100.0 %, MLBP: 75/100), rDNA (Fig. 3; BPP: (see Table 2). We were able to successfully sequence MCM7. 100.0 %, MLBP: 90/100), 3-gene (Fig. 4; BPP: 99.9 %, MLBP: Unfortunately, for TSR1, our sequence appears to be that of 91/100), and 4-gene analyses (Fig. 5; BPP: 100.0 %, MLBP: a mucoralean contaminant. Dimargaris bacillosporus is often 95/100), and a branch that is not strongly supported within the grown in co-culture with its host, Cokeromyces recurvatus. The MCM7 (Fig. 1; BPP: 86.4 %, MLBP: 48/100) analysis. The phylogenetic position of the Dimargaris within the TSR1 tree position of Barbatospora, which is one of the most consistent suggests strongly that our sequence is that of the host . and well supported evolutionary hypotheses provided by this Our MCM7 sequence does not appear to show any affinity to study, may suggest that the species is an ‘offshoot’ from an the Mucorales, and thus be genuine. ancestral clade that split to form the Kickxellales and Harpel­ The MCM7 analysis reveals a monophyletic Kickxellomycotina lales. Thus, Barbatospora might offer valuable insights into the that includes Dimargaris (BPP: 100.0 %, MLBP: 86/100) as early evolution of this group. part of an early-diverging group that also contains Ramicande­ Orphella, also currently a member of the Harpellales, has un- laber, although the connection between Ramicandelaber and usual morphological features for that order (see review by Dimar­garitales was only supported by the Bayesian analysis Valle & Santamaria 2005). Orphella is unique among gut fungi (BPP: 97.5 %, MLBP: 59/100). Multi-gene analysis was less in releasing both trichospores and zygospores as multi-celled 124 Persoonia – Volume 30, 2013 dissemination units, and in having allantoid to coiled asexual ConclusionS spores and (to some extent) coiled zygospores (Valle & Santa­ maria 2005). At maturity, both spore forms extend, attached to The comparison between the rDNA-based and MCM7-based the thallus, beyond the anus of the host. Valle & Santamaria phylogenies suggest that MCM7 is likely to be a valuable (2005) reported that Orphella has a characteristic ‘coemansoid’ gene for phylogenetic inference within the Kickxellomycotina, growth form, which pointed to a relationship with the Kickxel­ although it does not seem to have the same degree of resolving lales. This relationship was also suggested by molecular-based power that it does within Ascomycota (Schmitt et al. 2009, Raja studies (James et al. 2006a, White et al. 2006a), where Orphella et al. 2011). While it is unlikely to be sufficient to resolve complex is clustered with the Kickxellales. Aside from the unusual spore relationships on its own, the relative ease of amplification and features, its morphology resembles the Harpellales, with an sequencing (for a single-copy, protein-coding gene) and the extruded mucilaginous holdfast, a specialized holdfast cell, high degree of resolving power make it a valuable addition to and a branched, septate thallus. rDNA-based or multi-gene studies. In addition, MCM7 seems Again, for Orphella, we were able to sequence MCM7 but not to not be plagued with the long-branch attraction problems TSR1. The MCM7 analysis does not offer any additional in­ demonstrated by the rDNA of the Dimargaritales, and to a lesser sight into the relationship between Orphella and the other taxa extent, Ramicandelaber, making it an excellent alternative to within the Kickxellomycotina, beyond suggesting that Orphella consider for accurate phylogenetic inference. is separate from the other Harpellales. The 3-gene analysis As we have pursued the use of TSR1 over a shorter time frame, (Fig. 4; BPP: 100.0 %, MLBP: 100/100 both above and below its potential utility is more difficult to ascertain. While the large- the branch containing Orphella) supports the phylogeny demon­ scale phylogenetic resolution of TSR1 appears to be quite good, strated by previous studies (James et al. 2006a, White et al. difficulties in identifying and removing introns and incongruities 2006a), noting the possible disproportionate phylogenetic between the TSR1 tree and the rDNA tree make it uncertain at signal from rDNA. those levels, and specifically how trustworthy it may be within Spiromyces is currently a member of the Kickxellales, although the Harpellales. Additional studies with it for more representa- previous phylogenetic analyses have placed it apart from that tives of the Harpellales for TSR1 should make it easier to reliably order. It is separated from the Kickxellales by Orphella (White et remove introns and align amino acid sequences. To date, TSR1 al. 2006a), but sometimes it appears ancestral to both the Kick­ appears to be more difficult to amplify and sequence compared xellales and Harpellales (James et al. 2006a). Morphologically, to MCM7, although in our laboratory we have found it to be far Spiromyces is an unusual member of the Kickxellales because easier to work with than RPB1 or RPB2 (White et al. unpubl. rather than pseudophialides, it produces merosporangia from data). When TSR1 amplifies, it is specific to the correct gene enlarged sections of the sporangiophore, similar to the collar and to Fungi, and the variability could be an asset within groups regions of the generative cells of Harpellales (Moss & Young of closely related species. 1978). It is also one of the few Kickxellales that is dry-spored at In addition to their utility within the Kickxellomycotina, general maturity. Spiromyces species are saprobic and usually associ- congruence with accepted phylogenetic studies across the ated with dung. We were able to amplify and sequence both broader fungal tree and successful amplification within several MCM7 and TSR1 for Spiromyces, but neither single-gene tree is early-diverging lineages suggests that MCM7 and TSR1 can able to place it reliably (Fig. 1, 2). Within the 3-gene tree (Fig. 4), potentially be used by those studying other groups of early- Spiromyces is placed as a sister clade to a group consisting of diverging fungi. In particular, they are also likely to be useful the Kickxellales (except Ramicandelaber) and Orphella (BPP: 100.0 %, MLBP: 88/100). Within the 4-gene tree (Fig. 5), Spiro­ within the Entomophthoromycotina and Zoopagomycotina, myces is with the Kickxellales (except Ramicandelaber) as the groups that traditionally have proven difficult to culture (for earliest-diverging member (but recall Orphella is not available some taxa at least) and to place. While the gene regions for this tree) (BPP: 100.0 %, MLBP: 100/100). require some manual adjustment (intron removal, translation, and removal of poorly aligned regions) to be used, this is true Ramicandelaber is another genus within the Kickxellales that of the majority of phylo­genetically-informative genes, including may not belong with the order. This genus has an unusual well-accepted ones (such as RPB1 and RPB2), when used over growth form for the Kickxellales. It forms both stolons and wide taxonomic ranges. We are poised to consider them for our rhizoids and in R. brevisporus, may form supporting branches revisionary efforts on the gut fungi, within the Kickxellomycotina, (Benny 2005). It is also unusual how, in age, Ramicandelaber and hope they will be considered by others exploring the earliest sporocladia broaden and become covered with more pseudo- branches of the fungal tree of life. phialides, which become subspherical (Ogawa et al. 2001). Previous molecular studies have placed Ramicandelaber apart from the Harpellales and Kickxellales (Ogawa et al. 2005, White Acknowledgements Financial support from NSF REVSYS Awards DEB- et al. 2006a). On the MCM7 tree (Fig. 1), Ramicandelaber 0918182 (to MMW) and DEB-0918169 (to collaborator R.W. Lichtwardt, University of Kansas) are gratefully acknowledged for this and ongoing is placed within the Kickxellomycotina on an early-diverging studies toward a molecular-based reclassification of the Harpellales and branch along with Dimargaris (note however that this branch Asellariales. MMW received funding for some sequences from a Martin- was only supported by the Bayesian analysis; BPP: 97.5 %, Baker Award from the Mycological Society of America. We would especially MLBP: 59/100). Within the TSR1 analysis (Fig. 2), it was placed like to thank all who have contributed samples to our efforts, without which as an unsupported branch as the earliest-diverging member they would have never been able to proceed. In particular, we would like to of the Kickxellomycotina (recall that the Dimargaritales sample thank A. Gryganskyi (and the laboratory of Rytas Vilgalys) as well R. Humber. was not placed correctly on this tree due to amplification of the Additionally, G. Benny, M.J. Cafaro, L.C. Ferrington Jr., D.B. Strongman, fungal host of Dimargaris; BPP: 85 %, MLBP: 40/100). Within L.G. Valle provided sample vouchers and support. T. James provided kind research support during earlier (AFTOL) training sessions to MMW, and more all five analyses (Fig. 1–5) Ramicandelaber is placed outside recently as well. Thanks to Paula Clarke for proofreading final versions of of a well-supported clade that contains all other members of the manuscript. Comments from committee members I. Robertson, J. Smith the Kickxellales and the Harpellales (except, in the case of and S. Novak were incorporated at the proof stage. Finally, we would like to the rDNA analysis, Barbatospora). These results suggest that thank Dr. Robert W. Lichtwardt, without whose tireless efforts on the Harpel­ the rDNA-based placement of Ramicandelaber outside of lales and other trichomycetes, especially with his extended efforts on the the Kickxellales is likely an accurate one, and that this genus web-based trichomycete resources, this lineage of studies have never been may well represent a unique, early-diverging lineage of the possible and as poised for continuity. Kickxello­mycotina. E.D. Tretter et al.: Assessing MCM7 and TSR1 for Kickxellomycotina phylogenetics 125

REFERENCES O’Donnell K. 1993. Fusarium and its near relatives. In: Reynolds DR, Taylor JW (eds), The fungal holomorph: mitotic, Meiotic and pleomorphic specia- Abascal F, Zardoya R, Posada D. 2005. ProtTest: Selection of best-fit models tion in fungal systematics: 225–233, CAB International, UK. of protein evolution. Bioinformatics: 21, 9: 2104–2105. O’Donnell K, Cigelnik E, Benny GL. 1998. Phylogenetic relationships among Aguileta G, Marthey S, Chiapello H, Lebrun M-H, Rodolphe F, et al. 2008. the Harpellales and Kickxellales. Mycologia 90: 624–639. Assessing the performance of single-copy genes for recovering robust Ogawa Y, Hayashi S, Degawa Y, Yaguchi Y. 2001. Ramicandelaber, a new phylogenies. Systematic Biology 57: 613–627. genus of the Kickxellales, Zygomycetes. Mycoscience 42: 193–199. Altekar G, Dwarkadas S, Huelsenbeck JP, Ronquist F. 2004. Parallel metro­ Ogawa, Y, Kurihara Y, Suda A, Kusama-Eguchi K, Watanabe K, Tokumasu polis-coupled markov chain monte carlo for Bayesian phylogenetic infer- S. 2005. Taxonomic position of the genus Ramicandelaber, Kickxellales, ence. Bioinformatics 20: 407–415. inferred from 18S rDNA. Nippon Kingakukai Kaiho 46: 13–17. Benjamin, RK. 1959. The merosporangiferous Mucorales. Aliso 4: 321–433. Posada D. 2008. jModelTest: Phylogenetic model averaging. Molecular Benny GL. 2005. Zygomycetes. Published on the internet at http://www. Biology and Evolution 25: 1253–1256. zygomycetes.org. Raja H, Schoch CL, Hustad V, Shearer C, Miller A. 2011. Testing the phylo- Brain APR, Jeffries P, Young TWK. 1982. Ultrastructure of septa in Tieghe- genetic utility of MCM7 in the Ascomycota. MycoKeys 1: 63–94. miomyces californicus. Mycologia 74: 173–181. Ronquist F, Huelsenbeck JP. 2003. MrBayes 3: Bayesian phylogenetic infer- Drummond A, Strimmer K. 2001. PAL: An object-oriented programming library ence under mixed models. Bioinformatics 19: 1572–1574. for molecular evolution and phylogenetics. Bioinformatics 17: 662–663. Saikawa M. 1989. Ultrastructure of the septum in Ballocephala verruco­ Edgar RC. 2004. MUSCLE: multiple sequence alignment with high accuracy spora (Entomophthorales, Zygomycetes). Canadian Journal of Botany and high throughput. Nucleic Acids Research 32: 1792–1797. 67: 2484–2488. Gardes M, Bruns TD. 1993. ITS primers with enhanced specificity for ba- Saikawa M, Oguchi M, Ruiz RFC. 1997. Electron microscopy of two nema- sidiomycetes: application to the identification of mycorrhizae and rusts. tode-destroying fungi, Meristacrum asterospermum and Zygnemomyces Molecular Ecology 2: 113–118. echinulatus (Meristacraceae, Entomophthorales). Canadian Journal of Gelperin D, Horton L, Beckman J, Hensold J, Lemmon SK. 2001. Bms1p, a Botany 75: 762–768. novel GTP-binding protein, and the related Tsr1p are required for distinct Schmitt I, Crespo A, Divakar P, Fankhauser J, Herman-Sackett E, et al. 2009. steps of 40S ribosome biogenesis in yeast. Rna-a Publication of the Rna New primers for promising single-copy genes in fungal phylogenetics and Society 7: 1268–1283. systematics. Persoonia 23: 35–40. Guindon S, Gascuel O. 2003. A simple, fast, and accurate algorithm to Sekimoto S, Rochon D, Long J, Dee J, Berbee M. 2011. A multigene phy- estimate large phylogenies by maximum likelihood. Systematic Biology logeny of Olpidium and its implications for early fungal evolution. BMC 52: 696–704. Evolutionary Biology 11: 331. Hermet A, Méheust D, Mounier J, Barbier G, Jany J-L. 2012. Molecular sys- Suzuki Y, Glazko GV, Nei M. 2002. Overcredibility of molecular phylogenies tematics in the genus Mucor with special regards to species encountered obtained by Bayesian phylogenetics. Proceedings of the National Academy in cheese. Fungal Biology 116: 692–705. of Sciences 99: 16138–16143. Hibbett DS, Binder M, Bischoff JF, Blackwell M, Cannon PF, et al. 2007. A Tanabe Y, Saikawa M, Watanabe MM, Sugiyama J. 2004. Molecular phy- higher-level phylogenetic classification of the Fungi. Mycological Research logeny of Zygomycota based on EF-1α and RPB1 sequences: limitations 111: 509–547. and utility of alternative markers to rDNA. Molecular Phylogenetics and Huelsenbeck JP, Ronquist F. 2001. MrBayes: Bayesian inference of phylo­ Evolution 30: 438–449. geny. Bioinformatics 17: 754–755. Valle LG, Cafaro MJ. 2008. First report of Zygospores in Asellariales and James TY, Kauff F, Schoch CL, Matheny PB, Hofstetter V, et al. 2006a. new species from the Caribbean. Mycologia 100: 122–131. Reconstructing the early evolution of Fungi using a six-gene phylogeny. Valle LG, Santamaria S. 2005. Zygospores as evidence of sexual reproduc- Nature 443: 818–822. tion in the genus Orphella. Mycologia 97: 1335–1347. James TY, Letcher PM, Longcore JE, Mozley-Standridge SE, Porter D, et al. Vilgalys R, Hester M. 1990. Rapid genetic identification and mapping of en- 2006b. A molecular phylogeny of the flagellated fungi (Chytridiomycota) and zymatically amplified ribosomal DNA from several Cryptococcus species. description of a new (Blastocladiomycota). Mycologia 98: 860–871. Journal of Bacteriology 172: 4238–4246. Jeffries P, Young TWK. 1979. Ultrastructure of septa in Dimargaris cristal- Wang Y. 2012. Ribosomal RNA gene-based and multigene phylogenies of ligena R.K. Benjamin. Journal of General Microbiology 111: 303–311. Smittium (Harpellales) and allies – toward unraveling relationships among Kearsey SE, Labib K. 1998. MCM proteins: evolution, properties, and role in early diverging fungi. MS thesis Boise State University, USA. DNA replication. Biochimica et Biophysica Acta 1398: 113–136. Wang Y, Tretter ED, Lichtwardt RW, White MM. 2013. Overview of 75 years Le SQ, Gascuel O. 2008. An improved general amino acid replacement of Smittium research, establishing a new genus for Smittium culisetae, matrix. Molecular Biology and Evolution 25: 1307–1320. and prospects for future revisions of the ‘Smittium’ clade. Mycologia 105: Lichtwardt RW, Cafaro MR, White MM. 2007. and co-evolution 90–111. of Trichomycetes (gut-inhabiting fungi) and their Chironomidae (Diptera) White MM. 1999. Legerioides, a new genus of Harpellales in isopods and hosts. Published at http://www.nhm.ku.edu/fungi/. other Trichomycetes from New England, USA. Mycologia 91: 1021–1030. Lichtwardt, RW, Manier, JF. 1978. Validation of the Harpellales and Asel- White MM. 2006. Evolutionary implications of a rRNA-based phylogeny of lariales. Mycotaxon 7: 441–442. Harpellales. Mycological Research 110: 1011–1024. Liu Y, Leigh JW, Brinkmann H, Cushion MT, Rodriguez-Ezpeleta N, et al. White TJ, Bruns T, Lee J, Taylor J. 1990. Amplification and direct sequencing 2009. Phylogenomic analyses support the monophyly of , of fungal ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand including Schizosaccharomyces fission yeasts. Molecular Biology and DH, Sninsky JJ, White TJ (eds), PCR Protocols: a guide to methods and Evolution 26: 27–34. applications: 315–322. Academic Press, San Diego, USA. Maddison WP, Maddison DR. 2011. Mesquite: a modular system for evolu- White MM, James TY, O’Donnell K, Cafaro MJ, Tanabe Y, Sugiyama J. 2006a. tionary analysis. v 2.75 (http://mesquiteproject.org). Phylogeny of the Zygomycota based on nuclear ribosomal sequence data. Moir D, Stewart SE, Osmond BC, Botstein D. 1982. Cold-sensitive cell- Mycologia 98: 872–884. division-cycle mutants of yeast: Isolation, properties, and pseudoreversion White MM, Lichtwardt RW, Colbo MH. 2006b. Confirmation and identification studies. Genetics 100: 547–563. of parasitic stages of obligate endobionts (Harpellales) in blackflies (Sim- Morgenstern I, Powlowski J, Ishmael N, Darmond C, Marqueteau S, et al. uliidae) by means of rRNA sequence data. Mycological Research 110: 2012. A molecular phylogeny of thermophilic fungi. Fungal Biology 116: 1070–1079. 489–502. White MM, Siri A, Lichtwardt RW. 2006c. Trichomycete insect symbionts in Moss ST. 1975. Septal structure in the trichomycetes with special reference Great Smoky Mountains National Park and vicinity. Mycologia 98: 333–352. to Astreptonema gammari (Eccrinales). Transactions of the British Myco- Wilgenbusch JC, Warren DL, Swofford DL. 2004. AWTY: A system for graphi- logical Society 65: 11 5–124. cal exploration of MCMC convergence in Bayesian phylogenetic inference. Moss ST, Young TWK. 1978. Phyletic considerations of the Harpellales and http://ceb.csit.fsu.edu/awty. Asellariales (Trichomycetes, Zygomycotina) and the Kickxellales (Zygo- Zwickl, DJ. 2006. Genetic algorithm approaches for the phylogenetic analy- mycetes, Zygomycotina). Mycologia 70: 944–963. sis of large biological sequence datasets under the maximum likelihood criterion. PhD thesis, The University of Texas at Austin.